The 3' Untranslated Region of the Human Interferon-Fl Mrna Has an Inhibitory Effect on Translation (SP6 RNA Transcripts/Translational Efficiency) V

Home , Untranslated region

Proc. Natl. Acad. Sci. USA Vol. 84, pp. 6030-6034, September 1987 Biochemistry The 3' untranslated region of the human interferon-fl mRNA has an inhibitory effect on translation (SP6 RNA transcripts/translational efficiency) V. KRUYS*, M. WATHELET*, P. POUPARTt, R. CONTRERASt, W. FIERSt, J. CONTENTt, AND G. HUEZ*§ *D6partement de Biologie Moldculaire, Universitd Libre de Bruxelles, 1640 Rhode-St-Gen~se, Belgium; tf~partement de Virologie, Institut Pasteur du Brabant, 1180 Bruxelles, Belgium; and fLaboratory of Molecular Biology, State University of Ghent, 9000 Ghent, Belgium Communicated by M. Van Montagu, April 13, 1987 (received for review January 20, 1987)

ABSTRACT In vitro-transcribed human interferon-I3 transfection of the IFN-,8 gene, that the 3' region of the (IFN-1P) mRNA, which contains all the sequence of the natural mRNA influences its stability. Nevertheless, the authors molecule, is poorly translated in a reticulocyte lysate or when could not conclude whether the coding sgequence or the 3' injected in Xenopus oocytes. This low level of translation is due UTR is responsible for the destabilization of the mRNA. to an inhibition by the 5' ;and 3' untranslated regions (UTRs). It has been shown that the IFN-,8 mRNA is posttranscrip- Indeed, the replacement of these sequences by those ofXenopus tionally regulated (7). During the course of a study on the .-globin mRNA dramatically increases the translational effi- possible mechanism of such regulation, we observed that an ciency of the mRNA, especially in oocytes. This phenomenon is in vitro-transcribed IFN-p3 mRNA was actually very poorly not due to a difference in mRNA stability since both native and translated in certain translation systems and that this phe- chimeric mRNAs remain undegraded, at least during 'the nomenon was not due to a rapid degradation of the molecule. translation period considered. Construction of different chi- We demonstrate here that the IFN-P UTRs, and especially meric molecules having various combinations of5' and 3' UTRs the 3' region, are inhibitory for the m1NA translation. Such from IFN-J3 or Xenopus ,.1-globin mRNA or a small sequence of inhibition occurs even when this 3' sequence is added to a SP6 polylinker as 5' UTR has revealed that the 3' UTR ofIFN-f3 completely different mRNA, that of chicken lysozyme. in itself has a pronounced inhibitory effect on translation in the two translation systems from animal cells. Indeed, the addition MATERIALS AND METHODS of this 3' UTR at the 3' end of the coding region of a chicken lysozyme mRNA also causes a large decrease of its translational Construction of the Different Plasmids Used for in Vitro capacity in both systems. However, the nature of-the 5' Synthesis of Corresponding RNAs. Hu-IFN-f3 mRNA is ob- noncoding sequence influences the degree of translation inhi- tained by in vitro transcription of a Sal I linearized SP65 bition exerted by the 3' UTR. Remarkably, we observed no vector (SP65IFN/3) containing the Hae III/HindII fragment difference in translation level when the different mRNAs were of the Hu-IFN-f3 gene inserted downstream of the SP6 tested in a wheat germ extract. promoter. This Hae III/HindIl fragment corresponds to the complete Hu-IFN-p8 cDNA sequence (8). The IFN-,B in Eukaryotic messenger mRNAs contain both 5' and 3' un- vitro-transcribed mRNA from this SP65IFN8 plasmid con- translated regions (UTRs) of different sizes. Most mRNAs tains in its 5' UTR, in addition to the natural 5' IFN-,8 mRNA also possess a poly(A) segment at their 3' end. There is some UTR, 19 bases corresponding to a gene segment upstream of evidence that those'untranslated sequences are involved in the cap site and 21 nucleotides due to the transcription of the posttranscriptional controls of gene expression either by vector polylinker. governing mRNA translation efficiency or stability. For IFN-,f mRNA with its 5' and 3' UTRs replaced by those of example, the poly(A) segment markedly increases the sta- P-globin mRNA is synthesized by transcription of a plasmid bility of several mRNAs introduced either in oocytes or derived from that of Krieg and Melton (SP64TIFN,8) (9). somatic cells in culture (1). On the other hand, the real Cytidine residues present at the 3' end of the SP64TIFN8 meaning of the presence of rather long 5' and 3' UTRs were eliminated as follows: the SP64TIFNB was linearized by adjacent to the coding part is still unclear. It has been shown HindIII, which cleaves 7 base pairs (bp) upstream of the 5' that some sequences of limited length in the 5' UTR play an UTR. The extremities were then filled in with the Klenow important role in translation. The "Kozak" sequence and the was Sal which CCRCCATGG (where R = purine) appears to be required for polymerase plasmid digested by I, the most efficient recognition of the correct initiation codon cleaves it 3 nucleotides downstream of the 3' UTR. The by the ribosomes in eukaryotic cells (2). The length of the 5' resulting 850-bp fragment corresponding to the complete untranslated sequence in itself does not influence the trans- IFN-p coding sequence flanked by the P-globin UTRs was lation capacity, at least for some mRNAs (3). However, the inserted in the SP65 vector between the EcoRI filled-in and translation of the mRNA can be markedly impaired if a very Sal I sites. RNA was transcribed from this construction stable hairpin structure is introduced in the 5' UTR (4). Data (SP65IFNB 5'-3'-GlobpC) previously linearized by Sal I. concerning the 3' UTR role remain somewhat contradictory. This RNA was then transcribed into cDNA using oligo(dT) as For example, Soreq et al. (5) have reported that the removal primer. The cDNA was digested by Pst I, which cleaves in of most of the 3' UTR from the mRNA' coding for human the coding sequence (200 bp from the AUG). It was then interferon-,B (Hu-IFN-,3) does not affect either the stability or inserted in SP65IFNP 5'-3'-GlobpC. For this, the latter the translation of the mRNA in Xenopus oocytes. On the plasmid was first linearized with HindIII then filled in and other hand, using Vero cells, which present an IFN-,B redigested with Pst I. The resulting construction (SP65IFNp production deficiency, Mosca et al. (6) demonstrated by 5'-3'-G) was linearized by HindIII for in vitro transcription.

