Proc. Natl. Acad. Sci. USA Vol. 88, pp. 3584-3588, May 1991 Developmental Biology Cytoplasmic protein binding to highly conserved sequences in the 3' untranslated region of mouse protamine 2 mRNA, a translationally regulated transcript of male germ cells (spermatogenesis/stored mRNA/gel retardation assay/UV-crosslinklig/postmeiotic genes) YUNHEE K. KWON AND NORMAN B. HECHT* Department of Biology, Tufts University, Medford, MA 02155 Communicated by Liane B. Russell, January 22, 1991 (receivedfor review November 22, 1990) ABSTRACT The expression of the protamines, the pre- tional control (12-14). Their genes are transcribed solely in dominant nuclear proteins of mammalian spermatozoa, is round spermatids, and their mRNAs are stored in the sper- regulated translationally during male germ-cell development. matid cytoplasm from 3 days to 7 days before being trans- The 3' untranslated region (UTR) of protamine 1 mRNA has lated. been reported to control its time of translation. To understand The studies of Braun et al. (4) have demonstrated that in the mechanisms controlling translation of the protamine transgenic mice the translation of the transcript of a prota- mRNAs, we have sought to identify cis elements of the 3' UTR mine 1 (Prm-1) fusion construct is controlled by the 3' UTR of protamine 2 mRNA that are recognized by cytoplasmic of Prm-1 mRNA. When the Prm-1-hGH (human growth factors. From gel retardation assays, two sequence elements hormone) fusion construct contains the 3' UTR of hGH, are shown to form specific RNA-protein complexes. Protein transcription and translation both occur in the round sper- binding sites of the two complexes were determined by RNase matid. Replacement of the hGH 3' UTR with that of Prm-1 T1 mapping, by blocking the putative binding sites with delays translation to the time when the endogenous prota- antisense oligonucleotides, and by competition assays. The mine mRNAs are translated in elongated spermatids. Thus, sequences of these elements, located between nucleotides +537 cis elements of the 3' UTR of Prm-1 mRNA act to delay and +572 in protamine 2 mRNA, are highly conserved among translation of the fusion construct transcript. postmeiotic translationally regulated nuclear proteins of the mammalian testis. Two closely linked protein binding sites To understand the regulatory mechanisms controlling the were detected. UV-crosslinking studies revealed that a protein translation of the protamine mRNAs during spermiogenesis, ofabout 18 kDa binds to one of the conserved sequences. These we have sought to identify essential cis-acting elements ofthe data demonstrate specific protein binding to a highly conserved 3' UTR of Prm-2 mRNA that are recognized by cytoplasmic 3' UTR of translationally regulated testicular mRNA. factors. Here, we show that conserved sequence elements in the 3' UTR of Prm-2 mRNA form specific RNA-protein The utilization of functional mRNAs in the cytoplasm of complexes, and a protein of about 18 kDa binds to one of the eukaryotic cells can be regulated by controlling the stability conserved sequences. of individual mRNAs or by altering their ability to bind ribosomes and be translated. There is growing evidence that MATERIALS AND METHODS the 5' and 3' untranslated regions (UTRs) of mRNAs play important roles in modulating mRNA translation (1-4). One Preparation of Tissue Extract. S100 cytoplasmic extracts of the best-studied examples of translational regulation me- were prepared from the testes ofadult male CD-1 mice by the diated by protein-UTR interactions involves cellular iron procedure of Dignam et al. (15). metabolism in eukaryotic cells (2, 3). Sequences called iron- Preparation of Plasmid Constructs and RNA Transcripts. responsive elements (IREs) have been identified within the The following 32P-labeled RNAs containing various lengths of UTRs of ferritin and the transferrin receptor mRNAs. The the 3' UTR of Prm-2 were transcribed from pGem plasmids: binding of a protein to an IRE represses translation when the (i) transcript a, 161 nucleotides (nt) consisting of 41 nt of IRE is located within the 5' UTR ofthe ferritin mRNA (7, 8). polylinker sequence, 20 nt of coding region, and the first 100 Binding of the same protein to the IREs in the 3' UTR of the nt of the 3' UTR of Prm-2; (ii) transcript b, 133 nt consisting transferrin receptor mRNA increases the utilization of this of83 nt of 3' UTR, 17 nt ofpoly(A)+, and 33 nt of polylinker; mRNA by inhibiting its degradation (9). (iii) transcript c, 67 nt consisting of42 nt of 3' UTR and 25 nt During spermatogenesis, male germ cells differentiate from of polylinker; and (iv) transcript d, 84 nt consisting of 48 nt a population of diploid stem cells, spermatogonia, to haploid ofthe 3' UTR, 17 nt ofpoly(A)+, and 19 nt ofpolylinker (Fig. spermatozoa. The developing male germ cell undergoes