Literature Review and Scope of Work

ESRP1 is a novel marker of germ cell development and

gonadal cancer

Shaghayegh Saeidi

Doctor of Philosophy

March 2018

Department of Anatomy and Neuroscience

The University of Melbourne

Australia

Abstract:

Alternative splicing (AS) plays critical roles in controlling developmental programs.

To date, there is evident that many genes splice differently during gametogenesis. Since disruption in AS may result in various reproductive disorders such as cancer, regulation of this event would be crucial during gametogenesis. The regulation of alternative splicing occurs through a network of highly combinatorial molecular interactions and numerous RNA binding proteins (RBPs) and transcription factors have been implicated in this process. Among them,

ESRP1 (Epithelial Splicing Regulatory Protein) is an important cell-type specific regulator that affects the splicing of various developmental genes. Given the high level of alternative splicing during gametogenesis and the association of ESRP1 with AS, I was interested in examining the expression of ESRP1 during germ cell development and gonadal cancer.

In this study by droplet digital PCR (ddPCR), I identified that Esrp1 is expressed in developing murine male and female germ cells but not somatic cells. Esrp1 also showed a high level of expression in adult mouse spermatogonia. In addition, the result of immunofluorescence experiments showed that ESRP1 protein is most highly expressed in nuclei of pre-meiotic germ cells in adult testes and co-labeled with PLZF and c-KIT. However, it did not co-localized with SOX9 in somatic cells, indicating it is germ cell specific.

Furthermore, no colocalization was detected between ESRP1 and SC35 (post-transcriptional splicing marker), which suggests a probable role for ESRP1 in co-transcriptional splicing.

In addition, my studies on the expression of Esrp1 in gonadal cancers showed upregulation of Esrp1 in both serous and mucinous ovarian carcinomas, its correlation with the levels of E-cadherin (CDH1) expression and coincides with switches from mesenchymal to epithelial isoforms of CD44 and FGFR2.

In testicular cancer, my data showed that Esrp1 was also up-regulated in both seminoma and mixed-germ cell testicular cancers. However, it did not regulate splicing of FGFR2 and

CD44 in testicular cancers. RNA interference-mediated knockdown of ESRP1 expression in the seminoma-derived TCam-2 cell line, followed by RNA sequencing resulted in the identification of 576 novel potential splicing targets for ESRP1 in germ cell tumor cell line.

IPA analyses of the data demonstrated ESRP1 regulates alternative splicing of genes that are involved in directing critical pathways involved in cell migration, morphology, and behaviors that occur during EMT. My data also showed that four mitochondrial complexes of oxidative phosphorylation are affected by differential gene expression after silencing of ESRP1.

Overall, these data suggest that ESRP1 is required for germ cell development and raises the possibility that ESRP1 plays a role in splicing of mitotic and premeiotic transcripts during spermatogenesis, particularly in spermatogonia. Furthermore, my findings reveal that ESRP1 plays an important role in gonadal cancer progression by regulation of AS of numerous genes that are related to EMT. Furthermore, differential gene expression after silencing of ESRP1 suggesting that ESRP1 expression in testicular germ cells may alter ATP production and thus affect energy metabolism of these cells.

Declaration

This is to certify that

1) This thesis comprises only of my original work towards the PhD;

2) Due acknowledgement has been made in the text to all other materials used;

3) The thesis is less than 100,000 words in length, exclusive of figures, tables, bibliographies and appendices.

Shaghayegh Saeidi

iii

Preface

According to the rules and regulations that govern the Doctor of Philosophy degree at the University of Melbourne, the assessment of my contribution to this thesis was made as follows;

• Chapter 3: This chapter has been published in PLoS One “Saeidi S, Shapouri F, de Iongh RU, de Iongh RU, Casagranda F, Sutherland JM, Western PS, McLaughlin EA, Familari M, Hime GR. Esrp1 is a marker of mouse fetal germ cells and is upregulated in spermatogonia. PLoS ONE. 2018; 13(1): e0190925.” I am the lead author and contributed 80% of experimental work and wrote the first draft of the entire manuscript.

Chapter 4: 100%

Chapter 5: 100%

Chapter 6: 100%

Acknowledgments

There are many friends, family, and faculty that supported me during my PhD career.

Words cannot express how much their encouragement, inspiration, and motivation has meant to me.

First and foremost, I would like to thank my supervisors, Prof. Gary Hime, Dr. Mary

Familari and A/Prof. Robb De Iongh for their excellent guidance throughout my doctoral studies. They provided me with opportunities to take on challenging projects and experiments, allowing me to mature as a scientist, all the while being ever present to help me along the way when necessary. Besides my supervisors, I would like to thank my advisory committee, Dr

Peter Kitchener for his insightful comments and encouragement.

I would like to thank my previous supervisor, A/Prof Reza Aflatoonian, for all his support and encouragement during my academic career. I appreciate the role you played in helping me get here.

My special and heartily thanks to Franca Casagranda for helping me learn new techniques. I really appreciate your kindness and support during my PhD.

My lab members, Dr Nicole Siddall, Trisha, Aviv, Arjun, James, Yoshana, Elena and

Andrew. Thank you for making the lab one of the happiest labs I’ve worked in. Working alongside you guys was truly a joy.

I would like to express my gratitude to my lovely friends, Kiana, Akram, Mitra, Javad,

Maryam and Farhad for their unconditional friendship, support and patience throughout these years.

I would like to thank my best friend Farnaz. There is no one with whom I can share my tears and fears, if you were not here. Thanks for being by my side and always giving me reasons to cheer.

I am grateful for the financial support I have received during my studies as the recipient of the Melbourne International Research Scholarship, the Melbourne International Fee

Remission Scholarship and the Department of Anatomy and Neuroscience Travel Scholarship.

Finally, I would like to thank my family members: my parents, my sisters, my brothers in law, my nephews (Arvin and Parsa) and my aunts. I am 100% certain (p < 0.001) that I could not have completed this journey without your love and support. I cannot possibly express how grateful I am to all of you for putting up with the emotional roller coaster that I’ve been on over the past four years.

Publications

• Saeidi S, Shapouri F, de Iongh RU, de Iongh RU, Casagranda F, Sutherland JM, Western PS, McLaughlin EA, Familari M, Hime GR. Esrp1 is a marker of mouse fetal germ cells and is upregulated in spermatogonia. PLoS ONE. 2018; 13(1): e0190925.

Conference presentations

• Saeidi S, Shapouri F, de Iongh RU, Casagranda F, Western PS, McLaughlin EA, Sutherland JM, Familari M, Hime GR. The role of ESRP1 during gametogenesis. Published in clinical endocrinology. 2015. Volume 84: PP-48.

• Saeidi S, Shapouri F, de Iongh RU, Casagranda F, Western PS, McLaughlin EA, Sutherland JM, Familari M, Hime GR. The role of ESRP1 in mammalian germ cell development. 2016. 19th Eroupean Testis Workshop. Saint-Malo, France.

vii

Table of Contents Preface...... iv

Chapter 1. Literature review and scope of work ...... 1 1.1. Epithelial to Mesenchymal Transition (EMT) ...... 2 1.2. Alternative splicing (AS) during EMT ...... 4 1.3. Regulatory splicing factors ...... 6 1.4. ESRP1 as an epithelial-specific splicing regulatory factor ...... 7 1.5. Targets of ESRP1 ...... 10 1.5.1. FGFR2 ...... 11 1.5.2. CD44 ...... 12 1.6. Regulation of ESRP1 expression ...... 14 1.7. ESRP1 function, expression, and localization ...... 16 1.8. Germ cell development ...... 18 1.9. Alternative splicing in germ cell development ...... 20 1.10. ESRP1 and carcinogenesis ...... 23 1.11. Hypothesis...... 25

Chapter 2. Materials and methods ...... 27 2.1. Molecular biology ...... 28 2.1.1. RNA extraction ...... 28 2.1.2. RNA quality ...... 28 2.1.3. cDNA synthesis ...... 28 2.1.3.1 Mouse...... 28 2.1.3.2 Human ...... 29 2.1.4. Droplet digital PCR ...... 29 2.1.4.1 Statistical analysis ...... 32 2.2. Histology and Immunohistochemistry ...... 32 2.2.1. Haematoxylin and eosin staining ...... 32 2.2.2. Immunofluorescence ...... 32 2.2.3. Confocal microscope imaging ...... 33

Chapter 3. Esrp1 is a marker of mouse fetal germ cells and differentially expressed during spermatogenesis ...... 34 3.1. Introduction ...... 35 3.2. Materials and methods ...... 37 3.2.1. Experimental animals ...... 37 3.2.2. Isolation of gonadal germ and somatic cells ...... 38 3.2.3. Cell culture and RNA interference ...... 39 3.2.4. Cycloheximide chase assay ...... 39 3.2.5. Western blot ...... 40 3.2.6. RNA extraction, cDNA synthesis, RT-PCR and droplet digital PCR (ddPCR) ...... 40 3.2.7. Immunofluorescence ...... 42 3.2.8. Statistical analyses ...... 43 3.3. Results ...... 43 3.3.1. Esrp1 is expressed in fetal germ but not somatic cells ...... 43 viii

3.3.2. Esrp1 is upregulated in adult spermatogonia ...... 44 3.4. Discussion ...... 55

Chapter 4. Evaluation of phenotypes resulted from overexpressing or knocking down fusilli expression in testis ...... 57 4.1. Introduction ...... 58 4.1.1. Germline stem cells in the Drosophila testis and spermatogenesis ...... 59 4.1.2. Aim ...... 60 4.2. Methods...... 60 4.2.1. Drosophila culture condition ...... 60 4.2.2. Drosophila Strains ...... 61 4.2.3. The GAL4-UAS system ...... 61 4.2.4. Drosophila immunofluorescence staining ...... 62 4.3. Results ...... 63 4.3.1. fusilli mRNA expresses in Drosophila testis ...... 63 4.3.2. Knock-down of fusilli using RNAi showed no obvious phenotype ...... 63 4.3.3. Overexpression of fusilli ...... 65 4.4. Discussion ...... 66

Chapter 5. Examination of ESRP1 expression in human cancerous ovary and testis ...... 69 5.1. Introduction ...... 70 5.2. Aim ...... 73 5.3. Methods...... 73 5.3.1. Sample collection ...... 73 5.3.2. Quantitative reverse transcription PCR (RT-qPCR) ...... 77 5.3.3. Droplet Digital PCR (ddPCR) ...... 78 5.3.4. Immunofluorescence staining and histology ...... 78 5.4. Results ...... 78 5.4.1. Selection of housekeeping gene in ovarian and testicular samples ...... 78 5.4.2. ESRP1 expression is up-regulated in epithelial ovarian carcinomas ...... 79 5.4.3. Normal ovary shows expression of mesenchymal marker ZEB1 but not epithelial marker CDH1 ...... 80 5.4.4. FGFR2IIIb to FGFR2IIIc switch during ovarian carcinogenesis ...... 81 5.4.5. CD44v6 is up-regulated in mucinous but not serous carcinoma ...... 82 5.4.6. ESRP1 is minimally expressed in human normal ovary ...... 84 5.4.7. ESRP1 expression in germ cell testicular tumours ...... 85 5.4.8. No detectable FGFR2 splicing in testicular germ cell tumours ...... 86 5.4.9. No detectable CD44 isoform switching in testicular germ cell tumors ...... 87 5.4.10. OCT4 colocalizes with ESRP1 in seminoma tumors ...... 90 5.5. Discussion ...... 93 5.5.1. Induction of ESRP1 expression may correlate with ovarian cancer by regulate FGFR2 and CD44 splicing ...... 93 5.5.2. ESRP1 may play a role in the progression of testicular cancer via regulating of pluripotency factors ...... 95 5.6. Conclusions ...... 96

Chapter 6. Identification of potential ESRP1 targets in testicular germ cell tumor (TCam-2 cell line) ...... 97 6.1. Introduction ...... 98 6.2. Aim ...... 98 6.3. Methods...... 99 6.3.1. TCam-2 cell culture ...... 99 6.3.2. Cycloheximide chase assay ...... 99 6.3.3. Cell lysis ...... 100 6.3.4. Western Blot Analysis ...... 100 6.3.5. Cell transfection ...... 101 6.3.6. ddPCR ...... 102 6.3.7. Immunofluorescence of cells ...... 103 6.3.8. RNA-Sequencing analysis ...... 103 6.3.9. Ingenuity® Pathway Analysis ...... 104 6.3.10. PCR amplification ...... 105 6.4. Results ...... 106 6.4.1. ESRP1 protein stability ...... 106 6.4.2. ESRP1 is depleted efficiently in TCam-2 cell line using siRNA ...... 106 6.4.3. Down-regulation of ESRP1 results in altered gene expression ...... 106 6.4.4. Ingenuity Pathway Analysis for Differentially expressed transcripts ...... 110 6.4.5. New splicing targets of ESRP1 in germ cell tumor ...... 113 6.4.6. ESRP1 may be implicated in regulation of cell motility and tumor invasion ...... 113 6.4.7. ESRP1 potentially affects testicular cancer via regulating pluripotency factors ...... 115 6.5. Discussion ...... 116 6.5.1. Knockdown of ESRP1 affects mitochondrial function in germ cell tumors ...... 116 6.5.2. ESRP1 regulates cell motility via splicing of different genes in distinct pathways ...... 117 6.5.3. ESRP1 potentially affects testicular cancer via regulating pluripotency factors ...... 118 6.6. Conclusions ...... 119

Chapter 7. Discussion and future directions ...... 121 7.1. Esrp1 is expressed in spermatogonia but not in somatic cells of mouse testis ...... 122 7.2. Esrp1/fusilli does not have a major role in Drosophila GSC ...... 124 7.3. ESRP1 acts as a splicing factor in germline tumors ...... 124 7.4. Future research directions ...... 128 References ...... 130

Appendix 152

List of Figures

Chapter 1

Figure 1. 1: Epithelial to Mesenchymal Transition (EMT)...... 3

Figure 1. 2: Schematic depiction of alternative splicing ...... 6

Figure 1. 3: Schematic figure of ESRP1 orthologues ...... 8

Figure 1. 4: ESRP1 binding sites ...... 9

Figure 1. 5: FGFR2 isoforms structure ...... 12

Figure 1. 6: The CD44 gene undergoes alternative splicing ...... 13

Figure 1. 7: Regulation of ESRP1 ...... 16

Figure 1. 8: Germ cell development...... 20

Chapter 3

Figure 3. 1:. Esrp1 is expressed in developing male and female germ cells but not somatic cells ...... 44

Figure 3. 2: Analysis of separated germ cell populations...... 45

Figure 3. 3: Esrp1 is highly expressed in spermatogonia in the adult testis ...... 46

Figure 3. 4: ESRP1 is expressed in type A and type B spermatogonia...... 48

Figure 3. 5: siRNA knockdown of Esrp1 demonstrates antibody specificity ...... 49

Figure 3. 6; Immunostaining with a second ESRP1 antibody shows a similar expression pattern...... 50

Figure 3. 7:ESRP1 is not localized to somatic (Sertoli cells) ...... 51

Figure 3. 8: Nuclear ESRP1does not co-localize with the spliceosome marker, SC35 ...... 52

Figure 3. 9: ESRP1 protein is depleted 72 hours after blocking translation ...... 53

Figure 3. 10: ESRP1-mediated alternative splicing in TCam-2 cells...... 54

Chapter 4

Figure 4. 1: Schematic of the apical tip of the Drosophila testis ...... 60

Figure 4. 2: GAL4-UAS system in Drosophila ...... 62

Figure 4. 3: fusilli transcript is detected in in Drosophila testis ...... 63

Figure 4. 4: Knockdown of fusilli does not affect GSCs ...... 64

Figure 4. 5: No differences were observed between control and knockdown fusilli testes ...... 65

Figure 4. 6: No changes is detected in GSCs when fusilli is overexpressed in the testes...... 66

Chapter 5

Figure 5. 1: The average expression stability values of reference genes ...... 79

Figure 5. 2: ESRP1 expression is upregulated in both serous and mucinous ovarian carcinomas ...... 80

Figure 5. 3: Normal ovaries show mesenchymal properties and ovarian cancer tissue exhibits epithelial

properties...... 81

Figure 5. 4: FGFR2 IIIb expression is up-regulated and FGFR2 IIIc is down-regulated in ovarian cancers

...... 82

Figure 5. 5: Up-regulated CD44v6 expression in mucinous but not serous carcinoma ...... 83

Figure 5. 6: Localisation of ESRP1 and CD44v6 in ovarian tumours ...... 84

Figure 5. 7: ESRP1 is minimally expressed in normal ovary...... 85

Figure 5. 8: ESRP1 expression is up-regulated in germ cell testicular cancer ...... 86

Figure 5. 9: No detectable FGFR2 splice variant switching in testicular germ cell cancers...... 87

Figure 5. 10: CD44s is up-regulated in mixed germ cell tumors ...... 89

Figure 5. 11: ESRP1 showed strong and CD44v6 weak staining in germ cell testicular cancer ...... 90

Figure 5. 12: Co-expression of Oct4 and ESRP1 in seminoma testicular tumors ...... 92

Chapter 6

Figure 6. 1: Knockdown of ESRP1 in TCam-2 cells using shRNAmir ...... 102

Figure 6. 2: RNA-Seq data processing workflow...... 104

Figure 6. 3: Quality of RNA isolated from transfected TCam-2 cells ...... 108

Figure 6. 4: Smear plot and Multidimensional scaling (MDS) plot ...... 109

Figure 6. 5: Heatmap of top 50 most differentially expressed genes after silencing of ESRP1 ...... 110

Figure 6. 6: Top canonical pathways affected by silencing of ESRP1 identified by IPA ...... 111

xii

Figure 6. 7: Oxidative phosphorylation genes expression affected by depletion of ESRP1 ...... 112

Figure 6. 8: Impact of ESRP1 knockdown on splicing of genes in integrin and actin signaling ...... 115

xiii

List of Tables

Chapter 1

Table 1. 1: Tissue-specific regulators of splicing ...... 4

Chapter 2

Table 2. 1: Primer and probe sequences ...... 31

Table 2. 2: Antibodies and corresponding methods ...... 33

Chapter 3

Table 3. 1: siRNA target sequences ...... 39

Table 3. 2: Digital PCR primer and probe sequences ...... 41

Chapter 4

Table 4. 1: Fly strains used in this study ...... 61

Chapter 5

Table 5. 1: Human normal and carcinomas ovarian specimens used in this study ...... 75

Table 5. 2: Human adjacent normal and tumor testicular specimens used in this study ...... 76

Table 5. 3: Normal human ovarian specimens used in this study ...... 77

Table 5. 4: Primer sequences of the reference genes ...... 77

Chapter 6

Table 6. 1: siRNA target sequences ...... 102

Table 6. 2: Primer sequences used in PCR amplification of splice variants ...... 105

Table 6. 3:The top five canonical signaling pathways regulated by ESRP1 in TCam-2 cells ...... 114

Table 6. 4: Pluripotency factors are differentially expressed after silencing ESRP1 ...... 116

xiv

List of abbreviation

AS Alternative Splicing CDH1 E-cadherin CLDN1 Claudin CRC Colorectal Cancer ddPCR Droplet Digital PCR DMC1 DNA meiotic recombination protein 1 ECM Extracellular Matrix EMT Epithelial to Mesenchymal Transition EPAB Embryonic poly (A) binding protein EPCAM Epithelial Cell Adhesion Molecule EST Expressed Sequence Tag FGF Fibroblast Growth Factors HCET Human Corneal Epithelial Cells HSF2 Heat shock transcription factor 2 ISE Intronic Splicing Enhancer ISS Intronic Splicing Silencer MET Mesenchymal to Epithelial Transition NMD Nonsense-Mediated Decay OCLN Occludin RBPs RNA binding proteins RIN RNA integrity number RRMs RNA Recognition Motifs SCC Spermatogonial Stem Cells SRN Splicing Regulatory Networks TCGA The Cancer Genome Atlas TGCTs Testicular Germ Cell Tumors ZEB1 Zinc Finger E-Box-Binding Homeobox 1 ZEB2 Zinc Finger E-Box-Binding Homeobox 2

Chapter 1.

Literature review and scope of work

1.1. Epithelial to Mesenchymal Transition (EMT)

Two of the most important morphological changes that occur in eumetazoans are epithelial to mesenchymal, and mesenchymal to epithelial transition, known as EMT and MET respectively (Thiery et al, 2009). EMT is characterised by cellular changes in epithelial cells such as loss of cell adhesion, and the gain of migration and invasion ability to become mesenchymal cells. Epithelial cells are tightly bound to each other by adherens junctions, desmosomes, gap junctions and tight junctions, whereas mesenchymal cells do not display such tight cell-cell contacts. Epithelial cells also have apico-basal polarity and are bound to a basal lamina, enabling the epithelium to form a semi-permeable and protective layer. Mesenchymal cells, conversely, do not exhibit apico-basal polarization and have an unidentified shape, which interacts with the extracellular matrix enabling them to migrate (Thiery & Sleeman, 2006)

(Figure 1. 1).

EMT was first shown as a feature of embryogenesis (Kong et al, 2011). EMT and its reverse process, MET, are essential for cell differentiation and organogenesis. A good example of these events occurs during gastrulation (Thiery et al, 2009). During this process, epithelia undergo EMT to change into mesenchyme, which can subsequently re-form as epithelial cells during renal, heart and kidney formation by MET (Little et al, 2010; Thiery et al, 2009).

Although these processes have been characterized during normal development, they are also involved in several pathophysiological processes including tissue fibrosis and carcinogenesis

(Thiery et al, 2009).

Apart from cellular changes, it is well established that a number of distinct molecular processes occur during EMT. Various growth factor signaling pathways such as Wnt, TGF-β,

Notch, and fibroblast growth factors (FGF) have profound effects on EMT by changing the expression of genes that lead to a cell’s phenotypic transition (Boyer et al, 1999; Strutz et al,

2002; Thiery et al, 2009; Thiery & Sleeman, 2006). Key biomarkers of EMT include the

transcription factors SNAI1, SNAI2, ZEB1 (zinc finger E-box-binding homeobox 1), ZEB2

(zinc finger E-box-binding homeobox 2) and TWIST (Comijn et al, 2001; Liu et al, 2009;

Peinado et al, 2003). The reverse program, MET, involves up-regulation of genes such as claudin (CLDN1), E-cadherin (CDH1), occludin (OCLN), and epithelial cell adhesion molecule

(EPCAM)(Samavarchi-Tehrani et al, 2010). In addition, it has been shown that the expression of several miRNAs change during EMT or MET.

For instance carcinoma cell lines, which show epithelial cell features, express the miR-

200 family and miR-205, whereas carcinoma cells with a mesenchymal phenotype express low or undetectable levels of these miRNAs (Gregory et al, 2008).

Figure 1. 1: Epithelial to Mesenchymal Transition (EMT); during EMT, epithelial cells (green box) loss their cell adhesion and gain migration and invasion ability to become mesenchymal cells (blue box). Each epithelial or mesenchymal cell has its own specific molecular markers. For instance, down-regulation of epithelial markers including E-cadherin and up-regulation of mesenchymal markers such as N-cadherin can promote the EMT process. (Adapted from (Gout & Huot, 2008).

To date, many investigations have focused on molecular mechanisms that induce EMT or MET. One particular line of inquiry was whether alternative splicing (AS) acts as a post- transcriptional layer of gene regulation in EMT. Some investigations have shown that specific

AS events occur in epithelial cells as opposed to mesenchymal cells. Genes encoding fibroblast

growth factor receptor 2 (FGFR2), p120-catenin (CTNND1), CD44 (CD44), and MENA

(ENAH) proteins, produce multiple alternatively spliced mRNAs. There is also evidence that most AS is tissue-specific and several differentially expressed regulators of AS have been identified (Table 1. 1), suggesting that AS is regulated in a tissue-specific manner and has an important role in tissue formation and maintenance (Wang et al, 2008).

Table 1. 1: Tissue-specific regulators of splicing Name Tissue expression References

nPTB Differentiated neurons Boutz et al (2007)

NOVA1 Neurons of the hindbrain and spinal cord Dredge et al (2005); Ule et al (2005)

Neurons of the cortex, hippocampus, and dorsal spinal NOVA2 Ule et al (2005); Yang et al (1998) cord

Quaking Glial cells Farnsworth et al (2017)

HUB Neurons Akamatsu et al (1999)

CELF1 Brain Ladd et al (2001)

CELF4 Muscle Ladd et al (2001); Musunuru (2003)

1.2. Alternative splicing (AS) during EMT

Transcriptional regulation of gene expression in eukaryotes starts in the nucleus with the transcription of a pre- mRNA, which is modified to produce a mature RNA. Most eukaryotic genes contain segments of coding sequences (exons) that are interrupted by long non-coding sequences (introns). During transcription, introns are removed, and exons are joined to each other, a process called pre-mRNA splicing, which allows a single gene to code

multiple proteins. More complex organisms tend to have a greater number of exons than simple organisms. For instance, the average gene in Drosophila melanogaster has four exons separated by introns while the human genome contains an average of nine exons (Deutsch &

Long, 1999).

Researchers have also discovered that the arrangement of coding exons in a gene is not necessarily linear. Pre-mRNA can be spliced in different ways to produce different transcripts in a process known as (alternative splicing) AS (Berget SM, 2000; Chow LC, 2000 ). Recent studies have shown that 95% of human genes have alternatively spliced transcripts (Akamatsu et al, 1999; Pan et al, 2008). There are different models of AS (Figure 1. 2), the most common of which is the inclusion or skipping of a single internal exon. In this kind of splicing, a certain exon may be included in mRNAs under some conditions or in specific tissues and excluded from the mRNA in others (Hartmann & Valcarcel, 2009). Splicing at different points allows the lengthening or shortening of an exon (Black, 2003). AS by the generation of novel open reading frames results in multiple proteins from a single coding gene. On the other hand, the creation of premature termination codons by this event can cause mRNA degradation by the nonsense-mediated decay (NMD) pathway (Lewis et al, 2003).

Figure 1. 2: Schematic depiction of alternative splicing; Exons and introns are shown in green and yellow respectively. A. Exon skipping: an exon will be excluded; B. Mutually exclusive exons: one or two exons are included in the mRNA after splicing; C and D. Alternative 5’ or 3’ splice junction: joining of different 5' and 3' splice site; E. Intron Retention: an intron can remain in the final transcript. (Adapted from (Keren et al, 2010).