The publication costs of this article were defrayed in part by page charge Abbreviations: IFN-,B, interferon-/3; Hu-IFN, human IFN; UTR, payment. This article must therefore be hereby marked "advertisement" untranslated region. in accordance with 18 U.S.C. §1734 solely to indicate this fact. §To whom reprint requests should be addressed.

6030 Downloaded by guest on September 26, 2021 Biochemistry: Kruys et al. Proc. Natl. Acad. Sci. USA 84 (1987) 6031 The mRNA with a 19-base synthetic oligonucleotide as 5' UTR was synthesized by transcription of a plasmid contain- Ad...-i ing the HindII/HindII fragment of the IFN-,f gene (SP65IFN,8 5'-SO). This fragment corresponds to the coding F 'a ._. and 3' noncoding sequence of the IFN-83 mRNA. The construction was obtained by insertion of this HindII/HindII _ A: with EcoRI linkers into the SP65 ,,K,,_s ,. .. ' ' ...:... fragment EcoRI-digested vector. Before transcription, the SP65IFNf3 5'-SO was lin- ;...Xv,.,'v1>g. s earized by Sac I, which cleaves 7 bp downstream of the 3' 1 2 3 4 ...> :- :.....e. 7 8 noncoding sequence. SP65IFN,8 pla'smid containing the 3' ,-globin UTR (SP65IFN,8 3'-G) was constructed as follows. FIG. 1. Translation ofthe two in vitro-transcribed IFN-,8 mRNAs For technical convenience-e.g., the presence of suitable that have the most different translational efficiency: SP65IFN,8 and restriction sites-all constructions containing the 3' 3-globin SP65IFN,8 5'-3'-G in the three different systems. Wheat germ were from the SP64TIFNJ3 extract: lane 1, SP65IFN,8; lane 2, SP65IFNJ 5'-3'-G. Reticulocyte UTR synthesized starting plas- lysate: lane 3, SP65IFNf 5'-3'-G; lane 4, SP65IFNp. Oocytes: lane mid, which has an extra oligo(C). We checked that the 5, SP65IFN,8 5'-3'-G; lane 6, SP65IFN,8 (the three bands correspond removal ofthis oligo(C) sequence ohly marginally influences, to different stages ofglycosylation). Oocyte incubation medium: lane if at all, the translational efficiency of the mRNA (data not 7, SP65IFN,8 5'-3'-G; lane 8, SP65IFN/3. shown). SP64TIFN,8 was digested by Pst I to isolate the 610-bp insert corresponding to part of the IFN-,8 coding sequence as well as the ,-globin 3' UTR. This insert was (14). Analysis of the translation products was performed on ligated to the SP65IFN,8 plasmid previously digested by Pst NaDodSO4/20% polyacrylamide gels. I to remove the 600-bp fragment corresponding to the same Injection into Oocytes. Oocytes were injected with 50 n1 of coding region as above but followed by the IFN-p8 3' UTR. mRNA dissolved in water and adjusted to a concentration of The other two constructions-SP64IFN,3 5'-G and SP65- 0.1 mg/ml. The injection procedure and the incubation ofthe IFN/3 5'-SO 3'G-were obtained using the same strategy oocytes have been described by Gurdon et al. (15). After starting from SP65IFN/3 and SP65IFN,8 5'-SO constructions. injection, the oocytes were incubated for 6 hr at 18TC in These three plasmids were linearized, respectively, by Barth's medium (0.01 ml per oocyte) containing [35S]methi- HindIII, Sal I, and HindIII, which cleave at the nearest sites onine (9 uCi per oocyte), 10% bovine serum albumin, 1% downstream of the insert. Trasylol. Analysis of the immunoprecipitated proteins was SP64IFNBGL plasmid was constructed by inserting the performed with NaDodSO4/20% polyacrylamide gels. entire IFN-/3 cDNA of the SP65IFNB construction (800-bp Immilunoprecipitations. Incubation media and oocytes were BamHI/HindIII fragment, filled-in) in the filled-in