Therapeutic Targeting of the Secreted Lysophospholipase D Autotaxin Suppresses

Author Manuscript Published OnlineFirst on May 11, 2020; DOI: 10.1158/0008-5472.CAN-19-2884 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Title: Therapeutic targeting of the secreted lysophospholipase D autotaxin suppresses

tuberous sclerosis complex-associated tumorigenesis

Authors: You Feng1,4, William J. Mischler1,4,5, Ashish C. Gurung1,4,5, Taylor R. Kavanagh1,4,

Grigoriy Androsov1,4, Peter M. Sadow2,4, Zachary T. Herbert3,4, Carmen Priolo1,4

Affiliations: 1Pulmonary and Critical Care Medicine, Department of Medicine, Brigham and

Women’s Hospital, Boston, MA

2Department of Pathology, Massachusetts General Hospital, Boston, MA

3Molecular Biology Core Facilities, Dana-Farber Cancer Institute, Boston, MA

4Harvard Medical School, Boston, MA

5 These authors contributed equally

Running title: Autotaxin pathway inhibition halts TSC tumorigenesis

Corresponding author: Carmen Priolo, MD PhD Brigham and Women’s Hospital Boston MA 02115 [email protected] Tel: 857-307-0783 Fax: 617-394-2769

Conflict of interest: The authors declare no potential conflicts of interest

Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2020 American Association for Cancer Research. Author Manuscript Published OnlineFirst on May 11, 2020; DOI: 10.1158/0008-5472.CAN-19-2884 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Abstract

Tuberous Sclerosis Complex (TSC) is an autosomal dominant disease characterized by

multi-organ hamartomas, including renal angiomyolipomas and pulmonary

lymphangioleiomyomatosis (LAM). TSC2 deficiency leads to hyperactivation of mammalian

Target of Rapamycin Complex 1 (mTORC1), a master regulator of cell growth and metabolism.

Phospholipid metabolism is dysregulated upon TSC2 loss, causing enhanced production of lysophosphatidylcholine (LPC) species by TSC2-deficient tumor cells. LPC is the major substrate of the secreted lysophospholipase D autotaxin (ATX), which generates two bioactive lipids, lysophosphatidic acid (LPA) and sphingosine-1-phosphate (S1P).

We report here that ATX expression is upregulated in human renal angiomyolipoma- derived TSC2-deficient cells compared to TSC2 add-back cells. Inhibition of ATX via the

clinically developed compound GLPG1690 suppressed TSC2-loss associated oncogenicity in vitro and in vivo and induced apoptosis in TSC2-deficient cells. GLPG1690 suppressed Akt and

Erk1/2 signaling and profoundly impacted the transcriptome of these cells while inducing minor gene expression changes in TSC2 add-back cells. RNAseq studies revealed transcriptomic signatures of LPA and S1P, suggesting an LPA/S1P-mediated reprogramming of the TSC lipidome. In addition, supplementation of LPA or S1P rescued proliferation and viability, neutral lipid content, and Akt or Erk1/2 signaling in human TSC2-deficient cells treated with

GLPG1690. Importantly, TSC-associated renal angiomyolipomas have higher expression of LPA receptor 1 and S1P receptor 3 compared to normal kidney.

These studies increase our understanding of TSC2-deficient cell metabolism, leading to

novel potential therapeutic opportunities for TSC and LAM.

Statement of Significance

This study identifies activation of the ATX-LPA/S1P pathway as a novel mode of metabolic dysregulation upon TSC2 loss, highlighting critical roles for ATX in TSC2-deficient cell fitness and in TSC tumorigenesis.

Introduction

Tuberous Sclerosis Complex (TSC), an autosomal dominant disease characterized by

multisystem hamartomas, including benign tumors of the brain, kidney, heart, and lung, affects

one in 8000 live births. About 30% of women with TSC develop lymphangioleiomyomatosis

(LAM), a cystic lung destruction associated with diffuse proliferation of smooth muscle actin-

positive cells that can progress to pulmonary failure requiring oxygen supplementation and lung

transplant. Sporadic LAM can also occur, characterized by somatic mutations in the TSC1 or

TSC2 gene and frequently associated with renal angiomyolipomas1, 2. TSC2 deficiency due to

inactivating mutations in the TSC genes leads to hyperactivation of mTORC1, which integrates

growth factor and nutrient signaling to stimulate cell growth, proliferation, and metabolism 3-8.

Clinical trials of TSC and LAM with the mTORC1 inhibitor rapamycin showed heterogeneous

response of tumor lesions and stabilization of pulmonary function; however, tumor growth and

pulmonary function decline resumed when treatment was stopped 9, 10. Similarly, in laboratory

studies, rapamycin exerts a cytostatic effect in TSC2-deficient cells. These studies highlight the

need for additional therapeutic regimens in TSC and LAM.

Choline phospholipid metabolism is dysregulated in TSC2-deficient cells, and distinct

lysophosphatidylcholine (LPC) species are significantly increased in LAM patient plasma 6 and

suppressed by treatment with rapamycin and chloroquine 11, supporting the hypothesis that

circulating LPC may participate in TSC/LAM pathogenesis. LPC is the major substrate of

autotaxin (ATX), a secreted lysophospholipase D that degrades LPC to lysophosphatidic acid

(LPA), a bioactive lipid known to play roles in cell proliferation, angiogenesis and tumor

metastases via specific G protein-coupled receptors 12. ATX also degrades

sphingosylphosphorylcholine (SPC), converting it into sphingosine-1-phosphate (S1P), a

metabolite regulating cell motility 13. ATX is involved in wound healing, inflammation and angiogenesis, and was identified among the top 40 upregulated genes in a model of metastatic mammary carcinoma 14.

Here, we show the impact of inhibiting the ATX pathway on the biology of TSC2- deficient cells in vitro and in vivo. GLPG1690 (developed by Galapagos NV) is a compound that specifically targets ATX and has progressed to phase III clinical trial for idiopathic pulmonary fibrosis (ClinicalTrials.gov Identifier: NCT03711162). We found that autotaxin is upregulated in TSC2-deficient cells, and that GLPG1690 inhibits the oncogenic potential of

TSC2-deficient cells in vitro and in vivo. Short-term treatment with GLPG1690 inhibits the

phosphorylation of Akt and Erk1/2 in TSC2-deficient cells, while long-term treatment suppresses

lipid synthesis and promotes fatty acid oxidation, leading to lower neutral lipid content in TSC2-

deficient cells. TSC-associated renal angiomyolipomas express significantly higher levels of

LPA receptor 1 (LPAR1) and S1P receptor 3 (S1PR3) compared to normal kidney. Consistent

with these results, autotaxin products LPA and S1P rescue the proliferation, survival, and

transcriptome of human renal angiomyolipoma-derived TSC2-deficient cells treated with

GLPG1690.

In summary, our data support a role for the ATX-LPA/S1P pathway in TSC-associated

tumorigenesis with potential therapeutic implications.

Materials and Methods

Cell lines, plasmids, CRISPR gene editing, and treatments

The following cell lines were used: 1) isogenic derivatives of LAM patient renal

angiomyolipoma-derived TSC2-deficient 621-101 cells (gift of Dr. Elizabeth Henske). These

cells were derived from a LAM patient renal angiomyolipoma 15 and carry the same somatic bi-

allelic TSC2 gene inactivating mutations as the patient's LAM cells (G1832A missense mutation

of one allele, and loss of the other allele) 16. The isogenic derivative pair includes empty vector

621-102 cells and TSC2 add-back 621-103 cells (Supplementary Figure 1); and 2) Tsc2-/- and

Tsc2+/+ mouse embryonic fibroblasts (MEFs, gift of David Kwiatkowski 17).

All cell lines were grown in Dulbecco's Modified Eagle Medium (DMEM) supplemented

with 10% fetal bovine serum (FBS), 100 IU/ml of penicillin, and 100 µg/mL of streptomycin,

unless specified otherwise. 621-102 and 621-103 cells were grown under antibiotic selection

pressure with zeocin (30 µg/ml). Zeocin was removed before each experiment.

Cell line validation: TSC2 deficiency, constitutive activation of mTORC1, and rapamycin

sensitivity were validated after each thawing by immunoblotting for tuberin/TSC2 and phospho-

S6 kinase or phospho-S6 ribosomal protein in the presence or absence of FBS. Mycoplasma

testing (MycoAlertTM Mycoplasma Detection Kit, Lonza) was conducted after each thawing and

at least monthly. Cells were no longer used in experiments after reaching passage 40.

