Fluvastatin Inhibits HMG-Coa Reductase and Prevents Non

Published OnlineFirst September 25, 2019; DOI: 10.1158/1940-6207.CAPR-19-0211

Research Article Cancer Prevention Research Fluvastatin Inhibits HMG-CoA Reductase and Prevents Non–Small Cell Lung Carcinogenesis Tianshun Zhang1, Ruihua Bai1,2, Qiushi Wang1, Keke Wang1,3, Xiang Li3, Kangdong Liu3, Joohyun Ryu1, Ting Wang1,3, Xiaoyu Chang1, Weiya Ma1, Ann M. Bode1, Qingxin Xia2, Yongping Song2, and Zigang Dong1,3

Abstract

Lung cancer is the leading cause of cancer-related growth and induced apoptosis in vitro and in vivo. Fur- death worldwide. However, promising agents for lung thermore, we found that fluvastatin, an inhibitor of cancer prevention are still very limited. Identification of HMGCR, suppressed NSCLC cell growth and induced preventive targets and novel effective preventive agents apoptosis. Intriguingly, fluvastastin functions by is urgently needed for clinical applications. In this inhibiting the HMGCR-driven Braf/MEK/ERK1/2 and study, we found that fluvastatin targeted 3-Hydroxy- Akt signaling pathways. Notably, fluvastatin attenua- 3-methylglutaryl coenzyme A (HMG-CoA) reductase ted tumor growth in 4-(methylnitrosamino)-1-(3- (HMGCR), which a rate-limiting enzyme in the meva- pyridyl)-1-butanone (NNK)-induced lung tumorigen- lonate pathway, and inhibited non–small cell lung esis and in a patient-derived xenograft lung tumor cancer (NSCLC) tumorigenesis. Initially, we demon- model. Overall, our findings suggest that fluvastatin strated that HMGCR is overexpressed in human lung might be promising chemopreventive or potential ther- adenocarcinoma tissues compared with normal tissues. apeutic drug against NSCLC tumorigenesis, providing Knockdown of HMGCR in NSCLC cells attenuated hope for rapid clinical translation.

Introduction preventive targets and novel effective preventive agents is still urgently needed for clinical applications. Lung cancer is the leading cause of cancer-related death 3-Hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) worldwide. Non–small cell lung cancer (NSCLC) is the reductase (HMGCR) is the rate-limiting enzyme for cho- major type of lung cancer and the overall 5-year survival lesterol synthesis in the conversion of HMG-CoA to meva- rate in patients diagnosed from 2008 to 2014 was only lonate (4, 5). Recently, an increasing number of reports 19% (1). Current strategies in the treatment of NSCLC demonstrated the oncogenic roles of HMGCR in several include surgery, radiation therapy, chemotherapy, and cancer types, including breast (6–8), colorectal (9), gas- immunotherapy and now multiple targeted therapies are tric (10), and ovarian (11). However, the function of approved for use against NSCLC. These treatments dem- HMGCR in lung tumorigenesis is still not well addressed onstrated effectiveness in first- and second-line thera- and thus, merits further study. Statins are HMGCR inhi- pies (2, 3). However, promising agents for NSCLC preven- bitors used to decrease serum cholesterol levels aimed at tion were still limited. Therefore, identification of novel reducing the incidence of cardiovascular and cerebrovas- cular disorders (4). Several bench study and clinical trial results suggested that statins might be potential agents – 1The Hormel Institute, University of Minnesota, Austin, Minnesota. 2Affiliated for cancer prevention or treatment (6, 8, 12 14). Fluvas- Cancer Hospital of Zhengzhou University, Zhengzhou, Henan, China. 3China-US tatin is the first entirely synthetic HMGCR inhibitor and (Henan) Hormel Cancer Institute, Zhengzhou, Henan, China. has been reported to reduce cancer development and Note: Supplementary data for this article are available at Cancer Prevention metastasis (15–17). A recent study revealed that fluvastatin Research Online (http://cancerprevres.aacrjournals.org/). effectively prevented lung adenocarcinoma bone metasta- T. Zhang, R. Bai, Q. Wang, and K. Wang contributed equally to this article. sis in a nude mouse model (18). The Braf/MEK/ERK1/2 Corresponding Author: Zigang Dong, University of Minnesota, 801 16th Avenue and phosphatidylinositol 3-kinase (PI3-K)/Akt signaling NE, Austin, MN 55912-3679. Phone: 507-437-9600; Fax: 507-437-9606; E-mail: cascades are known to mediate cell proliferation and [email protected] apoptosis, and have been implicated in the development Cancer Prev Res 2019;12:1–12 of many types of cancer, including lung cancer (19–23). It doi: 10.1158/1940-6207.CAPR-19-0211 is well reported that cholesterol activates Braf/MEK/ERK1/ 2019 American Association for Cancer Research. 2 and AKT pathways (24–27). Inhibition of the activation

www.aacrjournals.org OF1

Downloaded from cancerpreventionresearch.aacrjournals.org on September 25, 2021. © 2019 American Association for Cancer Research. Published OnlineFirst September 25, 2019; DOI: 10.1158/1940-6207.CAPR-19-0211

Zhang et al.