Bgl II- immunoprecipitated with a goat anti-human IFN-,8 polyclo- digested SP64T vector previously described by Krieg and nal antibody or a rabbit anti-chicken lysozyme polyclonal Melton (9). This construction was linearized by EcoRI before antibody according to the method described by Huez et al. in vitro transcription. (1). For each sample, 2.5 X 106 35S cpm of oocyte extract and The chicken lysozyme SP6 plasmid (10) (SP64LYS 3'- 2.5 x 1 35S cpm of the incubation medium were used for Vect) was obtained from Amersham. It was linearized by Pvu immunoprecipitationt. II before transcription. The lysozyme 3'-IFN construction Analysis of mRNA Stability. The RNA extraction was (SP65LYS 3'-IFN) was obtained by inserting the Sph I/Sal I performed according to the procedure of Marbaix et al. (16) (filled-in) lysozyme cDNA fragment (962 bp) isolated from with some modifications (see legend to Fig. 2). the SP64LYS 3'-Vect into the SP65IFN,8 plasmid digested with Sph I/Bgl II (filled-in). This construction was linearized by Sal I prior to in vitro transcription. RESULTS The lysozyme 3' globin construction (SP64LYS 3'-Glob) Translation and Stability of in Vitro-Transcribed IFN-,f was obtained by inserting the Sph I/BartHI lysozyme cDNA mRNA. We have synthesized an IFN-83 mRNA by in vitro fragment (975 bp) from the SP64LYS 3'-Vect into the transcription ofthe plasmid SP65IFN,8. This mRNA contains SP64TIFNB plasmid (9) digested by Sph I and Bgl II. The all the sequences of the natural messenger RNA. Due resulting plasmid was linearized by BamHI before synthesis IFN-,l of the corresponding RNA. to the cloning strategy as well as the characteristics of the In Vitro Transcription with SP6 Polymerase. All the RNAs vector, it also possesses 40 extra nucleotides at the 5' end (see used in these experiments were obtained by in vitro transcription of constructions in SP6 vectors according to the method described by Melton et al. (11) except that the RNAs were capped during the transcription reaction (12). RNAs were purified from DNA by a RNase-free DNase I treatment and from unincorporated nucleotides by G50 spun column. For RNA stability analysis in oocytes, we synthesized radioactive mRNAs according to the same procedure except that 80 ,Ci of [a-32PJUTP (1 Ci = 37 GBq) was introduced in the in vitro transcription and the nonradioactive UTP concentration was lowered to 330 ,uM. Polyadenylylation of the Transcripts. Purified RNAs were \ 1 C 1) 1I polyadenylylated using poly(A) polymerase from Escherich- ia coli according to the method described by Drummond et al. FIG. 2. Nonpolyadenylylated SP65IFNB mRNA stability in The were Xenopus oocytes. Three nanograms of radioactively labeled RNA (10). polyadenylylated transcripts purified by was injected per oocyte. Total RNA was extracted from a batch of oligo(dT) chromatography. five oocytes at different incubation times after injection and the Cell-Free Protein Synthesis Systems. Rabbit reticulocyte amount corresponding to two oocytes was submitted to agarose gel lysate was prepared and used according to the method of electrophoresis followed by autoradiography. Lane A, noninjected Pelham and Jackson (13). Wheat germ extract was purchased SP65IFNInmRNA; lane B, injected SP65IFNB mRNA at time 0; lane from Amersham and used as described by Marcu and Dudock C, 3 hr; lane D, 7 hr; lane E, 24 hr. Downloaded by guest on September 26, 2021 6032 Biochemistry: kruys et al. Proc. Natl. Acad. Sci. USA 84 (1987) A NAME OOCYTES RETIC. LYSATE