Thus at the post-transcriptional level, AS of mRNA can lead to expression of specific epithelial- or mesenchymal-specific splice variants that may play a role in EMT. Differential expression of FGFR2 splice variants is a good example to demonstrate the importance of AS in EMT. FGFR2 encodes a transmembrane receptor for fibroblast growth factors (FGFs). AS of FGFR2 results in two isoforms: the epithelial-expressed FGFR2-IIIb and the mesenchymal- expressed FGFR2-IIIc. Switching from FGFR2-IIIb to FGFR2-IIIc isoforms is considered one of the hallmarks of EMT and is thus an important regulatory event in EMT during development and cancer progression (De Medina et al, 1999; Savagner et al, 1994).

1.3. Regulatory splicing factors

The regulation of AS occurs through a network of highly combinatorial molecular interactions. Numerous RNA binding proteins (RBPs), transcription factors as well as cis- and trans- elements are involved. Several studies illustrated that cell-type specific splicing factors control AS and importantly, identified splicing regulatory networks (SRN) and biological pathways that affect cell morphology and function (Warzecha & Carstens, 2012).

Splicing Regulatory (SR) proteins are a family of conserved proteins containing serine

(S) and arginine (R) residues and are associated with RNA splicing (Vajda et al, 2009). While this family has been widely studied, there are various other splicing factors, including PTB,

Tial/TIAR, Fox2, hnRNPM, and hnRNPA1, affecting splicing of different genes such as

FGFR2 during EMT (Baraniak et al, 2006; Hovhannisyan & Carstens, 2007).

As all these factors are ubiquitously expressed, it has been suggested that there must be a cell-specific regulator of FGFR2 splicing. In pursuit of this hypothesis, the Carstens

Laboratory in 2009 conducted a high-throughput, genome-wide cDNA screen to identify factors that uniquely promote splicing of FGFR2 IIIb in epithelial cells. Among various factors, two proteins, RNA binding motif proteins 35A and 35B (RBM35A and RBM35B), were found to promote exon IIIb but inhibit exon IIIc inclusion (Warzecha et al, 2009a).

Analysis of mRNA levels of these genes in cell lines as well as in mouse tissues (Warzecha et al, 2009a) showed that both genes were highly epithelial cell-specific and thus were renamed as epithelial splicing regulatory proteins 1 and 2 (ESRP1 and ESRP2). They also showed that several targets of ESRPs, such as CD44, ENAH, and CTNND1, are involved in EMT (Warzecha

& Carstens, 2012; Warzecha et al, 2009a) and proposed ESRPs as epithelial specific AS factors that negatively regulate EMT.

1.4. ESRP1 as an epithelial-specific splicing regulatory factor

ESRPs are RNA binding proteins with a molecular weight of 75 kDa and contain three

RNA recognition motifs (RRMs) that have high levels of similarity (~60%; Figure 1. 3), suggesting they share similar RNA binding properties (Dominguez et al, 2010).

Figure 1. 3: Schematic figure of ESRP1 orthologues; RNA recognition motifs (RRM) depicted as colored boxes in different species. The amino acid length of the proteins is provided on the right side of each motif. (Reproduced from (Warzecha et al, 2009a).

Among mammalian splicing proteins, hnRNP F/H proteins have the highest degree of homology to RBM35A and RBM35B in their RNA recognition motifs (RRM) (Warzecha et al, 2010). The RRMs, are the most common RNA binding domain, containing 90 amino acids.

ESRP1 and ESRP2 each contain three domains with similarity to the RRMs of hnRNP F and hnRNP H1. ESRP1 has multiple copies of RRMs, which allow it to recognize a long nucleotide sequence of RNA and increase its binding affinity (Maris et al, 2005).

Orthologs of ESRP1 and ESRP2 are evolutionarily conserved from nematode to humans. Their orthologs in Caenorhabditis elegans and Drosophila melanogaster are Sym-2 and fusilli respectively (Barberan-Soler et al, 2011; Wakabayashi-Ito et al, 2001). Sym-2 was identified in a synthetic lethal screen with another splicing factor, mec-8 (Davies et al, 1999) and was shown to be a critical regulator of AS during the embryo to LI larval transition

(Barberan-Soler & Zahler, 2008). However, homozygous mutation of this gene on its own does not result in an obvious mutant phenotype (Barberan-Soler et al, 2011). fusilli is expressed in the follicle cells of the developing Drosophila embryo and it seems that this gene

is involved in dorsal-ventral patterning. fusilli can also be detected in the ovary and nurse cells of adult Drosophila and it is necessary for embryo survival (Wakabayashi-Ito et al, 2001).

Moreover, fusilli can rescue splicing of FGFR2 in mammalian epithelial cells that have been depleted of ESRP1 and ESRP2 (Warzecha et al, 2009b). However, targets of fusilli and the speciﬁc function of this gene during Drosophila development remain undefined.

RNA-mapping of ESRP binding sites identified an 85 base auxiliary RNA cis-element

(intronic splicing enhancer/intronic splicing silencer 3; ISE/ISS-3) and also a UGCAUG motif that play a key role in AS of FGFR2 (Hovhannisyan & Carstens, 2007; Hovhannisyan et al,

2006). Subsequent analyses of other ESRP1-regulated exons revealed that ESRPs bind to a

UGG-rich motif both upstream and downstream of regulated exons (Dittmar et al, 2012;

Warzecha CC, 2010). The location of this motif determines the splicing fate of exons. If this motif is located downstream of an exon, it leads to its inclusion; however, if it is located upstream or into the exon, it leads to exclusion of that exon (Dittmar et al, 2012; Shapiro et al,

2011). So, ESRPs can adjust both inclusion and skipping of exons (Figure 1. 4).

Figure 1. 4: ESRP1 binding sites; If ESRP1 binds to a UGG-rich motif upstream of an exon, the exon will be excluded in the final transcript. By contrast, ESRP1 binding to this motif downstream of regulated exons leads to exon inclusion. (Adapted from (Dittmar et al, 2012).

ESRP1 is located on chromosome 8q22.1 in human and it has been shown that deletion of this region can cause Nablus mask-like facial syndrome (NMFLS). NMFLS patients display mild to severe abnormalities in their teeth, nose, and pinnae, as well as aortic arch

malformations. Moreover, some anomalies have been seen in the lacrimal duct, the nipple, and genital tract (Jerome & Papaioannou, 2001). However, NMFLS patients have a 2.4-MB deletion, and it has been suggested that this could be a contiguous deletion syndrome with at least 10 additional genes contributing to this disease (Jain et al, 2010). Studies in mice show that genetic ablation of Esrp1, alone or with Esrp2, resulted in an aplastic kidney phenotype.

Mutant kidneys had reduced ureteric branching and fewer nephrons and it was proposed that this was due to aberrant Fgfr2 splicing (Bebee et al., 2016). Furthermore, it has been shown that loss of Grhl2 results in cranial neural tube defects (NTDs) in mice. Since expression of some epithelial genes such as Esrp1, Sostdc1, Fermt1, Tmprss2 and Lamc2 are downregulated in Grhl2 mutants, it seems that GRHL2 has an impact on neural tube formation by regulating these epithelial genes (Ray & Niswander, 2016).

1.5. Targets of ESRP1

Identification of ESRP1 as an epithelial-specific splicing regulator has resulted in several studies to explore the range of ESRP1 target genes. Warzecha et al (2009a) identified more than a hundred potential targets for ESRP1 using the splicing sensitive Affymetrix Exon

ST1.0 Arrays in an ESRP-depleted prostate cell line. Remarkably, reciprocal changes in AS events were observed after ectopic expression of ESRP1 in mesenchymal MDA-MB-231 cells, confirming the crucial role of ESRP1 in epithelial-specific splicing (Warzecha et al, 2009a).

Most ESRP1 targets, such as FGFR2 and CD44, have a significant impact on epithelial cell function during EMT via different mechanisms (Warzecha et al, 2009a; Warzecha et al,

2009b). To date, FGFR2 and CD44 have been the most characterised targets of ESRP1 and in the following sections more detail about their structure and function is provided.

1.5.1. FGFR2

The FGFR2 gene encodes a transmembrane receptor tyrosine kinase that is activated by FGFs. FGF stimulation, initiates a cascade of downstream signals that lead to diverse outcomes, including mitogenesis and/or differentiation. FGFRs contain three extracellular immunoglobulin (Ig) domains and an intracellular split tyrosine kinase (TK) domain. Ligand- binding specificity is based on AS of the Ig III domain (Johnson et al, 1990; Lee et al, 1989).

An RNA cis-element, ISE/ISS-3, which is located in intron 8 of FGFR2, regulates FGFR2 splicing (Hovhannisyan et al, 2006). It has been reported (Orr-Urtreger et al, 1993) that inclusion of exon 8 generates FGFR2IIIb isoform while the inclusion of exon 9 leads to producing FGFR2IIIc (Figure 1. 5). Epithelial tissues express the IIIb isoform whereas mesenchymal tissues express the IIIc isoform (Carstens et al, 1997). The switch of the

FGFR2IIIb to FGFR2IIIc was the first example of AS role in EMT (De Medina et al, 1999;

Savagner et al, 1994). Moreover, it has been shown that epithelial cells expressing FGFR2IIIb interact with FGFs secreted by mesenchymal cells and vice versa. For instance, FGF7 is expressed in mesenchyme and shows specific binding affinity toward FGFR2b (Zhang et al,

2006). This reciprocal regulatory pathway has impact on formation of epithelial structures during development (Arman et al, 1999). It has been shown that Fgfr2 null mice die at embryonic day 10.5 resulting from defects in placenta (Xu et al, 1998). Also, disruption in the

FGFR2IIIb isoform can cause defects of the lungs, anterior pituitary, thyroid, teeth and limbs.

These mice die immediately after birth (Pulkkinen et al, 2003). On the other hand, disruption in FGFR2IIIc results in delayed ossiﬁcation and defects in the chondrocranium but these mice are viable (Eswarakumar et al, 2002).

Figure 1. 5: FGFR2 isoforms structure; FGFR2 contains two isoforms, FGFR2 IIIb and IIIc. The inclusion of exon 8 generates FGFR2IIIb isoform while inclusion of exon 9 leads to the formation of FGFR2IIIc. ESRP1 promotes production of FGFR2IIIb in epithelial cells. (Adapted from (Matsuda et al, 2012).

As mentioned above, Warzecha et al (2009a) were the first group that identified ESRPs as regulators of FGFR2IIIb. They performed high-throughput genome wide cDNA screen on

293T cells, which only express the mesenchymal FGFR2IIIc isoform. By transfecting these cells with a minigene reporter library (Mammalian Gene Collection; MGC) they screened for factors that promote exon IIIb inclusion and showed ESRP1 and ESRP2 induced greater inclusion of exon IIIb than other factors. Moreover, they showed that knockdown or ectopic expression of ESRP1 can alter the switching between FGFR2IIIb and FGFR2IIIc isoforms.

(Warzecha et al, 2009a).

1.5.2. CD44

The CD44 gene on chromosome 11, encodes a cell surface glycoprotein that acts as a receptor for hyaluronan. It also has additional binding sites for other extracellular matrix

(ECM) components. The cytoplasmic domain of CD44 is linked to actin and its activation can result in initiation of downstream signaling pathways, which control cell-cell and cell-matrix adhesion (Bennett et al, 1995; Zoller, 2011). CD44 plays a critical role in cell proliferation, adhesion, migration, and invasion (Nagano & Saya, 2004). These multiple functions of CD44

could be due to different isoforms generated by AS, as well as posttranslational alterations

(Dougherty et al, 1994; Katoh et al, 1995; Stamenkovic et al, 1991).

The CD44 gene consists of 20 exons (Figure 1. 6) and AS of CD44 can produce various isoforms that have different tissue-specific effects. Exons 1-5 and exons 16-20 splice together to form the standard isoform, CD44s, which is widely expressed on the surface of most cells.

Figure 1. 6: The CD44 gene undergoes alternative splicing; The human CD44 gene comprises 20 exons. Ten constitutive exons (shown in blue) generate the CD44 standard, or CD44s isoform. Ten variable exons between exons 5 and 16 (shown in pink) can be alternatively spliced to generate several transcripts, containing various combinations of the variable exons, and make a family of protein isoforms that are called CD44 variants, or CD44v. ESRP1 binds to the intronic region of a CD44 variable exon and causes variable exon inclusion. (Adapted from (Biddle et al, 2013).

There are also 10 variable exons between exon 5-16 that are alternatively spliced to produce the variable isoforms, CD44v (1-10), which have more restricted expression patterns.

The inclusion of the variant exons extends the glycosylation and glycosaminoglycan (GAG)- binding sites, which provide additional binding sites for hyaluronan (Prochazka et al, 2014;

Zoller, 2011).

Warzecha et al (2009a) showed ESRPs are necessary for switching of CD44 isoforms during EMT. They examined CD44v8-10 expression in prostate epithelial cell line (PNT2) cells depleted of ESRP1 and ESRP2 and showed significant reduction of CD44v8-10 in these cells, while CD44s expression increased in the same cells. These data suggest that ESRP1 is necessary for switching of CD44s to CD44v isoforms. Moreover, Brown et al, (2011) showed

CD44s expression in mesenchymal cells can be induced by downregulation of ESRP1 (Brown et al, 2011).

1.6. Regulation of ESRP1 expression

To better understand the role of ESRP1 in EMT and AS regulation, it is important to understand how its expression is controlled by other transcriptional regulators. Several studies revealed that ESRP1 was inactivated when EMT was induced in human mammary epithelial cell lines (HMLEs) by the mesenchymal transcription factor Twist1 (Brown et al, 2011;

Shapiro et al, 2011; Warzecha CC, 2010). Furthermore, there is some evidence that transcriptional repressors including SNAIL (Reinke et al, 2012), δ-crystallin enhancer binding protein (δEF1, also called zinc finger E-box binding homeobox 1, ZEB1) and Smad-interacting protein 1 (SIP1 or ZEB2) downregulate ESRP1 expression during EMT (Horiguchi et al, 2012).

Since SNAIL signaling also induces ZEB1 expression, this may be the mechanism by which

SNAIL represses ESRP1 expression (Guaita et al, 2002; Reinke et al, 2012). Also, Horiguchi et al (2012) showed, by chromatin immunoprecipitation assay, that δEF1 and SIP1 bind directly to the promoters of ESRP genes. Positive regulation of ESRP1 has not been well-examined but

Roca et al (2013) showed that the transcription factors OVOL1 and OVOL2 promote ESRP1 expression during MET. Another transcription factor that can induce ESRP1 expression is

Grainyhead-like protein 2 (GRHL2; (Ray & Niswander, 2016; Xiang et al, 2012). Ray &

Niswander (2016) found that Grhl2 null mutation resulted in down-regulation of Esrp1 in non- neural ectoderm of mouse. Furthermore, it has been shown that ectopic GRHL2 expression in

MDA-MB-231 breast cancer cells elicits a mesenchymal-to-epithelial transition and consequently induces ESRP1 expression (Cieply et al, 2012). As GRHL2 directly represses the

EMT-promoting transcription factor, ZEB1, and ZEB1 is suppressor of ESRP1, the induction of ESRP1 by GRHL2 may be via repression of ZEB1 (Cieply et al, 2012).

Apart from transcription factors that regulate ESRP1 expression, several proteins have been identified as working with ESRP1 to control AS. PININ (PNN) is a transcriptional activator that binds to the E-cadherin promoter and has a key role in differentiation of the

corneal epithelium (Joo et al, 2013). PNN showed a close localization with ESRP1 in human corneal epithelial cells (HCET) and transcriptome analysis on these cells, after ESRP1 or PNN knock-down, displayed splicing changes in a specific subset of genes, suggesting that ESRP1 and PNN have similar effects on cellular responses (Joo et al, 2013). The RNA-binding Fox

(RBFOX) proteins are also important regulators of AS during EMT. All members of this family (RBFOX1, RBFOX2 and RBFOX3) bind to the same UGCAUG sequence that is recognized by ESRPs, and AS of some ESRP targets, such as ENAH and FGFR2, are co- regulated by RBFOX2 (Braeutigam et al, 2014; Yae et al, 2012).

Lastly, in a recent study a correlation between ESRP2 and RNF111, also known as

Arkadia, has been shown in clear-cell carcinoma (ccRCC; (Mizutani et al, 2016). RNF111R is a ubiquitin-protein ligase that has a role in vertebrate development by enhancing TGF-β signalling activities (Miyazono & Koinuma, 2011). Consistent with a bidirectional role of

TGF-β signalling in progression of cancer, RNF111R can positively or negatively be involve in cancer progression. Mizutani et al (2016) showed that RNF111R by ubiquitination of ESRP2 in the second and third RRM motifs regulates its splicing activity and consequently suppresses the progression of ccRCC.

Taken together, various genes and regulatory mechanisms can regulate the expression of the ESRPs or modulate their activity during splicing events that underlie EMT (Figure 1. 7).

Figure 1. 7: Regulation of ESRP1; ESRP1 can be regulated by different factors. Factors inducing ESRP1 and ESRP2 functions are shown as arrows, while hammerheads present inhibitors (Gottgens et al, 2016).

1.7. ESRP1 function, expression, and localization

Since the tissue-specific splicing regulatory role of RBM35A/B proteins were first demonstrated, many researchers have investigated the expression pattern of ESRP1 and 2 in different cell lines, and in embryonic and adult tissues.

In initial studies, expressions of ESRPs in different epithelial cell lines, including ZR75,

SKBR3, MCF7, LNCaP, and OVCAR3, were compared with mesenchymal cell lines, such as

MDA-MB-231, BT-549, OVCAR5, and Du145, with highest expression of ESRPs reported in epithelial cell lines (Warzecha et al, 2009a). As outlined above, various studies using ectopic expression or knock-down strategies have capitalised on the properties of various cell lines to identify the mechanisms by which the ESRPs regulate EMT/MET by controlling the splicing patterns of key epithelial genes, such as FGFR2, CD44, CTNND1, and ENAH (Brown et al,

2011; Dittmar et al, 2012; Warzecha et al, 2009b).

As mentioned before, EMT is a critical event in development and gastrulation. It has been reported that Esrp1 is expressed ubiquitously in embryonic day (E) 6.5 in mice, then becomes restricted to the chorion and definitive endoderm at E7.5. During later stages, E8.5-

E12.5, the expression of this gene becomes limited to a subset of epithelial cell types such as nephrogenic cords, developing tooth buds and testis cords (Revil & Jerome-Majewska, 2013).

However, Sherwood et al (2007) reported that Esrp1 was highly enriched and expressed in endoderm at E8.5 in the mice. It should be noted that from E9.5 to E11.5 Esrp1 and Esrp2 expression in the mouse placenta is higher than in the embryo (Revil & Jerome-Majewska,

2013). Furthermore, a genomewide transcriptome study of the developing human embryo revealed that the expression of ESRP1 decreases during 20–32 weeks gestation in humans, which is equivalent to E9-11.5 in mice (Fang et al, 2010).

Moreover, Esrp1 expression in different epithelial tissue sections of postnatal day1 (P1) and adult mouse by in-situ hybridization was demonstrated, with the highest expression level found in skin, gastrointestinal tract, olfactory epithelia and intestine (Warzecha et al, 2009a).

More recently, it has been shown that Esrp1 deletion in mouse results in neonatal lethality and embryonic mice display cleft lip and palate defects while Esrp1/Esrp2 double knockouts showed more severe phenotypes in organ development (Bebee et al, 2015). Also,

Esrp1 -/- mice at E18.5 showed defects in kidney development with reduced ureteric branching and a decrease in nephron numbers (Bebee et al, 2016). These studies highlight the essential role of ESRPs in organ development.

Notably, it was found that along with induction of MET, mouse embryonic fibroblasts

(MEFs) can be reprogrammed to create pluripotent stem cells (iPSCs) (Polo et al, 2012). MET occurs in MEFs during the initiation phase of reprogramming and induces activation of ESRPs, it suggests a role for ESRPs in promoting of splicing changes during phase (Li et al, 2010;

Samavarchi-Tehrani et al, 2010). Since ESRP1 is the most highly upregulated gene during

MET, it might be considered as an additional reprogramming factor to induce the production of iPSC (Li et al, 2010).

Fagoonee et al (2013) have implicated Esrp1 in the differentiation of embryonic stem cells by regulating pluripotency. Knock-down of Esrp1 expression in mouse embryonic stem cells resulted in increased expression of the core pluripotency factors Oct4, Nanog and Sox2, measured at both mRNA and protein levels and also resulted in a higher rate of proliferation compared to controls. However, ESRPs appear not to be necessary for maintenance of pluripotency as embryonic stem cells with double-knock down of ESRPs still express the core pluripotency factors (Cieply et al, 2016).

Together these two studies suggest that ESRP1 may play a role in regulating pluripotency. However, to date, very little work has been conducted into the expression and function of ESRP1 during germ cell development. As AS is a very frequent event in the ovary and testis, we hypothesised that ESRP1 expression may have effects during spermatogenesis and oogenesis.

1.8. Germ cell development

During development, mouse germ cells arise from epiblast cells that differentiate into primordial germ cells and migrate to the gonadal ridges to form the germ line, which has the potency to differentiate into either sperm or oocytes (McLaren, 1983).

Germ cells that populate the mammalian male gonad testicular cords are called gonocytes and undergo mitotic division to produce spermatogonial stem cells (SCC) or spermatogonia near the basement membrane of the seminiferous cords (Manku & Culty, 2015;

Oatley & Brinster, 2012). The SCC, also known as the Ad spermatogonia stay in the basal compartment of the seminiferous tubule. By contrast, the Ap spermatogonia are actively dividing stem cells that differentiate into Type B spermatogonia, which move towards the

lumen and differentiate into primary spermatocytes. The primary spermatocytes undergo the first meiotic division producing two secondary spermatocytes. Meiosis is completed by division of secondary spermatocytes to produce spermatids. These spermatids transform into spermatozoa (Holstein et al, 2003).

In female gonads, germ cells produce oogonia. Most of the oogonia transit to primary oocytes (Hartshorne et al, 2009; McClellan et al, 2003), and the rest are removed by apoptosis

(Albamonte et al, 2008). Following this step, meiosis I begins but primary oocytes arrest at diplotene of Prophase I. During this period of arrest, which usually occurs before birth in most mammals and can vary from a few days to many years, depending on the species, primary oocytes synthesize a protein coat (zona pellucida) and cortical granules (Eppig & Downs,

1984). From puberty, a cohort of the primary oocytes complete meiosis I and produce a haploid secondary oocyte and a haploid first polar body. These secondary oocytes resume meiosis II where they re-arrests at metaphase II. The secondary oocyte will only complete meiosis if fertilization occurs, when the second polar body will be formed (McLaren & Southee, 1997)

(Figure 1. 8).

Figure 1. 8: Germ cell development; Primordial germ cells are derived from a group of cells in the epiblast. These cells migrate to the gonads. In male (upper row), PGCs produce gonocytes. They will undergo multiple rounds of mitosis and then meiosis produces spermatids and mature sperm. In female (lower row), PGCs undergo mitosis and then meiosis generates primary oocytes, which arrest in the late fetal stage, and only some of them will reactivate after puberty to complete meiosis I and begin meiosis II and are re-arrested at metaphase II until fertilisation. (Adapted from Schuh-Huerta et al, 2011).

1.9. Alternative splicing in germ cell development

There are many pathways and genes involved in AS events during germ cell development as each step requires a specific profile of gene expression (Eddy, 1998; Margolin et al, 2014; Paronetto et al, 2011; Schmid et al, 2013). Appropriate expression of these genes can be controlled at the transcriptional level by transcription factors and at the post- transcriptional level by AS (Chalmel & Rolland, 2015; Paronetto et al, 2011).

Examples of AS factors in the testis include the meiotic regulators, DNA meiotic recombination protein 1 (DMC1) and MutS Homolog 4 (MSH4), which are functionally conserved from yeast to humans. In mice lacking these genes, spermatogenesis is arrested in the zygotene stage of meiosis I (Yoshida et al, 1998). DMC1 includes domains; an ATPase motif and a DNA binding site. The ATPase motif acts as a catalytic domain and is important for DNA binding (Kinebuchi et al, 2005). AS of DMC1 produces two spliced isoforms in germ cells, each having specific roles. The longer DMC1 isoform, which has an extra region

encoding 55 amino acids, is not expressed in somatic cells. The shorter isoform showed lower

ATPase activity (Wolgemuth et al, 2002). The MSH4 gene is only expressed in the testis and ovary and has a role in meiotic recombination. Similar to DMC1, MSH4 can exist as two AS isoforms; MSH4 and ΔMSH4. ΔMSH4 lacks exon 5. Production of this non-functional mRNA variant by AS, results in inactivation of hMSH4 expression in somatic tissues (Santucci-

Darmanin et al, 1999).

In addition, several regulatory genes that regulate gene expression are themselves alternatively spliced. For instance: there are two different mRNA isoforms of Sox17 gene.

One is Sox17, which produces a Sry-related protein containing a high mobility group box

(HMG), while the other is t-Sox17, which lacks the HMG box and does not have DNA-binding activity. Sox17 splicing switching to t-Sox17 expression, leads to loss of post-meiotic germ cell activity of Sox 17. This isoform replaces the normal message during male meiosis (Kanai et al, 1996).

SOX9 is another member of SRY-related gene family that promotes differentiation of

Sertoli cells and is essential for male sex determination (Kent et al., 1996). SOX9 requires fibroblast growth factor 9 (FGF9) during testis differentiation. It seems that FGFR2 as a receptor for FGF9 in the gonad, plays a pivotal role during testis determination. FGFR2 showed a nuclear localization in Sertoli cells (Kim et al, 2007b). Moreover, Kim et al (2007b) showed expression of only Fgfr2IIIc in isolated pre-Sertoli cells, whereas in the migrating coelomic epithelial cells which become Sertoli cells as well as interstitial cells of the gonad both

Fgfr2IIIb and Fgfr2IIIc are expressed (Karl & Capel, 1998). Also, it has been shown that

FGFR2IIIb is expressed in FACS sorted primordial germ cells (PGCs) not FGFR2IIIc. In addition, in Fgfr2IIIb–/– embryos, the numbers of germ cells are signiﬁcantly reduced, which confirms a role of FGFR2IIIb in PGCs (Takeuchi et al, 2005). These data, suggest that

regulation of alternative splicing of FGFR2 may impact on differentiation of Sertoli cells and

PGC proliferation.