of these signaling pathways holds promise for the man- and to verify the identity of the cells by short tandem repeat agement of lung cancer. profiling before being frozen. Each vial was thawed and Tobacco smoking and second-hand smoke exposure are maintained for a maximum of 2 months. Enough frozen responsible for the majority of lung cancer cases (28). 4- vials of each cell line were available to ensure that all cell- (Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) based experiments were conducted on cells that had been has a significant association with lung cancer. Experimen- tested and were in culture for 8 weeks or less. Cells were tally, lung tumors can be readily induced in A/J mice by cultured at 37 C in a 5% CO2 humidified incubator NNK (29). Activation of the MAPK and PI3-K/Akt path- following the ATCC protocols. MRC5 human normal lung ways is known to play a key role in malignant transfor- fibroblasts were grown in Eagle minimum essential medi- mation in the NNK-induced lung carcinogenesis mouse um with 10% FBS and 1% antibiotics (Gen DEPOT). A549 model (30, 31). Patient-derived xenograft (PDX) models human lung cancer cells were cultured with F-12K medium are based on the transfer of primary tumors directly from containing 10% FBS and 1% antibiotics. NL20 cells were the human patient into an immunodeficient mouse to cultured with F12K with 1.5 g/L sodium bicarbonate, 2.7 g/ mimic the development of human tumors in mouse mod- L glucose, 2.0 mmol/L L-glutamine, 0.1 mmol/L nones- els (32). For preclinical studies, these mouse models offer sential amino acids, 0.005 mg/mL insulin, 10 ng/mL EGF, tools for developing agents for cancer prevention or 0.001 mg/mL transferrin, 500 ng/mL hydrocortisone, and treatment. 4% FBS. All other human lung cancer cells were grown in In this study, we investigated the oncogenic function of RPMI1640 medium supplemented with 10% FBS and 1% HMGCR in vitro and in vivo. Then we examined the effect of antibiotics. HEK293T cells (stably expressing the SV40 fluvastatin, an HMGCR inhibitor, on lung tumorigenesis. In large T antigen in HER293 cells) were purchased from the addition, we investigated the mechanism of action for ATCC and cultured in DMEM (Corning) supplemented HMGCR and its inhibitor, fluvastatin, in lung tumorigenesis. with 10% FBS (Corning) and 1% penicillin–streptomycin. Subsequently, we examined the anticancer effects of fluvastatin by using NNK-induced lung tumorigenesis and lung Lentiviral infection PDX mouse models. Our findings suggested that fluvastatin To generate knockdown HMGCR cells, the lentiviral might be a potential drug for lung cancer prevention. expression vector of HMGCR (shHMGCR) or pLKO.1- puro nontarget shRNA control plasmid DNA (shCon) and packaging vectors (pMD2.0G and psPAX) were Materials and Methods transfected into HEK293T cells using the iMfectin Poly Reagents and antibodies DNA Transfection Reagent (GenDEPOT) following the Cell culture media, gentamicin, penicillin, and L-gluta- manufacturer's suggested protocols. The lentivirus plas- mine were all obtained from Invitrogen. FBS was from mids for shHMGCR (#1, TRCN0000046448; CCGGGC Gemini Bio-Products. Tris, NaCl, and SDS for molecular AGTGATAAAGGAGGCATTTCTCGAGAAATGCCTCCTTT biology and buffer preparation were purchased from Sig- ATCACTGCTTTTTG; and #2, TRCN0000046450; CCG ma-Aldrich. The HMGCR plasmid (catalog no. 86085) was GGCTATGATTGAGGTCAACATT CTCGAGAATGTTGAC obtained from Addgene. The Mock plasmid (pCMV- CTCAATCATAGCTTTTTG) were purchased from Univer- SPORT6) was obtained from DF/HCC DNA Resource Core sity of Minnesota Genomics Center (University of Min- (Harvard Medical School, Boston, MA). Antibodies to nesota,Minneapolis,MN).Thetransfectionmixin10% detect HMGCR (sc-271595), b-actin (sc-47778), Braf FBS/DMEM without antibiotics was incubated with cells (sc-166), GAPDH (sc-25778), caspase 3 (sc-7272), and for 12 hours, and then 10 mL of fresh medium with Bcl-2 (sc-7382) were from Santa Cruz Biotechnology, Inc. antibiotics (penicillin/streptomycin) were added. Viral p-Braf (catalog no. 2696), p-MEK (catalog no. 9121), MEK supernatant fractions were collected at 48 hours and (catalog no. 9122), p-ERK1/2 (catalog no. 9101), ERK1/2 filtered through a 0.45-mm syringe filter followed by (catalog no. 9102), p-Akt (catalog no. 9271), Akt (catalog infection into the appropriate cells together with no. 9272), cleaved-caspase-3 (catalog no. 9661), PARP 8 mg/mL polybrene (Millipore). After overnight infec- (catalog no. 9542), cleaved-PARP (catalog no. 9541), and tion, the medium was replaced with fresh complete Bax (catalog no. 2772) antibodies were purchased from growth medium containing the appropriate concentra- Cell Signaling Technology. Fluvastatin sodium salt hydrate tion of 1.5 mg/mL puromycin and cells were incubated was purchased from TCI America, lovastatin, simvastatin, for an additional 24 hours. The selected cells were used and atorvastatin were purchased from Cayman Chemical, for experiments. and NNK (sc-209854) was obtained from Santa Cruz Biotechnology. Anchorage-independent cell growth assay Cells (8 103/well) were seeded into 6-well plates with Cell culture and transfection 0.3% Basal Medium Eagle agar containing 10% FBS and All cells were purchased from ATCC. The cells were different concentrations of fluvastatin and then cultured routinely screened to confirm Mycoplasma-negative status for 1–2 weeks. Colonies were scored under a microscope