Tsc2-/- MEFs were infected with pBabe-Puro-Myr-Flag-AKT1 18 and/or transfected with

pCMV-myc-ERK2-L4A-MEK1_fusion (gift from Melanie Cobb, Addgene plasmid # 39197;

http://n2t.net/addgene:39197; RRID:Addgene_39197) using Fugene HD (Promega).

For CRISPR gene editing, Tsc2-/- MEFs were transfected with a predesigned TrueGuide sgRNA targeting ENPP2 (assay ID CRISPR480928_SGM) or TrueGuide sgRNA Negative

Control non-targeting 1 and TrueCut Cas9 v2 (Invitrogen) following the manufacturer’s recommendations. Due to low transfection efficiency, single cell clones were grown and

screened for on-target genome editing using the Alt-R Genome Editing Detection Kit (IDT).

T7EI assay results were analyzed by visualizing the cleavage products and the full-length amplicon (forward primer: 5’-GAATCTCTCCGATCACTACCATTT; reverse primer: 5’-

AGGCAGGTGGTGTTTCATAG) on a 2% agarose gel.

GLPG1690 was obtained from Medkoo Biosciences and dissolved in DMSO. LPA and

S1P were obtained from Sigma and Avanti Polar Lipids and pre-conjugated with 2% fatty acid- free BSA at 37 ˚C for 20-30 min prior to each experiment. MK2206 (Selleckchem) and

SCH772984 (Cayman Chemical) were dissolved in DMSO.

Cell Proliferation Assay

Cells were plated on 12-well plates and treated with increasing doses of GLPG1690 or rapamycin (20 nM) in medium supplemented with 10% FBS unless otherwise specified. After

68-96 hr of incubation, cells are fixed with formalin and stained with crystal violet, then dissolved in methanol and read on a Synergy HT BioTek plate reader.

Migration Assay

Oris assays (Cat# CMA5.101, Platypus Technologies) use a stopper to create a cell-free detection zone in the center of each well of a 96-well plate. Assays were performed according to the manufacturer’s instructions. Briefly, 30,000 cells were seeded in DMEM containing 2% FBS per well around the stoppers. After cells attached overnight, the stoppers were removed (except for 0 h control wells) and GLPG1690 (3 µM for Tsc2-/- MEFs and 6 µM for the human Tsc2- deficient cells) or DMSO vehicle was added. Cells were allowed to migrate to the center of wells

for 18 hr before the 96-well plate was scanned on a Celigo imager. Migration was quantified by

measuring the % wound healing (tend – t0, 40% well mask) and normalized to vehicle control.

Soft agar colony formation assay

Cells (10,000/well) were mixed in a layer of 0.4% Noble agar (BD Biosciences) in

DMEM with 10% FBS (1 ml) and plated on top of a layer of 0.6% agar in DMEM with 10%

FBS (3 ml) in 6-well plates. After agar solidified, cells were treated with GLPG1690 (6 µM) or

DMSO control (0.06%) in 1 ml of medium, twice a week for 6 weeks. Images of the entire wells

were taken with an Olympus SZH10 Research Stereo Microscope and colonies were counted.

RNAseq Analysis

Human TSC2-deficient or TSC2 add-back cells were plated on 10 cm dishes and treated

with vehicle or GLPG1690 (6 µM) in DMEM with 2% FBS, 0.18% DMSO and 0.1% BSA. LPA

(6 µM) or S1P (6 µM) was supplemented to human TSC2-deficient cells. After 24 hr-treatment,

cells were washed with cold PBS (6 mL) and RNA was collected with PureLink RNA Mini Kit

(Invitrogen) following the manufacturer’s instructions. The concentration of purified RNA was

measured using Nanodrop. Two micrograms of RNA were submitted for Illumina RNAseq, which was conducted by the Molecular Biology Core Facilities, Dana-Farber Cancer Institute.

Library preparation and sequencing. Libraries were prepared using Kapa stranded mRNA

Hyper Prep sample preparation kits from 100ng of purified total RNA according to the

manufacturer’s protocol. The finished dsDNA libraries were quantified by Qubit fluorometer,

Agilent TapeStation 2200, and RT-qPCR using the Kapa Biosystems library quantification kit

according to manufacturer’s protocols. Uniquely indexed libraries were pooled in equimolar

ratios and sequenced on an Illumina NextSeq500 with single-end 75bp reads by the Dana-Farber

Cancer Institute Molecular Biology Core Facilities.

RNAseq Analysis. Sequenced reads were aligned to the UCSC hg19 reference genome

assembly and gene counts were quantified using STAR (v2.5.1b) 19. Differential gene expression

testing was performed by DESeq2 (v1.10.1) 20 and normalized read counts (FPKM) were

calculated using cufflinks (v2.2.1) 21. RNAseq analysis was performed using the VIPER

snakemake pipeline.22

Enrichment Analysis. Gene set enrichment analysis (GSEA) was performed using the R

package GSEABase 23. Entrez IDs ranked by decreasing fold changes from DESeq2 results table were used as input and evaluated against the mdsig database v6.2 24-26. Gene ontology

enrichment analysis was performed by VIPER using on genes selected from the DESeq2 results

table that had a fold change > 2 or fold change < -2 and an adjusted p-value < 0.05 against a

background of all genes detected in the dataset.

Published RNAseq data 27 were obtained through dbGap. Differential gene expression

(DESeq) analysis was performed for 12 renal angiomyolipomas and 4 normal kidney tissue samples using R. Transcripts per million (TPM) values for LPA and S1P receptors were obtained

and plotted.

qPCR Analysis

Two micrograms of total RNA (PureLink RNA Mini Kit, Invitrogen) were

retrotranscribed with the SuperScript IV First-Strand Synthesis System (Invitrogen). Eighty

nanograms of cDNA per reaction were tested using the following TaqMan probes (Applied

Biosystems): ENPP2 (HS00905125_m1), Enpp2 (mouse Mm00516572_m1), FASN

(Hs01005622_m1), PCYT1A (Hs00192339_m1), ACACA (Hs01046047_m1), SCD

(Hs01682761_m1), LPAR1 (HS00173500_m1, LPAR2 (HS01109356_m1), LPAR3

(HS00173857_m1), LPAR4 (Hs01099908_m1), LPAR5 (Hs01054871_m1), LPAR6

(Hs05006584_m1), S1PR3 (Hs01019574_m1), and S1PR5 (Hs00924881_m1).

Flow Cytometry Analyses

For BrdU incorporation, Tsc2+/+ and Tsc2-/- MEFs cells were plated on 10 cm plates

and incubated with GLPG1690 (3 µM) or DMSO control for 68 hr in DMEM supplemented with

10% FBS. Two hours before collecting the cells, 10 µM BrdU (Upstate) was added. Adherent

cells were trypsinized and combined with floating cells. Cells were pelleted (1000 rpm, 5 min),

resuspended in 50 µL of PBS, and fixed with 6 ml of pre-cooled 70% ethanol at room

temperature for 30 min. Cells were pelleted, washed with 1 ml of 0.5% BSA in PBS, pelleted

again and resuspended with 500 µl of 2M HCl in PBS. After 20 min-incubation at room

temperature, 1 ml of 0.5% BSA in PBS was added immediately to each sample. Cells were

pelleted, resuspended in 50 µL of BrdU-FITC Ab (BD-Biosciences, cat. # 556028) or mouse IgG

negative control, and incubated in the dark at room temperature for 30 min. One ml of 0.5% BSA

in PBS was added to each sample. Cells were again pelleted and resuspended in 500 µL of PI (10

µg/mL in distilled H2O) with 10 μL of RNase A (10 µg/µl). After 30 min incubation at room temperature, cells were kept on ice and analyzed on a flow cytometer.

For BODIPY493/503 staining, 621-102 and 621-103 cells were seeded on 6-well plates

(200,000 cells per well) in DMEM with 2% FBS. After attachment, cells were treated with

vehicle control (0.18% DMSO + 0.1% BSA), GLPG1690 (6 µM), GLPG1690 (6 µM) + LPA (6

µM), LPA (6 µM), GLPG1690 (6 µM) + S1P (6 µM) or S1P (6 µM) for 70 hr. Cells were then washed with PBS, incubated with 2 ml of 4 µM BODIPY 493/503 (Cat# D3922, Invitrogen) in

PBS at 37 ˚C in the dark for 30 min, rinsed with PBS, trypsinized and resuspended in 300 μL of

PBS. Flow cytometry was performed to obtain a minimum of 10,000 events per condition.