L4) . The 3' UTR of hGH mRNA consists of a 130-nt meiosis and enters spermiogenesis, the haploid phase of transcript with 92 nt of 3' UTR, 9 nt of poly(A)+, and 29 nt spermatogenesis, where there are massive changes in cell of polylinker. A control pGem RNA of 172 nt was prepared structure as the round spermatid transforms into the species- by transcribing the Riboprobe positive control template specific shaped spermatozoon (10, 11). Since transcription (Promega). Single-stranded templates containing the phage ceases during midspermiogenesis in mammals, many of the T7 promoter were used to synthesize transcripts Y and H spermatid and spermatozoan proteins are encoded by (16). Labeled and unlabeled transcripts were generated in mRNAs that are stored as ribonucleoproteins (mRNPs). The vitro from the above templates with SP6 or T7 RNA poly- protamines and transition proteins, structural DNA-binding merase by using the protocol of the supplier (Promega). proteins, are among the proteins synthesized under transla- Abbreviations: Prm-1 and Prm-2, mouse protamines 1 and 2; UTR, The publication costs of this article were defrayed in part by page charge untranslated region; hGH, human growth hormone; nt, nucleo- payment. This article must therefore be hereby marked "advertisement" tide(s); RNP, ribonucleoprotein. in accordance with 18 U.S.C. §1734 solely to indicate this fact. *To whom reprint requests should be addressed. 3584 Downloaded by guest on October 1, 2021 Developmental Biology: Kwon and Hecht Proc. Natl. Acad. Sci. USA 88 (1991) 3585 Full-length transcripts were isolated from urea/6-20% poly- isolated RNAs were digested to completion with 10 units of acrylamide gels. RNase T1, boiled in formamide buffer, and analyzed by Assays of RNA-Protein Complexes. Binding assays were electrophoresis in a urea/25% polyacrylamide gel. performed by a modified procedure of Leibold and Munro Crosslinking ofRNA-Protein Complexes. Binding reactions (7). After elution from a polyacrylamide gel, isolated RNAs were performed as described above except that the amounts were heated at 70'C for 15 min and cooled slowly to room of RNA and RNase T1 were changed to 105 cpm/0.5 ng and temperature. This produced uniform secondary structures in 0.2-0.7 unit, respectively (7). The reaction products were the RNA and yielded one major RNA band in a nondenatur- irradiated on ice in a UV Stratalinker 1800 (Stratagene) with ing polyacrylamide gel. Radiolabeled RNAs (3 x 104 cpm/0.5 a 254-nm, 8-W UV bulb (maximum intensity, 3.6 mV/cm2) ng) were incubated with 40-100 pug of S100 cytoplasmic and were resolved in a SDS/12.5% polyacrylamide gel (19). extract in 20 mM Hepes, pH 7.6/3 mM MgCl2/40 mM KCI/2 mM dithiothreitol/5% (wt/vol) glycerol in a volume of 25 ,gl for 20 min at 23TC. The samples were then digested for 10 min RESULTS at 230C with RNase T1 (0.6-1.0 unit) and incubated with RNA-Protein Binding of the 3' UTR of Prm-2. The 3' UTRs heparin (5 mg/ml) for an additional 10 min at 230C. RNA- of mRNAs encoding mammalian protamines and transition protein complexes were resolved in 4% nondenaturing poly- proteins sequenced to date contain several conserved se- acrylamide gels run at 16 V/cm for about 3 hr at 4°C (17). quences. These sequences in Prm-2 mRNA are denoted Y, Isolation of RNA-Protein Complexes and RNase T1 Map- H, and Z (Fig. L4). ping. RNase T1 mapping was performed as described by To investigate the binding of cytoplasmic trans-acting Leibold and Munro (7) with the following modifications. factors to the Y, H, and Z sequences, 32P-labeled transcripts After protein binding and RNase T1 digestion, the protected for subclones a, b, c, and d of the 3' UTR of Prm-2 mRNA RNA fragments were isolated by electroelution from the were incubated with a S100 cytoplasmic testicular extract, native gel, followed by extraction with phenol and, after and RNA-protein complexes were resolved in a nondena- addition oftRNA (2.5 ,ug/ml), precipitation with ethanol. The turing polyacrylamide gel. RNA-protein complexes were detected with transcripts from clones a, b, and c (Fig. 1B). A CTGAGCCCTGAGCTGCCAAGGAGCCACGAGATCTGA These complexes were not found when the protein extract CTGGAGCCAAGGAA5 ATAGTCACCTGCC AAAGCCACCTGCC was previously digested with proteinase K or heat-denatured +411 C613 (data not shown). No complexes were detected with tran- BanI y 9 Taq I y B 12 PIyA , zs H Z An script d, with control pGem RNA, or with the 3' UTR ofhGH TAA mRNA. To remove proteins bound nonspecifically to the a LLD RNA, heparin (Fig. 2, lane 3) or RNase T1 and heparin (Fig. c d 2, lane 4) were added to the incubation mixture. The con- centrations of MgCI2 and KCl were adjusted for maximal olioH RNA-protein binding. Two distinct complexes, U and L, were resolved when radiolabeled transcripts b or c were incubated with cytoplas- B mic extract (Fig.