Heat shock transcription factor 2 (HSF2) is a transcriptional regulator essential for the function of HSP70.2, which has been shown to have an important role in spermatogenesis

(Eddy, 1999). HSF2 has two isoforms, which have distinct expression at different stages of spermatogenesis. HSF2-α was expressed during stages I-VII but not detected at later stages, whereas HSF2-ß, which is smaller due to lack of 18 amino acids, not only has higher levels of protein expression than HSF2-α but is also expressed during all stages of spermatogenesis

(Alastalo et al, 1998).

AS during ovarian germline development remains largely undefined, but there are some examples of AS genes and splicing factors in the ovary. Embryonic poly (A) binding protein

(EPAB) is involved in the regulation of maternal mRNA translational activation during oocyte maturation (Padmanabhan & Richter, 2006; Vasudevan et al, 2006). Alternate splicing of

EPAB exon 8 produces short and long isoforms, with omission of exon 8 resulting in loss of the necessary EPAB domain in the short isoforms, while inclusion of exon 8 results in a full- length isoform, which is necessary for oocyte and early embryonic development (Guzeloglu-

Kayisli et al, 2014). Other genes such as cubitus interruptus (Ci) in Drosophila and Gli proteins in mammals have AS isoforms. These proteins are the transcriptional effectors of the

Sonic hedgehog (Shh) signalling pathway, which is required in many tissues for embryonic patterning, cell proliferation, and differentiation. It has been shown that skipping exon 3, or exons 4 and 5 in GLI2 generates two alternatively spliced forms in the ovary and testis (Speek et al, 2006).

As we can see, there are various genes expressed in the ovary and testis with AS isoforms that have diverse roles in germ cell development and gametogenesis. However, the key splicing regulators that control tissue-specific AS events need further investigation.

1.10. ESRP1 and carcinogenesis

Recent studies have shown that deregulation of EMT can lead to cancer. The majority of cancers originate from epithelial cells (carcinomas) but will acquire mesenchymal features in advanced and aggressive states (Thiery et al, 2009; Ye & Weinberg, 2015). Although EMT occurs during the invasiveness and metastatic stages, there is evidence that indicates MET is also important for the late stages of metastasis (Hugo et al, 2007). On the other hand, disruption of AS can also result in cancer and it has been demonstrated that splicing patterns of various genes are altered during cancer progression (Hanahan & Weinberg, 2011; Oltean & Bates,

2014). Cancer-specific AS events can affect genes that have roles in cellular proliferation (e.g.

FGFR2), cellular adhesion (CTNND1), and invasion (CD44) (Pajares et al, 2007; Skotheim &

Nees, 2007). As ESRP1 is involved in MET and regulation of AS of different genes, several studies have revealed the potential role of ESRP1 in cancer progression.

To date, down-regulation of ESRP1 has been reported in various cancer cell lines including breast, prostate, pancreas and head and neck squamous cell carcinomas (HNSCCs), suggesting a tumour suppressor role for ESRPs (Horiguchi et al, 2012; Ishii et al, 2014; Lu et al, 2015; Ueda et al, 2014). This contention is supported by other studies showing that downregulation of ESRP1 leads to mesenchymal characteristics that are necessary for cancer progression (Brown et al, 2011; Horiguchi et al, 2012).

A study of HNSCCs carcinoma found that the expression levels of ESRPs were low in normal epithelium, but increased in carcinoma in situ, and diminished in invasive fronts, suggesting not only dynamic expression patterns as cancers develop but a negative regulatory role for ESRPs during metastasis. Also, it has been verified by other studies that ESRPs suppress cell motility in different cancer cell types, such as human mammary epithelial cells

(Warzecha et al, 2010) and clear cell renal carcinoma (Mizutani et al, 2016), potentially by a

mechanism that involves down-regulation of Rac1b and δEF1/SIP1, as demonstrated in

HNSCCs by Ishii et al (2014).

In contrast to the suggested tumour suppressor role for ESRP1, a recent study has shown that ESRP1 overexpression can induce human colorectal cancer (CRC) progression (Fagoonee et al, 2017). Moreover, Ueda et al (2014) showed that overexpression of ESRP1 results in increased invasiveness in pancreatic cancer. Taken together, these findings lead to the suggestion that ESRPs may positively or negatively affect cancer progression and its role is cancer type specific (Hayakawa et al, 2017).

Although several studies indicated the role of ESRP1 in different tumour types, its role in gonadal cancer is less understood. There is evidence that points to a strong link between

ESRP1 targets, CD44 and FGFR2, in gonadal cancer. Steele et al (2006) have revealed that the expression of FGFR2IIIb ligands (FGF1, FGF7, and FGF10) in epithelial ovarian cancer cell lines increased proliferation and motility of the cells (Steele et al, 2006). Furthermore, a correlation between CD44v6 expression and poor prognosis in ovarian serous carcinomas patients has been reported (Wang et al, 2014). Consistent with this study, Zhou et al (2012) suggested CD44v6 can be used as a molecular marker for poor prognosis in ovarian cancer.

By contrast, other studies did not observe any differences in CD44v6 expression between benign or metastatic ovarian lesions (Bar et al, 2004; Sakai et al, 1999). Therefore, to determine the exact role of CD44v6 in ovarian cancer further investigation will be required. The expression of CD44 in testicular cancer also is reported. Miyake et al (1998) have shown

CD44s is expressed in all seminoma and non-seminoma testicular germ cells tumours

(NSGCTs), whereas CD448-v8-10 is only expressed in NSGCTs.

In a recent study conducted by Jeong et al (2017) using the Cancer Genome Atlas

(TCGA) data analysis, ESRP1 and ESRP2 expression in normal ovaries were compared with ovarian cancer tissues. They found that ESRP1 gene expression is signiﬁcantly higher in

ovarian serous carcinoma than normal ovarian tissues, while ESRP2 expression did not change significantly. They confirmed these results by RT-qPCR on ovarian cancer cell lines and immunostaining on ovarian cancer tissues. However, they did not provide any information about ESRP1 mRNA expression in ovarian normal and carcinoma tissues. Also, it is not clear if ESRP1 expression may change during progression in other ovarian cancer cell types, including mucinous carcinomas. Furthermore, they found that ESRP1 overexpression in an ovarian cell line can drive a switch from mesenchymal to epithelial isoforms in CD44 and

ENAH but not FGFR2 which is not consistent with the role of ESRP1 as a regulator of FGFR2 splicing (Jeong et al, 2017). While these findings suggest a role for ESRP1 in ovarian and testicular cancers, further investigation is needed.

1.11. Hypothesis

AS occurs in germ cells and is crucial during gametogenesis. Many of the targets of

ESRP1 are expressed in germ cells and are important for their development. However, there is very little information about the role of ESRP1 in AS in germ cells. Similarly, although

ESRP1 splicing plays a role in MET and AS, very little is known about its role in ovarian or testicular cancers. Based on the known role for ESRP1 in EMT and AS, I hypothesize that

ESRP1 is required during gametogenesis and therefore its dysregulation may contribute to the progression of gonadal cancers.

To address this hypothesis, the aims of the current study are:

1. To examine the expression of ESRP1 in fetal and post-natal gonadal development in mice. 2. To examine phenotypes were resulted from overexpressing or knocking down fusilli expression in testis. 3. To examine ESRP1 expression in cancerous ovary and testis in human. 4. To identify potential ESRP1 targets in testicular germ cell tumor (TCam-2 cell line).

Chapter 2. Materials and methods

2.1. Molecular biology

2.1.1. RNA extraction

Total RNA was extracted using RNeasy mini kits (Qiagen, Chadstone VIC, Australia) with on column DNAse I (Qiagen) digestion as per manufacturer’s instructions. For RNA isolation from cultured cells, following lysis the lysate was passed through QIAshredder (Qiagen), before continuing as per manufacturer’s instructions.

2.1.2. RNA quality

The quality and quantity of isolated total RNA was assayed using an Agilent 2200 Tape

Station (Agilent Technologies, Mulgrave VIC, Australia), which generates an RNA integrity number (RIN 1-10) as an assessment of the quality of the total RNA sample. Briefly, 1μl of RNA was mixed with 5µl of the supplied sample buffer (Agilent technologies 5067-5583 D1000) and mixed by vortex for 1 min in an Optical Tube 8x Strip (401428). The samples were heated at 72°C for 3 min, cooled on ice for 2 min and then, following centrifugation, loaded into the Agilent 2200

TapeStation system for analysis. All RNA samples, isolated from mouse tissues and cultured cells had a RIN>7 number, indicating high quality total RNA. However, the RNA isolated from human tissues, supplied by the Tissue Bank, had a RIN>5.

2.1.3. cDNA synthesis

2.1.3.1 Mouse

A total of 200 ng total RNA was reverse transcribed using iScript™ Advanced cDNA

Synthesis Kit (Bio-Rad, Cat. No. 170-8842, Australia) in a 20 μl reaction containing 4μl 5X iScript™ reaction mix and 1μl reverse transcriptase. Following incubation for 20 min at 46°C the

reaction was terminated by incubation for 1 min at 95°C. Samples were either used immediately or stored at -20°C until use.

2.1.3.2 Human

cDNA was prepared from 200 ng RNA of human tissues using SensiFAST™ cDNA

Synthesis Kit (Bioline, Cat. No. BIO-65053, Australia) according to manufacturer’s instruction.

Briefly, RNA (200 ng), 4 µl of 5x TransAmp Buffer, 1 µl of Reverse Transcriptase, and 0-15 µl

RNase free-water were mixed in a total volume of 20 µl. cDNA synthesis conditions were 25o C for 10 min (Primer annealing), 42o C for 15 min (reverse transcription) and 85o C for 5 min.

Alternatively, reaction products were stored at -20o C.

2.1.4. Droplet digital PCR

Droplet digital PCR (ddPCR) was conducted using a Qx100TM Droplet DigitalTM PCR system (Bio-Rad). Each 25 μl PCR reaction mixture contained 12.5 μl of 2x ddPCR Supermix

(Bio-Rad-186-3010), 1.25 μl of 20X Primer/Probe mix including 1 M of each forward and reverse primers and 0.5 M probe (Table 2. 1), 1μl of sample cDNA (100 ng/μl) and 10.25 μl sterile nuclease-free water. The PCR reaction mixture was loaded into an 8-well DG8 TM Cartridge (Bio-

Rad) and an emulsion of ~20.000 monodispersed droplets was created using the Bio-Rad QX100TM

Droplet Generator. The droplets were then transferred to a 96-well plate and sealed with a Bio-

Rad PX1TM PCR Plate Sealer before being amplified by Bio-Rad C1000 Touch TM thermal cycler with the following cycling conditions: 95ºC for 10 min, followed by 40 cycles of 94ºC for 30 s and 60ºC for 1 min, followed by a final 10 min enzyme deactivation step at 98 ºC (ramp rate =

2ºC/s). Droplets were then analysed by Qx100 Droplet reader (Bio-Rad) for fluorescent measurements of FAM/HEX probes. The numbers of positive and negative droplets read in each

channel were quantified by the QuantaSoftTM v.1.7.4.0917 (Bio-Rad) software to calculate the concentration of the target DNA sequences.

Table 2. 1: Primer and probe sequences

Gene – Probe 5’ Amplicon Primer/Probe Sequences in 5’-3’ orientation with fluorophore Supplier/Catalogue # Primer/Probe fluorophore Size (bp) Canx Fw CACATAGGAGGTCTGACAGC Rev AATTATCTACCCAGGCACCAC IDT Probe HEX/TCGGGTCCT/ZEN/CTGGAGCACAAGGCTTT/3IABKFQ HEX 89 ** Mapk1 Fw CCTTCAGAGCACTCCAGAAA Rev AATCTATGCAGTTTGGGATACAAC IDT Probe HEX/TCTGCTCTG/ZEN/TACTGTGGATGCCTT/3IABKFQ HEX 93 ** Esrp1 Fw TCCTTCTGTCTCTGTACTGACG Rev GGAATAGAAGCACTCAGGCA IDT Probe FAM/AGATCTTGC/ZEN/ATCCCGAGGCTTCC/3IABkFQ FAM 99 * Mmpt.56a.2875884 Taqman Ppia Sequences not available for Taqman probes FAM 112 Mm02342429_g1 RPL4 Fw CCTTTTTGATATCATTCCAGGCTT Rev GCACTGGTCATGTCTAAAGGT 145 IDT Probe FAM/TCCTTTGGT/ZEN/AGTTGAAGATAAAGTTGAAGGCT/3IABkFQ FAM * Hs.PT.58. 22795454.g RPLP0 Fw GAACACAAAGCCCACATTCC Rev GAAGGCTGTGGTGCTGAT 124 IDT Probe HEX/TCGAGGGCAC/ZEN/CTGGAAAACAACC/3IABkFQ HEX * Hs.PT.58. 3280405.g TBP Fw CATATTTTCTTGCTGCCAGTCTG Rev GCTGCGGTAATCATGAGGATA IDT Probe HEX/AAATCAGTG/ZEN/CCGTGGTTCGTGG/3IABkFQ HEX 121 * Hs.PT.58.19838260 CD44S Fw CCGACAGCACACAGACAGAAT Rev TTCAGATCCATGAGTGGTATGG 86 IDT Probe FAM/ACCAGAGACCAAGACACATTCCACC FAM ** CD44V6 Fw CCAGGCAACTCCTAGTAGTACA Rev GGGAGTCTTCTTTGGGTGTTT 107 IDT Probe FAM/ACCAGAGACCAAGACACATTCCACC FAM ** Fgfr2IIIb Fw CTGTTCAATGTGACCGAGGC Rev CTCCTTTTCTCTTCCAGGCG 129 IDT Probe FAM/ATATAGGGC/ZEN/AGGCCAACCAGTCTG/3IABkFQ FAM ** Fgfr2IIIc Fw AGGACGCTGGGGAATATACG Rev CTCCTTTTCTCTTCCAGGCG 101 IDT Probe FAM/TGCTTGGCG/ZEN/GGTAATTCTATTGGGA/3IABkFQ FAM ** Zeb1 Fw CCTTCTGAGCTAGTATCTTGTCTTTC Rev GGCATACACCTACTCAACTACG 108 IDT Probe FAM/AGAACCACC/ZEN/CTTGAAAGTGATCCAGC/3IABkFQ FAM * Hs.PT.58.39178574 Cdh1 Fw CTGGTTATCCATGAGCTTGAGA Rev CCATTCAGTACAACGACCCA 104 IDT Probe FAM/ACCCACCTC/ZEN/TAAGGCCATCTTTGG /3IABkFQ FAM * Hs.PT.58.1930183 * Pre-existing assay provided as readymade primers by IDT; ** Primers designed specifically for this project.

2.1.4.1 Statistical analysis

Data from each ddPCR experiment was normalized to the geometric mean of reference genes (Mapk1, Canx, Ppia, RPL4, RPLP0, TBP) based on sample types (Fu et al, 2010; van den Bergen et al, 2009) and expressed as copies/μl (mean ± S.E.M.) Then the GraphPad Prism

7.03 (GraphPad Software, USA) was used for data analyzing. One-way analysis of variance

(ANOVA) and student’s unpaired t-test were performed for statistical analysis. *, **, *** indicates p < 0.05, p < 0.01, and p < 0.001 respectively for each comparison.

2.2. Histology and Immunohistochemistry

2.2.1. Haematoxylin and eosin staining

Human gonadal tissue as frozen samples and as haematoxylin and eosin (H&E) stained slides were obtained from the Victorian Cancer Biobank or from Debra Gook at Reproductive

Services, Women's Hospital, Melbourne. Images of these sections were captured using Zeiss

Axioskop II microscope, linked to Axioviosion Imaging software (Carl Zeiss, Melbourne, VIC,

Australia).

2.2.2. Immunofluorescence

Immunofluorescence, with 0.01% acidic citrate buffer antigen retrieval, was performed on paraffin sections (7 µm). Following dewaxing, sections were blocked with 3% normal horse serum in 0.1% BSA/PBS (blocking solution) for 30 min before being incubated overnight at

4°C with primary antibodies to various proteins (see Table 2. 2 for details of dilutions and source). Control sections were incubated with non-immune rabbit IgG to control for non- specific reactivity. Reactivity was visualized using appropriate secondary antibodies conjugated to Alexafluor-488 or Alexafluor-596 (Invitrogen, Australia), diluted 1:500 in

PBS/0.1% BSA and incubated for 120 min at room temperature (RT). After rinsing in

PBS/BSA, sections were stained with 1μg/ml Hoechst dye (Sigma, Castle Hill, Australia) for

5 min to label nuclei.

Table 2. 2: Antibodies and corresponding methods Antigen/Spices Conjugate Host Dilution Source Method 1:50/1:100 HPA023719 IF ESRP1 Rabbit 1:250 Sigma Alderich WB AF1356 IF c-KIT Goat 1:250 R &D system AF2944 IF PLZF Goat 1:500 R &D system BMS125 IF CD44/V6 Mouse 1:500 eBioscience Sc-5279 IF OCT4 Mouse 1:50 Santa Cruz A/Prof Wilhelm lab IF SOX9 Sheep 1:100 (Melbourne University) SC35 ab11826 IF Mouse 1:250 Abcam A5441 Anti-β-Actin Mouse 1:5000 WB Sigma Alderich ab27478 IF IgG/Rabbit Rabbit 1:1000 Abcam IgG/Mouse HRP Donkey 1:20000 Invitrogen WB IgG/Rabbit HRP Donkey 1:20000 Invitrogen WB IHC: Immunofluorescence, WB: Western blotting.

2.2.3. Confocal microscope imaging

Confocal imaging was performed on a Zeiss LSM800 confocal microscope (Carl Zeiss,

Melbourne, VIC, Australia) in the Department of Anatomy and Neuroscience at the University of Melbourne. Image acquisition was performed using Zeiss Zen 2.3 (blue edition) software.

Chapter 3. Esrp1 is a marker of mouse fetal germ cells and differentially expressed during spermatogenesis

This chapter was published in PLoS One as “Saeidi S et al. Esrp1 is a marker of

mouse fetal germ cells and is upregulated in spermatogonia. PLoS ONE. 2018; 13(1).”

3.1. Introduction

Germ cells exhibit unique profiles of gene expression that distinguish them from somatic cells (reviewed in (Wrobel & Primig, 2005)) and utilise specific transcriptional regulators, which produce transcripts that differ from those observed in other tissues (White-

Cooper & Davidson, 2011). Transcript diversity also derives from an extensive array of post- transcriptional regulation that is present in differentiating germ cells including extensive alternative splicing of pre-mRNA molecules that amplifies the number of proteins produced from a finite number of genes (Bao et al, 2014; Iwamori et al, 2016; Margolin et al, 2014;

O'Bryan et al, 2013; Ortiz et al, 2014; Paronetto et al, 2011). Genome-wide analyses of alternative splicing of transcripts in the gonads of Drosophila and mice, have demonstrated the existence of many germ-cell specific protein isoforms (Gan et al, 2010; Margolin et al,

2014) and a high frequency of alternate splicing events in the testis (Elliott & Grellscheid,

2006; Schmid et al, 2013). The Drosophila study also identified RNA splicing factors that are highly enriched in pre-meiotic cells (Gan et al, 2010). While the core elements of the RNA splicing mechanism are ubiquitously expressed and regulate mRNA splicing in all cells, splicing profiles differ between cells (Will & Luhrmann, 2011), suggesting that tissue specific regulators generate cell specific splicing events. In pursuit of this hypothesis, Warzecha et al

(2009a) conducted a genome wide screen to identify new factors that could uniquely promote splicing in epithelial cells. Among various factors, two protein paralogues were found to cause epithelial specific splicing patterns. Previously, these proteins were known as RNA binding motif proteins 35A and 35B (RBM35A and RBM35B). Expression of both genes was highly cell type specific, but up-regulation of both genes was generally observed in epithelial cell types. These proteins were thus renamed epithelial splicing regulatory proteins 1 and 2 (ESRP1 and ESRP2)(Warzecha et al, 2009a).

Up-regulation of ESRP1 and ESRP2 expression coincides with the earliest changes in global gene expression associated with the mesenchymal to epithelial transition and induction of pluripotency during iPS cell generation (Li et al, 2010; Samavarchi-Tehrani et al, 2010).

Moreover, a recent study of alternative splicing events, which occur during reprogramming of mouse embryonic fibroblasts to iPS cells, identified enrichment of ESRP1 binding sites upstream of alternatively spliced exons. Subsequent knockdown of ESRP1/2, followed by

RNA-Seq analysis demonstrated that ESRP1/2 dependent splicing events occur during the induction of pluripotency (Cieply et al, 2016).

Mouse spermatogonial stem cells, in addition to their capacity to repopulate germ cell- depleted seminiferous tubules (Brinster & Zimmermann, 1994), display pluripotent characteristics when isolated and cultured under the same conditions as embryonic stem cells

(Guan et al, 2006; Izadyar et al, 2008; Kanatsu-Shinohara et al, 2008; Seandel et al, 2007) including expression of pluripotency markers (e.g. Oct4, Nanog, Rex-1), differentiation along mesodermal and neuroectodermal lineages, formation of teratomas when injected into SCID mice and generation of chimeras when injected into host blastocysts (Guan et al, 2006; Izadyar et al, 2008; Kanatsu-Shinohara et al, 2008; Seandel et al, 2007). Similarly, pluripotent cells have been isolated from human testes (Golestaneh et al, 2009; Kossack et al, 2009) but appear to be less competent or not as efficient as ES cells in forming chimeras and teratomas (reviewed in (Kuijk et al, 2011)). Comparison of rodent adult germline stem cells with ES cells by expression profiling demonstrated that they are almost identical, express the same level of pluripotency genes and respond similarly in differentiation assays (Meyer et al, 2010).

Given the high level of alternate splicing during spermatogenesis and the association of

ESRP1 with pluripotency, we were interested in examining the expression of ESRP1 during the development of male and female germ cells. Germ cells in the mouse are derived from a small number of cells present in the epiblast at E6.25 (embryonic day 6.25 after fertilization)

that receive a BMP signal from extraembryonic ectoderm. After limited proliferation, these cells migrate, by both passive and actively directed transport and are found by E11.5 in the genital ridges, which are the gonadal precursors. By day E13.5 male fetal germ cells down regulate pre-meiotic genes, enter mitotic arrest and are termed gonocytes, whereas female embryonic germ cells differentiate into oogonia, which enter meiosis and arrest in prophase I.

By birth, the majority of oogonia have either degenerated, or developed into primordial follicles, that remain in meiotic arrest unless selected for maturation during the adult female reproductive cycle. By contrast, gonocytes remain mitotically arrested until around post-natal day 3 in males, before re-entering the cell cycle and forming spermatogenic stem cells within the seminiferous tubules. The spermatogenic stem cells subsequently produce spermatogonia that will differentiate into spermatocytes. Each spermatocyte undergoes two meiotic divisions to produce four haploid round spermatids that undergo a morphological change to produce elongating spermatids, and eventually, mature spermatozoa (reviewed in (Ewen & Koopman,

2010)).

In this study we identify that Esrp1 is transcribed in fetal germ cells and in perinatal gonocytes/spermatogonia and shows enriched expression in adult spermatogonia. In addition, we show that ESRP1 protein is most highly expressed in nuclei of pre-meiotic germ cells in adult testes and demonstrate that ESRP1 regulates alternative splice selection of mRNAs in a germ cell-derived cell line.

3.2. Materials and methods

3.2.1. Experimental animals

All animal procedures were approved by the Animal Ethics Committees of the

University of Melbourne, the Murdoch Children’s Research Institute and the University of

Newcastle. Mice (FVB, C57Bl6/J, CD1, and OG2) were maintained under standard housing

conditions with ad libitum access to rodent chow and water and under a 12 hour dark, 12 hour light cycle. Wild-type mouse strains were obtained from ARC (Murdoch WA, Australia) and maintained as inbred colonies. OG2 mice (Jackson Lab Stock 004654), which express enhanced green fluorescent protein under the control of the Pou5f1 promoter and distal enhancer (Szabo et al, 2002) were maintained as homozygous transgenic strain on a C57Bl6/J background (van den Bergen et al, 2009).

3.2.2. Isolation of gonadal germ and somatic cells

Fetal gonadal germ and somatic cells were isolated as previously described (Shapouri et al, 2016; van den Bergen et al, 2009). Briefly, fetal (E12.5 –E15.5) gonads were dissected and dissociated cells were fluorescent-activated cell sorting (FACS) to isolate GFP+ germ cells and GFP- somatic cells. The identity of each isolated cell type was confirmed by immunofluorescence for specific germ cell (OCT4, MVH) and somatic cell (SOX9) markers

(van den Bergen et al, 2009).

Testes from 1 day (for isolation of gonocytes/spermatogonia), 8–10 day

(spermatogonia) and 8 week (pachytene spermatocytes and round spermatids) old wild-type mice were dissociated using a combination of 0.5 mg/ml collagenase and 0.25% trypsin and separated on 2–4% continuous bovine serum albumin (BSA) gradient as described previously

(Baleato et al, 2005; Bellve et al, 1977). RT-ddPCR was used to confirm the identities of the separated cell populations as described (Ccnd1 and Ngn3 were used to show enrichment of gonocytes/spermatogonia) (McIver et al, 2012), Dnah8 showed enrichment of pachytene spermatocytes and Tob1 showed enrichment of round spermatids (Shapouri et al, 2016). We obtained three independent biological replicates of enriched gonocytes, spermatogonia and pachytene spermatocytes but only two replicates of round spermatids.

3.2.3. Cell culture and RNA interference

The TCam-2 cell line, which derives from a primary testicular seminoma (Mizuno et al, 1993) and exhibits characteristics of fetal germ cells (Young et al, 2011) was cultured in

RPMI 1640 medium (Thermo Fisher Scientific, Scoresby VIC, Australia) supplemented with

10% fetal calf serum (Life Technologies, Mulgrave VIC, Australia) and penicillin/streptomycin diluted 1:200 (Thermo Fisher Scientific) at 37°C in 5% CO2 in a humidified incubator.