Immunoblotting

Total proteins were extracted through 30-minute incubation on ice with Nonidet P-40 lysis buffer containing protease and phosphatase inhibitors, and resolved on Bolt Bis-Tris Plus

polyacrylamide gels (Life Technologies). Antibodies against PARP (cat# 9532S), Phospho-Akt

(S473; cat# 4060S), Akt (cat# 4685S), Phospho-Erk (T202/Y204; cat# 9101S), Erk1/2 (cat#

9102S), Phospho-S6 ribosomal protein (S235/236; cat# 2211S), total S6 ribosomal protein (cat#

2317S), Phospho-S6 kinase (cat# 9234S), total S6-kinase (cat# 2708S), Tuberin/TSC2 (cat#

4308S), Phospho-RSK (S380) (cat# 9335), total RSK (cat# 9355), Fatty Acid Synthase (cat#

3180S), Acetyl-CoA Carboxylase (cat# 3676S), Stearoyl-CoA desaturase 1 (cat# 2794S), CCTα

(cat# 6931S) and BrdU (5292S) were obtained from Cell Signaling Technology (Danvers, MA).

Anti-beta actin antibody (cat# A5316) was obtained from Millipore Sigma (St. Louis, MO) and anti-CPT1A antibody (cat# ab128568) from Abcam (Cambridge, MA).

Fatty acid oxidation

TSC2 add-back (300,000/well for 24 hr and 150,000/well for 72 hr) and TSC2-deficient

cells (200,000/well for 24 hr and 100,000 for 72 hr) were seeded in 12-well plates and treated

with GLPG1690 (6 µM) or control (0.06% DMSO) in DMEM with 10% FBS for 24 or 72 hr.

Cells were then incubated for 3 hr at 37ºC with 1 µCi/mL of [U-14C]palmitate (PerkinElmer Inc.,

MA). 3 M perchloric acid was added to the cell culture medium and the wells were sealed with

Whatman filter paper saturated with phenethylamine (Sigma-Aldrich) to capture 14C-CO2. The plates were gently shaken for 3 hr at room temperature and the filter paper was removed and placed into Ultima Gold F Scintillation Fluid (PerkinElmer Inc.). Radioactivity was counted on a

Packard Tri-Carb Liquid Scintillation Analyzer. Data were normalized against the protein mass

(total µg from three independent wells).

De novo lipid synthesis

Human TSC2-deficient cells (400,000/well for 24 hr and 200,000 for 72 hr) and TSC2

add-back cells (600,000/well for 24 hr and 300,000/well for 72 hr) were seeded in 6-well plates

and treated with GLPG1690 (6 µM) or control (0.06% DMSO) in DMEM with 10% FBS for 24

or 72 hr. Cells were then labeled with [1-14C]acetic acid (0.5 µCi/ml; PerkinElmer, MA) for 4 hr,

washed 2 times with PBS and collected for lipid extraction using isopropanol (500 µL).

Radioactivity from 20 µL of the lipid extract was counted on a Packard Tri-Carb Liquid

Scintillation Analyzer. Data were normalized against the protein mass (total µg from three

independent wells).

Animal studies

Subcutaneous tumors were generated by injecting Tsc2-/- MEFs in female NOD.Cg-

Prkdcscid Il2rgtm1Wjl/SzJ (NSG) mice (The Jackson Laboratory, JAX stock #005557). Three

independent trials were conducted. 2.5x106 cells/mouse were resuspended in 100 µl of PBS and injected with matrigel (1:1) in a single flank. When tumors reached a palpable size, mice were

treated with GLPG1690 (60 mg/kg/d) or control (DMSO) diluted in sterile vehicle (0.25%

Tween 80/0.25% PEG 200 in distilled water) through intraperitoneal injection (i.p.) using a 27G

needle for 30 days. Tumors were harvested 4 hr after BrdU injection (1 mg/mouse, i.p.) and the

last treatment, and submitted for histopathological analyses.

The animal studies were conducted under a protocol approved by the Institutional Animal

Care and Use Committee (IACUC) at the Brigham and Women's Hospital (Boston, MA).

Histology and immunohistochemistry

Dissected tumors were fixed in formalin for 24 hr. Hematoxylin and eosin (H&E) and

immunohistochemical staining were performed on five-micron sections of formalin-fixed and

paraffin-embedded (FFPE) samples. Immunohistochemistry was performed by InvivoEx Inc.

(Boston, MA).

Paraffin sections of tissue were dewaxed using xylene and rehydrated in graded ethanol.

DNA hydrolysis was performed using HCl and neutralized with sodium borate buffer. Sections

were then incubated in a 1:200 dilution of the mouse monoclonal anti-BrdU primary antibody

(cat# Bu20a, Cell Signaling Technology, Danvers, MA) at 4C overnight, and then incubated in a

1:200 dilution of biotinylated goat anti-mouse IgG secondary antibody (Vector Laboratories) for

1 hr at room temperature. Immunoreactivity was visualized using streptavidin-alkaline

phosphatase followed with substrate Vector blue, which resulted in a blue immunoreactive

signal; sections were then counterstained with nuclear fast red and mounted.

Transmission Electron Microscopy

Small tumor fragments (1-2 mm3) were fixed in FGP (2.5% glutaraldehyde, 1.25%

paraformaldehyde and 0.03% picric acid in 0.1 M sodium cacodylate buffer, pH 7.4) at 4 ˚C.

Three tumor samples from each group (drug or control) were analyzed at the Electron

Microscopy Core Facility (Harvard Medical School, Boston).

Tissue samples were postfixed with 1% osmium tetroxide (OsO4)/1.5% potassium

ferrocyanide (KFeCN6) for 1 hour, washed in water 2 times, 1 time in 50mM maleate buffer (pH

5.15, MB) and incubated in 1% uranyl acetate in MB for 1hr followed by 1 wash in MB, 2

washes in water and subsequent dehydration in grades of alcohol (10min each; 50%, 70%, 90%,

2x10min 100%). The samples were left in propyleneoxide for 1 hr and infiltrated overnight in a

1:1 mixture of propyleneoxide and TAAB Epon (TAAB Laboratories Equipment Ltd,

https://taab.co.uk). The following day the samples were embedded in TAAB Epon and

polymerized at 60ºC for 48 hr. Ultrathin sections (about 80nm) were cut on a Reichert Ultracut-S

microtome, picked up on to copper grids stained with lead citrate, and examined in a JEOL

1200EX Transmission electron microscope or a TecnaiG² Spirit BioTWIN. Images were

recorded with an AMT 2k CCD camera.

Statistical analysis

Statistical analyses were performed using GraphPad Prism 5. Data are reported as median

± 95% CI unless otherwise noted. Statistical significance was defined as p<0.05.

Results

Autotaxin (ATX) gene expression is significantly upregulated in TSC2-deficient cells

TSC2-deficient cells produce increased levels of LPC compared to TSC2-expressing cells

6. Because LPC is a preferential substrate of the secreted lysophospholipase D autotaxin (ATX),

we assayed the expression of this enzyme in TSC2-deficient and TSC2-expressing cells. ATX

mRNA expression was ~4-fold higher in LAM patient renal angiomyolipoma-derived TSC2- deficient cells (621-102) compared with the isogenic TSC2 add-back control cells (621-103)

(Figure 1A).

This result was validated in Tsc2-/- mouse embryonic fibroblasts (MEFs), which showed

~30-fold increase in ATX expression compared with Tsc2+/+ MEFs (Supplementary Figure 2A).

Treatment with rapamycin (20 nM, 24 hr) significantly reduced ATX expression selectively in

TSC2-deficient 621-102 cells (Figure 1A), suggesting that ATX expression may be regulated

downstream of mTORC1 in this patient-derived cell line.