SP65IFN/6 m 0.3% 5%

SP65IFYv pA MMI IIMMMiMb..Aloo 1% 5%

SP64IFIr 5'G 4% 50%

SP65IF)O 3'G 60% 50% mm.MM. m 3=20

100% 100% SP65IFNA 5'3'G 'r- -77777= A12

SP65IFN, 5'SO 0.3% 5% mw.l

SP65IFNb 5'SO 3'G 80% 50% I

SP64IFNlp GL M- 0.3% 5% B

IFN-beta 5' UTR :m G( 5 )pppGAAUACACGAAUUCUAGAGUCCCAUACCCACGGAGAAAGGACAUUCUAACUGCA

ACCUUUCGAAGCCUUUGCUCUGGCACAACAGGUAGUAGGCGACACUGUUCGUGUUGUCAAC AUG

beta-GLOBIN 5' UTR : m G(5' )pppGAAUACAAGCUUCUUGUUCUUUUUGCAGAAGCUCAGAAUAAACCCUCAACUUUGG

CAGAUCUGAAC AUG

SYNTH. OLIGO. 5' UTR :m G(5')pppGAAUACACGGAAUUCCAAC AUG FIG. 3. Summary of results obtained for translation of the different chimeric IFN-,B mRNAs ii Xenopus oocytes and reticulocyte lysate. (A) Translational efficiency of different chimeric IFN-,8 coding mRNAs. The translational efficiencies are expressed in percentages, attributing 100% to the best translated mRNA, SP65IFN,8 5'-3'-Glob. Values were obtained by densitometric scanning of the polyacrylamide gel autoradiographs. Large boxes, coding regions; small boxes, untranslated sequences. (B) Sequence of 5' UTRs in different IFN-.8 coding mRNA constructions. *, Hu-IFN-0; o, Xenopus 3-globin; B, vector transcript.