OF2 Cancer Prev Res; 12(11) November 2019 Cancer Prevention Research

Targeting HMGCR Suppresses Lung Carcinogenesis

using the Image-Pro PLUS (v6.) computer software pro- graphics and baseline characteristics are shown in Supple- gram (Media Cybernetics). mentary Table S1. HMGCR (sc-271595) antibody was diluted into 10% goat serum (1:50). A Vectastain Elite MTS assay ABC Kit obtained from Vector Laboratories was used for MRC5 normal lung cells (1 104 cells/well) were seeded IHC staining according to the protocol recommended by into 96-well plates for determining cytotoxicity of fluvas- the manufacturer. Mouse lung tissues were embedded in tatin. After an overnight incubation, cells were treated with paraffin for examination. Sections were stained with hema- different concentrations (5, 10, 20, or 40 mmol/L) of toxylin and eosin (H & E) and analyzed by IHC. Briefly, all fluvastatin or DMSO vehicle control and incubated for specimens were deparaffinized and rehydrated. To expose 24 or 48 hours. Then, 20 mL of the CellTiter 96 Aqueous antigens, samples were unmasked by submerging each into One Solution (Promega) was added to each well and cells boiling sodium citrate buffer (10 mmol/L, pH 6.0) for were then incubated for an additional 1 hour at 37 C. 10 minutes, and then treated with 3% H2O2 for 10 min- Absorbance was measured at an optical density of 492 nm utes. Each slide was blocked with 10% goat serum albumin using the Thermo Multiskan Plate-Reader (Thermo Fisher in 1 PBS in a humidified chamber for 1 hour at room Scientific). temperature. Then, slides were incubated with proliferat- ing cell nuclear antigen (PCNA; 1:3,000) and other pri- Crystal violet staining assay mary antibodies (1:50) at 4C in a humidified chamber Cell proliferation was determined by a crystal violet overnight. The slides were washed and hybridized with a 4 staining assay. Cells (3 10 /well) were seeded into 24- secondary antibody from Vector Laboratories (anti-rabbit well plates. After an overnight incubation, cells were trea- 1:150 or anti-mouse 1:150) for 1 hour at room tempera- ted with different concentrations of fluvastatin and incu- ture. Slides were stained using the Vectastain Elite ABC kit. bated for 3 days. Then, each well was washed three times After developing with 3,30-diaminobenzidine, the sections with PBS and stained with 0.2% (w/v) crystal violet in 2% were counterstained with hematoxylin and observed in the (v/v) ethanol. After 10 minutes, cells were washed three microscope, and then the integrated optical density (IOD) times with distilled water, and the remaining dye was value was analyzed from three different field of tumor dissolved in 0.5% (w/v) SDS in 50% (v/v) ethanol. Absor- tissues using the Image-Pro PLUS (v.6) computer software bance was measured at an optical density of 540 nm using program (Media Cybernetics, Inc.) following the manu- the Thermo Multiskan plate-reader. facturer's protocol.

Flow cytometry for analysis of apoptosis For analysis of apoptosis, H441 and A549 lung cancer Mouse xenograft model cells (2.5 105/well) expressing shCon or shHMGCR were Athymic nude mice (6–7 weeks, female) were obtained seeded into 60-mm dishes overnight and then treated with from Charles River Laboratories and maintained under fluvastatin for 48 hours. Cells were trypsinized and washed specific pathogen-free conditions. Mice were divided into twice with cold PBS and then resuspended with PBS and three groups (n ¼ 8miceineachgroup)andshConor 6 incubated for 5 minutes at room temperature with annexin shHMGCR H441 lung cancer cells (2 10 /0.1 mL) were V-FITC plus propidium iodide. Cells were analyzed using a injected subcutaneously into the right flank of each FACSCalibur Flow Cytometer (BD BioSciences). mouse. Body weights and tumor measurements were performed once a week and tumor volume was calculated Western blot analysis on the basis of the formula: length width width Equal amounts of protein were determined using a 0.52. At the end of the experiment, mice were euthanized, Protein Assay Kit (Bio-Rad Laboratories). Lysates were and tumors were harvested and fixed in formalin for resolved by SDS-PAGE and then transferred onto polyvi- further analysis. All animal studies were performed fol- nylidene difluoride membranes (EMD Millipore) and lowing the guidelines approved by the University of blocked with 5% nonfat milk for 1 hour at room temper- Minnesota Institutional AnimalCareandUseCommittee ature. Blots were probed with appropriate primary (protocol ID: 1803-35739A). The tumor tissues were antibodies (1:1,000) overnight at 4C and followed by fixed and embedded in paraffin for histologic analysis incubation with a horseradish peroxidase–conjugated sec- and IHC staining. The IOD value was analyzed from three ondary antibody (1:5,000) for hybridization. Protein different fields of each tumor tissue using the Image-Pro bands were visualized with a chemiluminescence reagent PLUS (v.6) computer software program following the (GE Healthcare Biosciences). manufacturer's protocol. Eight mice and 24 pictures were subjected to analysis per group. IHC analysis of a tissue array and mouse lung tissues Human lung tissue samples were obtained from the NNK-induced mouse lung tumorigenesis study Affiliated Cancer Hospital of Zhengzhou University. The A/J mice (6–8 weeks, male) were obtained from samples are archived pathology samples, and demo- Jackson Laboratory. All animal procedures were

www.aacrjournals.org Cancer Prev Res; 12(11) November 2019 OF3

Zhang et al.