ATX inhibition halts proliferation of TSC2-deficient cells

Next, to determine the role of ATX in the proliferation and survival of TSC2-deficient cells, we used a specific ATX inhibitor, GLPG1690, which is currently being tested in Phase 3

clinical trial for idiopathic pulmonary fibrosis (NCT03711162). First, using a synthetic ATX

substrate, FS-3 (LPC analogue), in a fluorogenic activity assay, we confirmed that GLPG1690

inhibits the enzymatic activity of recombinant ATX in vitro with an IC50 of ~64 nM

(Supplementary Figure 2B), validating its potency. Second, we tested GLPG1690 in both TSC2-

deficient models, the human renal angiomyolipoma cells and Tsc2-/- MEFs, in dose-dependent

experiments. GLPG1690 inhibited the proliferation of TSC2-deficient cells at a significantly lower IC50 (5.46 ± 0.24 μM for human TSC2-deficient cells; 2.84 ± 0.22 µM for Tsc2-/- MEFs) than that achieved in TSC2-expressing cells (7.34 ± 0.15 μ M for human TSC2 add-back cells,

Figure 1B; 4.71 ± 1.17 µM for TSC2+/+ MEFs, Supplementary Figure 2C) by crystal violet

staining.

Consistent with these results, inhibition of ATX via CRISPR sgRNA suppressed TSC2-

deficient cell proliferation by ~75% (Supplementary Figure 2D). On-target genome editing was

confirmed using T7 endonuclease I (T7EI), which recognizes and cleaves mismatched DNA

heteroduplexes. T7EI assay results were analyzed by visualizing the cleavage products and the

full-length amplicon on a 2% agarose gel (Supplementary Figure 2D).

Additionally, GLPG1690 induced moderate apoptosis levels selectively in the TSC2-

deficient cells, as shown by PARP cleavage (an apoptosis marker) in the presence of the drug (6

µM, 6 or 72 hr) in immunoblotting analysis (Figure 1C). As expected, rapamycin alone did not

induce apoptosis.

ATX inhibitor GLPG1690 inhibits the migration and anchorage-independent growth of

TSC2-deficient cells

We tested the impact of GLPG1690 on other oncogenic properties of TSC2-deficient

cells. GLPG1690 inhibited the migration of LAM patient renal angiomyolipoma-derived TSC2-

deficient cells by 73% (Figure 1D) and that of Tsc2-/- MEFs by 37% (Supplementary Figure 2E)

in the presence of 10% FBS, as shown by 18-hr Oris migration assays.

Next, we found that GLPG1690 inhibited the anchorage-independent growth of TSC2- deficient cells (621-102) by 82% (Figure 1E). TSC2 add-back cells (621-103) formed 74% less colonies in soft agar than TSC2-deficient cells at baseline, and were not affected by the drug

(Figure 1E).

GLPG1690 impacts the transcriptome of TSC2-deficient cells

To understand the mechanisms through which inhibition of the ATX pathway by

GLPG1690 suppresses TSC2-loss associated oncogenicity, we performed RNAseq analysis on human TSC2-deficient and TSC2 add-back cells treated with the drug or vehicle, in the presence of LPA or S1P, the two lipid products of ATX. Treatment with GLPG1690 induced substantial

gene expression changes in the TSC2-deficient cells: 5116 genes were differentially expressed (P

adj< 0.05), including 294 genes with absolute log2 (fold change) > 1.0 (205 upregulated genes,

and 89 downregulated genes) (Figure 2A; Supplementary File 1). Only 280 differentially

expressed genes (P adj < 0.05) including 1 gene with absolute log2 (fold change) > 1.0 were

found in the TSC2 add-back cells (Figure 2A; Supplementary File 1). Interestingly, ATX mRNA

levels were reduced by GLPG1690, selectively in TSC2-deficient cells, suggesting that the drug

suppresses not only the activity but also the transcription of ATX (Figure 2B). To identify

transcriptional changes at the pathway level, gene set enrichment analysis (GSEA) was

conducted, revealing 50 significantly enriched KEGG gene sets and 36 significantly enriched

Hallmark gene sets in the TSC2-deficient cells. These included cell cycle (KEGG), focal

adhesion (KEGG), oxidative phosphorylation (Hallmark), adipogenesis (Hallmark), apoptosis

(Hallmark) and fatty acid metabolism (Hallmark) (Figure 2C and Supplementary File 1).

ATX products LPA and S1P reverse the transcriptomic changes induced by GLPG1690 inTSC2-deficient cells.

To test whether the effects of GLPG1690 were mediated by the ATX lipid products, we supplemented the culture media of drug-treated human renal angiomyolipoma-derived TSC2- deficient cells with LPA or S1P and tested these conditions in RNAseq, proliferation and survival experiments.

In the RNAseq analysis, out of the 294 genes impacted by GLPG1690 in 621-102 cells (P

adj < 0.05, log2 (fold change) > 1.0), expression of 147 genes was reversed by adding back LPA,

expression of 64 genes was reversed by adding back S1P, and expression of 15 genes was reversed by both LPA and S1P. The rescue was defined as a significant change (with opposite

sign) in gene expression in GLPG1690 + LPA or S1P-treated cells vs. GLPG1690-treated cells

(Figure 3A, Supplementary Figure 3A and Supplementary File 1). These results suggest that

LPA and S1P drive non-redundant transcriptional programs in TSC2-deficient cells,

differentially contributing to ATX signaling. GO (Gene Ontology) term enrichment analysis of

the RNAseq data revealed that LPA mainly regulated inflammatory-associated pathways and

adhesion-associated genes, while S1P regulated lipid metabolism-associated genes

(Supplementary File 1).

To validate the role of LPA and S1P in mediating the effects of GLPG1690 on the

biology of TSC2-deficient cells, these cells were treated with GLPG1690 (6 µM), LPA (6 µM)

or S1P (6 µM), or the combination of both in the presence of 2% FBS for 72 hr. Crystal violet

staining showed that either LPA or S1P could partially rescue the proliferation of TSC2-deficient

cells upon treatment with GLPG1690 (Figure 3B). In line with the RNA-seq data,

supplementation of both LPA and S1P (3µM + 3µM) fully rescued proliferation under the same

conditions (Supplementary Figure 3B). Immunoblotting revealed that supplementation of either

LPA or S1P could prevent PARP cleavage (apoptosis) in the TSC2-deficient cells treated with

GLPG1690 (Figure 3C).

TSC2-deficient cells and TSC-associated renal angiomyolipomas overexpress LPA and S1P

receptors

RNAseq experiments corroborated a role for the ATX products, LPA and S1P, in the

response to treatment with GLP1690. These lipids act through specific G protein-coupled

receptors (GPCRs), LPARs and S1PRs. We tested the expression of these receptors in human

TSC2-deficient and TSC2 add-back cells in the RNAseq database and by qPCR. LPAR1 and

S1PR3 were significantly overexpressed in TSC2-deficient cells (Figures 3D, 3E). Treatment

with GLPG1690 led to an increase in the expression of LPAR1 and a decrease in the expression

of S1PR3 in these cells (Figure 3E, top panel). LPAR1 expression was also enhanced by

treatment with rapamycin, whereas S1PR3 expression was not affected (Figure 3E, bottom

panel). Lower or unchanged expression levels in TSC2-deficient vs. TSC2 add-back cells were

found for S1PR5, LPAR2 and LPAR3 (Supplementary Figure 4).

Importantly, LPAR1 and S1PR3 were also significantly overexpressed in TSC-associated renal angiomyolipomas, as tested in a published RNA seq dataset (Figure 3F).

GLPG1690 treatment suppresses Akt and Erk1/2 phosphorylation in TSC2-deficient cells

To assess GLPG1690-induced cell signaling changes, we screened 43 P-kinase sites and

2 related proteins in the LAM patient-derived TSC2-deficient cells and the TSC2 add-back

control cells treated with GLPG1690 (6 μM, 6 hr) or DMSO. Twenty-four of these P-kinase sites

(or proteins) showed greater than 25% suppression by GLPG1690 treatment specifically in the

TSC2-deficient cells; 8 of them showed greater than 50% change with the inhibitor, including

Erk1/2 (T202/Y204, T185/Y187) and Akt1/2/3 (S473) (Supplementary Figure 5A), which are

known to mediate signaling downstream of LPAR/S1PR 28-34. We confirmed the effect of

GLPG1690 on Akt and Erk phosphorylation by immunoblotting: 6 hr-treatment with GLPG1690

(6 μM) led to a decrease in P-Akt (S473) by 68 ± 10% and in P-Erk (T202/Y204) by 56 ± 12% in

the human TSC2-deficient cells (Figure 4A-B). P-S6 (S235/236), a direct target of mTORC1,

was not affected under this condition. Consistent results were obtained in Tsc2-/- MEFs

(Supplementary Figure 5B).