To conduct ESRP1 knockdown experiments, two Silencer® siRNAs and a negative control were obtained from Ambion/ThermoFisher (Table 3. 1). On the day prior to transfection, TCam-2 cells (~0.6 ×106 cells/well) were seeded in RPMI medium in the absence of antibiotic in 6 well culture plates (3 per control and 3 per siRNA pair) (Nunclon™ Delta,

ThermoFisher). The siRNA (25 ρmole) and 3% Lipofectamine RNAiMAX (Invitrogen/Life

Technologies) diluted in Opti-MEM® medium (Invitrogen/Life Technologies), as specified in the manufacturer’s instructions, were added to cells in each culture well. After 48 or 72 h of culture the cells were harvested and extracted for Western blotting.

Table 3. 1: siRNA target sequences

siRNA ID Sense Sequence (5’-3’) Catalogue Lot Number Silencer®Select Antisense Sequence (5’-3’) Number

GAGAGUGAAUUACAAGUUUTT S29570 #4392420 # AS025SCB AAACUUGUAAUUCACUCUCTC

CCUUCGAGGUCUUCCCUAUTT S29571 #4392420 # AS025SCC AUAGGGAAGACCUCGAAGGCG

Negative Control Sequences is not available #4390843 #AS023T9Q

3.2.4. Cycloheximide chase assay

To investigate the stability of ESRP1 protein, TCam-2 cells were subjected to a cycloheximide chase assay. The transfection medium was replaced with RPMI medium

containing 50 μg/ml cycloheximide (CHX) added into each well. At various time-points after addition of the cycloheximide (t = 24, 48, 72 hours), cells were harvested, centrifuged and lysed in RIPA buffer containing protease inhibitors for western blotting analysis.

3.2.5. Western blot

Protein concentrations of cell lysates were determined using a bicinchoninic acid protein assay kit (BCA kit; ThermoFisher Scientific) and 10 μg of protein from each sample were electrophoresed on a 10% SDS PAGE gel and transferred onto an Immobilon-P PVDF membrane (Millipore, Australia). After blocking (5% milk powder and 0.05% Tween-20 in

PBS) the membranes were incubated overnight at 4°C with anti-ESRP1 (HPA023719; Sigma;

1:250) and anti-β-actin (A5441, Sigma, 1:5000) antibodies, diluted in 5% BSA in PBS/Tween-

20. After washes in PBS/Tween-20 the membranes were incubated for 1 h at room temperature with the appropriate HRP-conjugated secondary antibodies (Invitrogen) diluted in

PBS/BSA/Tween-20. Signals were visualized using Clarity TM Western ECL substrates

(BioRad) according to the manufacturer’s recommended protocol and imaged with a

ChemiDocTM MP system (Bio-Rad).

3.2.6. RNA extraction, cDNA synthesis, RT-PCR and droplet digital PCR (ddPCR)

RNA was extracted from gonadal cell populations, gonadal tissues and cultured TCam-

2 cells using RNeasy mini kits (Qiagen, Australia) with on-column DNA digestion, as per manufacturer’s instructions. The quality and quantity of total RNAwas assayed using an

Agilent 2200 Tape Station (Agilent Technologies, Germany). For each sample, 100 ng total

RNA was reverse transcribed using iScript™ Advanced cDNA Synthesis Kit (Bio-Rad, USA) according to manufacturer’s instructions. Expression analyses were performed by droplet digital PCR (ddPCR) as described previously (Shapouri et al, 2016); see Table 3. 2) on at least

three separate cell or tissue isolations normalized to house-keeping genes

(Mapk1, Canx or Ppia) and data were expressed as mean ± standard error of the mean (S.E.M.).

Table 3. 2: Digital PCR primer and probe sequences Amplicon Supplier and Gene Primer and Probe sets in 5’-3’ orientation size Catalogue number

Fw: CAC ATA GGA GGT CTG ACA GC Rev: AAT TAT CTA CCC AGG CAC CAC Canx P: HEX/TCG GGT CCT/ZEN/CTG GAG CAC AAG GCT 89 IDT; NA

TT/3IABKFQ

Fw: CAC ATA GGA GGT CTG ACA GC Rev: AAT TAT CTA CCC AGG CAC CAC Canx P: HEX/TCG GGT CCT/ZEN/CTG GAG CAC AAG GCT 89 IDT; NA

TT/3IABKFQ

Fw: CCT TCA GAG CAC TCC AGA AA; Rev: AAT CTA TGC AGT TTG GGA TAC AAC Mapk1 P: HEX /TCT GCT CTG /ZEN/TAC TGT GGA TGC CTT 93 IDT; NA

/3IABKFQ

Fw: TCC TTC TGT CTC TGT ACT GAC G; Rev: GGA ATA GAA GCA CTC AGG CA IDT; Esrp1 P: FAM/AGATCTTGC/ZEN/ATC CCG AGG CTT CC 99 Mm.pt.58.28758847 /3IABKFQ

ThermoFisher – Primer sequences not available, FAM Ppia 112 Taqman Assay: RefSeq NM_008907.1, assay location 232, exon boundary 3-4 Mm02342429_g1

ThermoFisher – Primer sequences not available, FAM Ngn3 73 Taqman Assay: RefSeq NM_009719.6, assay location 493, exon boundary 2-2 Mm00437606_s1

ThermoFisher – Primer sequences not available, FAM Ccnd1 145 Taqman Assay: RefSeq NM_007631.2, assay location 957, exon boundary 4-5 Mm00432360_m1

To examine splicing events in cultured TCam-2 cells, RNA was extracted from control

and siRNA transfected cells as described above and analyzed by standard RT-PCR and gel

electrophoresis to detect splicing of CTNND1 and DOCK7. As DOCK7 splice variants show

alternative splicing of exon 23 (93 nt) we designed primers to exon 22 (5’-

GCTAGATCTGCGGTGAGACC-3’) and exon 24 (5’-TCTGTGTGCGAAGACATACG-3’) to detect splice variants and primers to constant exons 2 (5’-TAGTGGTTCTCCCCAACTGC-

3’) and 4 (5’-GGATCCATTTCACTTTCTTCAGG-3’) to detect the all DOCK7 transcripts.

Similarly, to detect alternate splicing of CTNND1 at exons 2 and 3, we designed primers in exon 1 (5’-TGTCTTTCTCAGCACCTTGG-3’) and exon 4 (5’-

GTCTTTCAAGGTCAGCATCG-3’) to detect splice variants and primers to the constant exon

5 (5’-CAGATGATGGGACCACTCG-3’) and exon 6 (5’-TCTAGCCCATAAGGCTCTGG-

3’) to detect all CTNND1 transcripts.

3.2.7. Immunofluorescence

Immunofluorescence, incorporating antigen retrieval with acidic citrate buffer at

100°C, was carried out on paraffin sections of formalin-fixed ovaries and testes from 12-week old mice as described previously (Shapouri et al, 2016). Antibodies used included two rabbit polyclonal anti-human ESRP1 (HPA023719 and HPA023720; Sigma Aldrich) diluted 1:100 and 1:50 for testis and ovary specimens respectively, a goat polyclonal anti-mouse c-KIT

(AF1356, R&D system) diluted 1:250, a goat polyclonal anti-human PLZF (AF2944, R &D system) diluted 1:500, a sheep anti-Sox9 antibody (provided by Dr Dagmar Wilhelm) diluted

1:100 and a mouse monoclonal antibody to the nuclear speckle/spliceosome marker, SC35

(ab11826, AbCam) diluted 1:250. Negative controls included sections incubated with non- immune rabbit serum (NIS). Reactivity was visualized using appropriate secondary antibodies conjugated to Alexafluor-488 or Alexafluor-596 (Invitrogen, Australia), diluted 1:500 and imaged using a Zeiss LSM800 confocal microscope (Carl Zeiss, Melbourne, VIC, Australia).

For immunofluorescence of cultured TCam-2 cells, the cells were grown on 13 mm round plastic coverslips (Thermanox™) in six-well culture plates as described above. Following

siRNA transfection, cells were cultured in RPMI medium for various periods (24, 48, 72 hours) before being fixed in 4% paraformaldehyde in PBS for 20 min, and permeabilized for 20 min in 0.2% TritonX-100 in PBS. After blocking with 10% FCS in PBS for 30 min, cells were incubated overnight at 4°C with anti-ESRP1 primary antibody (HPA023719; Sigma) diluted

1:50 in blocking buffer. Antibody binding was detected by incubating with 1:500 AlexaFluor

488-conjugated donkey anti-rabbit IgG (Invitrogen A-21052) for 1h. Cells were counterstained with 1 μg/ml Hoechst dye and 1 μg/ml Phalloidin-TRITC (Sigma) for 1h. Matching plastic coverslips for each treatment were mounted onto 50 mm square glass coverslips and visualized using confocal microscopy as described above. To quantify and compare the immunofluorescence intensity between siRNA transfected cells with control, ImageJ 1.50b was performed.

3.2.8. Statistical analyses

For analyses of the ddPCR data, application of a Shapiro-Wilks normality test indicated the data fitted a Gaussian distribution. Therefore, where at least three biological replicates were available, a one-way analysis of variance with a Tukey’s post-hoc analysis and α = 0.05 was employed to determine significant differences among groups. All statistical analyses and generation of graphs were performed using GraphPad Prism (La Jolla CA, USA).

3.3. Results

3.3.1. Esrp1 is expressed in fetal germ but not somatic cells

To examine Esrp1 expression specifically in fetal germ and somatic cells of murine gonads, we took advantage of the Pou5f1-GFP (Oct4-GFP) transgenic mouse line to isolate male and female gonadal (GFP+) and somatic (GFP-) cells at various stages of development by FACS (van den Bergen et al, 2009). Using ddPCR we found that Esrp1 is highly expressed in female and male germ cells but not somatic cells from E12.5 to E15.5 (Figure 3. 1). These data

are consistent with published microarray data showing detectable expression of Esrp1 in only male and female germ cells from E11.5 –E14.5 (Jameson et al, 2012). To examine if ESRP1 protein could be detected in fetal gonads, immunofluorescence experiments were conducted on mouse E12.5-E14.5 male and female gonadal sections. However, little or no specific reactivity could be detected in somatic or germ cells and if ESRP1 protein is produced in fetal germ cells it is below the level of detection via immunofluorescence.

Figure 3. 1:. Esrp1 is expressed in developing male and female germ cells but not somatic cells; Histograms show Esrp1 RNA expression, measured by RT-ddPCR, in FACS sorted (A) germ (GC) and (B) somatic (SC) cells, isolated from E12.5-E15.5 mouse embryos expressing an Oct4 (Pou5f1)-GFP transgene. Gene expression is expressed as copies/μl and normalised against Mapk1 expression in germ cells and against Canx expression in somatic cells. Data are presented as mean ± S.E.M of three independent samples at each age. Transcripts for Esrp1 were detected in male and female germ cells but not in sorted somatic cells. No significant differences in expression were detected in Esrp1expression with age in male or female germ cells (n = 3 for each group; One- way ANOVA, p>0.05). Abbreviations: GC, germ cells; SC, somatic cells.

3.3.2. Esrp1 is upregulated in adult spermatogonia

To examine the expression of Esrp1 during postnatal male gametogenesis, we utilized a BSA gradient to separately enrich gonocytes/spermatogonia (at P1), spermatogonia (at P8-

10), pachytene spermatocytes and round spermatids (at 8 weeks) as described previously

(Baleato et al, 2005; Bellve et al, 1977; McIver et al, 2012).

Previous studies have demonstrated that this method can be used to isolate gonocyte- and spermatogonial-enriched populations, expressing specific marker

(Pou5f1, Nanog, Ngn3, Plzf) profiles (McIver et al, 2012). Using RT-ddPCR we confirmed

(Figure 3. 2) that each population was specifically enriched for gonocytes (Ccnd1), spermatogonia (Ngn3) and pachytene spermatocytes (Dnah8). In addition, we have recently

shown, using the same RNA samples as used in this study, that the round spermatid sample uniquely expressed Tob1 (Shapouri et al, 2016). The RT-ddPCR analysis indicated that Esrp1 was most strongly expressed in cell populations enriched for spermatogonia.

Greatly reduced expression was detected in pachytene spermatocytes and round spermatids

(Figure 3. 3).

Figure 3. 2: Analysis of separated germ cell populations; Droplet digital RT-PCR analyses of BSA gradient- separated cells from mouse testes confirmed that the isolated populations of cells are enriched for spermatogonia (S; Ngn3 and Ccnd1expressing) and pachytene spermatids (P; Dnah8 expressing). Gonocytes (G), like spermatogonia (S), express Plzf but express very low levels of Ccnd1. In another study we have shown that round spermatids express elevated Tob1 (Shapouri et al, 2016). Statistical analyses: One-way ANOVA with Tukey’s post-hoc analyses; n = 3 in all cases, except RS (n = 2); *, p<0.05; ****, p<0.0001.

Figure 3. 3: Esrp1 is highly expressed in spermatogonia in the adult testis; RT-ddPCR of isolated germ cells from postnatal mouse testes show that Esrp1 is highly expressed in spermatogonia (S), weakly expressed in gonocytes/spermatogonia (G) and barely detectable in pachytene spermatocytes (PS) and round spermatids (RS). Expression data are expressed as copies/μl, normalised against Cyclophilin Aexpression, and as mean ± S.E.M of three independent samples (except for Round Spermatids n = 2). Individual data are shown as black circles, mean as a red line and the error bars in black. Asterisks indicate significance differences by ANOVA and Tukey’s post- hoc analysis (**, p<0.01; ***, p<0.001).

To confirm ESRP1 expression in adult spermatogonia, we used immunofluorescence with a specific antibody for ESRP1 (Figure 3. 4). Consistent with the ddPCR data, strong nuclear immunostaining for ESRP1 was detected in spermatogonia that reside close to the basal lamina of the seminiferous tubules (arrows, Figure 3. 4D and G), with expression also observed in differentiating spermatocytes and spermatids. The presence of immunostaining in these cells suggests that the greatly lower levels of mRNA (mean ± SEM; 852 ± 125 copies/μl; see Figure

3. 3) are still sufficient to allow for translation of the protein. This level of expression is more than an order of magnitude higher than that of Ngn3 expression in spermatogonia (Figure 3.

2), indicating that these lower levels of mRNA expression can still result in readily detectable protein levels. The lack of staining with non-immune serum (Figure 3. 4C) combined with western blot and immunofluorescence analyses of ESRP1-siRNA transfected TCam-2 cells

(Figure 3. 5) indicates that the antibody (HPA023719) is specific. Also, to quantify the efficiency of transfection, Fiji analysis have been used. However, because the exposure time for recording the picture was different as it was difficult to detect the signal in siRNA knocked

down cells, so it is suggested to confirm the results by performing other methods of quantification as well such as ddPCR (Figure 3.10 A). Moreover, similar patterns of reactivity were detected with another antibody to ESRP1 (Figure 3. 6). To determine if ESRP1 expression was restricted to a specific type of spermatogonial cell, we performed a co-labelling experiment with PLZF and c-KIT antibodies, which mark type As-Aal and type A1-B spermatogonia respectively (Buaas et al, 2004; Costoya et al, 2004). The results showed that ESRP1 is expressed in both Type A and Type B (Figure 3. 4D-I) spermatogonia. To confirm that ESRP1 was not associated with somatic cells, we performed co-localization studies with Sox9, a marker for testicular somatic Sertoli cells. Consistent with the ddPCR data indicating little or no expression of Esrp1 in somatic cells (Figure 3. 1), ESRP1 showed little to no co-localization with Sox9 in the somatic Sertoli cells (Figure 3. 7).

Figure 3. 4: ESRP1 is expressed in type A and type B spermatogonia; Double labelling immunofluorescence showed that ESRP1 (antibody HPA023719) is detected in both Type A (PLZF+) and Type B (c-Kit+) spermatogonia, Representative sections of seminiferous tubules were labelled with antibodies to ESRP1 (A, D, G), PLZF (F), c-Kit (I) and Hoechst nuclear stain (B, E, H). ESRP1 staining in spermatogonia is present as speckled nuclear reactivity (A, D, G). Arrows indicate double-labelled cells in each image series (D-F; G-I). Very little non-specific labelling was detected when sections were incubated with non-immune serum (NIS; C). Scale bars: 34.5 μm (A-B); 20.5 μm (C); 10.5 μm (D-F); 18 μm (G-I).

Figure 3. 5: siRNA knockdown of Esrp1 demonstrates antibody specificity; Immunofluorescence of TCam- 2 cells transfected with negative control-siRNA (A-D) or with ESRP1-siRNA (E-H). In control cells, ESRP1 (A) showed a granular nuclear immunofluorescent staining (HPA023719; Sigma; 1:100), which was greatly depleted in siRNA-treated cells (E). Cells were counterstained with phalloidin to stain filamentous cortical actin (B, F) and Hoechst dye to label cell nuclei (C, G). Merged images are shown in D and F. Scale bar, 20 μm for all images. K quantification of ESRP1 fluorescence intensity using Fiji Software, to confirm a reduction in ESRP1 protein expression in the siRNA knocked down TCam-2 cells (I) compared to the control cells (J)-Magnification 40x. Statistical analysis of data was performed with Student's t-test. P<0.05 considered as significant difference.

Figure 3. 6; Immunostaining with a second ESRP1 antibody shows a similar expression pattern; ESRP1 immunofluorescence in adult mouse testis using another antibody (Sigma-Aldrich, HPA023720; Lot: 3070388) showed similar nuclear staining in spermatogonia (A, C, arrows) to that observed with HPA023719 (Fig 3). Non- immune IgG (D, F) showed no reactivity in the seminiferous tubules but did show but nonspecific labelling in the interstitial Leydig cells (*). Section were counter-stained with Hoechst dye to label nuclei (B, E) and merged images are shown in (C, F). Scale bar: A-C, 30 μm; D-F, 20 μm.

Figure 3. 7:ESRP1 is not localized to somatic (Sertoli cells); Double labelling immunofluorescence experiments with an antibody to Sox9 (A) showed that ESRP1 (B; antibody HPA023719) exhibits minimal labelling of somatic Sertoli cells in the testis. Scale bar: 20 μm all images.

The nuclear speckled pattern of reactivity seen in the spermatogonia suggested that

ESRP1 may be localized to the spliceosome. To investigate this further, we examined whether

ESRP1 co-localized with SC35, a well-known constituent of nuclear speckles and pre-mRNA splicing (Fu, 1993; Spector et al, 1991). Surprisingly, ESRP1 did not co-localize to

SC35+ nuclear speckles (Figure 3. 8).

Figure 3. 8: Nuclear ESRP1does not co-localize with the spliceosome marker, SC35; Double labelling immunofluorescence experiments of ESRP1 (antibody HPA023719) with an antibody to SC35, a marker for the spliceosome (A), showed that the nuclear ESRP1+ speckles (B) do not overlap with SC35+ nuclear speckles (D). Scale bar: 20 μm all images. ESRP1 regulates splicing in a fetal germ cell line (TCam-2 cells)

To investigate if ESRP1 can modulate splicing of target genes in fetal germ cells we examined the effects of siRNA knockdown of ESRP1 in vitro, using the seminoma-derived

TCam-2 cell line, which has been shown to have characteristics of fetal germ cells (Young et al., 2011). To first determine the lability of the ESRP1 protein in Tcam2 cells we conducted a cycloheximde chase analysis and found that ESRP1 protein remains stable in these cells for at least 24 hours. By 48 hours, small amounts of the protein are still detected by western blot, but by 72 hours no protein was detected (Figure 3. 9). We therefore conducted our analyses of siRNA knockdown cells 72 hours post-transfection. Transfection of these cells with two independent siRNA constructs resulted in efficient knock-down of ESRP1 mRNA and protein, as determined by RT-ddPCR (Figure 3. 10A), and by western blot (Figure 3. 10B). As previous studies (Warzecha et al, 2009b) demonstrated that exons 2 and 3 of CTNND1 and exon 23 of DOCK7 are direct targets of ESRP1-mediated splicing, we designed primers to detect the

alternatively spliced and constant exons of these transcripts and examined their expression by

RT-ddPCR in cells treated with or without siRNA. Consistent with previous reports that ESRP1 mediates exclusion of exons2 and 3 in CTNND1transcripts, we detected a shift from the variants lacking exons 2–3 to variants that include these exons in cells treated with ESRP1 siRNA (Figure 3. 10C). Similarly, greater inclusion of exon 23 in DOCK7 transcripts was detected, whereas the expression of the constant exons for both genes remained unchanged (Figure 3. 10D).

Figure 3. 9: ESRP1 protein is depleted 72 hours after blocking translation; Immunoblot of cycloheximide (CHX) chase experiment in TCam-2 cells showing stability of ESRP1 protein after arrest of protein synthesis. ESRP1 protein (75kD) was still detected weakly after 48 hours but was absent by 72 hours. Beta-actin (43 kD) was used as a loading control and was present in all samples. ESRP1 antibody HPA023719).

Figure 3. 10: ESRP1-mediated alternative splicing in TCam-2 cells; A. TCam-2 cells transfected with siRNA constructs for ESRP1 displayed a dramatic (~85%) and significant (n = 3 each group; p<0.0001, Student’s t-test) decrease in expression of ESRP1 mRNA. Similar data were obtained in two independent experiments. B. By western blot analysis, a distinct 75kD band for ESRP1 was detected in non-transfected and control siRNA- transfected TCam2 cells but was not detectable in cells transfected with either siRNA construct. Similar data were obtained in two independent experiments. C. RT-PCR using primers specific to splice variants of CTNND1 and DOCK7 showed that loss of ESRP1 expression promoted inclusion of exons 2–3 in CTNND1 transcripts and inclusion of exon 23 in DOCK7 transcripts. By contrast no changes were detected for the constant exons in these genes. The splicing pattern and band size are illustrated for each transcript variant.

3.4. Discussion

In this study we documented the expression of Esrp1 during gonadal development and in differentiating cells of the adult gonads. We observed that in mouse fetal gonads, Esrp1 mRNA was specifically detected in germ cells of either sex and absent from somatic gonadal cells. Esrp1 mRNA was also present in a gonocyte-enriched cell fraction and in all germ cells examined in the postnatal testis; however, it was found at much higher levels in spermatogonia than in pachytene spermatocytes or round spermatids. Consistent with mRNA levels, ESRP1 protein expression was detected in cells at the periphery of seminiferous tubules, co-staining with PLZF and c-Kit, indicating that ESRP1 is present in type A and B spermatogonia but not in Sox9+ Sertoli cells. Protein expression was also detected in spermatocytes and round spermatids, suggesting that the level of mRNA expression in these cells can sustain detectable protein production. This raises the possibility that ESRP1 plays a continuing role in splicing of pre-meiotic transcripts in these more differentiated cells.

Spermatogenesis is characterized by a variety of post-transcriptional regulatory events and alternative splicing may plausibly regulate these later events (Bettegowda & Wilkinson, 2010).

While it is unclear precisely where splicing occurs within the nucleus, it is becoming clear that constitutive splicing occurs most commonly as co-transcriptional splicing of the pre- mRNA and that alternate splicing occurs more commonly as a post-transcriptional process

(Sahebi et al, 2016). Spliceosome assembly involves the sequential recruitment of U1, U2, U4,

U5 and U6 snRNAs and various small ribonucleoproteins into a macromolecular complex at the pre-mRNA splice sites (Sahebi et al, 2016). Studies with the U2-associated protein,

SF3b155, have shown that 80% of pre-mRNA splicing, marked by anti-phospho-SF3b155 antibodies, occurs co-transcriptionally, whereas only 10–20% of splicing occurs post- transcriptionally in nuclear speckles, which are positive for SC35 (Girard et al, 2012).

Consistent with previous findings indicating that ESRP1 is a splicing factor, ESRP1 was

localized to numerous small nuclear speckles in spermatogonia. However, the lack of ESRP1 co-localization with SC35 suggests that ESRP1 is more likely to be involved in constitutive, co-transcriptional rather than post-transcriptional, alternate splicing events in SC35+ speckles during spermatogonial self-renewal and differentiation. Despite the lack of co-localization with

SC35, siRNA experiments indicated that down-regulation of ESRP1 expression resulted in expected changes in the splicing of two known ESRP1 target pre-mRNAs

(CTNND1and DOCK7). These data suggest that ESRP1 plays a role in regulating alternative splicing in male germ cells in vitro. Whether this extends to regulating these ESRP1 target genes in the testis in vivo remains to be determined. The standard spliced form of CD44 mRNA is expressed in the testis but not the splice variant, CD44v6, mediated by ESRP1 (Miyake et al,

1998). Similarly, while FGFR2 is expressed in spermatogonia, spermatocytes and spermatids

(Li et al, 2014), it is not known if this is the IIIC or the IIIB isoform.

Transcriptomic analysis of mouse spermatogenesis has identified over 13,000 alternative splicing events (Margolin et al, 2014), indicating that alternative splicing is a key driver of cell differentiation events during spermatogenesis. However, while ESRP1 is known as an important regulator of alternative splicing in epithelial tissues, in the testis it appears not to function in nuclear speckles associated with post-transcriptional alternate splicing. Our data cannot exclude an alternate splicing role for ESRP1 in the testis and combined expression and bioinformatic analyses may yet yield information about potential ESRP1 target genes in the testis. Additionally, analyses of spermatogenesis and spermiogenesis in Esrp1-/- mice will be required to determine the precise role of Esrp1 in spermatogonia.

Chapter 4. Evaluation of phenotypes resulted from overexpressing or knocking down fusilli expression in testis

4.1. Introduction

The fruit fly, Drosophila melanogaster, is one of the most powerful genetic model organisms to study developmental mechanisms, because of quick generation times, high numbers of progeny, and numerous tools for manipulating gene expression (Adams et al, 2000;

St Johnston, 2002). Furthermore, many genes playing a role in Drosophila development are highly conserved in evolution and their homologues are found in vertebrates (Bier, 2005;

Holley et al, 1995; Pandey & Nichols, 2011). As mentioned previously in section 1.4, ESRP1 is also an evolutionarily conserved gene and its orthologue in Drosophila is fusilli, similar to

ESRP1 contains three RRMs. The C-terminal domain is rich in alanine, glutamine and serine while the N-terminal domain is less studied (Marchler-Bauer et al, 2017). This gene was first identiﬁed in a genetic screen for dominant maternal enhancers of an unusual dorsal-ventral patterning and it has been shown that loss of fusilli results in lethality during embryogenesis, suggesting an important role in developmental processes (Wakabayashi-Ito et al, 2001).