performed following guidelines approved by the Uni- volume was calculated on the basis of the formula: versity of Minnesota Institutional Animal Care and Use length width width 0.52. At the end of the Committee (protocol ID: 1709-35106A). Mice were experiment, mice were euthanized prior to removal of housed in climate-controlled quarters with a 12-hour tumors for further analysis. light/12-hour dark cycle and allowed full access to food and water. After being acclimated for 1 week, mice were Statistical analysis randomized into four groups of 14 mice each. The body All quantitative data are expressed as mean values SD weights of the mice were measured weekly. For the or SE of at least three independent experiments or samples. tumorigenesis studies, mice in the negative control Significant differences were determined by one-way group were given PBS, all other mice received a single ANOVA (Dunnett test). The data fits normal distribution dose of NNK in PBS (100 mL) at 100 mg/kg of body and was determined by using Kolmogorov–Smirnov test. A weight by intraperitoneal injection once a week for probability value of P < 0.05 was used as the criterion for 3 weeks. From the week following the last dose of NNK, statistical significance. the mice were administered vehicle only or 15 mg/kg or fl þ 75 mg/kg uvastatin (dissolved in a 5% PGE400 5% Results Tween80 solution þ 2.5% DMSO) by oral gavage every day for 27 weeks. At the end of treatment, mice were HMGCR is highly expressed in lung cancer tissues and euthanized and the tissues were fixed and embedded in cell lines paraffin for histologic analysis and IHC staining. NSCLC is the most common type of all lung cancers and numerous oncogenes are associated with this dis- Mass spectrometry analysis ease. Initially, we determined the protein expression Mass spectrometry analysis was performed using a level of HMGCR in human lung cancer tissues and lung SCIEX TripleTOF5600 coupled with a DuoSpray ion cancer cell lines. Results indicated that increased expres- source. The fluvastatin and simvastatin (internal standard) sion of HMGCR occurred both in NSCLC tissues and in mouse plasma samples were directly infused into the ion several human NSCLC cell lines compared with normal source at a flow rate of 5 mL/mL and acquired 30 scan from tissues or normal NL20 and MRC5 lung cells (Fig. 1A m/z 100 to m/z 1,000 in positive product ion mode. The and B). quantification was performed with manual transitions of m/z 412.2!224.1 for fluvastatin and m/z 436.3!285.2 Knockdown of HMGCR inhibits lung cancer cell growth for simvastatin. Compound-dependent parameters for by mediating Braf/MEK/ERK1/2 and Akt activation manual transition were set as follow: DP, 130 and CE, To investigate the function of HMGCR in lung cancer, we 10!30 for fluvastatin; DP, 100 and CE, 5!20 for simva- generated stable knockdown of HMGCR in H441 statin. The main working parameters for mass spectrom- and A549 lung cancer cells and measured anchorage- etry analysis were set as follows: gas1, 20 psi; gas2, 20 psi, independent growth. Results showed that knocking down curtain gas3, 30 psi, ion source temperature, 500; ionspray HMGCR expression suppressed anchorage-independent voltage, 5.5 kV. growth of H441 and A549 lung cancer cells (Fig. 1C). The The levels of fluvastatin and simvastatin in plasma were MAPK and Akt signaling cascades are well-known survival determined using peak intensity of transition ions in SCIEX pathways involved in the regulation of cell growth, tumor- AnalystTF software. igenesis, and apoptosis. Our results showed that knocking down HMGCR expression inhibited phosphorylation of PDX mouse model Braf/MEK/ERK1/2 and Akt in both H441 and A549 lung The lung tumor (adenocarcinoma, grade 2; stage I) was cancer cells (Fig. 1D). obtained from the patient of Henan Cancer Hospital. The lung tumor tissue fragments (2–3mm)were Knockdown of HMGCR induces apoptosis of lung cancer implanted into SCID mice. This study followed a pro- cells tocol that was approved by the Zhengzhou University Annexin-V FITC staining was used to determine whether Institutional Animal Care and Use Committee. After HMGCR functions in the induction of apoptosis in lung tumor implantation, when the tumors reached around cancer cells. The data showed that knocking down HMGCR 100 mm3, mice were randomly divided into four groups induced apoptosis in H441 and A549 lung cancer cells (n ¼ 8 mice per group). The groups were: (i) vehicle (5% (Supplementary Fig. S1A and S1B). Western blotting was PGE400 þ 5% Tween80 solution þ 2.5% DMSO) con- used to examine changes in apoptosis-related protein trol; (ii) 3 mg/kg fluvastatin; (iii) 15 mg/kg fluvastatin; expression. Results showed a substantial reduction in the and (iv) 75 mg/kg fluvastatin. Mice were administered antiapoptotic protein, Bcl-2, and marked increases in the drug or vehicle by oral gavage daily. Body weight and proapoptotic proteins BAX, cleaved caspase 3, and cleaved tumor volume were measured once a week and tumor PARP (Supplementary Fig. S1C).

OF4 Cancer Prev Res; 12(11) November 2019 Cancer Prevention Research

Targeting HMGCR Suppresses Lung Carcinogenesis

Figure 1. HMGCR expression is upregulated in human lung cancer and HMGCR mediates lung adenocarcinoma cancer cell growth associated with Braf/MEK/ERK1/2 and Akt activation. A, IHC analysis of HMGCR protein expression in normal and lung cancer tissues. Detection of HMGCR protein levels was accomplished using DAB (brown) staining and nuclei were counterstained with hematoxylin (blue; left). Density scores were obtained from each sample and statistical signiﬁcance was determined by one-way ANOVA (P < 0.001; right). Tissues include normal (n ¼ 14) and adenocarcinomas (n ¼ 48) and the scale bar, 100 mm. B, Expression of HMGCR in human lung normal and cancer cell lines. C, H441 and A549 lung cancer cells with stable knockdown of HMGCR were established. H441 and A549 cells stably expressing shCon (control) or shHMGCR were incubated in 1.25% agar. Colonies were counted using a microscope and the Image- Pro Plus (v.6) computer software program. For C, data are presented as mean values SD from triplicate experiments. Statistical differences were evaluated using one-way ANOVA (Dunnett test). The asterisks indicate a signiﬁcant difference between HMGCR knockdown and shCon cells (, P < 0.001). D, Knockdown of HMGCR in H441 and A549 lung cancer cells. Western blotting was conducted to examine the expression of HMGCR and Braf/MEK/ERK1/2 and Akt activation.

Knockdown of HMGCR expression suppresses tumor 2.5 mm3 at day 7 to 100.5 12.0 mm3 and 129.5 22.7 growth in a xenograft mouse model mm3 at day 42, respectively. IHC data showed that the To further study the function of HMGCR, we performed proliferation-associated protein, PCNA, and the apopto- an in vivo xenograft mouse model experiment. Athymic sis-associated protein Bcl-2 were substantially inhibited nude mice were injected with H441 cells expressing in cells expressing shHMGCR compared with shCon. In control (shCon) or knockdown of HMGCR. Results addition, the expression level of p-ERK1/2 and p-Akt was showed that knockdown of HMGCR signiﬁcantly sup- also decreased in the shHMGCR groups compared with pressed tumor size and weight in the H441 cell xenograft the control (shCon) group (Fig. 2D). These results suggest mouse model (Fig. 2A–C). The tumor volume in control that attenuated expression of HMGCR signiﬁcantly group was from 82.1 1.6 mm3 at day 7 to 673.3 138.6 reduces the tumorigenic properties of lung cancer and mm3 at day 42, while the tumor volume in HMGCR- that targeting HMGCR might hold promise for lung knockdown group was from 78.7 1.3 mm3 and 84.7 cancer treatment.

www.aacrjournals.org Cancer Prev Res; 12(11) November 2019 OF5

Zhang et al.