Intriguingly, a differential effect of LPA and S1P supplementation on AKT/ERK

activation was found. P-AKT levels were rescued by supplementation of LPA, while P-ERK

levels were rescued by supplementation of S1P (Figure 4C).

Next, to ask whether suppression of Akt and Erk signaling plays a role in GLPG1690 pro-apoptotic and anti-proliferative effects, we used two approaches. First, we treated cells with

a specific Akt or Erk inhibitor in combination with GLPG1690. The human TSC2-deficient cells

were pretreated for 30 min with Akt inhibitor MK2206 (4 µM) or Erk inhibitor SCH772984 (2

µM), and then incubated with GLPG1690 (6 µM) for 18 hr in the presence of 10% FBS.

Immunoblotting was performed to detect cleaved PARP. Either inhibitor induced low levels of

apoptosis as single agent and worked synergistically in combination with GLPG1690 to enhance

apoptosis (Figure 4D). Second, to test whether constitutive activation of Akt or Erk would

prevent the impact of GLPG1690 treatment on TSC cell proliferation, we expressed

myristoylated-Akt (myr-Akt) or a fusion of Erk2 with the low activity form of its upstream

regulator, the MAP kinase MEK1 35, in Tsc2-/- MEFs (Figure 4E). Cells were treated with

GLPG1690 (3 µM) or vehicle for 92 hr. The proliferation rate upon drug treatment (drug/DMSO, each normalized to its own baseline) was significantly higher in the presence of co-expression of myr-Akt and constitutively active ERK compared to the empty vector control (Figure 4E).

These data support a role for Akt and Erk signaling in TSC2-deficient cell proliferation, including effects downstream of the ATX/LPA/S1P axes.

Inhibition of the ATX-LPA/S1P pathway by GLPG1690 induces reprogramming of lipid metabolism in TSC2-deficient cells.

The RNA seq analysis revealed substantial changes in genes of fatty acid metabolism in

621-102 cells treated with GLPG1690. Specifically, in the gene sets of fatty acid metabolism and

adipogenesis, 63 out of 146 genes and 86 out of 186 genes were significantly altered

transcriptionally. Four enzymes involved in fatty acid oxidation, including acyl-CoA

dehydrogenase short chain (ACADS), acyl-CoA thioesterase 8 (ACOT8) and malonyl-CoA

decarboxylase (MLYCD), were upregulated, whereas 7 enzymes involved in lipid synthesis,

including fatty acid synthase (FASN), acetyl-CoA carboxylase alpha (ACACA) and acyl-CoA

synthetase long chain family member 1 (ACSL1), were downregulated (Supplementary File 1).

To validate the metabolic reprogramming suggested by the transcriptome changes, we

used flow cytometry-based neutral lipid quantification and 14C labeling experiments to trace fatty

acid oxidation and de novo lipid synthesis. TSC2-deficient human cells were treated with

GLPG1690 (6 µM), LPA (6 µM), S1P (6 µM), the combination of GLPG1690 with either lipid, or vehicle (DMSO), in the presence of 2% FBS for 70 hr. Cellular neutral lipids were then

stained with BODIPY493/503. GLPG1690 decreased neutral lipid content by 29% (p<0.01) in

TSC2-deficient cells, which have higher neutral lipid content than TSC2 add-back cells (p<0.01),

as expected. Intriguingly, the decrease in neutral lipid content was rescued by adding back either

LPA or S1P (Figure 5A).

To further determine the causes of these changes, we performed 14C-palmitate oxidation

(fatty acid oxidation) and 14C-acetate lipid incorporation (de novo lipid synthesis) assays upon

ATX inhibition for 24 or 72 hr in TSC2-deficient and TSC2 add-back cells. GLPG1690

significantly promoted β-oxidation selectively in TSC2-deficient cells at 24 hr and in both cell

lines at 72 hr (Figure 5B). The drug also significantly downregulated de novo lipid synthesis in both cell lines at 72 hr (Figure 5B).

Consistent with these results, the protein expression of the lipogenic enzyme CCTα

(CTP:phosphocholine cytidylyltransferase α), which is involved in lipid droplet biogenesis 36

was suppressed by ~50% following 72-hr treatment with GLPG1690, while no change in CCTα

protein expression was found in TSC2 add-back cells (Figure 5C and Supplementary Figure 6).

Minor changes in the expression (~30%) of two enzymes involved in de novo fatty acid

synthesis, FASN (fatty acid synthase) and ACCα (Acetyl-CoA carboxylase α), occurred in

TSC2-deficient cells (Figure 5C and Supplementary Figure 6), and expression of the desaturase

SCD1 (stearoyl-CoA desaturase 1) was suppressed in both TSC2-deficient and TSC2 add-back

cells (Figure 5C). FASN and SCD1 were confirmed to be regulated transcriptionally (Figure

5D). Expression of the mitochondrial fatty acid oxidation rate-limiting enzyme CPT1A was not

affected by drug treatment.

GLPG1690 suppresses TSC tumorigenesis in vivo.

Treatment with GLPG1690 led to a reduction in tumor burden by ~40% (p=0.016)

(Figure 6A). Mouse body weight was not affected by GLPG1690 treatment (Figure 6B) and no drug toxicity was found. Pathological analysis revealed clusters of more differentiated, fibroblast-like cells. As an observation, subcutaneous fat around the tumors appeared to be less abundant in the drug-treated mice and tumors seemed to infiltrate less into the muscle. (Figure

6C). Interestingly, electron microscopy images revealed inflated endoplasmic reticulum and confirmed a reduction in lipid droplets in the tumors treated with GLPG1690 (Figure 6D), consistent with the BODIPY493/503 staining and fatty acid oxidation/ de novo lipid synthesis

assays results. Finally, consistent with the effect of GLPG1690 on Tsc2-/- MEFs in vitro (Figure

6E), we found a decrease in BrdU incorporation in tumor cells by 38% (p = 0.034; Figure 6F).

Discussion

This study identifies a novel mode of metabolic dysregulation in the TSC tumor microenvironment, the ATX-LPA/S1P pathway (Figure 6G).

ATX regulates availability of two bioactive lipids, LPA and S1P, for activating specific

membrane G-protein-coupled receptors (GPCRs). ATX generates LPA and S1P through its

lysophospholipase D activity and binds and delivers these lipids to their receptors, protecting

them from phosphatase degradation 37. The ATX pathway has been associated with cancer

progression and metastasis 38, 39. LPA and S1P regulate several physiological processes,

including cell proliferation, cell migration/invasion, angiogenesis and inflammation. These lipids

activate a series of GPCRs, at least six for LPA (LPAR1-6) and five for S1P (S1PR1-5),

stimulating a wide variety of downstream signaling including PI3K/Akt and Ras/Erk pathways

40-47.

Importantly, two of these GPCRs, LPAR1 and S1PR3, are upregulated in TSC-associated renal angiomyolipomas (Figure 3F), consistent with TSC2-deficient human cells (Figure 3D, E).

GLPG1690 is a potent and specific autotaxin inhibitor currently in Phase III clinical trials

for idiopathic pulmonary fibrosis (IPF). Its safety and target engagement was shown in Phase I

and II trials 48, 49. We found that inhibition of the ATX pathway using GLPG1690 suppresses the

oncogenicity of TSC2-deficient cells, including cell proliferation, cell migration, anchorage-

independent growth, and tumor growth in vivo. Consistent with GLPG1690 effects, ATX gene

editing via CRISPR sgRNA dramatically suppressed the proliferation of Tsc2-/- MEFs.

Taken together, these data suggest a substantial role for ATX-LPA/S1P signaling pathway in TSC tumorigenesis. Mechanistically, Akt and Erk signaling were affected in cells treated with GLPG1690 and combination of the ATX inhibitor with either Akt or Erk1/2 specific inhibitors led to enhanced apoptosis in TSC2-deficient cells; on the contrary, expression of constitutively active Akt and Erk rendered the cells significantly less sensitive to the anti- proliferative effect of GLPG1690.