Materials and Methods). When we tested this mRNA for lysate, the level of its translation was 1/10th that of rabbit translation into Xenopus oocytes, we observed an unexpect- globin mRNA taken as reference. Again, we checked by edly low level of IFN synthesis (see Fig; 1). As this in RNA blot analysis that this was not due to rapid degradation vitro-transcribed RNA was not polyadenylylated, we as- of this IFN-/3 mRNA during the translation assay (data not sumed that this was due to a rapid degradation of the injected shown). mRNA molecule (1). After transcription, a poly(A) segment Translation of Chimeric IFN-'f mRNA. With the aim to was then added to this mRNA with E. coli poly(A) polymer- understand the reason of the low translational efficiency of ase. A subsequent test in oocytes demonstrated that this only this synthetic IFN-,8 mRNA in both translation systems from marginally improved the IFN-,B synthesis. Moreover, the animal cell origin, we modified this molecule. First, the stability of both IFN-j3 mRNAs, polyadenylylated or not, original 5' and 3' noncoding sequences of the SP65IFNf was checked and no degradation of the mRNA was observed nmRNA were replaced by the corresponding segments from after 24 hr even with the tonpolyadenylylated molecule (see Xenopus ,B-globin mRNA. The translation of this chimeric Fig. 2). It thus became most probable that the low level of molecule (SP65IFNj3 5'-3'-G) was compared to that of the IFN-f3 synthesis was actually due to a poor translation of the SP65IFNf3 mRNA. As shown in Fig. 1, the SP65IFN/3 mRNA mRNA. To determine whether this was peculiar to the oocyte has a much weaker translational efficiency than the chimeric translation system machinery, we also tested this IFN-,B molecule in both Xenopus oocytes and reticulocyte lysate. In mRNA in a rabbit reticulocyte lysate and in a wheat germ the former system, the translation was at least 300 times extract. We found that in the latter system, the IFN-P3 mRNA lower, while in the latter, it was lower by a factor of 20 (Fig. was translated with normal efficiency by comparison with 3). In the wheat germ extract, on the contrary, no significant other mRNAs of similar size. However, in the reticulocyte difference in translation efficiency was observed. Downloaded by guest on September 26, 2021 Biochemistry: Kruys et al. Proc. Natl. Acad. Sci. USA 84 (1987) 6033

NAME OOCYTES RETIC. LYSATE

SP64LYS 3' VECT 70% 100% EZLLLLLL--= ......

SP64LYS 3'G C- ...... LA :3mm 100% 100%

SP65LYS 3'IFN EF...... m 10% 20% FIG. 4. Summary of results obtained for the three chimeric lysozyme mRNAs in Xenopus oocytes and reticulocyte lysate. The levels of translation are expressed in percentages, attributing 100% to the most efficiently translated mRNA. The values were calculated from densitometric measurements of polyacrylamide gel autoradiographs. Large boxes, coding region; small boxes, noncoding sequences. F-, chicken lysozyme; *, Hu-IFN-13; o, Xenopus ,3globin; z, vector transcript.