Figure 2. Knockdown of HMGCR decreases tumor growth in a xenograft mouse model. A, Photos of tumors from a lung xenograft model. Tumor volume was measured every week (B) and at 42 days, tumor weight was measured (C). D, The expression of PCNA, Bcl-2, p-ERK1/2, and pAkt was detected by using IHC staining, the scale bar, 100 mm. For B–D, data are presented as mean values SE. For D, density scores were obtained for each sample and statistical signiﬁcance was determined by one-way ANOVA (Dunnett test). The asterisks indicate a signiﬁcant difference compared with the shCon group (, P < 0.05; , P < 0.01; , P < 0.001).

OF6 Cancer Prev Res; 12(11) November 2019 Cancer Prevention Research

Targeting HMGCR Suppresses Lung Carcinogenesis

Statin targeting HMGCR inhibits cell growth and induces the untreated group (Fig. 3A and B). The fluvastatin apoptosis in lung cancer cells and inhibits cell growth in decreased the tumor number by 31.9% and 53.5%, HMGCR-overexpressed NL20 cells respectively, in a dose-dependent manner. In addition, On the basis of the previous results, we determined no significant changes were observed in the weight of whether the drug fluvastatin, which is known to inhibit mouse liver or spleen between the NNK groups treated HMGCR, has any effect on human lung cancer cell with fluvastatin (Fig. 3C and D). However, we found growth. To determine whether fluvastatin exerted any that NNK treatment decreased liver weight compared cytotoxic effects against normal lung cells, normal with vehicle-treated group (Fig. 3D) and high dose MRC5 cells initially were treated with different concen- fluvastatin treatment decreased the mouse body weight trations of fluvastatin for 24, 48 or 72 hours. The results (Supplementary Fig. S5). Then, mass spectrometry anal- showed that fluvastatin had no cytotoxicity at concen- ysiswasconductedtodetectthefluvastatininmouse trations less than 40 mmol/L (Supplementary Fig. S2). plasma. We found 8.13 2.40 and 13.22 2.10 mmol/L Then, we examined the effects of fluvastatin on H441 fluvastatin in NNK þ low fluvastatin treatment group and A549 lung cancer cell growth and the results showed and NNK þ high fluvastatin treatment group, respec- that fluvastatin effectively inhibited H441 and A549 tively (Supplementary Figs. S6 and S7). Importantly, lung cancer cell growth in a dose-dependent manner IHC analysis showed that the expression levels of PCNA, (Supplementary Fig. S2B and S2C). Fluvastatin also Bcl-2, p-ERK1/2, and p-Akt were substantially reduced significantly enhanced apoptosis in H441 lung cancer in both fluvastatin-treated groups compared with the cells and increased the level of cleaved-PARP, cleaved vehicle group with NNK treatment (Fig. 3E). These data caspase 3, and Bax, and decreased the expression of Bcl- provided evidence showing that fluvastatin exerts a 2 (Supplementary Fig. S2D and S2E). Furthermore, the preventive effect against NNK-induced mouse lung car- level of phosphorylated Braf, MEK, ERK1/2, and Akt was cinogenesis by targeting HMGCR. markedly suppressed in a dose-dependent manner with fluvastatin treatment (Supplementary Fig. S2F). Then we Fluvastatin suppresses tumor growth in a lung cancer used lovastatin, simvastatin, and atorvastatin to make PDX mouse model sure that the effect was more generalizable. The results In preclinical studies, PDX mouse models offer a tool showed that lovastatin, simvastatin, and atorvastatin to examine the function of anticancer agents for inhibited H441 and A549 lung cancer cells growth. patients with cancer. We conducted PDX experiments Meanwhile, they also suppressed the activation of with lung tumor tissues collected from a patient with ERK1/2 and Akt (Supplementary Fig. S3). On the basis lung cancer to investigate the effectiveness of fluvastatin of these results and compared with the results from in preventing tumor growth. The results showed that Supplementary Fig. S2, fluvastatin is the most efficient fluvastatin at 75 mg/kg, but not at 3 or 15 mg/kg of statin inhibiting lung cancer cells' growth without tox- body weight, significantly inhibited PDX tumor growth icity. In addition, we overexpressed HMGCR in normal compared with the vehicle-treated group (Fig. 4A–C). In lung cells NL20. The results showed that HMGCR over- addition, fluvastatin did not significantly change the expression enhanced NL20 cells growth. Importantly, body weight under the experimental conditions. fluvastatin suppressed the growth of HMGCR- (Fig.4D).Importantly,treatmentwithfluvastatin at overexpressed NL20 cells in a dose-dependent manner 75 mg/kg of body weight substantially suppressed (Supplementary Fig. S4). Then, we evaluated the effects PCNA,HMGCR,p-ERK1/2,andp-Aktexpression of fluvastatin on lung tumorigenesis in NNK-induced (Fig. 4E). Overall, these results illustrated that fluvas- lung cancer and PDX mouse models. tatin is a promising potential anticancer agent against lung tumorigenesis. Fluvastatin prevents NNK-induced lung tumorigenesis in A/J mice To further investigate the chemopreventive effect of Discussion fluvastatin on lung cancer development, we conducted Lung cancer is the leading cause of cancer-related death an in vivo experiment using an NNK-induced mouse worldwide. In 2019, an estimated 228,150 new cases of lung tumorigenesis model. Groups included a control lung and bronchial cancer will be diagnosed and 142,670 vehicle group (no NNK treatment) and three groups in deaths will occur in the United State (1). The promising which NNK was used to induce lung cancer. Two groups agents for preventing lung cancer are needed for clinical were treated with fluvastatin (15 or 75 mg/kg body applications. In this study, we first demonstrated the weight) and one group was untreated. Our results clear- oncogenic function of HMGCR in NSCLC. We then con- ly showed that administration of fluvastatin at either 15 ducted experiments to examine fluvastatin, the known or 75 mg/kg of body weight dose dependently decreased HMGCR inhibitor, could be a potential preventive drug NNK-induced tumor number in lungs compared with which affects NSCLC development.

www.aacrjournals.org Cancer Prev Res; 12(11) November 2019 OF7

Zhang et al.