Moreover, ATX inhibition led to LPA and S1P-dependent transcriptomic and metabolic reprogramming. Our RNA seq experiments uncovered specific roles for LPA and S1P in the

context of TSC2 loss. These bioactive lipids reversed differential changes in the transcriptome of

TSC2-deficient cells treated with GLPG1690, with major involvement of LPA in cell

adhesion/motility and inflammatory processes, and of S1P in sterol and lipid biosynthesis.

We found that inhibition of ATX by GLPG1690 led to a reprogramming of lipid metabolism via multiple mechanisms. One mechanism included reduction in the mRNA and/or

protein expression of lipogenic enzymes, CCT, ACC, FASN, and SCD1, with associated

decrease in lipid droplet content and de novo lipid synthesis in cells treated with the drug. CCT is

the rate-limiting enzyme in the CDP-choline pathway for phosphatidylcholine biosynthesis. This enzyme participates in nuclear membrane, nucleoplasmic reticulum, and lipid droplet biogenesis, and contributes to phospholipid homeostasis. ACC, FASN and SCD1 mediate fatty acid synthesis. Interestingly, TSC2-deficient cells have the ability to upregulate expression of the lipogenic enzyme FASN over time in culture (72-hr compared to 24-hr), likely to enhance fatty acid synthesis when exogenous availability decreases; however, treatment with GLPG1690 prevented this increase, potentially making these cells more vulnerable to nutrient depletion.

Another mechanism involves lipid catabolic processes. Treatment with GLPG1690 led to

enhanced fatty acid oxidation selectively in the TSC2-deficient cells at 24 hr and in both TSC2-

deficient and TSC2 add-back human renal angiomyolipoma cells at 72 hr.

These data suggest a role for the ATX pathway in the regulation of the intracellular lipidome of TSC2-deficient cells.

Surprisingly, while suppression of LPA and S1P levels through ATX inhibition would be

expected to upregulate ATX expression in tissues due to feedback regulation 50, we found that

treatment with GLPG1690 suppressed the expression of ATX in human TSC2-deficient cells, suggesting that this compound acts through multiple mechanisms to suppress ATX activity.

In summary, our studies suggest that dysregulated ATX-LPA/S1P pathways are critical

players in TSC2-deficient cell fitness and in TSC tumorigenesis, and that ATX could be tackled

for novel therapeutic modalities in TSC and LAM.

Acknowledgements

We thank Maria Ericsson (Electron Microscopy Facility, Harvard Medical School) for providing

assistance with electron microscopy. This work was supported through NIH R01HL130336 and

funds from the Department of Defense (W81XWH-16-1-0165) and the Tuberous Sclerosis

Alliance (50K Crowdfunded Research Challenge) to C.P.. Y.F. was supported by a Postdoctoral

Fellowship co-funded by the Tuberous Sclerosis Alliance and The LAM Foundation and a

microgrant from the Brigham Research Institute. We are grateful to the Engles Program in TSC

and LAM Research for supporting publication of this work.

References

[1] Henske EP, Jozwiak S, Kingswood JC, Sampson JR, Thiele EA: Tuberous sclerosis complex.

Nat Rev Dis Primers 2016, 2:16035.

[2] Gupta N, Henske EP: Pulmonary manifestations in tuberous sclerosis complex. Am J Med

Genet C Semin Med Genet 2018, 178:326-37.

[3] Duvel K, Yecies JL, Menon S, Raman P, Lipovsky AI, Souza AL, et al.: Activation of a

metabolic gene regulatory network downstream of mTOR complex 1. Mol Cell 2010, 39:171-83.

[4] Laplante M, Sabatini DM: mTOR signaling at a glance. J Cell Sci 2009, 122:3589-94.

[5] Saxton RA, Sabatini DM: mTOR Signaling in Growth, Metabolism, and Disease. Cell 2017,

168:960-76.

[6] Priolo C, Ricoult SJ, Khabibullin D, Filippakis H, Yu J, Manning BD, et al.: Tuberous

Sclerosis Complex 2 Loss Increases Lysophosphatidylcholine Synthesis in

Lymphangioleiomyomatosis. Am J Respir Cell Mol Biol 2015, 53:33-41.

[7] Parkhitko AA, Priolo C, Coloff JL, Yun J, Wu JJ, Mizumura K, et al.: Autophagy-dependent

metabolic reprogramming sensitizes TSC2-deficient cells to the antimetabolite 6-

aminonicotinamide. Mol Cancer Res 2014, 12:48-57.

[8] Ben-Sahra I, Howell JJ, Asara JM, Manning BD: Stimulation of de novo pyrimidine synthesis by growth signaling through mTOR and S6K1. Science 2013, 339:1323-8.

[9] Bissler JJ, McCormack FX, Young LR, Elwing JM, Chuck G, Leonard JM, et al.: Sirolimus

for angiomyolipoma in tuberous sclerosis complex or lymphangioleiomyomatosis. N Engl J Med

2008, 358:140-51.

[10] McCormack FX: The way forward in lymphangioleiomyomatosis: a trial for every patient,

every patient in a trial. J Bras Pneumol 2011, 37:422-3.

[11] Tang Y, El-Chemaly S, Taveira-Dasilva A, Goldberg HJ, Bagwe S, Rosas IO, et al.:

Metabolic Changes in Patients With Lymphangioleiomyomatosis Treated With Sirolimus and

Hydroxychloroquine. Chest 2019.

[12] Albers HM, Dong A, van Meeteren LA, Egan DA, Sunkara M, van Tilburg EW, et al.:

Boronic acid-based inhibitor of autotaxin reveals rapid turnover of LPA in the circulation. Proc

Natl Acad Sci U S A 2010, 107:7257-62.

[13] Clair T, Aoki J, Koh E, Bandle RW, Nam SW, Ptaszynska MM, et al.: Autotaxin

hydrolyzes sphingosylphosphorylcholine to produce the regulator of migration, sphingosine-1-

phosphate. Cancer Res 2003, 63:5446-53.

[14] Euer N, Schwirzke M, Evtimova V, Burtscher H, Jarsch M, Tarin D, et al.: Identification of

genes associated with metastasis of mammary carcinoma in metastatic versus non-metastatic cell

lines. Anticancer Res 2002, 22:733-40.

[15] Yu J, Astrinidis A, Howard S, Henske EP: Estradiol and tamoxifen stimulate LAM-

associated angiomyolipoma cell growth and activate both genomic and nongenomic signaling

pathways. Am J Physiol Lung Cell Mol Physiol 2004, 286:L694-700.

[16] Carsillo T, Astrinidis A, Henske EP: Mutations in the tuberous sclerosis complex gene

TSC2 are a cause of sporadic pulmonary lymphangioleiomyomatosis. Proc Natl Acad Sci U S A

2000, 97:6085-90.

[17] Zhang H, Cicchetti G, Onda H, Koon HB, Asrican K, Bajraszewski N, et al.: Loss of

Tsc1/Tsc2 activates mTOR and disrupts PI3K-Akt signaling through downregulation of PDGFR.

J Clin Invest 2003, 112:1223-33.

[18] Priolo C, Pyne S, Rose J, Regan ER, Zadra G, Photopoulos C, et al.: AKT1 and MYC

Induce Distinctive Metabolic Fingerprints in Human Prostate Cancer. Cancer Res 2014.

[19] Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, et al.: STAR: ultrafast

universal RNA-seq aligner. Bioinformatics 2013, 29:15-21.

[20] Love MI, Huber W, Anders S: Moderated estimation of fold change and dispersion for

RNA-seq data with DESeq2. Genome Biol 2014, 15:550.

[21] Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, van Baren MJ, et al.: Transcript

assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching

during cell differentiation. Nat Biotechnol 2010, 28:511-5.

[22] Cornwell M, Vangala M, Taing L, Herbert Z, Koster J, Li B, et al.: VIPER: Visualization

Pipeline for RNA-seq, a Snakemake workflow for efficient and complete RNA-seq analysis.

BMC Bioinformatics 2018, 19:135.

[23] Morgan M FS, Gentleman R GSEABase: Gene set enrichment data structures and methods.

R package version 1460 2019.

[24] Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, et al.: Gene

set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression

profiles. Proc Natl Acad Sci U S A 2005, 102:15545-50.