Wakabayashi-Ito et al (2001) using in situ hybridization showed epithelial-specific expression of fusilli in stage 9 embryogenesis in the stomodeum and was subsequently expressed in mesodermal and ectodermal layers in stage 11 and 13 respectively. Also, its epithelial expression in the foregut and posterior spiracles have been reported (Wakabayashi-Ito et al,

2001). Like ESRP1, fusilli plays a role in the regulation of RNA splicing. Warzecha et al

(2009b) have shown that fusilli can rescue splicing of FGFR2 in mammalian epithelial cells that have been depleted of ESRP1 and ESRP2, indicating a conserved function and RNA- binding capacity for ESRP homologues.

In the previous chapter, our results suggested a probable role for ESRP1 during germ cell development in mouse gonads. Since we did not have access to Esrp1 knockout mice, we decided to determine if knocking down or overexpressing of fusilli expression in fly testis results in any specific phenotype.

4.1.1. Germline stem cells in the Drosophila testis and spermatogenesis

The Drosophila testis is one of the best models to study germline stem cells (GSCs) due to its simple structure and specific stem cells which can be easily recognizeed, imaged and manipulated easily (de Cuevas & Matunis, 2011; Spradling et al, 2011). The Drosophila testis is a coiled blind-ended tube that curls around a seminal vesicle. A stem cell niche resides at the apical end of each testis and adheres to a population of small somatic cells called the hub

(Hardy et al, 1979). The number of stem cells varies based on the number of hub cells but there are typically 6–9 germ stem cells (GSCs) per testis (Boyle et al, 2007). They divide asymmetrically to generate two different cells, one remains a stem cell and another which is called a gonialblast displaces from the niche and begins to differentiate. Additionally, at the apical tip of Drosophila testis, there are other types of somatic stem cells called cyst stem cells

(CySCs), two of which flank each GSC. CySCs divide asymmetrically and generate cyst cells, two of which surrounded each gonialblast. The gonialblast undergoes four division with incomplete cytokinesis to produce a sixteen-cell spermatogonial cyst (Cheng et al, 2011). Cells in this spermatogonial cyst enter premeiotic S-phase and then differentiate and grow into spermatocytes, which become displaced from the apical of testis and undergo meiosis to produce haploid sperm (White-Cooper, 2010)(Figure 4. 1).

Figure 4. 1: Schematic of the apical tip of the Drosophila testis; Germ line stem cells (yellow) are surrounded by two somatic stem cells (red) and are in direct contact with a microenvironment called the hub (blue). The germ line stem cells will generate a gonialblast (light pink), which is encapsulated by two cyst cells (green). The gonialblast undergoes four mitotic divisions with incomplete cytokinesis and produces sixteen spermatogonial cells enclosed by two cyst cells. (Reproduced from Spradling et al, 2011)

4.1.2. Aim

Since the results in Chapter 3 suggested a role for ESRP1 in germ cell development, in this chapter, I examined whether fusilli inhibition or overexpression has effects on GSCs in the testis. I used the nos:GAL4 driver to overexpress fusilli or to express a fusilli RNAi in the

GSCs and then characterized the observed testes phenotypes.

4.2. Methods

4.2.1. Drosophila culture condition

All stocks were raised on standard agar-molasses medium at 25°C. As the fly life cycle is temperature-dependent, the stocks used for virgin collection were kept at 18°C to slow down the rate of development and provide more time for virgin collection. Virgin females were mated

with young males. Flies were kept at 25°C to lay eggs and then transferred to 29°C to induce

Gal4 expression (Duffy, 2002).

4.2.2. Drosophila Strains

Fly strains used in this study are shown in Table 4. 1.

Table 4. 1: Fly strains used in this study Fly Strain Donor Bloomington Drosophila Stock Centre w1118 (control) (BDSC)- BL3605 Bloomington Drosophila Stock Centre nanosGAL4:VP16 (BDSC)- BL4937

Bloomington Drosophila Stock Centre y[1]sc[*]v[1];P{y[+t7.7]v[+t1.8]=TRiP.HMC04208}ttP40 (BDSC)-BL55921 fus RNAi

Vienna Drosophila Resource Centre P{KK108164}VIE-260B (VDRC)-v107575 fus RNAi Blomington Drosophila Stock Centre y[1] w[*]; P{w[+mC]=EP}fus[G2369] (BDSC)- BL27457 fus EP

4.2.3. The GAL4-UAS system

The Gal4/UAS system includes the UAS (Upstream Activator Sequence) enhancer element and the Gal4 transcription factor which were developed by Brand & Perrimon (1993).

In this system, the gene of interest is linked to UAS and it will be expressed when GAL4 binds to the UAS site. This system can be combined with a tissue-specific driver of Gal4, which results in overexpression of the gene of interest in the specific tissue. Thus, if one fly strain carries the UAS-gene of interest is mated to a second strain that contains the GAL4 under the control of specific driver this will result in offspring that ectopically expresses that gene in specific tissue dependent on the driver (Duffy, 2002) (Figure 4. 2). In this experiment, I used the nosGAL4 driver to drive expression of fusilli in GSCs. Since GAL4 expression is temperature dependent, flies were kept at 25°C for three days to lay eggs, then transferred to

29°C to enhance GAL4 expression.

Figure 4. 2: GAL4-UAS system in Drosophila ; Transgenic flies carrying a GAL4 and selected driver are mated to flies of the opposite sex caring gene of interest down stream of UAS. Gal4 speciﬁcally binds to UAS to activate gene of interest transcription in a tissue-specific dependent on the selected driver line.

4.2.4. Drosophila immunofluorescence staining

Testes were dissected in Ringers buffer and fixed in 4% formaldehyde diluted in PBS with 0.2% Triton-X (PBT) for 20 minutes. Testes were then washed three times for 5 minutes each in PBT. The testes were blocked with 5% normal horse serum in PBT (PBTH) for 1 hour, followed by incubation in primary antibodies overnight at 4°C with goat anti-Vasa (Santa Cruz,

1:100) and mouse anti-FasIII (DSHB, 1:50) diluted in PBTH. The next day, testes were washed three times in PBT for 5 minutes each, before incubation in secondary antibody

(AlexaFluor488 conjugated; Molecular Probes) diluted (1:500) in PBTH for 2 hours at room temperature. Testes were again washed three times for 5 minutes in PBT before being counterstained with Diamidino-2-phenylindole (DAPI, Prolong® Gold, Molecular Probes) and mounted. Images were taken on the Zeiss LSM800 confocal microscope.

4.3. Results

4.3.1. fusilli mRNA expresses in Drosophila testis

To first confirm if fusilli is expressed in Drosophila testis, I performed RT-ddPCR on cDNA prepared from mRNA isolated from whole testes as described in 2.1.4 using specific fusilli primers to measure its mRNA levels in wild-type testis. The cDNA of fly testes was generously provided by Aviv Gafni, a previous Ph.D. student in our lab. The results showed fusilli is expressed in fly testis with the mean of 1115.5 copies/µl (Figure 4. 3). Unfortunately, as a fusilli antibody was not available, I could not confirm fusilli protein expression in fly testis.

Figure 4. 3: fusilli transcript is detected in in Drosophila testis; RT-ddPCR was performed to detect fusilli mRNA in adult wild Drosophila type testis and demonstrated high levels of expression compared to Snail.

4.3.2. Knock-down of fusilli using RNAi showed no obvious phenotype

Based on the results in chapter 3 showing high expression of ESRP1 in mammalian germ cells and high expression of fusilli in Drosophila testes, I hypothesized that limiting the expression of fusilli may affect GSCs. Since the homozygous loss of fusilli causes early embryonic lethality (Wakabayashi-Ito et al, 2001), I could not study the phenotype of fusilli mutants in the adult organism. Therefore, I used GAL4-UAS system to drive expression of the fusRNAi transgene in germ cells via the nos:GAL4 driver (Forbes & Lehmann, 1998).

To examine the effects of the RNAi on the germ cells and the hub, I stained nos:GAL4>fusRNAi and nos:GAL4>w1118 (Control) testes with antibodies for the germ cell marker, Vasa, and the hub marker, FasIII. As shown in Figure 4. 4 there appeared to be no marked differences in the hub or GSC structure between control and fusRNAi.

To ensure that these results were not due to inefficiency of the fusRNAi line (BL55921) to knockdown fusilli expression, I utilised another fusRNAi line (v107575). However, this line also did show any noticeable change in hub or GSC phenotype when crossed with the nos:Gal4 driver (Figure 4. 5Figure 4. 4).

Figure 4. 4: Knockdown of fusilli does not affect GSCs; nosGAL4>fus RNAi(55921) and nosGAL4>w1118 testes were stained for vasa (A=control and E=RNAi) and Fas III (B=control and F=RNAi). DNA marked by DAPI (C and G). No noticeable differences in hub or GSC structure were observed between control and fusRNAi(55921) testes. Scale bar: 20µm.

Figure 4. 5: No differences were observed between control and knockdown fusilli testes; Apical tip of control (A-D) and fusilli (v107575) knockdown (E-H) testes. Germ cells marked by Vasa (green), hub cells by FasIII (red), and nucleus by DAPI. No noticeable differences in hub or GSC structure were observed between control and fusRNAi(v107575) testes. Scale bar: 20µm.

4.3.3. Overexpression of fusilli

As knockdown of fusilli did not show any specific phenotype in GSCs, I wanted to determine whether the high level of fusilli could induce extra germ cell division. To do this, I overexpressed UAS:fusEP in GSCs using nos:GAL4 driver. However, immunostaining results using anti-Vasa and anti-FasIII showed a similar number of GSCs compared to wild-type testes and no noticeable differences in phenotypes were observed between control and mutant testes

(Figure 4. 6).

Figure 4. 6: No changes is detected in GSCs when fusilli is overexpressed in the testes; Immunostaining of control(A-D) and fusilli overexpressed (E-H) testes. GSCS marked by Vasa (A and E). FasIII (B and F) and DAPI (C and G) used as marker of hub cells and nucleus respectively. No noticeable differences in hub or GSC structure were observed between control and fusEP testes. Scale bar: 20µm.

4.4. Discussion

It has been reported that fusilli plays a maternal role in embryonic development in later stages, since it was not detected in early embryos (Wakabayashi-Ito et al, 2001). Wakabayashi-

Ito et al (2001) using in situ hybridization, have shown fusilli RNA expression in nurse and follicle cells of Drosophila ovaries. Furthermore, they have used FLP-FRT system to produce germ-line clones homozygous for fusilli. But no dorsalization abnormality was observed in these mutant germ-line clones, which suggested expression of fusilli in the germ-line is not correlated to dorsal–ventral patterning of embryos, while it may be necessary in the follicle cells of the ovary during embryonic patterning. Since fusilli was expressed in the Drosophila ovary, we hypothesized that it may express and play a role in the Drosophila testis. I have detected the expression of fusilli in Drosophila testis using ddPCR. As loss of fusilli is homozygous lethal during embryogenesis (Wakabayashi-Ito et al, 2001), it was not possible to study the phenotype of fusilli mutants in the adult testis. Instead an RNAi knockdown approach was employed.

However, despite the distinct expression of fusilli in Drosophila testes, RNAi-mediated knockdown of fusilli in GSCs, using two separate RNAi lines did not result in any overt changes in the hub or GSC phenotype in comparison to wild-type controls. Furthermore, driving ectopic expression of fusilli in GSCs similarly had no noticeable effect on GSC number or hub phenotype in comparison to wild-type.

It is possible that none of the transgenes were functional. Due to lack of time and the lack of phenotype, I did not pursue examining the expression of fusilli in these mutant testes, which would have determined if the transgenes had the intended effects on fusilli expression.

To further compare the expression of fusilli in RNAi and ectopic expressed fusilli line with wild-type control, ddPCR can be used. To do this experiment, total RNA should be extract from (~100) adult male flies testis followed by making cDNA and performing ddPCR respectively.

On the other hand, the fact that the nos:GAL4 driver is commonly used in our laboratory to drive expression of numerous RNAi and over-expression transgenes, leads me to suggest that failure of transgene expression is unlikely and that the more likely explanation for the lack of mutant phenotype is that fusilli function is not critical in regulation or maintenance of the

Drosophila testis GSCs.

Chapter 5. Examination of ESRP1 expression in human cancerous ovary and testis

5.1. Introduction

In recent years, there has been increasing literature reporting the effects of alternative splicing (AS) in different biological processes such as cancer (Ladd & Cooper, 2002; Takeda et al, 2006). Characterization of cancer-speciﬁc AS variants and their regulatory mechanisms may improve our knowledge of malignant transformation and could be a prominent factor in clinical diagnosis or in therapeutic avenues for finding potential therapeutic drugs (Kim et al,

2007a; Takeda et al, 2006).

To date, a considerable number of cancer-related genes have been shown to undergo splicing alterations during cancer progression (Hanahan & Weinberg, 2011; Oltean & Bates,

2014). The most well-known of these are CD44 and FGFR2, which play a role in invasion and proliferation respectively (Pajares et al, 2007; Skotheim & Nees, 2007). Since ESRP1 is known as a key regulator of FGFR2 and CD44 splicing (Warzecha et al, 2009b), it may have a potential role in cancer progression. It has been shown that ESRP1 expression is attenuated during tumor invasion in several carcinoma cell lines such as prostate, pancreas, and breast

(Horiguchi et al, 2012; Lu et al, 2015; Ueda et al, 2014). Conversely, there is evidence regarding the pro-oncogenic role of ESRP1 in some types of cancer. It has been shown that expression of ESRP1 in the 4T1 breast cancer cell line promotes lung metastasis and is related to poor survival of breast cancer patients (Yae et al, 2012). A recent study showed ESRP1 overexpression promotes proliferation and transformation of colorectal cancer cells (Fagoonee et al, 2017). Moreover, Bebee et al (2015) found that expression of ESRPs is dynamic during different stages of cancer progression. While both ESRP1 and ESRP2 are weakly expressed in normal human squamous epithelium, they are upregulated in the head and neck carcinomas.

However, their expression is down-regulated at the migrating front. It has been revealed that

ESRP1 and ESRP2 suppress cell motility at the migrating front by two different mechanisms;

ESRP1 by inhibiting Rac1b and affecting actin dynamics, whereas ESRP2 inhibits genes

involved in EMT and promotes epithelial (e.g E-cadherin) genes. Collectively, these studies suggest that ESRPs may have various roles in cancer progression depending on the type of cancer and their stage.

Our finding in chapter 3 showed that ESRP1 expression may play a role in germ cell differentiation. In addition, high levels of alternative splicing were observed in the human ovary and testis, strongly suggesting that AS regulation plays an important role in reproductive cancers (Eddy, 1998; Guzeloglu-Kayisli et al, 2014; He et al, 2007; Klinck et al, 2008;

Paronetto et al, 2011; Schmid et al, 2013). The evidence presented in this chapter provides evidence that ESRP1 may play a major role in reproductive cancer progression.

Reproductive cancers can affect both men and women. In women, ovarian cancer is the most lethal reproductive tissue cancer and the fifth most common cause of cancer deaths among women in the world (Oronsky et al, 2017). About 90% of all ovarian neoplasms are epithelial ovarian carcinomas including different histopathological subtypes such as serous and mucinous

(Landen et al, 2008; Levanon et al, 2008). The five-year survival rate for patients diagnosed with ovarian cancer is appoximately 46 percent; however, survival time can increase in patients who are diagnosed at early stages (Oronsky et al, 2017). Since early symptoms of ovarian cancer are non-specific, detection of this disease is difficult (Klinck et al, 2008). Currently, there are no diagnostic methods for detection of epithelial ovarian cancers at their early stages.

Thus, the examination of cancer-specific splice variants and their regulatory mechanisms may promote the identification of new biomarkers.

Recently, several studies have shown that the expression of specific isoforms of CD44 and FGFR2 could be related to ovarian carcinogenesis. Sosulski et al (2016) reported that high levels of CD44v8-10 expression correlated with increased survival rate in high grade serous ovarian cancer patients. Moreover, different studies observed a positive correlation between expression of CD44v6 and ovarian carcinoma progression (Shi et al, 2013; Wang et al, 2014;

Yorishima et al, 1997). However, there are several studies reporting no significant differences in CD44v6 expression between benign and advanced stage ovarian carcinomas (Bar et al, 2004;

Berner et al, 2000; Sakai et al, 1999). Considering all this evidence, it seems that the role of

CD44v6 in epithelial ovarian carcinoma has remained unclear. In addition to the role of

CD44v8-10 and CD44v6 expression in ovarian cancer progression, there is some evidence concerning a co-relationship between FGFR2IIIb and malignancy of ovarian cancer (Cole et al, 2010; Steele et al, 2006).

In males, one of the most common reproductive cancers is testicular cancer. It is the second most common cause of death from cancer among young men (Klinck et al, 2008). The most common testicular cancer type is testicular germ cell tumor (TGCT), which can be sub- divided into seminoma and non-seminoma tumors (Ye & Ulbright, 2012). Non-seminoma tumors are composed of a mixture of different histologic types such as embryonal carcinoma, teratoma, choriocarcinoma, and yolk sac tumors (Oosterhuis & Looijenga, 2005). Testicular cancer is the most curable solid cancer, but the therapeutic methods are different depending on the histopathological diagnosis (Miyake et al, 1998). Hence, it is important to find novel markers to precisely distinguish the histological sub-types of these tumors.

To date, several studies have profiled gene expression and specific AS patterns in normal testis and testicular cancer (He et al, 2007; Yamada et al, 2004). He et al (2007) through genome-wide detection using expressed sequence tag (EST) data analysis showed a distinct

AS patterning in the normal human testis and testicular cancer, suggesting regulation of alternative splicing may have a profound effect on testicular tumorigenesis. Moreover, Miyake et al (1998) have shown that the CD44v8-10 expression pattern may differ depending on the histopathological type of the testicular tumor. They identified CD44s expression in both seminoma and non-seminoma tumors, whereas CD44v8-10 was expressed only in non- seminoma tumors. As the expression pattern of CD44v8-10 was different between seminoma

and non-seminoma, it was suggested as a useful diagnostic biomarker for non-seminoma tumors.

5.2. Aim

Our data in chapter 3 suggests a role for ESRP1 in germ cell development. On the other hand, previous studies provide evidence implicating AS in ovarian and testicular cancer.

However, whether ESRP1 plays any role in the progression of ovarian and testicular cancer is still unclear. To begin to address this question, this chapter investigates ESRP1 expression in human ovarian and testicular, normal and tumor tissues. In addition, the expression patterns of its putative targets, FGFR2 and CD44, were also examined.

5.3. Methods

5.3.1. Sample collection

A total of 40 snap-frozen normal and malignant ovarian and testicular tissues were obtained from the Victorian Cancer Biobank, Melbourne with the approval from Human

Research Ethics Committee, University of Melbourne (Ethics ID 1441610; Table 5. 1 and

Table 5. 2). The ovarian samples were obtained from postmenopausal women, between 48-76 years of age including 5 mucinous and 4 serous carcinomas. The normal ovarian tissues (n=7) were from patients diagnosed with uterine cancer with normal ovaries.

In addition to the ovarian samples provided by the Victorian Cancer Biobank, 5 snap- frozen normal ovarian tissues were provided by A/Prof John McBain, at Reproductive

Services, The Women's Hospital, Melbourne and collected by Dr. Debra Gook. These samples were obtained from patients who were 20 to 32 years old when diagnosed with different kind of cancers (Table 5. 3), it is worth noting that these cancers were non-reproductive cancers.

Cortical ovarian tissues from these patients were cryopreserved before undergoing chemotherapy with the expectation of restoring their fertility post-treatment. Informed consent was obtained from patients to use their ovarian tissue samples for research if cure following chemotherapy was not achieved.

The testicular tissue samples were obtained from the Victorian Cancer Biobank, from men between 20-48 years of age, including 7 seminomas and 5 mixed germ cell tumor tissues

(Table 5. 2). Non-cancerous testicular tissues were used as control (Normal, n= 7 for seminoma and n=5 for mixed germ cell).

Table 5. 1: Human normal and carcinomas ovarian specimens used in this study RNA RIN Tissue bank number Condition Age RNA (ng/µl) number 14AH0246(1.30) Normal ovary (uterine cancer) 76 7 144

10RMH623(2B) Adjacent normal ovary (ovarian serous 52 8.3 221 carcinoma) 13AH0381(1.17) Normal ovary (uterine cancer) 66 6.8 81.6

14AH0239(C4) Normal ovary (uterine cancer) 65 7.1 80.7

13AH0458(1.2) Normal ovary (uterine cancer) 64 6.2 16.4

14AH0118(1.14) Normal ovary (uterine cancer) 59 4.4 64.6

13AH0162(1.20) Normal ovary (uterine cancer) 48 4.7 32.2

11RMH0748(1A) Ovarian serous carcinoma 73 9.5 92.7

10AH423A7 Ovarian serous carcinoma 52 7.1 405 10AH491A21 Ovarian serous carcinoma 68 7.8 258 10AH536A14 Ovarian serous carcinoma 64 8.7 297 11MH0450(1B) Ovarian mucinous adenocarcinoma 45 6.7 328 10RMH802(1A) Ovarian mucinous adenocarcinoma 36 8.6 321

12MH0125(1Y) Ovarian mucinous adenocarcinoma 19 7.9 170

10RMH684 Ovarian mucinous adenocarcinoma 56 6.6 358

12MH0350 Ovarian mucinous adenocarcinoma 50 5.5 108

Table 5. 2: Human adjacent normal and tumor testicular specimens used in this study Tissue bank Condition Age RNA RIN RNA (ng/µl) number number 04PM0533 Adjacent normal testis to testis seminoma 30 7 168

03PM0653 Adjacent normal testis to testis seminoma 26 6.2 116

11PM0090 Adjacent normal testis to testis seminoma 37 6.1 500

04PM1736 Adjacent normal testis to testis seminoma 30 5.5 261

15AH0256 Adjacent normal testis to testis seminoma 26 5.1 495

02PM0083 Adjacent normal testis to testis seminoma 38 5.1 105

12SH097 Adjacent normal testis to testis seminoma 33 4.3 634

03PM0653 Testis seminoma 26 6.3 152

11SH669 Testis seminoma 48 5.7 57

02PM0083 Testis seminoma 38 4.8 783

11SH218 Testis seminoma 24 4.1 80

04PM0533 Testis seminoma 30 3.8 229

04PM1736 Testis seminoma 30 3.4 88.4

12SH097 Testis seminoma 33 5.1 270

10PM1366 Adjacent normal testis to mixed germ cell 34 5.6 348

09PM1721 Adjacent normal testis to mixed germ cell 21 5.7 575

11SH592 Adjacent normal testis to mixed germ cell 33 7.3 140

10AH3559 B5 Adjacent normal testis to mixed germ cell 20 7.3 456

09AH492 1.6 Adjacent normal testis to mixed germ cell 36 7.8 224

03PM1167 Testis mixed germ cell 29 6.7 379

11SH220 Testis mixed germ cell 27 5.4 229

11SH592 Testis mixed germ cell 33 7.2 366

09NH269 A10 Testis mixed germ cell 21 4.2 135

08NH057 A1 Testis mixed germ cell 37 7.3 235

Table 5. 3: Normal human ovarian specimens used in this study RNA RIN Tissue number Condition Age RNA (ng/µl) number T-cell lymphoma 24 6.5 1 140

2 Sarcoma 32 7.9 62.4

3 Medulloblastoma 20 7.7 50 4 Non-Hodgkin lymphoma 24 7.5 64.8 5 Aplastic anaemia 26 8.2 67

5.3.2. Quantitative reverse transcription PCR (RT-qPCR)

First, RNA was isolated according to the method described in §2.1.1. Then, cDNA was made as mentioned in §2.1.3.2. Finally, RT-qPCR was performed with KAPA SYBER FAST qPCR master mix (Geneworks) in 20 μl reactions to check the expression level and stability of the candidate reference genes (Fu et al, 2010; Svingen et al, 2014). Each reaction consisted of

10 μl of master mix and 1μl cDNA, with a final concentration of 0.2M for each of the forward and reveres primers (Table 5. 4). Thermal cycling conditions were 95°C for 2 minutes, then 40 cycles of 90°C for 5 seconds and 60°C for 15 seconds, followed by dissociation curve measurements. The geNorm software was used to confirm reference gene stability as described previously (Vandesompele et al, 2002).

Table 5. 4: Primer sequences of the reference genes Gene Tm Primer sequences (5’-3’)

F: AAGCAGATGCAGCAGATCC RPLP0 55.4 C° R: GAGGTCCTCCTTGGTGAACA

F: CAGGGTGCTTTTGGAAACAT RPL4 53.8 C° R: AGATGGCGTATCGTTTTTGG

F: GGGTTTATGTGTCAGGGTGG PPIA 55.6 C° R: CAGGACCCGTATGCTTTAGG

F: GAACCACGGCACTGATTTTC TBP 54.5 C° R: GCTGGAAAACCCAACTTCTG

5.3.3. Droplet Digital PCR (ddPCR)

To examine changes in ESRP1 and its target gene expression during ovarian and testicular carcinogenesis, ddPCR was performed as described in §2.1.4 using specific primers and probes (Table 2. 1). Data from each ddPCR experiment was normalized to the geometric mean of housekeeping genes (RPL4, RPLP0, and TBP) and expressed as the mean ± standard error of the mean (SEM). Statistical analyses involved one-way ANOVA, followed by Tukey’s post-hoc analysis for ovarian samples and unpaired t-test used for testicular samples using

α=0.05.

5.3.4. Immunofluorescence staining and histology

Immunofluorescence was carried out on paraffin sections of formalin-fixed ovaries and testes as described in 2.2.2. Antibodies used included a rabbit polyclonal anti-human ESRP1 diluted 1:50, a mouse monoclonal anti-human CD44v6 diluted 1:500, and a mouse monoclonal anti-human OCT4 diluted 1:50 (Table 2. 2). To check the tissue structure of samples, haematoxylin and eosin stained sections were provided for each tissue section by the Victorian

Cancer Biobank and The Women's Hospital.