Figure 3. Fluvastatin inhibits NNK-induced lung carcinogenesis. A/J mice was intraperitoneally administered NNK (100 mg/kg of body weight) weekly for 3 weeks. From the week following the last dose of NNK, the mice were daily treated with vehicle (5% PGE400 þ 5% Tween80 solution þ 2.5% DMSO), 15 mg/kg, or 75 mg/kg fluvastatin by oral gavage for 27 weeks. A and B, Fluvastatin decreased NNK-induced tumor multiplicity. C and D, The weight of spleen and liver between treatment groups. E, Lung samples were harvested and stained with H & E, the scale bar, 100 mm. IHC analysis was used to determine the levels of HMGCR, PCNA, Bcl-2, p-ERK1/2, and p-Akt in lungs from fluvastatin-treated mice compared with those treated with vehicle, the scale bar, 400 mm. Data for B–E are presented as mean values SE. Statistical significance was determined by one-way ANOVA (Dunnett test) and the asterisks indicate a significant change compared with compared with the vehicle group with NNK treatment (, P < 0.05; , P < 0.01; , P < 0.001).

OF8 Cancer Prev Res; 12(11) November 2019 Cancer Prevention Research

Targeting HMGCR Suppresses Lung Carcinogenesis

Figure 4. Fluvastatin inhibits lung tumor growth in a PDX mouse model. Lung adenocarcinoma (Henan Cancer Hospital) fragments (2–3 mm) were implanted into SCID mice. Mice were treated with fluvastatin or vehicle (5% PGE400 þ 5% Tween80 solution þ 2.5% DMSO) by oral gavage. A–C, Fluvastatin at 75 mg/kg of body weight markedly decreased tumor size and tumor weight. D, Effect of fluvastatin on body weight of mice. E, Lung tumors were harvested and stained for IHC analysis. The levels of PCNA, HMGCR, p-ERK1/2, and p-Akt were determined from fluvastatin-treated mice and compared with those treated with vehicle, the scale bar, 400 mm. For B–E, data are presented as mean values SE. For E, density scores were obtained from each sample and statistical significance was determined by one-way ANOVA (Dunnett test). For B–E, the asterisks indicate a significant decrease compared with untreated controls (, P < 0.05; , P < 0.01; , P < 0.001).

www.aacrjournals.org Cancer Prev Res; 12(11) November 2019 OF9

Zhang et al.

A number of reports have supported an oncogenic that fluvastatin inhibition of HMGCR is a potential role of HMGCR in several cancer types. HMGCR target for NSCLC therapy and prevention. However, the enhanced the transformation of normal breast cells and side effects of fluvastatin need to be considered for its contributed to MCF-7 cell growth, which was associated widespread use. Our animal study also showed fluvas- with the short survival of some patients with breast tatin reduced the mice body weight (Supplementary cancer (33). In addition, targeting HMGCR in colorectal Fig. S5). It is known that fluvastatin might bring mus- and ovarian cancers reduced tumorigenesis and metas- cular side effects (43). Thus, we recommend that people tasis in cell- and animal-based studies (11, 34). Recent- with unexplained muscle pain or weakness who are ly, targeting HMGCR was reported to effectively prevent taking statins should be referred to the appropriate lung adenocarcinoma bone metastasis in a nude mouse physician and that intense exercise should be avoided model (18). Our study clearly demonstrated that until the cause of the muscle symptoms is determined. HMGCR is not only highly expressed in lung adenocar- Although fluvastatin has these side effects, it is still one cinoma but also plays an important role in lung NSCLC of the efficient drugs used to treat hypercholesterolemia cell growth and apoptosis (Figs. 1 and 2; Supplementary and to prevent cardiovascular disease. Our findings Fig. S1), which further highlighted the functions of suggested that fluvastatin might be a potential drug for HMGCR in the progression of malignancies. Intriguing- lung cancer prevention, providing hope for clinical ly, our results showed that HMGCR mediates lung translation. In conclusion, we suggest that HMGCR adenocarcinoma tumorigenesis through the activation is a potential target for prevention of NSCLC, acting of Braf/MEK/ERK1/2 and Akt (Fig. 1). HMGCR might by inhibiting cell growth and inducing apoptosis perform its carcinogenic function by promoting the by reducing the activation of the Braf/MEK/ERK1/2 and synthesis of lipid isoprene intermediates, including far- Akt pathways. Furthermore, we demonstrated that nesyl pyrophosphate (FPP) and geranylgeranyl pyro- fluvastatin inhibits NSCLC development in vitro and phosphate (GGPP; ref. 35). Typically, FPP drives acti- in vivo.Thesefindings provide hope for rapid clinical vation of the Ras GTPase family, whereas GGPP activates translation. the Rho/Rac family by prenylation and anchors them to the cell membrane (36). The Ras GTPase family and Disclosure of Potential Conflicts of Interest Rho/Rac family are known to be responsible for many No potential conflicts of interest were disclosed. signaling processes. Activated Ras recruits serine/threo- nine kinases of the RAF family to the plasma membrane Authors' Contributions and constitutively triggers the Braf/MEK/ERK1/2 (37) Conception and design: T. Zhang, Q. Wang, Z. Dong and PI3-K pathways (38). The Rho/Rac family also Development of methodology: T. Zhang interacts with the ERK1/2 and Akt signaling pathways Acquisition of data (provided animals, acquired and managed to promote cancer cell growth (39, 40). Overall, these patients, provided facilities, etc.): T. Zhang, Q. Wang, K. Wang, fi X. Li, K. Liu, X. Chang ndings indicate that HMGCR is a candidate target for Analysis and interpretation of data (e.g., statistical analysis, lung cancer treatment and prevention. biostatistics, computational analysis): T. Zhang, R. Bai, Q. Wang, Fluvastatin, a member of the group of drugs known as K. Wang, J. Ryu, X. Chang, A.M. Bode, Q. Xia, Y. Song HMGCR inhibitors, is generally used in the treatment of Writing, review, and/or revision of the manuscript: T. Zhang, R. Bai, patients with hypercholesterolemia (41). Notably, flu- Q. Wang, J. Ryu, A.M. Bode, Z. Dong vastatin reduced development and metastasis of several Administrative, technical, or material support (i.e., reporting or cancers, including breast (15), renal (16), and ovari- organizing data, constructing databases): T. Zhang, R. Bai, K. Wang, T. Wang, W. Ma, Q. Xia, Z. Dong an (17). The epidemiologic study demonstrated the Study supervision: Q. Xia, Y. Song, Z. Dong beneficial effects of long-standing statin use on lowering riskforlungcancer(42).Ourresultsclearlyshowedthat Acknowledgments fluvastatin inhibited lung cancer cell growth and The authors thank Todd Schuster for supporting the experiments, induced apoptosis of lung cancer cells. In addition, Tara Adams for supporting animal experiments, and Becky Earl for lovastatin, simvastatin, and atorvastatin also inhibited assistance in submitting our article (The Hormel Institute, University lung cancer cells growth, but the inhibitory efficiency of Minnesota, Minneapolis, MN). This work was supported by the waslessthanfluvastatin (Supplementary Figs. S2 and Hormel Foundation (to Z. Dong). S3). The NNK-induced lung cancer mouse model and lung cancer PDX mouse model offer opportunities for The costs of publication of this article were defrayed in part by the fl payment of page charges. This article must therefore be hereby marked testing the anticancer effects of uvastatin. Importantly, advertisement in accordance with 18 U.S.C. Section 1734 solely to fluvastatin prevented NNK-induced lung adenocarcino- indicate this fact. ma development; and a significant inhibitory effect was also observed in the lung cancer PDX mouse model Received April 23, 2019; revised August 6, 2019; accepted Septem- (Figs. 3 and 4). On the basis of our results, we believe ber 18, 2019; published first September 25, 2019.