[25] Liberzon A, Birger C, Thorvaldsdottir H, Ghandi M, Mesirov JP, Tamayo P: The Molecular

Signatures Database (MSigDB) hallmark gene set collection. Cell Syst 2015, 1:417-25.

[26] Liberzon A, Subramanian A, Pinchback R, Thorvaldsdottir H, Tamayo P, Mesirov JP:

Molecular signatures database (MSigDB) 3.0. Bioinformatics 2011, 27:1739-40.

[27] Martin KR, Zhou W, Bowman MJ, Shih J, Au KS, Dittenhafer-Reed KE, et al.: The

genomic landscape of tuberous sclerosis complex. Nat Commun 2017, 8:15816.

[28] Zhang G, Cheng Y, Zhang Q, Li X, Zhou J, Wang J, et al.: ATX-LPA axis facilitates

estrogeninduced endometrial cancer cell proliferation via MAPK/ERK signaling pathway. Mol

Med Rep 2018, 17:4245-52.

[29] Houben AJ, Moolenaar WH: Autotaxin and LPA receptor signaling in cancer. Cancer

Metastasis Rev 2011, 30:557-65.

[30] Safarian F, Khallaghi B, Ahmadiani A, Dargahi L: Activation of S1P(1) receptor regulates

PI3K/Akt/FoxO3a pathway in response to oxidative stress in PC12 cells. J Mol Neurosci 2015,

56:177-87.

[31] Lee HM, Lo KW, Wei W, Tsao SW, Chung GTY, Ibrahim MH, et al.: Oncogenic S1P signalling in EBV-associated nasopharyngeal carcinoma activates AKT and promotes cell migration through S1P receptor 3. J Pathol 2017, 242:62-72.

[32] Callihan P, Ali MW, Salazar H, Quach N, Wu X, Stice SL, et al.: Convergent regulation of neuronal differentiation and Erk and Akt kinases in human neural progenitor cells by lysophosphatidic acid, sphingosine 1-phosphate, and LIF: specific roles for the LPA1 receptor.

ASN Neuro 2014, 6.

[33] Rutherford C, Childs S, Ohotski J, McGlynn L, Riddick M, MacFarlane S, et al.: Regulation of cell survival by sphingosine-1-phosphate receptor S1P1 via reciprocal ERK-dependent

suppression of Bim and PI-3-kinase/protein kinase C-mediated upregulation of Mcl-1. Cell

Death Dis 2013, 4:e927.

[34] Hu X, Haney N, Kropp D, Kabore AF, Johnston JB, Gibson SB: Lysophosphatidic acid

(LPA) protects primary chronic lymphocytic leukemia cells from apoptosis through LPA

receptor activation of the anti-apoptotic protein AKT/PKB. J Biol Chem 2005, 280:9498-508.

[35] Robinson MJ, Stippec SA, Goldsmith E, White MA, Cobb MH: A constitutively active and

nuclear form of the MAP kinase ERK2 is sufficient for neurite outgrowth and cell

transformation. Curr Biol 1998, 8:1141-50.

[36] Krahmer N, Guo Y, Wilfling F, Hilger M, Lingrell S, Heger K, et al.: Phosphatidylcholine

synthesis for lipid droplet expansion is mediated by localized activation of CTP:phosphocholine

cytidylyltransferase. Cell Metab 2011, 14:504-15.

[37] Nishimasu H, Okudaira S, Hama K, Mihara E, Dohmae N, Inoue A, et al.: Crystal structure

of autotaxin and insight into GPCR activation by lipid mediators. Nat Struct Mol Biol 2011,

18:205-12.

[38] Benesch MGK, MacIntyre ITK, McMullen TPW, Brindley DN: Coming of Age for

Autotaxin and Lysophosphatidate Signaling: Clinical Applications for Preventing, Detecting and

Targeting Tumor-Promoting Inflammation. Cancers (Basel) 2018, 10.

[39] Barbayianni E, Kaffe E, Aidinis V, Kokotos G: Autotaxin, a secreted lysophospholipase D,

as a promising therapeutic target in chronic inflammation and cancer. Prog Lipid Res 2015,

58:76-96.

[40] Gonzalez-Cabrera PJ, Brown S, Studer SM, Rosen H: S1P signaling: new therapies and

opportunities. F1000Prime Rep 2014, 6:109.

[41] Takuwa Y, Okamoto H, Takuwa N, Gonda K, Sugimoto N, Sakurada S: Subtype-specific, differential activities of the EDG family receptors for sphingosine-1-phosphate, a novel

lysophospholipid mediator. Mol Cell Endocrinol 2001, 177:3-11.

[42] Brinkmann V: Sphingosine 1-phosphate receptors in health and disease: mechanistic

insights from gene deletion studies and reverse pharmacology. Pharmacol Ther 2007, 115:84-

105.

[43] Boucharaba A, Guillet B, Menaa F, Hneino M, van Wijnen AJ, Clezardin P, et al.:

Bioactive lipids lysophosphatidic acid and sphingosine 1-phosphate mediate breast cancer cell biological functions through distinct mechanisms. Oncol Res 2009, 18:173-84.

[44] Chen RJ, Chen SU, Chou CH, Lin MC: Lysophosphatidic acid receptor 2/3-mediated IL-8-

dependent angiogenesis in cervical cancer cells. Int J Cancer 2012, 131:789-802.

[45] Shida D, Kitayama J, Yamaguchi H, Okaji Y, Tsuno NH, Watanabe T, et al.:

Lysophosphatidic acid (LPA) enhances the metastatic potential of human colon carcinoma

DLD1 cells through LPA1. Cancer Res 2003, 63:1706-11.

[46] Yung YC, Stoddard NC, Chun J: LPA receptor signaling: pharmacology, physiology, and

pathophysiology. J Lipid Res 2014, 55:1192-214.

[47] Patmanathan SN, Wang W, Yap LF, Herr DR, Paterson IC: Mechanisms of sphingosine 1-

phosphate receptor signalling in cancer. Cell Signal 2017, 34:66-75.

[48] van der Aar E, Desrivot J, Dupont S, Heckmann B, Fieuw A, Stutvoet S, et al.: Safety,

Pharmacokinetics, and Pharmacodynamics of the Autotaxin Inhibitor GLPG1690 in Healthy

Subjects: Phase 1 Randomized Trials. J Clin Pharmacol 2019, 59:1366-78.

[49] Maher TM, van der Aar EM, Van de Steen O, Allamassey L, Desrivot J, Dupont S, et al.:

Safety, tolerability, pharmacokinetics, and pharmacodynamics of GLPG1690, a novel autotaxin

inhibitor, to treat idiopathic pulmonary fibrosis (FLORA): a phase 2a randomised placebo- controlled trial. Lancet Respir Med 2018, 6:627-35.

[50] Benesch MG, Zhao YY, Curtis JM, McMullen TP, Brindley DN: Regulation of autotaxin

expression and secretion by lysophosphatidate and sphingosine 1-phosphate. J Lipid Res 2015,

56:1134-44.

Figure legends

Figure 1. Impact of ATX inhibition on the oncogenicity of TSC2-deficient cells. (A) ATX mRNA expression is downregulated by TSC2 add-back or rapamycin treatment in LAM patient renal angiomyolipoma-derived TSC2-deficient cells. Human TSC2-deficient cells (TSC2-) or

TSC2 add-back cells (TSC2+) were treated with vehicle (DMSO) or rapamycin (20 nM) for 24.

Two-way ANOVA with Tukey's multiple comparisons test was applied. (B) TSC2- cells are

more sensitive to GLPG1690 than TSC2+ cells. Cells were treated with GLPG1690 in the

presence of 10% FBS for 96 hr and cell proliferation was quantified with crystal violet staining.

Multiple t tests was applied. IC50 is 5.46 ± 0.24 μM for TSC2- and 7.34 ± 0.15 μM (Mean ±

SEM) for TSC2+ cells. (C) GLPG1690 induces apoptosis in human TSC2- cells but not in

TSC2+ cells. Cells were treated with GLPG1690 (6 μM), rapamycin (20 nM) or the combination

for 6 or 72 hr. The red arrow points to the cleaved PARP, which indicates cell apoptosis. (D)

GLPG1690 inhibits the migration of human TSC2- cells. Cells were treated with GLPG1690 (6

µM) for 18 hr. Images were obtained on a Celigo imager. Mann-Whitney test was applied. (E)

GLPG1690 inhibits the anchorage-independent growth of TSC2- cells. Cells were treated with

GLPG1690 (6 µM) or control (0.06% DMSO) twice a week for 6 weeks. Two-way ANOVA

with Tukey's multiple comparisons test was applied. * p < 0.05, ** p < 0.01, *** p < 0.001, ****

p < 0.0001.