5.4. Results

5.4.1. Selection of housekeeping gene in ovarian and testicular samples

GeNorm analysis was used to confirm the suitability of house-keeping genes from RT- qPCR data obtained from ovarian and testicular tumour and non-cancerous (Normal) samples

(Fu et al, 2010; Svingen et al, 2014). In ovarian samples, RPLP0,TBP, and RPL4 showed lowest M values whereas PPIA showed the highest M value suggesting that RPLP0,TBP and

RPL4 were the most stable reference genes in ovarian samples. In testicular samples, PPIA and

TBP showed higher M values compared to RPL0 and RPL4, suggesting that RPLP0 and RPL4

were the most stable reference genes in these samples (Figure 5. 1). In all subsequent experiments, the geometric mean of data from ddPCR reactions for RPLP0,TBP and RPL4 were used to normalize expression data from ovarian tissues and the geometric mean of data from ddPCR reactions for RPLP0 and RPL4 were used to normalize expression data from testicular tissues.

Figure 5. 1: The average expression stability values of reference genes; Graphs showing gene stability rankings (M value) for selected reference genes for ovary (A) and testis (B). Stability of references gene expression by geNorm show that RPLP0,TBP and RPL4 are the most stable reference genes in ovarian samples whereas RPLP0 and RPL4 were most stable in testicular tissues.

5.4.2. ESRP1 expression is up-regulated in epithelial ovarian carcinomas

In order to investigate the involvement of ESRP1 in the development of epithelial ovarian cancers, I compared levels of ESRP1 mRNA expression in human serous and mucinous ovarian carcinomas with non-cancerous (normal) ovarian tissues by RT-ddPCR. As shown in

Figure 5. 2, ESRP1 was not expressed in normal ovaries, whereas its expression was significantly up-regulated in both serous and mucinous carcinomas. These data suggest that

ESRP1 may play a role in ovarian carcinogenesis.

Figure 5. 2: ESRP1 expression is upregulated in both serous and mucinous ovarian carcinomas; mRNA expression of ESRP1 in serous and mucinous ovarian carcinoma tissue samples compared to non-cancerous ovarian tissues (Normal) as analysed by ddPCR. ESRP1 expression is shown in copies/μl and normalised to RPL4, RPLP0, and TBP as the internal house keeper genes. For each group, individual data points are shown, and the bars indicate the mean ± SEM. Statistical comparisons were analysed using one-way ANOVA, followed by Tukey’s post-hoc analysis (*, p<0.05).

5.4.3. Normal ovary shows expression of mesenchymal marker ZEB1 but not epithelial marker CDH1

Since ESRP1 has been implicated in regulating EMT in various cell types and its expression was upregulated in the ovarian cancers compared to normal ovaries, I hypothesised that the differences in ESRP1 expression may be correlated with the epithelial or mesenchymal phenotypes in these tissues. To determine the predominant tissue type in the normal and cancerous ovarian tissue, RT-ddPCR was performed on the samples using primers and probes

(Table 2. 1) for genes that are specific markers of epithelial (CDH1) and mesenchymal (ZEB1) tissues.

The ddPCR data indicate that normal ovaries express a low level of CDH1, however, this marker is significantly increased in ovarian carcinomas (Figure 5. 3A). By contrast, the mesenchymal marker, ZEB1, was more highly expressed in normal ovaries than in either of the tumour sub-type (Figure 5. 3B). These data suggest that normal ovarian tissue may have more

mesenchymal properties than the serous and mucinous tumours, which appear to have more epithelial properties.

Figure 5. 3: Normal ovaries show mesenchymal properties and ovarian cancer tissue exhibits epithelial properties; The cellular phenotype of serous and mucinous carcinomas and non-cancerous (Normal) ovarian tissue samples were examined using CDH1 as epithelial marker and ZEB1 as mesenchymal marker. The mRNA expression of these genes is shown in copies/μl and their expression was normalised to RPL4, RPLP0, and TBP as internal house-keeping genes. (A) CDH1 is not expressed in normal ovary but is up-regulated in both serous and mucinous carcinomas. (B) ZEB1 expression is downregulated in both serous and mucinous carcinomas. Individual data points are shown and bars indicate mean ± SEM. Statistical significance determined by one-way ANOVA, followed by Tukey’s post-hoc analysis (*, p<0.05; **, p<0.01).

5.4.4. FGFR2IIIb to FGFR2IIIc switch during ovarian carcinogenesis

As ESRP1 was more highly expressed in both serous and mucinous carcinomas and

ESRP1 has a known role as a regulator in isoform switching of FGFR2 (Warzecha et al, 2009a),

I investigated if there were concomitant changes in FGFR2 splicing in these tumours. Using specific primers and probe for theFGFR2IIIb and FGFR2IIIc splice variants (Table 2. 1), I showed by ddPCR (Figure 5. 4) that FGFR2IIIc but not FGFR2IIIb was expressed in normal ovarian tissues. By contrast, serous and mucinous carcinomas expressed FGFR2IIIb but not

FGFR2IIIc. These data indicate that there is a shift in the expression from IIIc to IIIb FGFR2 isoforms in ovarian cancers compared to normal ovary and that this correlates with the increase in ESRP1 expression.

Figure 5. 4: FGFR2 IIIb expression is up-regulated and FGFR2 IIIc is down-regulated in ovarian cancers; mRNA expression of FGFR2IIIb and FGFR2IIIc in serous and mucinous ovarian carcinoma tissue samples compared with non-cancerous ovarian tissues (Normal) as analysed by ddPCR. Their expression was normalised to RPL4, RPLP0, and TBP as the internal house keeper genes (A) FGFR2IIIb, the epithelial specific isoform, is not expressed in normal ovaries and its expression is significantly increased in both serous and mucinous carcinomas. (B) FGFR2IIIc is expressed in normal ovaries but not in serous and mucinous ovarian carcinomas. Statistical comparisons were analysed using the one-way ANOVA, followed by Tukey’s post-hoc analysis (**, p<0.01).

5.4.5. CD44v6 is up-regulated in mucinous but not serous carcinoma

Similar to FGFR2, CD44 has been identified as an ESRP1 target and CD44 splicing is necessary for cancer progression (Brown et al, 2011). Among various CD44v isoforms, it has been reported in several studies that the CD44v6 isoform plays a pivotal role in progression of different cancers (Charpin et al, 2009; Gunthert et al, 1991; Shi et al, 2013). In this section, I examined the expression pattern of CD44s and CD44v6, as another putative target for ESRP1, in epithelial ovarian carcinoma samples compared to normal ovarian tissues using ddPCR. As shown in Figure 5.5, there was no significant difference in the expression of CD44s among normal and ovarian serous and mucinous tumours (Figure 5. 5A). While CD44v6 mRNA levels were significantly up-regulated in mucinous samples there was no little to no detectable expression in the serous carcinomas samples (Figure 5. 5B). These data suggest that there is increased splicing of CD44v6 in mucinous but not in serous carcinomas. However, the data showed considerable variability among the mucinous cancer samples and ideally further cancer samples of this and the serous type would need to be analyzed to confirm this result.

Figure 5. 5: Up-regulated CD44v6 expression in mucinous but not serous carcinoma; The expression level of CD44s and CD44v6 in ovarian carcinomas and non-cancerous ovarian tissues (Normal) as analysed by dd-PCR with normalization to RPL4, RPLP0, and TBP as the internal house-keeping genes. Individual data points are plotted along with their mean ± SEM. (A) CD44s expression did not show any changes in ovarian carcinomas compared to Normal tissue (B) CD44v6 expression is up-regulated significantly in mucinous but not serous carcinoma (One-way ANOVA, Tukey’s post-hoc analysis; *, p<0.05).

To further investigate the expression of ESRP1 and the CD44v6 isoform in ovarian tumours, I conducted immunofluorescence (IF) staining using specific ESRP1 and CD44v6 antibodies on paraffin-embedded section from normal ovary, serous and mucinous ovarian tumour tissues. Very little to no specific staining for ESRP1 (Figure 5. 6B) or CD44v6 (Figure

5. 6C) was detected in normal ovarian tissue. However, ESRP1 was abundant in nuclei and cytoplasm of both serous (Figure 5. 6F) and mucinous (Figure 5. 6J) ovarian tissues. While the CD44v6 antibody showed little to no staining in serous ovarian tissues (Figure 5. 6G) strong cytoplasmic staining detected in mucinous ovarian tissues (Figure 5. 6K). Overall, these data support the findings of the ddPCR analyses described above for ESRP1 and CD44v6 expression and indicate that there is increased expression of ESRP1 in both ovarian tumours and increased

CD44v6 splicing in mucinous tumours. In agreement with characteristic of ovarian samples in

§5.4.3, the histology of ovarian samples showed predominantly mesenchymal fibroblastic cells in normal ovary (Figure 5. 6A) whereas in serous (Figure 5. 6E) and mucinous (Figure 5. 6I) ovarian cancer samples, the tissues are clearly more epithelial in nature.

Figure 5. 6: Localisation of ESRP1 and CD44v6 in ovarian tumours; Representative images showing H&E (A, E, I) and immunofluorescence (B-D, F-H, J-L) staining for ESRP1 (B, F, J), CD44v6 (C, G, L) and DNA (D, H, L) in sections from normal (A-D) serous tumour (E-H) and mucinous tumour (I-L) samples. In normal tissue samples little or no staining for ESRP1 (green) or CD44v6 (red) were detected. In serous tumour samples, distinct cytoplasmic, perinuclear staining for ESRP1 (F) was detected in epithelial cells but very little or no staining for CD44v6 (G) was evident. The mucinous ovarian carcinoma tissue showed distinct nuclear and cytoplasmic labelling for ESRP1 (J) and distinct membrane- and cytoplasmic labelling for CD44v6 (K). Scale bar: 5 μm (A, E, I); 30 μm (B-D, F-H, J-L).

5.4.6. ESRP1 is minimally expressed in human normal ovary

The ovarian normal and tumour samples that were used in §5.3.1 to examine ESRP1 expression, were obtained from postmenopausal women between 48-76 years old and thus are likely to contain few if any ooctyes and follicles. To ensure that the lack of detectable ESRP1 expression was not due to the lack of follicles in the samples from these older women, I examined the expression of ESRP1 in normal ovarian samples from younger women (mean ±

SEM), which should contain oocytes.

Droplet digital PCR experiments using the ESRP1 primer and probes showed low levels of ESRP1 expression in these five normal samples from reproductive age women from 20-32

(Figure 5. 7A). Although ESRP1 expression in these ovarian samples is slightly higher compared to non-cancerous samples from postmonoposal women (ages 48-76), it was not

statistically significant (Figure 5. 7A). Similarly, immunofluorescence experiments on paraffin sections of follicles from these samples showed weak expression in the oocyte and granulosa cells in the primordial follicle (Figure 5. 7B). These data support the previous results showing that ESRP1 is only expressed at very low levels in the ovaries of older women, but also suggested that there may be subtle age-related differences in the levels of expression.

Figure 5. 7: ESRP1 is minimally expressed in normal ovary; (A). ESRP1 is minimally expressed in both normal ovarian samples from post-menoposal women (48-76 years, 0 to 2.5 copies/µl) and younger women (20- 32 years, 1-10 copies/µl) by RT- ddPCR. There was a slightly increased ESRP1 expression in young women but this increasing trend is not significant (Student’s unpaired t-test; p>0.05). Data for individual samples, normalised to RPL4, RPLP0 and TBP are shown along with the mean ± SEM. (B) Representaitve images of H&E stained normal young ovary (A) and confocal immunofluorescence images of paraffin embedded section from normal ovarian tissue stained with ESRP1 antibody (B) and Hoechst dye (C). Merged image is shown in D. Scale bar: 5 μm (A); 20 μm (B-D).

5.4.7. ESRP1 expression in germ cell testicular tumours

The results outlined in chapter 3 demonstrated that ESRP1 is expressed in germ but not somatic cells. Furthermore, many reports have described the role of AS in testicular tumors

(He et al, 2007; Yamada et al, 2004). As the data described in this chapter thus far (5.4.1-

§5.4.5) showed that ESRP1 expression is upregulated in female germ line tumours, we hypothesized that ESRP1 expression is also altered in testicular germ cell tumors.

To investigate this, ddPCR experiments were conducted on 12 male germ line tumours

(7 seminomas, 5 mixed germ cell tumours). The results showed significantly up-regulated expression of ESRP1 in both seminoma (Figure 5. 8A) and mixed germ-cell (Figure 5. 8B) tumors, compared to the control (Normal). This suggests ESRP1 expression may be involved in germ cell tumor initiation or progression.

Figure 5. 8: ESRP1 expression is up-regulated in germ cell testicular cancer; Expression of ESRP1 in seminoma tumors (A) and mixed germ cell tumors (B) compared to matching normal testicular tissues, analyzed using ddPCR with normalization to RPL4 and RPLP0, as the internal house-keeping genes. Individaul data points for each tumour sample are plotted along with the group mean ± SEM. Expression of ESRP1 was significantly elevated in both types of male germ cell tumours (un-paired Student’s t-test; *, p<0.05; **, p<0.01).

5.4.8. No detectable FGFR2 splicing in testicular germ cell tumours

Given that the ESRP1 target, FGFR2, showed marked changes in isoform expression in ovarian carcinomas, we also investigated whether similar isoform switching occurs in testicular cancers. The mRNA levels of FGFR2IIIb and IIIc spliced variants were analyzed using RT-ddPCR using the same samples used in §5.4.7. The result show that, in non-cancerous testicular samples, FGFR2IIIb is minimally expressed (Figure 5. 9A and C) but FGFR2IIIc is slightly more abundantly expressed (Figure 5. 9B and D). However, no significant changes were observed in the expression of either FGFR2 spliced variants in the seminoma (Figure 5.

9BA) or the mixed germ cell tumour samples (Figure 5. 9B A-D), suggesting that, in these tumours, FGFR2 is not a splicing target for ESRP1.

Figure 5. 9: No detectable FGFR2 splice variant switching in testicular germ cell cancers; RT-ddPCR analyses of FGFR2IIIb (A, C) and FGFR2IIIc (B,D) expression in seminoma (A,B) and mixed germ cell (C,D) tumors compared to respective non-cancerous testicular tissues. Neither FGFR2IIIb nor FGFR2IIIc expression were significantly different in seminoma or mixed germ cells tumors compared to normal tissues. Individual data are normalised to RPL4 and RPLP0 house-keeping genes and expressed as copies/μl along with the mean ± SEM for each group (un-paired Student’s t-test).

5.4.9. No detectable CD44 isoform switching in testicular germ cell tumors

Despite elevated levels of ESRP1 expression in testicular germ tumours, there was no apparent switching of FGFR2 isoforms. To investigate whether the expression of CD44 isoforms, as another ESRP1 target, are altered during testicular cancer, I conducted RT-ddPCR using specific primers and probes.

The result presented in Figure 4.10 indicates that the isoform switch from CD44s to

CD44v6 does not occur in testicular germ cell tumor. The graph in Figure 5. 10A shows that the mRNA expression of neither CD44s nor CD44v6 changed significantly in seminoma

tumors compared to normal. By contrast, CD44s expression is up-regulated in mixed germ cell tumors (Figure 5. 10C), while alterations in the expression levels of CD44v6 were not observed in this type of cancer (Figure 5. 10D). These data suggest that ESRP1 does not promote isoform switching from CD44s to CD44v6 in these two types of testicular cancer.

To confirm ESRP1 and CD44v6 protein expression levels in seminoma and mixed germs cell, immunofluorescence using specific ESRP1 and CD44v6 antibodies was performed.

Consistent with ddPCR data, ESRP1 showed weaker nuclear staining in normal tissues (Figure

5. 11B) but strong positive staining in both seminoma (Figure 5. 11F) and mixed germ cell tumors (Figure 5. 11I). By contrast, CD44v6 showed no staining in normal (Figure 5. 11C) and only a small amount of cytoplasmic staining in the tumors (Figure 5. 11H and J).

Figure 5. 10: CD44s is up-regulated in mixed germ cell tumors; Detection of CD44s and CD44v6 mRNA expression in seminoma tumor and mixed germ cell tumor in comparison to non-cancerous testicular tissues (Normal) using dd-PCR. (A)CD44s and CD44v6 expression does not change in seminoma tumor compared to normal. (B) CD44s expression was significantly up-regulated in mixed germ cell tumor whereas no significant change was observed in expression of CD44v6 in these tumor tissues compared to normal. RPLP0 and RPL4 were used as internal controls for normalization of the data. Data are shown as individual data points and the bars indicate mean ± SEM. Statistical comparsions by Student’s un-paired t-test (*, p<0.05).

Figure 5. 11: ESRP1 showed strong and CD44v6 weak staining in germ cell testicular cancer; H and E and immunofluorescence staining on paraffin embedded of normal, seminoma and mixed germ cell testicular tissues. The H and E staining (A, E and H) represent the tissue type used for the immunofluorescence staining. Specific antibodies of ESRP1 and CD44v6 were used for immunofluorescence staining. ESRP1 (green) showed weak nuclear staining in normal testis (B) but strong staining in both seminoma (F) and mixed germ cell (I) testicular tumour tissue. CD44V6 (red) showed no staining in normal testis (C) very weak cytoplasmic staining in seminoma (H) and mixed germ cell tumor (J). Hoechst (blue) used for nuclear stain (D,G,K). Scale bar for H&E stained images are 5 μm (A, E, and H) and 20 μm for immunofluorescence stained images (B-K).

5.4.10. OCT4 colocalizes with ESRP1 in seminoma tumors

Several studies have shown that expression of CD44 isoforms, especially CD44v6, alters in malignant cells and it could be associated with metastasis (Xin et al, 2001) (Yamaguchi et al, 2002) (Shimbori et al, 2003) (Todaro et al, 2014). Contrary to these studies, my finding did not show any changes in CD44v6 expression in testicular germ cell tumors. I next sought to investigate whether ESRP1 expression correlates with other testicular cancer markers.

In this section I investigated whether ESRP1 co-localizes with OCT4, which is another marker of germ cell tumors. OCT4 is a germ cell marker involved in the maintenance of pluripotency (Jones et al, 2004). Immunostaining of OCT4 is highly specific for diagnosis of a

seminoma tumour and embryonal carcinoma tumors (Cheng, 2004). A correlation of pluripotency factors with ESRP1 has previously been reported (Fagoonee et al, 2013). To address this question, ddPCR and immunofluorescence staining was conducted using specific primers and antibodies. The results presented in Figure 5. 12A indicates that OCT4 expression is up-regulated in seminoma tumours compared to normal tissues, whereas no significant changes were observed in mixed germ cells tumors (Figure 5. 12B).

The immunostaining (Figure 5. 12C) showed that both ESRP1 (in green) and OCT4 (in red) are upregulated in seminoma testicular cancer. Tumour cells show a strong nuclear staining with both antibodies for ESRP1 and OCT4 (Figure 5. 12C, G and H), whereas normal tissues much lower levels of staining with both antibodies (Figure 5. 12B and C). Furthermore,

ESRP1 colocalized with OCT4 in tumor cells (Figure 5. 12C, J). These data suggest are consistent with the RT-ddPCR data and suggest that ESRP1 may play a role in the progression of seminoma tumour in association with pluripotency factors.

Figure 5. 12: Co-expression of Oct4 and ESRP1 in seminoma testicular tumors; ddPCR analyses of OCT4 expression in seminoma (A) and mixed germ cell (B) tumors compared to non-cancerous testicular tissues (Normal). OCT4 expression was significantly up-regulated in seminoma tumors compared to normal tissues. No significant increase was detected in mixed germ cell tumours. Individual data points are shown and bars indicate mean ± SEM (Student’s un-paired t-test; *** p<0.001). H&E stained sections show representative examples of normal (C) and seminoma (H) tissues. Immunofluorescence on paraffin sections from normal (D-G) and seminoma testicular tissues (I-L) show ESRP1 (green, D, I) and OCT4 (red, E, J) are weakly stained in normal testis (D, E) but distinctly co-label cell nuclei in seminoma tumor tissue (I,J). Higher magnification images of double labelled nuclei are shown in insets for I-L. Scale bar: 5 μm for C, H; 20 μm for (D-G, I-L); 20 μm for insets I-L.

5.5. Discussion

5.5.1. Induction of ESRP1 expression may correlate with ovarian cancer by regulate FGFR2 and CD44 splicing

Recently, numerous studies have focused on investigating the role of ESRP1 in tumorigenesis and have revealed that ESRP1 can affect cancer progression in both a positive and a negative way depending on the types of cancer (Horiguchi et al, 2012; Ishii et al, 2014;

Lu et al, 2015; Ueda et al, 2014). Although there is much evidence about the role of ESRP1 in various cancers, its role in gonadal cancer remains to be elucidated.

In this study, we found that ESRP1 mRNA and protein expression was significantly up- regulated in both serous and mucinous ovarian carcinomas. This data was consistent with a recent study using The Cancer Genome Atlas (TCGA) database, showing that ESRP1 expression is signiﬁcantly higher in ovarian serous carcinoma than in normal ovarian tissues

(Jeong et al, 2017). My data here provides additional evidence that ESRP1 expression is not only increased in ovarian serous carcinoma but also in mucinous carcinoma.

It has been well established that ESRP1 expression is tissue specific and highly expressed in epithelial tissues (Warzecha et al, 2009a). Since, ESRP1 is minimally expressed in normal ovarian tissues, I asked if ESRP1 alteration could be related to ovarian cellular phenotypes. E-cadherin (CDH1) has been described as the epithelial cell marker which is down-regulated during EMT (Huber et al, 2005; Kalluri & Neilson, 2003; Kalluri & Weinberg,

2009). Previous studies reported upregulation of CDH1 in benign ovarian cancers compared to the normal ovary (Yi et al, 2015), while its expression was low in invasive tumours. It seems that the expression of CDH1 is associated with tumour grade (Vergara et al, 2010). Moreover, it has been observed that suppression of E-cadherin is due to increases in other EMT transcription factors such as Snail, Slug, ZEB1/2 (Elloul et al, 2005). In this study, I observed low level of CDH1, but high ZEB1, expression in the normal ovaries which was consistent with

their predominant mesenchymal phenotype, whereas the epithelial characteristic of ovarian cancer samples was consistent with high level of CDH1, but low ZEB1 expression. This suggests that ovarian cancer tumour cells undergo MET and proliferate as epithelial tumour cells. Furthermore, it has been proposed that EMT is involved in invasion and metastasis, while

MET is more related to tumour growth and proliferation (Brabletz, 2012). As ESRP1 expression appears to play a role in MET-related mechanisms (Warzecha et al, 2010) it’s upregulation may also impact on ovarian tumour cell growth.

Also, in this study I elucidated that ESRP1 target genes, CD44v6 and FGFR2IIIb, were up-regulated in ovarian cancer compared to normal ovarian tissue. My results demonstrated that FGFR2IIIb expression was up-regulated in both serous and mucinous carcinomas whereas

FGFR2IIIc is down-regulated. In agreement with my data, Steele et al (2006) using RT-PCR showed that FGFR2IIIb was expressed in 16/20 snap frozen epithelial ovarian cancers whereas it was not detected it in normal ovarian samples. Since FGFR2IIIb is an epithelial isoform, high levels of its expression in ovarian carcinomas lends further support that the epithelial phenotype of ovarian tissues increases when it undergoes malignant changes. Also, my result suggests that the switch in FGFR2 splicing, which occurs during ovarian cancer development, depends on the level of ESRP1 expression. However, Jeong et al (2017) showed that ectopic ESRP1 expression does not affect FGFR2 splicing in ovarian cancer cell line.

I also examined the expression of CD44 isoforms, CD44s and CD44v6, as another target of ESRP1 in normal and ovarian carcinomas. To date, several studies have focused on the expression of CD44 isoforms, specifically CD44v6, in ovarian cancer to find a correlation between expression and ovarian cancer progression. Recently several published studies are in support of CD44v6 correlation with epithelial ovarian cancer progression {Yoshida, 1998

#590}{Shi, 2013 #541}{Wang, 2014 #474}. In agreement with these studies, my results showed that CD44v6 is significantly up-regulated in mucinous ovarian carcinomas. However,

I did not observe any significant changes in serous carcinoma. Although this result was in contrast with the studies showing up-regulation of CD44v6 in both serous and mucinous carcinomas (Darai et al, 1998; Zhou et al, 2012), other studies have reported no association between CD44v6 expression with ovarian cancer (Bar et al, 2004; Berner et al, 2000; Sakai et al, 1999). These disparate finding could be related to the different detection methods used, the number of samples or heterogeneous collection of tissues.

Taken together, my findings suggest that ESRP1 causes phenotypic switching via regulation of epithelial isoforms of FGFR2 in both serous and mucinous ovarian carcinomas and CD44 only in mucinous carcinoma.

5.5.2. ESRP1 may play a role in the progression of testicular cancer via regulating of pluripotency factors

It has been reported that AS is a frequent process in the testis and is a very important step throughout germ cell development (Chalmel & Rolland, 2015; Eddy, 1998; Ladd &

Cooper, 2002; Margolin et al, 2014; Yeo et al, 2004). My data in chapter 3 showed that ESRP1 is expressed in germ cells but not in gonadal somatic cells in developing mice embryos. This suggests a role for ESRP1 in germ cell development. Although the importance of AS in testicular cancer has been demonstrated (He et al, 2007; Yamada et al, 2004), its regulatory mechanisms are still unknown. My RT-ddPCR data showed that ESRP1 is up-regulated in both seminoma and mixed-germ cell testicular cancer, suggesting that ESRP1 may also play a role in testicular cancer progression. However, I found no evidence for FGFR2 and CD44 isoform switching. Therefore, it seems that ESRP1 does not regulate splicing of FGFR2 and CD44 in testicular cancer. Intriguingly, my results showed that CD44s mRNA level was increased only in mixed germ cell, not seminoma tumours. I hypothesise that this may be related to the fact that mixed germ cell tumours are characteristically more heterogeneous and also show more mesenchymal phenotypes (Heidenberg et al, 2012).

Since my results did not show any changes in switching of FGFR2 and CD44 splice variants in testicular cancer, I demonstrated an association with OCT4 expression, which was up-regulated in seminoma tumours and the protein co-localised with ESRPQ in tumour cell nuclei. These results are compatible with previous studies, which introduced OCT4 as a specific marker for the diagnosis of seminoma tumour (Cheng, 2004).. As it has been reported previously that ESRP1 has effects on expression of pluripotency factors (Fagoonee et al, 2013), it is plausible that ESRP1 play a role in testicular cancer via regulating of such pluripotency factors. However, further investigation will be needed to elucidate the precise mechanism by which ESRP1 functions in testicular cancer.

5.6. Conclusions

Collectively, our data in this chapter suggest that ESRP1 expression may play a role in gonadal cancer development. ESRP1 regulates FGFR2 and CD44 splicing in ovarian cancer.