The results presented above suggested that one or both noncoding sequence was able to confer a poor translational untranslated regions of the original SP65IFN,8 mRNA were efficiency to another mRNA encoding an excreted protein. responsible for the low translation efficiency observed in the We constructed SP6 plasmids containing the lysozyme animal systems. To clarify the question, we synthesized cDNA with three different combinations of 3' UTR. In one of IFN-/3 mRNA in which the 5' and 3' UTRs were separately the transcripts, the 3' noncoding sequence corresponds to replaced by sequences from f3globin mRNA. As shown in part of the lysozyme 3' UTR (17 bases) followed by 225 bases Fig. 3A, the replacement of the 3' UTR of IFN-,3 mRNA by transcribed from the vector. The two other transcripts the corresponding sequences of ff3globin mRNA is already contain the same short fragment of the lysozyme 3' UTR sufficient to strongly increase the translation of the mRNA. followed by the complete ,3-globin or IFN-,B 3' UTR, respec- The replacement of the 5' UTR alone led to an improvement tively. The translational efficiency of these chimeric mRNAs but less pronounced, especially in oocytes. was compared in the three translation systems (Figs. 4 and 5). The difference in translation efficiency observed between We can conclude from these experiments that the IFN-,3 3' the IFN-,8 mRNA and the chimeric SP65IFN,35'-3'-G mRNA UTR markedly decreases the lysozyme mRNA translational is not due to a positive effect exerted by the /3-globin UTRs. efficiency in the two systems of animal cell origin. On the Indeed, the addition of both 5' and 3' UTRs of ,3-globin contrary, no significant difference was observed in the wheat mRNA at the respective ends of the SP65IFN,8 mRNA did germ extract for the translation of the three chimeric lyso- not improve the translational efficiency of the mRNA. The zyme mRNAs. results presented in Fig. 3A also demonstrate that the inhibition of translation caused by the presence of the IFN-f3 DISCUSSION 3' UTR occurs whatever the nature of the 5' UTR of the mRNA. However, the replacement of the IFN-j3 mRNA 5' In this paper, we show that a well defined natural 3' UTR UTR by the corresponding 5' f3-globin sequence improved (that of IFN-,/ mRNA) can have a pronounced inhibitory the translation of the mRNA, especially in the reticulocyte effect per se on translation. This is observed even when this lysate. No improvement was observed when the IFN-,8 5' sequence is inserted downstream of the translated sequence UTR was replaced by an oligonucleotide. It should be noted ofanother mRNA encoding an excreted protein. The replace- that when the IFN-p8 3' UTR is replaced by the t3-globin 3' ment of the 3' UTR of the IFN-,B mRNA by that of Xenopus which in itself confers a better translational l3-globin mRNA considerably increases its translational effi- UTR, efficiency ciency. This effect is observed in our experimental conditions to the mRNA, a significant difference of translation is regardless of the nature of the 5' UTR present in the observed depending on the nature of the UTR present at the molecule. However, the best translational efficiency is ob- 5' end. served with the chimeric mRNA having the 5' UTR from Translation of Chicken Lysozyme mRNA Containing Dif- Xenopus /3globin mRNA. The ranking observed for the ferent 3' UTR. We then determined whether the IFN-P 3' efficiency ofthe 5' UTR sequence to promote translation has no clear explanation. It does not follow the level of homology ofthe sequence flanking the AUG codon described by Kozak (2) as shown in Fig. 3. To explain the inhibitory action on translation ofthe IFN-13 3' UTR, one hypothesis could be that the 3' UTR (or part of it) forms a stable association by base pairing with another part of the molecule. However, computer analysis of the IFN-f3 mRNA sequence failed to reveal any intramolecular homology that could be responsible for the formation of such a structure. Moreover, the fact that the synthetic SP65IFN/ mRNA is efficiently translated in the wheat germ extract also 1 2 3 4 5 6 7 8 9 argues against this idea. The latter results rather suggest that translation ofthe SP65IFNB3 mRNA is inhibited in oocytes or FIG. 5. Translation of the three chimeric lysozyme mRNAs having different 3' UTRs. Wheat germ extract: lane 1, SP64LYS reticulocyte lysate by the presence of some factor(s) that 3'-Vect; lane 2, SP65LYS 3'-Glob; lane 3, SP65LYS 3'-IFN. Retic- recognizes the 3' UTR ofthis mRNA and that is absent in the ulocyte lysate: lane 4, SP64LYS 3'-Vect; lane 5, SP65LYS 3'-Glob; wheat germ extract. This (or those) putative factor(s) that lane 6, SP65LYS 3'-IFN. Xenopus oocytes: lane 7, SP64LYS recognizes the 3' UTR of the SP65IFNB3 mRNA probably 3'-Vect; lane 8, SP65LYS 3'-Glob; lane 9, SP65LYS 3'-IFN. interacts with the 5' part of the mRNA molecule, since our Downloaded by guest on September 26, 2021 6034 Biochemistry: Kruys et al. Proc. Natl. Acad. Sci. USA 84 (1987) results show that the inhibition is less pronounced when the Research Assistant of the National Fund for Scientific Research hybrid messenger molecule contains a Xenopus P-globin 5' (Belgium). V.K. is supported by a grant from the Institute for UTR. The factor may indeed have a different affinity for Encouragement of Scientific Research in Industry and Agriculture. those sequences. This may also explain why the translation 1. Huez, G., Cleuter, Y., Bruck, C., Van Vloten-Doting, L., of the chimeric lysozyme mRNA is less inhibited by the Goldbach, R. & Verdiun, B. (1983) Eur. J. Biochem. 