Figure 2. GLPG1690 induces marked changes in gene expression selectively in human

TSC2-deficient cells. (A) Volcano plots showing GLPG1690-induced gene expression change

(p adjusted < 0.05, absolute log2(fold change) > 1) in human TSC2-deficient cells (top panel)

and TSC2 add-back cells (bottom panel). Cells were treated with GLPG1690 (6 µM) or vehicle

(DMSO) in DMEM with 2% FBS for 24 hr. (B) ATX transcription is reduced by GLPG1690 in human TSC2-deficient cells. Transcripts per million (TPM) values are shown. Two-way

ANOVA with Tukey's multiple comparisons test was applied. (C) Selected gene sets enriched

upon GLPG1690 treatment in human TSC2-deficient cells. *** p < 0.001, **** p < 0.0001.

Figure 3. LPA and S1P reverse GLPG1690 effects on the transcriptome and proliferation/apoptosis in human TSC2-deficient cells. (A) TSC2-deficient cells were incubated for 24 hr with LPA (6 µM), S1P (6 µM), GLPG1690 (6 µM), either lipid in combination with the drug, or vehicle (DMSO + 0.1% BSA) in media with 2% FBS. TSC2 add- back cells were incubated with GLPG1690 or vehicle. Differentially expressed genes in human

TSC2-deficient cells (TSC2-) treated with GLPG1690 vs. vehicle (P adjusted < 0.05, absolute

Log2(fold change) > 1) are depicted in the heat map. Each row represents a gene and each

column a sample. Samples are color-coded. Unsupervised clustering enables visualization of

groups of genes rescued by LPA or S1P. One differential gene was identified in TSC2 add-back

cells (TSC2) treated with GLPG1690 vs. vehicle. (B) Cells were treated with GLPG1690 (6 μM)

or vehicle (0.18% DMSO & 0.1% fatty acid-free BSA) with or without the presence of LPA (6

μM) (left panel) or S1P (6 μM) (right panel) in DMEM with 2% FBS for 72 hr. One-way

ANOVA with Tukey's multiple comparisons test was applied. (C) LPA and S1P rescue human

TSC2-deficient cells from GLPG1690-induced apoptosis (cleaved PARP). Cells were treated as

in (B). (D) Expression of LPARs and S1PRs in human TSC2-deficient versus TSC2 add-back

cells (Transcripts per million, TPM values). Two-way ANOVA with Sidak's multiple

comparisons test was applied. (E) LPAR1 and S1PR3 expression in human TSC2-deficient cells

and TSC2 add-back cells treated with GLPG1690 (6 μM, 2% FBS; TPM values, top panels) or rapamycin (20 nM, 10% FBS; RT-qPCR analysis, bottom panels) for 24 hr. Two-way ANOVA with Tukey's multiple comparisons test was applied. (F) LPAR1 and S1PR3 have higher

expression in renal angiomyolipomas compared to normal kidney. Mann-Whitney test was

applied. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001

Figure 4. GLPG1690 impacts Akt and Erk signaling in human TSC2-deficient cells. (A)

Human TSC2-deficient cells and TSC2 add-back cells were treated with GLPG1690 (6 µM), rapamycin (20 nM), the combination of the two, or vehicle (DMSO) in DMEM with 10% FBS

for 6 hr. (B) P-Akt (S473) and P-Erk1/2 (T202/Y204) densitometry analysis from 3 biological

replicates using ImageJ. (C) Human TSC2-deficient cells and TSC2 add-back cells were

incubated with LPA (6 µM), S1P (6 µM), GLPG1690 (6 µM), the combination of each lipid with

the drug, or vehicle (DMSO) in DMEM with 2% FBS for 72 hr. (D) Human TSC2-deficient cells

were pretreated with Akt inhibitor MK2206 (4 µM) or Erk inhibitor SCH772984 (2 µM) for 30

min, and then incubated with GLPG1690 (6 µM) for 18 hr in DMEM with 10% FBS. (E)

Constitutively active Erk, myristoylated (Myr) Akt, or both were expressed in Tsc2-/- MEFs (top

panel). Cells were treated with vehicle (DMSO) or GLPG1690 (3 µM) in DMEM with 10% FBS

for 92 hr before crystal violet staining (bottom panel). One-way ANOVA with Dunnett's multiple

comparisons test was applied and data are shown as Mean±SD. * p < 0.05

Figure 5. Impact of GLPG1690 treatment on TSC2-deficient cell lipid metabolism. (A)

GLPG1690 treatment reduces the neutral lipid content in human TSC2-deficient cells. Cells were

treated with control (0.18% DMSO + 0.1% BSA), GLPG1690 (6 µM), GLPG1690 (6 µM) +

LPA (6 µM), LPA (6 µM), GLPG1690 (6 µM) +S1P (6 µM) or S1P (6 µM) in the presence of

2% FBS for 70 hr. Cells were stained with BODIPY493/503 (4 µM, 30 min) and analyzed by

Flow cytometry. One sample t test was used and data are shown as Mean±SD. (B) GLPG1690 treatment upregulates fatty acid oxidation and downregulates lipid synthesis. TSC2-deficient

cells and TSC2 add-back cells were treated with GLPG1690 (6 µM) or vehicle (0.06% DMSO) in DMEM with 10% FBS for 24 or 72 hr. Cells were incubated with [U-14C]palmitate (1

µCi/mL) for 3 hr (top panel) or [1-14C]acetic acid (0.5 µCi/ml) for 4 hr (bottom panel). Counts per minute (CPM) was normalized against protein mass. Two-way ANOVA with Tukey's multiple comparisons test was applied. (C) Immunoblotting analysis of lipogenic enzymes. Cells were treated with GLPG1690 (6 µM), rapamycin (20 nM) or the combination of the two for 72 hr. (D) RT-qPCR analysis of genes involved in lipid synthesis. Cells were treated with vehicle

(DMSO) or GLPG1690 (6 µM) for 24 or 72 hr. One-way ANOVA with Tukey's multiple comparisons test was applied. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001

Figure 6. GLPG1690 inhibits the proliferation of Tsc2-/- MEFs in vivo. (A) GLPG1690 reduces TSC tumor burden. Mice were treated with GLPG1690 (60 mg/kg/d; n = 15) or vehicle

(n=18) intraperitoneally (i.p.) for 30 days. Treatment reduced tumor volume by ~40% (Mann-

Whitney test was applied). (B) GLPG1690 did not affect mouse body weight. (C) Hematoxylin and eosin (H&E) of representative tumors treated with vehicle (top panel) or GLPG1690 (bottom panel). (D) GLPG1690 decreased lipid droplets and induced endoplasmic reticulum inflation in

Tsc2-/- tumors shown by electron microscopy. N: nucleus; LD: lipid droplet; ER: endoplasmic

reticulum. (E) GLPG1690 selectively decreased BrdU incorporation in Tsc2-/- MEFs in vitro.

Cells were incubated with GLPG1690 (3 µM) or vehicle (DMSO) for 68 hr in DMEM with 10%

FBS and flow cytometry was performed. Multiple t tests was applied. (F) GLPG1690 suppressed

BrdU incorporation in Tsc2-/- tumors. BrdU was injected intraperitoneally 4 hr before harvesting the tumors. Immunohistochemistry with BrdU antibody showed 38% reduction in BrdU+ cells

with GLPG1690 treatment (Mann-Whitney test was applied). (G) Working model of the impact

of ATX inhibition on TSC tumor cells.

* p < 0.05, ** p < 0.01

Therapeutic targeting of the secreted lysophospholipase D autotaxin suppresses tuberous sclerosis complex-associated tumorigenesis

You Feng, William J Mischler, Ashish C Gurung, et al.

Cancer Res Published OnlineFirst May 11, 2020.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-19-2884

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2020/05/09/0008-5472.CAN-19-2884.DC1

Author Author manuscripts have been peer reviewed and accepted for publication but have not yet been Manuscript edited.

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/early/2020/05/09/0008-5472.CAN-19-2884. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.