By contrast, it doesn’t appear to do have any regulatory roles in testicular cancer. In addition, it is plausible that ESRP1 may play a role in testicular cancer in association with pluripotency factors.

Chapter 6. Identification of potential ESRP1 targets in testicular germ cell tumor (TCam-2 cell line)

6.1. Introduction

Testicular germ cell tumors (TGCTs), are the most common solid malignant tumors in young men (Klinck et al, 2008). Seminomas, which constitute more than 50% of all TGCTs have cells that are uniform in appearance and resemble primordial germ cells. Due to this characteristic, studying gene expression in seminomas may not only improve understanding of its oncogenesis, but may also be helpful for research into primordial germ cells (Yamada et al,

2004).

To date, several reports have described high levels of alternative splicing (AS) in testis and its relevance to testicular cancer (He et al, 2007; Yamada et al, 2004). In the previous chapter, I hypothesized that ESRP1, a regulator of AS, plays a role in testicular cancer progression. Our results showed that although it is up-regulated in testicular tumors, its role may not be via regulation of FGFR2 and CD44 AS. To further define potential ESRP1 targets in testicular tumor cells, we used siRNA to deplete ESRP1 expression in the human testicular seminoma-derived TCam-2 cell line, which has been shown to have characteristics of fetal germ cells (Young et al, 2011).

The TCam-2 cell line was established from a primary testicular seminoma of a 35-year- old patient by Mizuno et al (1993). The seminoma characteristics of these cells have been shown by the high expression level of KIT, SCF and PLAP, OCT4 and Nanog and absence of

CD30, SSX2-4, and SOX2 in different studies (de Jong et al, 2008; Ferranti et al, 2013;

Looijenga et al, 2010).

6.2. Aim

In §5.4.8 and §5.4.9, I identified that different levels of ESRP1 expression do not correlate with isoform switching of FGFR2 and CD44 in testicular cancers. As previous studies had indicated a wide range of genes as being targets of ESRP1-mediated splicing, in

this chapter, I aimed to identify putative targets of ESRP1 in the TCam-2 cells, as an in vitro model system for testicular germ cell tumors. We used siRNA to deplete ESRP1 in TCam-2 cell line and utilized Illumina HiSeq 2500 RNA-sequencing, followed by bioinformatics analysis to identify genes differentially expressed and a novel set of alternative splicing events regulated by ESRP1.

6.3. Methods

6.3.1. TCam-2 cell culture

The human seminoma testicular cell line (TCam-2) was obtained from Professor Kate

Loveland (Hudson Institute of Medical Research) and cells were grown in Rosewell Park

Memorial Institute medium (RPMI 1640, Gibco,) supplemented with 10% fetal calf serum

(FBS, Life Technologies,) and penicillin/streptomycin diluted 1:200 (Gibco, USA) at 37°C,

5% CO2, in a humidified incubator and passaged at confluency. All experiments were performed using 6-well plates seeded with 0.6 ×106 cells cultured for 24 hours (Nunclon™

Delta, ThermoFisher) in medium lacking antibiotics and allowed to reach to 60-80% confluency.

6.3.2. Cycloheximide chase assay

To investigate the stability of ESRP1 protein, TCam-2 cells were subjected to a cycloheximide chase assay. Cells were seeded in 6 wells dishes as described above and incubated overnight at 37°C, prior to incubating the cells in RPMI medium with or without 50

μg/ml cycloheximide (CHX). Cells not treated with cycloheximide were considered as time point 0. Cell lysates (see 6.3.3 below) were then collected at 24, 48, and 72 hours after treatment and stored at -20°C. After determination of protein concentrations by the

bicinchoninic acid protein assay kit (BCA kit, Thermo Fisher Scientific), the extracts were analyzed by western blotting (see 6.3.4).

6.3.3. Cell lysis

After washing cells with PBS and removing media, 200µl of

Radioimmunoprecipitation assay buffer (RIPA) and protease inhibitor mixture were added to each 10cm culture dish and left on ice for 30 minutes. Then cells were scraped off the dish and collected in centrifuge tubes. Cells were centrifuged at 15,000 rpm for 10 min at 4ºC to pellet cell debris, and supernatant collected and stored at -20°C for Western Blot analysis.

6.3.4. Western Blot Analysis

The protein concentration of each cell lysate was measured using the Pierce TM BCA protein Assay Kit (Thermo Fisher Scientific, Australia). Standards ranging between 250 and

2000 μg/ml and the working Micro BCA reagent were prepared as per the manufacturer’s instructions. 10 µl of each of the protein samples and the standards were added to 200 µl of

BCA reagent and incubated at 37°C for 30 min. prior to measuring absorbance at 562nm using a Nanodrop 2000 spectrophotometer. Then cell lysates (20 ug protein/sample) were diluted in

4X loading buffer (Bio-Rad) and loaded per well onto a 10% SDS PAGE gel (Bio-Rad) and separated by electrophoresis (120mV for 90 min. at RT) using a BioRad electrophoresis apparatus (Tetra Blotting Module, Bio-Rad) and 1X running buffer (3g Tris base, 14.4 g glycine, 1% SDS). The separated proteins were transferred to Immobilon-P PVDF membranes

(Millipore, Australia) in transfer buffer (3.03 g Tris base, 14.4 g glycine, 20% methanol) at 100 mV for 1 hour (1h) while the chamber was placed on ice. Membranes were blocked for 1 hour in phosphate buffered saline (PBS) with 0.05% Tween-20 and 5% powdered milk, prior to incubation with primary antibodies (Table 2. 2) diluted in PBST (PBS and 0.05% Tween) with

5% BSA overnight at 4°C. Membranes were washed with PBST three times for 15 minutes, 100

followed by incubation with the appropriate horseradish peroxidase (HRP) -conjugated secondary antibodies (Invitrogen) for an hour at RT. Membranes were washed in PBST three times, each for 15 minutes and signals were visualized using Clarity TM Western ECL substrates (BioRad), according to the manufacturer’s recommended protocol. Finally, the membranes were imaged with the ChemiDocTM MP system (Bio-Rad).

6.3.5. Cell transfection

To transfect TCam-2 cells, two different approaches were compared. The first approach involved using the Neon® Transfection system (Invitrogen) to electroporate cells with pGIPZ-lentiviral shRNAmir (see appendix A1), which was generously provided by A/Prof

Carstens (Department of Medicine, University of Pennsylvania). EF1αEGFP was used as positive control. Several electroporation conditions (e.g., voltage, pulse width, and number of pulses) were optimized, the best electroporation parameters for TCam-2 cell line involved two pulses of 850 mV, for 30 ms. Cells were examined after three days post-electroporation using an inverted microscope (EVOS FLoid Cell Imaging, Life Technologies, Australia) to examine

GFP expression. However, this technique resulted in low transfection efficiency of TCam-2 cells when using the ESRP1shRNA (Figure 6. 1).

As the electroporation approach yielded low efficiency when using the ESRP1 siRNA construct, we also tried a Lipofectamine transfection kit (Lipofectamine® RNAiMAX; Life

Technologies, Australia) to directly introduce siRNA molecules. As described above, 0.6 ×106 cells were seeded in 6-well plates with RPMI medium in the absence of antibiotic the day before transfection. Two siRNA duplexes and negative control siRNA (25 ρmole), obtained from Ambion (Life Technologies, Australia, Table 6. 1), were diluted in Opti-MEM® medium

(Gibco, Thermo Fisher Scientific) and 3 % Lipofectamine® RNAiMAX (Life technologies,

Australia), according to the manufacturer's instructions. After incubation for 5 minutes at RT,

101

the RNAi duplex/Lipofectamine® RNAiMAX complexes were added to each well and left at

37℃ for 72 hours. Transfection efficiencies were analyzed by ddPCR and western blot after

72 hours.

Figure 6. 1: Knockdown of ESRP1 in TCam-2 cells using shRNAmir; TCam-2 cells transfected by EF1αEGFP as control (A) and pGIPZ-lentiviral ESRP1 shRNAmir (B). The successfully transfected cells show green fluorescence. The transfection efficiency in cells transfected with ESRP1 shRNA was very low compared to control. Table 6. 1: siRNA target sequences siRNA ID Sense Sequence (5’-3’) Catalogue Number Lot Number Silencer®Select Antisense Sequence (5’-3’)

GAGAGUGAAUUACAAGUUUTT S29570 #4392420 # AS025SCB AAACUUGUAAUUCACUCUCTC

CCUUCGAGGUCUUCCCUAUTT S29571 #4392420 # AS025SCC AUAGGGAAGACCUCGAAGGCG

Negative Control Sequences is not available #4390843 #AS023T9Q

6.3.6. ddPCR

To check gene transfection efficacy, expression analyses were performed by ddPCR as described previously in §2.1.4 RNA (200 ng) extracted from control and siRNA-transfected

TCam-2 cells, using RNeasy mini kits (§2.1.1), was reverse transcribed using SensiFAST™ cDNA Synthesis Kit (§2.1.3.2) and ddPCR performed using the ESRP1 assay.

102

6.3.7. Immunofluorescence of cells

To conduct immunofluorescence of transfected TCam-2 cells, the culture conditions were modified to grow the cells on 13 mm round plastic coverslips (Thermanox™) in six-well culture plates as described in section 6.3.1. Following siRNA transfection, cells were cultured in RPMI medium for 72 hours before being fixed in 4% paraformaldehyde in PBS for 20 min, and permeabilized for 20 min in 0.2% TritonX-100 in PBS. After blocking with 10% FCS in

PBS for 30 min, cells were incubated overnight at 4°C with anti-ESRP1 primary antibody diluted 1:50 (Table 2. 2) in blocking buffer. Antibody binding was detected by incubating with

1:500 AlexaFluor 488-conjugated donkey anti-rabbit IgG (Invitrogen A-21052) for 1h. Cells were counter-stained with 1 µg/ml Hoechst dye and 1 µg/ml Phalloidin-TRITC (Sigma) for 1h.

Matching plastic coverslips for each treatment were mounted onto 50 mm square glass coverslips and visualized using confocal microscopy as described in §2.2.3.

6.3.8. RNA-Sequencing analysis

To examine global changes in gene expression and splicing following ESRP1 siRNA transfection, we conducted RNA-sequencing analyses (RNA-Seq) on RNA isolated from control and siRNA transfected cells. The RNA-Seq analyses were performed at the Australian

Genome Research Facility (AGRF) using the Illumina HiSeq 2500 with 100 bp paired-end reads. The quality and quantity of RNA samples were examined using an Agilent 2200 Tape

Station prior to processing. Based on AGRF control parameters, only samples containing ≥100 ng total RNA, an A260/A280 ratio of 1.8 – 2, and a RIN ≥8 were processed for RNA-Seq. Six individual samples (3 control, 3 siRNA) were sequenced on Illumina HiSeq 2500 and the primary sequence data was generated using the Illumina bcl2fastq 2.19.1.403 pipeline. The raw FASTQ paired-end reads were aligned against the Homo sapiens genome (Build version

HG38) using Tophat aligner (v2.0.14). The transcripts were assembled with the Stringtie tool

103

v1.2.4, utilizing the reads alignment with hg38 and reference annotation-based assembly option

(RABT). EdgeR version 3.18.1 was used to perform differential expression analysis. For alternative splicing, feature counts to assign read counts to each of the exons were used and then the biomaRt package was utilized to map the gene for each given exon. Finally, different plots including MDS plots, smear plots and heatmaps were provided by AGRF. An overview of RNA-Seq data processing workflow is shown in Figure 6. 2.

Figure 6. 2: RNA-Seq data processing workflow; After sequencing of data and quality control of sequenced data, sequence alignment/mapping was performed. Aligned data was checked for quality control and the data normalized to reference genes. Finally, downstream functional analysis including differential expression and alternative splicing were conducted.

6.3.9. Ingenuity® Pathway Analysis

Altered expression of genes were analyzed by QIAGEN’s Ingenuity® Pathways

Analysis to identify canonical pathways, cellular processes, disease classifications and biofunctions that were significantly affected by knockdown of ESRP1 expression. Two

104

criteria, p-value <0.05 and fold change of log2 > 0.85, were set to identify genes which were significantly dysregulated by ESRP1 silencing.

6.3.10. PCR amplification

To confirm changes in specific gene splicing events of putative splicing targets

(CTNND1 and DOCK7) in transfected TCam-2 cells, standard RT-PCR was performed using cDNA template (from control and siRNA transfected cells as described in §6.3.6), exon- specific primers (Table 6. 2), dNTPs, PCR buffer and enzyme, according to the supplier’s protocol (Platinum® Taq DNA Polymerase, Invitrogen), made up to a total of 50µl with RNA- free H2O. The PCR mix was then amplified using a thermal cycler as preheated at 95°C for 5 min and followed by 35 cycles of 94°C for 1min, 53°C for 1min, 72°C for 1min and a final step at 72°C for 10 min. Then, the PCR products were separated by electrophoresis on 2% agarose gels to detect splicing of CTNND1 and DOCK7.

Table 6. 2: Primer sequences used in PCR amplification of splice variants Amplicon Gene Forward primer (5’-3’) Reverse Primer (5’-3’) Size

CTNND1 CAGATGATGGGACCACTCG TCTAGCCCATAAGGCTCTGG 463 Total CTNND1 Splice variants TGTCTTTCTCAGCACCTTGG GTCTTTCAAGGTCAGCATCG 592 (exons 2 and 3)

DOCK7 TAGTGGTTCTCCCCAACTGC GGATCCATTTCACTTTCTTCAGG 252 Total

DOCK7 (exons 23 and GGTTTGGGAGGATCAGTGC TCTGTGTGCGAAGACATACG 296/203 24)

105

6.4. Results

6.4.1. ESRP1 protein stability

Before conducting transfection experiments on TCam-2 cells, a cycloheximide chase analysis of the stability of the ESRP1 protein was conducted, which showed that the ESRP1 protein remains stable in these cells for at least 24 hours. By 48 hours, small amounts of the protein are still detected by western blot, but by 72 hours no protein was detected (Shown earlier in

Figure 3. 9). Therefore, we conducted our analyses of siRNA knockdown cells at 72 hours post-transfection.

6.4.2. ESRP1 is depleted efficiently in TCam-2 cell line using siRNA

Transfection of TCam-2 cells with two independent siRNA constructs (#S29570 and

#S29571) resulted in efficient knock-down of ESRP1 protein, as determined by western blot

(Shown earlier in Figure 3. 10B). As a faint band was still detected with siRNA#S29571, in all subsequent experiments the siRNA #S29570 was used to knock down the ESRP1 expression in these cells. The efficiency of transfection after using this siRNA was further confirmed by ddPCR (Shown earlier in Figure 3. 10A) and immunofluorescence (Shown earlier in Figure 3.

5), which showed effective knockdown of both mRNA and protein.

6.4.3. Down-regulation of ESRP1 results in altered gene expression

Having established that siRNA#S29570 efficiently down-regulated ESRP1 expression, we carried out RNA-Seq experiments to determine if changes in ESRP1 expression regulate gene expression and alternative splicing in TCam-2 cells. The RNA isolated from these cells was of high quality with RNA integrity numbers (RIN) ranging from 8.8-10 (Figure 6. 3). The smear plots and MDS from AGRF (Figure 6. 4A and B) also indicated consistency among the samples in each group and marked differences in the expression of large numbers of genes

106

between the control and siRNA-transfected cells. A total of 1682 gene were detected by the

RNA Seq experiment. Filtering of these data according to significant different expression

(p<0.05), false discovery rate (FDR<0.05) and fold change >1.8 fold (FC>log2=0.85) resulted in 1307 genes that were significantly different between control and siRNA-treated cells (see

Appendix A2). A heat map of the top 50 differentially expressed (DE) genes in the two treatment groups shows remarkable consistency among the three samples in each group (Figure

6. 5). As expected from the siRNA knockdown and consistent with our RT-PCR and western blotting data, ESRP1 was one of the most highly DE genes (arrow on Figure 6. 5).

107

Figure 6. 3: Quality of RNA isolated from transfected TCam-2 cells; (A) Gel-like image of a total RNA samples on the Agilent 2100 Bioanalyzer using the Eukaryote Total RNA Nano assay. S represents silenced and C is control. (B) Electropherograms of samples showing RIN numbers from 8.80 to 10.

108

Figure 6. 4: Smear plot and Multidimensional scaling (MDS) plot; (A) Smear plot showing changes in gene expression conferred by knockdown of ESRP1 expression. red dot indicates gene that is differentially expressed. Genes showing significant differences (FDR>0.05) are shown in red. FC is fold change in expression. (B) Results of RNA-Seq data quality assessment show the silenced samples (S, in green) are clearly separated from controls (C, in blue).

109

Figure 6. 5: Heatmap of top 50 most differentially expressed genes after silencing of ESRP1; Rows indicate the expression of different genes, and columns correspond to silenced (S) and control (C) samples, n=3 for each group. The highest expression of each gene across the samples is shown in dark red while the lowest expression is shown in dark blue. Arrow shows ESRP1 which its expression significantly declined in silenced compared to control.

6.4.4. Ingenuity Pathway Analysis for Differentially expressed transcripts

Differentially expressed transcripts that met P-value <0.05 and log fold change of ±0.85 were filtered in the IPA software and analyzed against the annotated literature database in IPA to identify the top canonical pathways that were dysregulated following knockdown of ESRP1 expression (Figure 6. 6). The most significant pathways affected included the oxidative

110

phosphorylation pathway in mitochondria, particularly genes involved in Complexes I, III, IV and V (Figure 6. 7).

Figure 6. 6: Top canonical pathways affected by silencing of ESRP1 identified by IPA. ; The bar charts display −log p-value and percentage of genes, above of x-axis, which up-regulated (green) and down-regulated (red) in each canonical pathway. Total number of genes in each pathway represented at the top of each bar, in bold. The yellow line represents −log p-value of affected genes to the total number of genes in a pathway.

111

Figure 6. 7: Oxidative phosphorylation genes expression affected by depletion of ESRP1.; Figure shows mitochondrial inner membrane, where oxidative phosphorylation occurs. The green and red colors indicate respectively up- or down-regulation of gene expression in response to silencing of ESRP1

112

6.4.5. New splicing targets of ESRP1 in germ cell tumor

ESRP1 is well-known for its involvement in the regulation of alternative splicing of different genes during EMT (Warzecha et al, 2010). To identify novel alternative splicing events regulated by the ESRP1 expression in TCam-2 cells, the edgeR tool was used to find genes differentially spliced between control and ESRP1 knockdown group. A total of 676 genes were identified (available in the Appendix A3). I compared my data to previously published papers (Dittmar et al, 2012; Joo et al, 2013; Warzecha et al, 2010; Warzecha et al,

2009b) and confirmed 99 common targets. Interestingly, I identified 576 novel target genes for ESRP1 in germ cell tumors.

To further validate changes in splicing associated with down-regulation of the ESRP1,

RT-PCR was performed in cells treated with or without siRNA to determine the exclusion or inclusion of exons after the ESRP1 knockdown. Previous studies reported that exons 2 and 3 of CTNND1 and exon 23 of DOCK7 are direct targets of ESRP1-mediated splicing (Warzecha et al, 2009b). My RNA-Seq data showed that both transcripts are the target of ESRP1 in TCam-

2 cells. Consistent with previous reports and our RNA seq data, RT-PCR showed a shift from the variants lacking exons 2-3 to variants that include these exons in cells treated with ESRP1 siRNA (Figure 3. 10C, left). Similarly, DOCK7 transcripts showed greater inclusion of exon

23 (Figure 3. 10D, left), whereas the expression of the constant exons for both genes remained unchanged (Figure 3. 10C and D, right).

6.4.6. ESRP1 may be implicated in regulation of cell motility and tumor invasion

Next, to find pathways that are related to these splicing targets of ESRP1, IPA analysis was performed on the 675 genes that showed evidence of being differentially spliced in the control and siRNA-treated cells. Table 6. 3 shows the top canonical pathways associated with

113

these differentially spliced genes. Consistent with the close connection of ESRP1 to EMT, the highest ranked pathways were integrin signaling (Figure 6. 8A) and actin cytoskeleton (Figure

6. 8B) which are related to cellular movement, cell adhesion, and tumor invasion.

Table 6. 3:The top five canonical signaling pathways regulated by ESRP1 in TCam-2 cells Name p-Value Overlap

Integrin Signaling 2.57E-05 8.7% 19/219

Actin Cytoskeleton Signaling 1.33E-04 7.9% 18/227

Rac Signaling 1.65E-04 10.3% 12/117

RhoA Signaling 2.85E-04 9.7% 12/124

EIF2 Signaling 2.89E-04 7.7% 17/221

114

Figure 6. 8: Impact of ESRP1 knockdown on splicing of genes in integrin and actin signaling; A schematic of the integrin and actin signaling canonical pathway produced using IPA overlaid with genes identified by RNA- Seq as being alternatively spliced. Genes highlighted in pink are differentially spliced after ESRP1 knockdown and gray shows genes that were not altered. Cut off criteria for analyzed: p< 0.05, FDR<0.05.

6.4.7. ESRP1 potentially affects testicular cancer via regulating pluripotency factors

Pluripotency factors such as OCT3⁄4, NANOG, SOX2 and LIN28 have been reported as hallmarks of germ cell line tumors (Cheng, 2004; Gillis et al, 2011; Hart et al, 2005; Hoei-

Hansen et al, 2005; Palumbo et al, 2002). The presence of these factors in TCam-2 cells has

115

been reported previously using immunostaining and western blot (de Jong et al, 2008; Gillis et al, 2011) . However, TCam-2 was negative for SOX2 as reported before (de Jong et al, 2008;

Gillis et al, 2011).

Fagoonee et al (2013) et al, showed a correlation between pluripotency-related genes and ESRP1. Also, my data in chapter 3 showed that OCT4 (POU5F1) expression is up- regulated in seminoma tumors and co-localized with ESRP1 in seminoma tumor cells. In this section, I checked if knockdown of ESRP1 in TCam-2 cells affected pluripotency gene expression. As shown in Table 6. 4, LIN28A expression is up-regulated significantly (FC=

3.75; p<0.001) after depletion of ESRP1, whereas NANOG (FC=0.77; p<0.001) and POU5F1 are downregulated significantly (FC=0.35; p<0.001).

Table 6. 4: Pluripotency factors are differentially expressed after silencing ESRP1

Gene log2 FC p-value FDR

LIN28A 1.90 0 0

NANOG -0.38 1.48E-10 7.05E-10

POU5F1(OCT4) -0.45 8.34E-20 8.08E-19

6.5. Discussion

6.5.1. Knockdown of ESRP1 affects mitochondrial function in germ cell tumors

Mitochondria are crucial for energy production in normal cells and they also play important roles in cancer progression. Oxidative phosphorylation, which occurs in mitochondria, produces the major amount of energy for the cells (Falk & Sondheimer, 2010;

Greaves et al, 2012). The proper function of mitochondria is essential for cancer cells to obtain required energy for proliferation and growth (Holmuhamedov et al, 2002; Mullen et al, 2011;

Tan et al, 2015). However, impairment of mitochondrial function is common in cancer cells

116

due to alteration in metabolic pathways for maintenance of cancer cells (Mullen et al, 2011).

My data here showed that four complexes of oxidative phosphorylation are affected by differential gene expression after silencing of ESRP1 suggesting that ESRP1 expression in testicular germ cells may alter ATP production and thus affect energy metabolism of these cells.

On the other hand, during oxidative phosphorylation 98% of consumed oxygen results in production of water with the residual 2% resulting in reactive oxygen species (ROS) production (Thannickal & Fanburg, 2000). There is strong evidence that malfunction in oxidative phosphorylation, specifically in complexes I and III, can result in excessive amounts of ROS and lead to carcinogenesis (Bonora et al, 2006). Taken together, my data suggest that

ESRP1 may affect energy production and/or ROS production in cancer cells. However, the precise mechanism by which ESRP1 regulates these processes needs further investigation.

6.5.2. ESRP1 regulates cell motility via splicing of different genes in distinct pathways

Several studies have revealed that knockdown of ESRP1 promotes cell motility, which suggests an inhibitory role for ESRP1 in cancer invasion and metastasis (Ishii et al, 2014; Ueda et al, 2014; Warzecha & Carstens, 2012). Ishii et al (2014) found that knockdown of either

ESRP1 or ESRP2 enhanced cell motility in HNSCC cells via up-regulation of Rac1b isoform and formation of long filopodia. Consistent with this, the IPA alternative splicing analysis showed significant changes in integrin, actin, Rac and Rho signaling pathways suggesting that these are potentially regulated by ESRP1 splicing activity. Integrins are heterodimer receptors containing α and ß subunits which can activate a variety of intracellular signaling cascades resulting in cellular movement, cell adhesion and tumor invasion (Seftor et al, 1992; Zheng et al, 1999). Actin cytoskeleton signaling is also associated with the metastatic phenotypes of malignant cancer cells via formation of filopodia (Faix & Rottner, 2006). Consistent with the

117

close connection of ESRP1 to EMT these data collectively indicate that ESRP1 negatively regulates cell motility via regulation of integrin, actin and Rac signaling.

6.5.3. ESRP1 potentially affects testicular cancer via regulating pluripotency factors

The regulation of genes that are involved in germ cell proliferation and maintenance of stem cells is very important during germ cell tumor formation. My results here show that knockdown of ESRP1 significantly induces LIN28A expression in TCam-2 cells (~ 4-fold change). LIN28A is required for germ cell lineage generation (West et al, 2009; Zheng et al,

2009). In addition, it has a negative regulatory role on miR-Let-7 maturation which acts as a tumor suppressor in different cancer types (Heo et al, 2008; West et al, 2009). My data here suggest that ESRP1 expression results in LIN28A suppression and thus consequently may increase miR-Let-7 tumor suppressor activity. This agrees with previous studies, which considered the implication of ESRP1 as a tumor suppressor gene in different cancers

(Horiguchi et al, 2012; Leontieva & Ionov, 2009).

On the other hand, I demonstrated small but significant reductions in OCT4 and Nanog mRNA expression in ESRP1 depleted TCam-2 cells. These data suggest a correlation between

ESRP1 expression with pluripotency factors, which has been considered previously (Fagoonee et al, 2013). However, this result is in contrast with the previous report, which showed that silencing of Lin28 in TCam-2 cells resulted in downregulation of Oct4 and Nanog (Gillis et al,

2011).