OF10 Cancer Prev Res; 12(11) November 2019 Cancer Prevention Research

Targeting HMGCR Suppresses Lung Carcinogenesis

References 1. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2019. CA Cancer J 20. See WL, Mukherjee J. Targeting the RAS-RAF-MEK-ERK signaling Clin 2019;69:7–34. pathway in gliomas. Handbook of brain tumor chemotherapy, 2. Hirsch FR, Scagliotti GV, Mulshine JL, Kwon R, Curran WJ Jr, Wu molecular therapeutics, and immunotherapy (2nd ed). Elsevier Y-L, et al. Lung cancer: current therapies and new targeted treat- Academic Press; 2018. p323–32. ments. Lancet North Am Ed 2017;389:299–311. 21. Wang Q, Gao G, Zhang T, Yao K, Chen H, Park MH, et al. TRAF1 is 3. Herbst RS, Morgensztern D, Boshoff C. The biology and man- critical for regulating the BRAF/MEK/ERK pathway in non-small agement of non-small cell lung cancer. Nature 2018;553:446. cell lung carcinogenesis. Cancer Res 2018;78:3982–94. 4. Istvan ES, Deisenhofer J. Structural mechanism for statin inhibi- 22. Zhao Y, Wang X, Sun Y, Zhou Y, Yin Y, Ding Y, et al. LYG-202 tion of HMG-CoA reductase. Science 2001;292:1160–4. exerts antitumor effect on PI3K/Akt signaling pathway in human 5. Sharpe LJ, Brown AJ. Controlling cholesterol synthesis beyond breast cancer cells. Apoptosis 2015;20:1253–69. 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR). J Biol 23. Hennessy BT, Smith DL, Ram PT, Lu Y, Mills GB. Exploiting the Chem 2013;288:18707–15. PI3K/AKT pathway for cancer drug discovery. Nat Rev Drug 6. Bjarnadottir O, Romero Q, Bendahl P-O, Jirstrom€ K, Ryden L, Discov 2005;4:988. Loman N, et al. Targeting HMG-CoA reductase with statins in a 24. Zhuang L, Kim J, Adam RM, Solomon KR, Freeman MR. Cho- window-of-opportunity breast cancer trial. Breast Cancer Res lesterol targeting alters lipid raft composition and cell survival in Treat 2013;138:499–508. prostate cancer cells and xenografts. J Clin Invest 2005;115: 7. Singh R, Yadav V, Saini N. MicroRNA-195 inhibits proliferation, 959–68. invasion and metastasis in breast cancer cells by targeting FASN, 25. Lee H, Yoo YS, Lee D, Song EJ. Cholesterol induces cardiac HMGCR, ACACA and CYP27B1. Sci Rep 2015;5:17454. hypertrophy by activating the AKT pathway. J Steroid Biochem 8. Gobel€ A, Breining D, Rauner M, Hofbauer LC, Rachner TD. Mol Biol 2013;138:307–13. Induction of 3-hydroxy-3-methylglutaryl-CoA reductase med- 26. Sun Y, Sukumaran P, Varma A, Derry S, Sahmoun AE, Singh BB. iates statin resistance in breast cancer cells. Cell Death Dis Cholesterol-induced activation of TRPM7 regulates cell prolifer- 2019;10:91. ation, migration, and viability of human prostate cells. 9. Lipkin SM, Chao EC, Moreno V, Rozek LS, Rennert H, Pinchev M, Biochim Biophys Acta 2014;1843:1839–50. et al. Genetic variation in 3-hydroxy-3-methylglutaryl CoA reduc- 27. Naito S, Makhov P, Astsaturov I, Golovine K, Tulin A, Kutikov A, tase modifies the chemopreventive activity of statins for colorec- et al. LDL cholesterol counteracts the antitumour effect of tyro- tal cancer. Cancer Prev Res 2010;3:597–603. sine kinase inhibitors against renal cell carcinoma. Br J Cancer 10. Chushi L, Wei W, Kangkang X, Yongzeng F, Ning X, Xiaolei C. 2017;116:1203. HMGCR is up-regulated in gastric cancer and promotes the 28. Islami F, Torre LA, Jemal A. Global trends of lung cancer mortality growth and migration of the cancer cells. Gene 2016;587: and smoking prevalence. Transl Lung Cancer Res 2015;4:327. 42–7. 29. Rioux N, Castonguay A. Prevention of NNK-induced lung tumor- 11. Stine JE, Guo H, Sheng X, Han X, Schointuch MN, Gilliam TP, igenesis in A/J mice by acetylsalicylic acid and NS-398. Cancer Res et al. The HMG-CoA reductase inhibitor, simvastatin, exhibits 1998;58:5354–60. anti-metastatic and anti-tumorigenic effects in ovarian cancer. 30. Yamakawa K, Yokohira M, Nakano Y, Kishi S, Kanie S, Imaida Oncotarget 2016;7:946. K. Activation of MEK1/2ERK1/2 signaling during NNKinduced 12. Ananthakrishnan AN, Cagan A, Cai T, Gainer VS, Shaw SY, lung carcinogenesis in female A/J mice. Cancer Med 2016;5: Churchill S, et al. Statin use is associated with reduced risk of 903–13. colorectal cancer in patients with inflammatory bowel diseases. 