130, presence of the 3' UTR of IFN-/3 mRNA than is the 205-209. SP65IFN,8 mRNA itself in oocytes or in the reticulocyte 2. Kozak, M. (1986) Cell 44, 283-292. lysate. One would also assume, according to this hypothesis, 3. Johansen, H., Schumperli, D. & Rosenberg, M. (1984) Proc. that in the reticulocyte lysate the 3' UTR binding factors are Nad. Acad. Sci. USA 81, 7698-7702. less abundant or have less affinity for this sequence. 4. Kozak, M. (1986) Proc. Natl. Acad. Sci. USA 83, 2850-2854. Shaw and Kamen (17) reported recently that some A+T- 5. Soreq, H., Sagar, A. D. & Sehgal, P. B. (1981) Proc. Natl. rich sequences present in the 3' end of different mRNAs Acad. Sci. USA 78, 1741-1745. could play a role in the stability of these molecules. It turns 6. Mosca, J. D. & Pitha, P. M. (1986) Mol. Cell. Biol. 6, the 2279-2283. out that similar consensus sequences are also present in 7. Raj, N. B. K. & Pitha, P. M. (1983) Proc. Natl. Acad. Sci. 3' UTR ofIFN-,f mRNA (18). We have established, however, USA 80, 3923-3927. that in our experimental conditions even the less well 8. Derynck, R., Content, J., De Clercq, E., Volckaert, G., translated IFN-p mRNA is stable for more than the time Tavernier, J., Devos, R. & Fiers, W. (1980) Nature (London) required for the translation assay both in the oocytes (Fig. 2) 285, 542-547. and the reticulocyte lysate (data not shown). The low level of 9. Krieg, P. A. & Melton, D. A. (1984) Nucleic Acids Res. 12, translation thus cannot be explained by a rapid degradation 7057-7070. ofthe mRNA. We are thus clearly dealing here with a distinct 10. Drummond, D. R., Armstrong, J. & Colman, A. (1985) Nu- phenomenon. It has been shown that the c-fos gene can cleic Acids Res. 13, 7375-7393. 11. Melton, D. A., Krieg, P. A., Rebagliati, M. R., Maniatis, T., acquire a transforming capacity if 67 nucleotides of the Zinn, K. & Green, M. R. (1984) Nucleic Acids Res. 12, mRNA 3' UTR containing the Caput A+T-rich sequence are 7035-7056. removed (19). This does not appear to be due to a change of 12. Konarska, M. M., Padgett, R. A. & Sharp, P. A. (1984) Cell c-fos mRNA stability (20). However, Treisman demonstrated 38, 731-736. later that transient accumulation of c-fos RNA following 13. Pelham, H. R. B. & Jackson, R. J. (1976) Eur. J. Biochem. 67, serum stimulation requires sequences at the 3' end of the 247-256. molecule (21). It is thus possible that the c-fos expression is 14. Marcu, K. & Dudock, B. (1974) Nucleic Acids Res. 1, 1385. actually regulated at two different posttranscriptional levels 15. Gurdon, J. B., Lane, C. D., Woodland, H. R. & Marbaix, G. depending on the circumstances surrounding the c-fos gene (1971) Nature (London) 223, 177-182. expression. 16. Marbaix, G., Huez, G., Burny, A., Cleuter, Y., Hubert, E., Besides, our observations fit well with the results of Van Leclercq, M., Chantrenne, H., Soreq, H., Nudel, U. & Heuvel et al. (22) who showed that the replacement of the 3' Littauer, U. Z. (1975) Proc. Natl. Acad. Sci. USA 72, UTR of murine IFN-a mRNA, which also contains the 3065-3067. consensus sequence of Caput et al. (18), by that of rabbit 17. Shaw, G. & Kamen, R. (1986) Cell 46, 659-667. j-globin results in a 4-fold higher IFN-a production in 18. Caput, D., Beutler, B., Hartog, K., Thayer, R., Brown- transfected COS cells. Shimer, S. & Cerami, A. (1986) Proc. Natl. Acad. Sci. USA 83, 1670-1674. We thank Dr. D. A. Melton, who sent us the SP64T plasmid. We 19. Meijlink, F., Curran, T., Miller, A. D. & Verma, I. M. (1985) are also grateful to Drs. E. De Clercq and A. Billiau for providing us Proc. Nail. Acad. Sci. USA 82, 4987-4991. the goat anti-human 3-IFN antisera and to Dr. D. Portetelle, who 20. Miller, A. D., Curran, T. & Verma, I. M. (1984) Cell 36, prepared the rabbit anti-chicken lysozyme antibody. This work was 51-60. supported by ULB-Actions de Recherches Concertnes ofthe Belgian 21. Treisman, R. (1985) Cell 42, 889-902. Government to G.H. and RUG-Gekoncerteerde Onderzoeksakties 22. Van Heuvel, M., Bosveld, I. J., Luyten, W., Trapman, J. & to W.F. G.H. and R.C. are Research Associates and M.W. is Zwarthoff, E. C. (1986) Gene 45, 159-165. Downloaded by guest on September 26, 2021