31. West KA, Linnoila IR, Belinsky SA, Harris CC, Dennis PA. Tobacco Clin Gastroenterol Hepatol 2016;14:973–9. carcinogen-induced cellular transformation increases activation 13. Nielsen SF, Nordestgaard BG, Bojesen SE. Statin use and reduced of the phosphatidylinositol 30-kinase/Akt pathway in vitro and cancer-related mortality. N Engl J Med 2012;367:1792–802. in vivo. Cancer Res 2004;64:446–51. 14. Gupta A, Stokes W, Eguchi M, Hararah M, Amini A, Mueller A, 32. Siolas D, Hannon GJ. Patient derived tumor xenografts: trans- et al. Statin use associated with improved overall and cancer forming clinical samples into mouse models. Cancer Res 2013; specific survival in patients with head and neck cancer. 73:5315–9. Oral Oncol 2019;90:54–66. 33. Clendening JW, Pandyra A, Boutros PC, El Ghamrasni S, Khosravi 15. Garwood ER, Kumar AS, Baehner FL, Moore DH, Au A, Hylton N, F, Trentin GA, et al. Dysregulation of the mevalonate pathway et al. Fluvastatin reduces proliferation and increases apoptosis in promotes transformation. Proc Natl Acad Sci U S A 2010;107: women with high grade breast cancer. Breast Cancer Res Treat 15051–6. 2010;119:137–44. 34. Wei T-T, Lin Y-T, Chen W-S, Luo P, Lin Y-C, Shun C-T, et al. Dual 16. Horiguchi A, Sumitomo M, Asakuma J, Asano T, Asano T, targeting of 3-hydroxy-3-methylglutaryl coenzyme A reductase Hayakawa M. 3-hydroxy-3-methylglutaryl-coenzyme a reductase and histone deacetylase as a therapy for colorectal cancer. EBio- inhibitor, fluvastatin, as a novel agent for prophylaxis of renal Medicine 2016;10:124–36. cancer metastasis. Clin Cancer Res 2004;10:8648–55. 35. Goldstein JL, Brown MS. Regulation of the mevalonate pathway. 17. Taylor-Harding B, Orsulic S, Karlan BY, Li AJ. Fluvastatin and Nature 1990;343:425. cisplatin demonstrate synergistic cytotoxicity in epithelial ovar- 36. Jackson SM, Ericsson J, Edwards PA. Signaling molecules derived ian cancer cells. Gynecol Oncol 2010;119:549–56. from the cholesterol biosynthetic pathway. In: Bittman R. editor. 18. Yang Z, Su Z, DeWitt JP, Xie L, Chen Y, Li X, et al. Fluvastatin Cholesterol. Subcellular biochemistry. Boston, MA: Springer; prevents lung adenocarcinoma bone metastasis by triggering 1997. p1–21. autophagy. EBioMedicine 2017;19:49–59. 37. Simons K, Toomre D. Lipid rafts and signal transduction. Nat Rev 19. Smalley I, Smalley KS. ERK inhibition: a new front in the war Mol Cell Biol 2000;1:31. against MAPK pathway–driven cancers? Cancer Discov 2018;8: 38. Castellano E, Downward J. RAS interaction with PI3K: more than 140–2. just another effector pathway. Genes Cancer 2011;2:261–74.

www.aacrjournals.org Cancer Prev Res; 12(11) November 2019 OF11

Zhang et al.

39. Frost JA, Steen H, Shapiro P, Lewis T, Ahn N, Shaw PE, et al. 41. Plosker GL, Wagstaff AJ. Fluvastatin. Drugs 1996;51: Crosscascade activation of ERKs and ternary complex factors by 433–59. Rho family proteins. EMBO J 1997;16:6426–38. 42. Khurana V, Bejjanki HR, Caldito G, Owens MW. Statins reduce 40. Murga C, Zohar M, Teramoto H, Gutkind JS. Rac1 and RhoG the risk of lung cancer in humans: a large case-control study of US promote cell survival by the activation of PI3K and Akt, inde- veterans. Chest 2007;131:1282–8. pendently of their ability to stimulate JNK and NF-kB. Oncogene 43. Sinzinger H, Wolfram R, Peskar BA. Muscular side effects of 2002;21:207. statins. J Cardiovasc Pharmacol 2002;40:163–71.

OF12 Cancer Prev Res; 12(11) November 2019 Cancer Prevention Research

Fluvastatin Inhibits HMG-CoA Reductase and Prevents Non− Small Cell Lung Carcinogenesis

Tianshun Zhang, Ruihua Bai, Qiushi Wang, et al.

Cancer Prev Res Published OnlineFirst September 25, 2019.

Updated version Access the most recent version of this article at: doi:10.1158/1940-6207.CAPR-19-0211

Supplementary Access the most recent supplemental material at: Material http://cancerpreventionresearch.aacrjournals.org/content/suppl/2019/09/25/1940-6207.CAPR -19-0211.DC1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerpreventionresearch.aacrjournals.org/content/early/2019/11/09/1940-6207.CAPR- 19-0211. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.