Based on these data, ESRP1 expression likely tunes a balance between cell proliferation by regulating of pluripotency factors expression and tumor suppression by regulating an oncogenic gene such as Lin 28.

118

6.6. Conclusions

Analysis of the RNA sequencing data from ESRP1 depleted TCam-2 cell line resulted in the identification of over five hundred potential novel targets for ESRP1 in germ cell tumors.

Also, in this chapter, I showed that pluripotency factor expression was changed after ESRP1 silencing. My results imply that ESRP1 plays a role as a tumor suppressor in testicular germ cell tumors by down-regulation of Lin 28. Oxidative phosphorylation and integrin signaling appear to be the most significant pathways affected by ESRP1 down-regulation. Taken together, these data suggest that ESRP1 may affect testicular cancer via regulating pluripotency factors, energy production, cell motility and tumor invasion.

119

120

Chapter 7. Discussion and future directions

121

Disruptions of germline development can lead to abnormalities such as infertility and germ cell tumors (GCTs). Most GCTs originate from a defect in primordial germ cell or gonocyte/spermatogonial stem cell development in neonates of both sexes (Dolci et al, 2015;

Facchini et al, 2018). For instance; testicular germ cell tumors in young adult males originate from primordial germ cells or spermatogonia stem cells (SSCs) (Del-Mazo et al, 2013;

Looijenga & Oosterhuis, 2013). On the other hand, several studies have shown that testis has the highest complexity of genome expression due to spermatogenesis stages specific alternative splicing (AS)(Xu et al, 2002; Yeo et al, 2004). Given that AS defects may result in various male reproductive disorders such as cancer (Krawczak et al, 1992), studying the specific splicing isoforms and the associated underlying regulations that may play a role in germ cell development at different stages will improve our knowledge about gonad development and features of the various types of GCTs. Since AS is a frequent event during embryonic development (Revil et al, 2010) and specifically in germ cells (Clark et al, 2007; Ramskold et al, 2009; Yeo et al, 2004), in this study, I was interested in examining the expression of ESRP1, as a well- known alternative splicing regulator, in both fetal and adult mice germ cells.

7.1. Esrp1 is expressed in spermatogonia but not in somatic cells of mouse testis

By RT-droplet digital PCR (RT-ddPCR) I showed that Esrp1 is expressed in germ but not somatic cells at different stages (embryonic days 12.5 to 15.5) of mouse gonadal development in both sexes. In agreement with these data, Jameson et al (2012), using

Affymetrix Microarray data, demonstrated expression of Esrp1 in male and female germ cells from embryonic days 11.5 to 14.5. The data here delineate a role for ESRP1 as an AS regulator in mouse germ cell development.

122

Furthermore, examination of Esrp1 expression by RT-ddPCR during postnatal male gametogenesis showed high levels of Esrp1 expression in spermatogonia, which reduced significantly in pachytene spermatocytes and round spermatids. Consistent with mRNA expression analyses, my immunostaining analyses revealed a distinct nuclear localization of

ESRP1 in both Type A and Type B spermatogonia, co-labelled with PLZF and cKit antibodies, respectively. However, the ESRP1 protein was also detected in spermatocytes and round spermatids which suggests that ESRP1 protein may persist till later stages of spermatogenesis.

Co-labelling with SOX9 antibodies confirmed that ESRP1 was not expressed in the somatic

Sertoli cells.

It has been shown that expression of many AS regulators is stage-specific during mouse spermatogenesis (Schmid et al, 2013). Overall, these data suggest that ESRP1 also is required for stage-speciﬁc AS regulation and raises the possibility that ESRP1 plays a role in splicing of mitotic and premeiotic transcripts during spermatogenesis, particularly in spermatogonia.

The importance of AS in spermatogonia is highlighted by a recent study (Liu et al., 2017), which showed that another splicing factor, BCAS2, is also enriched in PLZF+ spermatogonia and that conditional deletion of Bcas2, resulted in altered splicing of 245 genes and failure of meiosis I initiation. They found that Bcas2 depletion may affect splicing of numerous genes that play a role in RNA processing, chromatin organization and sexual function. Thus, BCAS2 expression is crucial for mouse spermatogenesis and male fertility. Since ESRP1 is also expressed significantly higher in spermatogonia, disruption in its expression may affect male fertility. But further investigation is needed to clarify the exact role of ESRP1 during spermatogenesis. Finding the targets of ESRP1 during spermatogenesis can lead to a better understanding of the molecular process and may improve our knowledge about male infertility and germ cell development.

123

Rather surprisingly, double immunofluorescence labeling of ESRP1 and SC35, marker for the post-transcriptional spliceosome (Fu & Maniatis, 1990), showed no colocalization in spermatogonial nuclei. Although this result suggests that ESRP1 doesn’t play a role in post- transcriptional splicing, it may be involved in co-transcriptional splicing which constitutes 80% of pre-mRNA splicing (Girard et al, 2012). To confirm this hypothesis, further double-labelling experiments need to be done with anti-phospho-SF3b155 antibodies, which appears to be a co- transcriptional splicing marker (Girard et al, 2012).

7.2. Esrp1/fusilli does not have a major role in Drosophila GSC

To clarify the role of ESRP1 in germ cells, I investigated the effects of overexpressing or knocking down the ESRP1 homolog (Fusilli) expression in Drosophila testis. However, neither knockdown or overexpression of fusilli in germ stem cells (GSCs) of fly testis resulted in any detectable testes phenotype when compared to wild-type controls, leading to the overall conclusion that fusilli is not involved in regulation of GSCs in the fly testis. However, due to lack of time, the expression levels of fusilli were not confirmed in these mutant strains and thus it is possible that the transgenes used were not sufficient to greatly over-express or knock-down fusilli in the GSCs. Since the FLP-FRT knock-out system is more effective than RNAi for knocking out of a gene in specific tissues (Frickenhaus et al, 2015), it may be of benefit to utilize this system to generate fusilli mutant clones for further investigation to find the exact role of fusilli in the regulation of GSCs.

7.3. ESRP1 acts as a splicing factor in germline tumors

There is growing evidence that epithelial-mesenchymal transition (EMT) is associated with cancer metastasis (Akalay et al, 2013; Derksen et al, 2006; Lorenzatti et al, 2011; Onder

124

et al, 2008) and can be controlled at the level of transcription and post-transcription by alternative splicing (Manley & Tacke, 1996; Venables, 2006). Given that ESRP1 is implicated in splicing regulation, it is a good candidate splicing factor that may orchestrate isoform switching that drives the EMT associated with cancer progression. To this end, I also investigated the expression and role of ESRP1 in gonadal cancers.

By RT-ddPCR I demonstrated that Esrp1 expression is upregulated in both serous and mucinous ovarian carcinomas and correlated this with the levels of E-cadherin (CDH1) expression, which is higher in carcinoma samples compared to normal. This is consistent with the fact that ovarian carcinomas show more epithelial characteristics (Jeong et al, 2017) and with the known role of ESRP1 in switching from mesenchymal to epithelial phenotypes. Up- regulation of ESRP1 has been reported in some epithelial cancer types such as human head and neck squamous cell carcinoma and lung cancer (Ishii et al, 2014; Yae et al, 2012) but down- regulated in colorectal cancer (Leontieva & Ionov, 2009). Due to the dual role of ESRP1 in different cancer progression, our data compatible with previous studies suggested that ESRP1 expression can be cancer-type specific.

Additionally, we found that ESRP1 up-regulation during ovarian cancer progression coincided with switches from CD44s and FGFR2IIIc to CD44v6 and FGFR2IIIb isoform expression. These findings build upon previous results showing that ESRP1 regulates the alternative splicing of FGFR2, and CD44 in other cancer types (Ishii et al, 2014; Zhao et al,

2013). However, this switch appears to be cancer-type specific, as the CD44 isoform switch did not occur in the serous carcinoma samples that I examined. As the number of tumor samples available to me was relatively small (n<10), this failure to demonstrate this isoform switch may be due to the sample size, tumor grade or the actual sampling of the tumors in the commercial collection. Thus, additional studies of a larger number of samples will be necessary to confirm if the CD44s isoform switches to CD44v6 in the serous ovarian carcinoma. The

125 results presented here indicate that ESRP1 may play a pivotal role in the progression of ovarian cancer by regulation of CD44 and FGFR2 alternative splicing.

Similar to our studies of ovarian cancer, our data showed that ESRP1 is also up- regulated in both seminoma and mixed-germ cell testicular cancers. However, no evidence was found for FGFR2 and CD44 isoform switching in these tumors suggesting that ESRP1 does not regulate splicing of FGFR2 and CD44 in testicular cancers. An explanation to this could be that as ovarian cancer is an epithelial type of cancer, switching of mesenchymal to epithelial isoforms is necessary during ovarian cancer progression. However, testicular cancer is a germ cell tumor and ESRP1 may regulate the splicing of other target genes during germ cell tumor progression.

Since ESRP1 is well-known splicing factor (Warzecha et al, 2009a; Warzecha et al,

2009b) and AS is a frequent process in the testis (Clark et al, 2007; Ramskold et al, 2009; Yeo et al, 2004), the next question I wanted to address was whether there were other potential targets than FGFR2 and CD44 for ESRP1 in germ cell testicular cancer. To investigate this, I turned to a cell line (TCam-2) derived from a human seminoma (germ cell tumour) that could be relatively easily transfected using ESRP1 siRNA. To analyse changes in expression and splicing, I analysed the transfected cells by high throughput sequencing (RNA-Seq). Using

Ingenuity Pathway Analysis, we identified differential expression of genes involved in mitochondrial functional and oxidative phosphorylation (OxPhos). It has been well documented that the most important function of mitochondria is the generation of ATP by oxidative phosphorylation via the respiratory chain (Falk & Sondheimer, 2010; Greaves et al,

2012). Also, it has additional functions in the production and detoxification of reactive oxygen species (ROS), apoptosis and synthesis of metabolites. Any abnormality in these process results in mitochondrial dysfunction (Jarrett et al, 2010; Vincent et al, 2004; Waldbaum &

Patel, 2010). Several studies indicated mitochondrial dysfunction can result in different cancer

126

types (Cairns et al, 2011; Chen et al, 2007; Upadhyay et al, 2013; Wallace, 2012) and OxPhos alteration is a mechanism that tumors acquire to provide their energy demands (Jiang et al,

2016; Kannan et al, 2016). A recent study, conducted by Guha et al (2018) identified that reduction of mtDNA copy number is correlated with low ESRP1 expression and can result in changes in splicing of several genes that promote metastasis in triple negative breast cancer

(TNBCs). Importantly, ectopic expression of ESRP1 in these tumor cells revered EMT and indirectly suggested that ESRP1 mediates low mtDNA-induced EMT. Intriguingly, our data indicate that silencing of ESRP1 results in altered mitochondrial gene expression and functional defects which suggests that ESRP1 may alter energy or ROS production in germ cell tumors. However, further investigation is needed to assess the impact of oxidative stress in the ESRP1-depleted germ cell line.

Cancer progression can also be affected by changes in alternative splicing of different genes mediated by RNA-binding proteins, such as ESRP1. Alterations in splicing factor expression and regulation of splicing events is a response from tumor cells and their microenvironment (Sebestyen et al, 2016). Another key observation made from the RNA-Seq data was the identification of 576 novel potential splicing targets for ESRP1 in the TCam-2 cell line. IPA analyses demonstrated that most of them were related to EMT-associated alternative splicing events in the integrin-actin cytoskeleton pathways. These findings suggest that ESRP1 regulates alternative splicing of genes that are involved in directing critical pathways that control changes in cell migration, cell morphology, and motility that occur during EMT. In several studies, ESRPs have been shown to repress cell motility in epithelial cells (Warzecha et al, 2010), head and neck squamous carcinoma (Ishii et al, 2014) and clear cell carcinoma (Mizutani et al, 2016). However, in other cancer types such as pancreatic cancer cells (Ueda et al, 2014) overexpression of ESRP1 attenuates cell motility and invasion.

Although these conflicting observations about the role of ESRP1 in cell motility suggest the

127 effects are cell context dependent, it is clear that ESRP1 is an important player in these processes.

Taken together with other studies, my findings reveal that ESRP1 plays important roles in germ cell development and gonadal cancer progression by regulation of AS of numerous genes. Given that EMT is an important event during development and is reactivated during cancer metastasis, defining the role of ESRP1, as one of the regulators of this event, in gonadal development and cancer progression may advance our effort in prevention of infertility or gonadal cancer progression. Similarly, identification of novel targets of ESRP1 that are modulated in testicular germ cells may be useful in designing targeted therapeutics in germ cell tumors.

7.4. Future research directions

This thesis has made contributions to understanding the role of ESRP1 in germ cell development. While further study is required to determine how ESRP1 may regulate stage- speciﬁc AS events during germ cell development, these data provide evidence for ESRP1 having a role during spermatogenic lineage development. While the Esrp1 knock out mice were not available for this series of studies, it would be of interest in future studies to conduct expression profiling using RNA-Seq to examine the expression and splicing changes that occur in the testes (and ovaries) of Esrp1-/- mice, similar to those conducted recently by Bebee et al

(2015). It would be of interest to compare whether the putative targets identified in TCam-2 cells in this study are also regulated by ESRP1 in the normal testis as this may provide insights into the mechanisms by which AS splicing is regulated normally as compared to tumors.

In addition to the role of ESRP1 in germ cell development, our data identify a novel role for ESRP1 in gonadal cancer progression. My results showed that ESRP1 may affect

128

ovarian carcinoma progression by regulation of CD44 and FGFR2 alternative splicing, but future studies are needed to determine other potential targets for ESRP1 in ovarian cancer.

Also, our data on testicular germ cell tumor cells showed that four complexes of oxidative phosphorylation are affected by differential gene expression after silencing of

ESRP1. Each of these complexes contains many subunits and the alteration of any of these may affect the metabolic pattern of the tumor cell. To further evaluate the effect of ESRP1 on energy metabolism of tumor cells, it will be important to examine the activity of these subunits in these ESRP1-depleted cells, using assays that permit visualization of oxidative activity of mitochondria in cultured cells by immunohistochemistry for Complexes I-IV (Rocha et al,

2015). Quantitative PCR arrays can also be used to verify changes in expression of the mitochondrial complexes that were identified by the RNA-Seq experiments. In addition, recent studies highlight the application of the Seahorse Bioscience XF24 to analysis impact of oxidative stress in isolated mitochondria (Ashley & Poulton, 2009; Pagliarini et al, 2008) and in cell cultures. This technology could be used to examine oxygen consumption rate and extracellular acidification as indicators for mitochondrial respiration and glycolysis in control and ESRP1 depleted TCam-2 cell lines. Similarly, luminescent assays exist to quantify reactive oxygen species that could be employed. However, these can be technically challenging, due to the intrinsic instability of ROS, and require specialized equipment and techniques (Uy et al,

2011).

The findings of this thesis have highlighted a wide repertoire of processes that are regulated by ESRP1 during gametogenesis and in gonadal tumors. Moreover, the data obtained provide a sound platform for further studies to investigate the mechanisms by which it regulates alternative gene splicing and affects cellular phenotype

129

References

Adams, M. D., Celniker, S. E., Holt, R. A., Evans, C. A., Gocayne, J. D., Amanatides, P. G., Scherer, S. E., Li, P. W., Hoskins, R. A., Galle, R. F., George, R. A., Lewis, S. E., Richards, S., Ashburner, M., Henderson, S. N., Sutton, G. G., Wortman, J. R., Yandell, M. D., Zhang, Q., Chen, L. X., Brandon, R. C., Rogers, Y. H., Blazej, R. G., Champe, M., Pfeiffer, B. D., Wan, K. H., Doyle, C., Baxter, E. G., Helt, G., Nelson, C. R., Gabor, G. L., Abril, J. F., Agbayani, A., An, H. J., Andrews-Pfannkoch, C., Baldwin, D., Ballew, R. M., Basu, A., Baxendale, J., Bayraktaroglu, L., Beasley, E. M., Beeson, K. Y., Benos, P. V., Berman, B. P., Bhandari, D., Bolshakov, S., Borkova, D., Botchan, M. R., Bouck, J., Brokstein, P., Brottier, P., Burtis, K. C., Busam, D. A., Butler, H., Cadieu, E., Center, A., Chandra, I., Cherry, J. M., Cawley, S., Dahlke, C., Davenport, L. B., Davies, P., de Pablos, B., Delcher, A., Deng, Z., Mays, A. D., Dew, I., Dietz, S. M., Dodson, K., Doup, L. E., Downes, M., Dugan-Rocha, S., Dunkov, B. C., Dunn, P., Durbin, K. J., Evangelista, C. C., Ferraz, C., Ferriera, S., Fleischmann, W., Fosler, C., Gabrielian, A. E., Garg, N. S., Gelbart, W. M., Glasser, K., Glodek, A., Gong, F., Gorrell, J. H., Gu, Z., Guan, P., Harris, M., Harris, N. L., Harvey, D., Heiman, T. J., Hernandez, J. R., Houck, J., Hostin, D., Houston, K. A., Howland, T. J., Wei, M. H., Ibegwam, C., et al (2000) The genome sequence of Drosophila melanogaster. Science, 287(5461), 2185-95.

Akalay, I., Janji, B., Hasmim, M., Noman, M. Z., Thiery, J. P., Mami-Chouaib, F. & Chouaib, S. (2013) EMT impairs breast carcinoma cell susceptibility to CTL-mediated lysis through autophagy induction. Autophagy, 9(7), 1104-6.

Akamatsu, W., Okano, H. J., Osumi, N., Inoue, T., Nakamura, S., Sakakibara, S., Miura, M., Matsuo, N., Darnell, R. B. & Okano, H. (1999) Mammalian ELAV-like neuronal RNA-binding proteins HuB and HuC promote neuronal development in both the central and the peripheral nervous systems. Proc Natl Acad Sci U S A, 96(17), 9885-90.

Alastalo, T. P., Lonnstrom, M., Leppa, S., Kaarniranta, K., Pelto-Huikko, M., Sistonen, L. & Parvinen, M. (1998) Stage-specific expression and cellular localization of the heat shock factor 2 isoforms in the rat seminiferous epithelium. Exp Cell Res, 240(1), 16-27.

Albamonte, M. S., Willis, M. A., Albamonte, M. I., Jensen, F., Espinosa, M. B. & Vitullo, A. D. (2008) The developing human ovary: immunohistochemical analysis of germ-cell-specific VASA protein, BCL-2/BAX expression balance and apoptosis. Hum Reprod, 23(8), 1895-901.

Arman, E., Haffner-Krausz, R., Gorivodsky, M. & Lonai, P. (1999) Fgfr2 is required for limb outgrowth and lung-branching morphogenesis. Proc Natl Acad Sci U S A, 96(21), 11895-9.

Ashley, N. & Poulton, J. (2009) Mitochondrial DNA is a direct target of anti-cancer anthracycline drugs. Biochem Biophys Res Commun, 378(3), 450-5.

Baleato, R. M., Aitken, R. J. & Roman, S. D. (2005) Vitamin A regulation of BMP4 expression in the male germ line. Dev Biol, 286(1), 78-90.

130

Bao, J., Tang, C., Li, J., Zhang, Y., Bhetwal, B. P., Zheng, H. & Yan, W. (2014) RAN-binding protein 9 is involved in alternative splicing and is critical for male germ cell development and male fertility. PLoS Genet, 10(12), e1004825.

Bar, J. K., Grelewski, P., Popiela, A., Noga, L. & Rabczynski, J. (2004) Type IV collagen and CD44v6 expression in benign, malignant primary and metastatic ovarian tumors: correlation with Ki-67 and p53 immunoreactivity. Gynecol Oncol, 95(1), 23-31.

Baraniak, A. P., Chen, J. R. & Garcia-Blanco, M. A. (2006) Fox-2 mediates epithelial cell- specific fibroblast growth factor receptor 2 exon choice. Mol Cell Biol, 26(4), 1209-22.

Barberan-Soler, S., Medina, P., Estella, J., Williams, J. & Zahler, A. M. (2011) Co-regulation of alternative splicing by diverse splicing factors in Caenorhabditis elegans. Nucleic Acids Res, 39(2), 666-74.

Barberan-Soler, S. & Zahler, A. M. (2008) Alternative splicing regulation during C. elegans development: splicing factors as regulated targets. PLoS Genet, 4(2), e1000001.

Bebee, T. W., Park, J. W., Sheridan, K. I., Warzecha, C. C., Cieply, B. W., Rohacek, A. M., Xing, Y. & Carstens, R. P. (2015) The splicing regulators Esrp1 and Esrp2 direct an epithelial splicing program essential for mammalian development. Elife, 4.

Bebee, T. W., Sims-Lucas, S., Park, J. W., Bushnell, D., Cieply, B., Xing, Y., Bates, C. M. & Carstens, R. P. (2016) Ablation of the epithelial-specific splicing factor Esrp1 results in ureteric branching defects and reduced nephron number. Dev Dyn, 245(10), 991-1000.

Bellve, A. R., Millette, C. F., Bhatnagar, Y. M. & O'Brien, D. A. (1977) Dissociation of the mouse testis and characterization of isolated spermatogenic cells. J Histochem Cytochem, 25(7), 480-94.

Bennett, K. L., Modrell, B., Greenfield, B., Bartolazzi, A., Stamenkovic, I., Peach, R., Jackson, D. G., Spring, F. & Aruffo, A. (1995) Regulation of CD44 binding to hyaluronan by glycosylation of variably spliced exons. J Cell Biol, 131(6 Pt 1), 1623-33.

Berget SM, M. C., Sharp PA (2000) Spliced segments at the 5' terminus of adenovirus 2 late mRNA. Rev Med Virol, 10(6), 7.

Berner, H. S., Davidson, B., Berner, A., Risberg, B., Kristensen, G. B., Trope, C. G., Van de Putte, G. & Nesland, J. M. (2000) Expression of CD44 in effusions of patients diagnosed with serous ovarian carcinoma--diagnostic and prognostic implications. Clin Exp Metastasis, 18(2), 197-202.

Bettegowda, A. & Wilkinson, M. F. (2010) Transcription and post-transcriptional regulation of spermatogenesis. Philos Trans R Soc Lond B Biol Sci, 365(1546), 1637-51.

Biddle, A., Gammon, L., Fazil, B. & Mackenzie, I. C. (2013) CD44 staining of cancer stem- like cells is influenced by down-regulation of CD44 variant isoforms and up-regulation of the standard CD44 isoform in the population of cells that have undergone epithelial-to- mesenchymal transition. PLoS One, 8(2), e57314.

Bier, E. (2005) Drosophila , the golden bug, emerges as a tool for human genetics. Nat Rev Genet, 6(1), 9-23. 131

Black, D. L. (2003) Mechanisms of alternative pre-messenger RNA splicing. Annu Rev Biochem, 72, 291-336.

Bonora, E., Porcelli, A. M., Gasparre, G., Biondi, A., Ghelli, A., Carelli, V., Baracca, A., Tallini, G., Martinuzzi, A., Lenaz, G., Rugolo, M. & Romeo, G. (2006) Defective oxidative phosphorylation in thyroid oncocytic carcinoma is associated with pathogenic mitochondrial DNA mutations affecting complexes I and III. Cancer Res, 66(12), 6087-96.

Boutz, P. L., Stoilov, P., Li, Q., Lin, C. H., Chawla, G., Ostrow, K., Shiue, L., Ares, M., Jr. & Black, D. L. (2007) A post-transcriptional regulatory switch in polypyrimidine tract-binding proteins reprograms alternative splicing in developing neurons. Genes Dev, 21(13), 1636-52.

Boyer, A. S., Erickson, C. P. & Runyan, R. B. (1999) Epithelial-mesenchymal transformation in the embryonic heart is mediated through distinct pertussis toxin-sensitive and TGFbeta signal transduction mechanisms. Dev Dyn, 214(1), 81-91.

Boyle, M., Wong, C., Rocha, M. & Jones, D. L. (2007) Decline in self-renewal factors contributes to aging of the stem cell niche in the Drosophila testis. Cell Stem Cell, 1(4), 470- 8.

Brabletz, T. (2012) EMT and MET in metastasis: where are the cancer stem cells? Cancer Cell, 22(6), 699-701.

Braeutigam, C., Rago, L., Rolke, A., Waldmeier, L., Christofori, G. & Winter, J. (2014) The RNA-binding protein Rbfox2: an essential regulator of EMT-driven alternative splicing and a mediator of cellular invasion. Oncogene, 33(9), 1082-92.

Brand, A. H. & Perrimon, N. (1993) Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development, 118(2), 401-15.

Brinster, R. L. & Zimmermann, J. W. (1994) Spermatogenesis following male germ-cell transplantation. Proc Natl Acad Sci U S A, 91(24), 11298-302.

Brown, R. L., Reinke, L. M., Damerow, M. S., Perez, D., Chodosh, L. A., Yang, J. & Cheng, C. (2011) CD44 splice isoform switching in human and mouse epithelium is essential for epithelial-mesenchymal transition and breast cancer progression. J Clin Invest, 121(3), 1064- 74.

Buaas, F. W., Kirsh, A. L., Sharma, M., McLean, D. J., Morris, J. L., Griswold, M. D., de Rooij, D. G. & Braun, R. E. (2004) Plzf is required in adult male germ cells for stem cell self- renewal. Nat Genet, 36(6), 647-52.

Cairns, R. A., Harris, I. S. & Mak, T. W. (2011) Regulation of cancer cell metabolism. Nat Rev Cancer, 11(2), 85-95.

Carstens, R. P., Eaton, J. V., Krigman, H. R., Walther, P. J. & Garcia-Blanco, M. A. (1997) Alternative splicing of fibroblast growth factor receptor 2 (FGF-R2) in human prostate cancer. Oncogene, 15(25), 3059-65.

Chalmel, F. & Rolland, A. D. (2015) Linking transcriptomics and proteomics in spermatogenesis. Reproduction, 150(5), R149-57. 132

Charpin, C., Secq, V., Giusiano, S., Carpentier, S., Andrac, L., Lavaut, M. N., Allasia, C., Bonnier, P. & Garcia, S. (2009) A signature predictive of disease outcome in breast carcinomas, identified by quantitative immunocytochemical assays. Int J Cancer, 124(9), 2124-34.

Chen, Z., Lu, W., Garcia-Prieto, C. & Huang, P. (2007) The Warburg effect and its cancer therapeutic implications. J Bioenerg Biomembr, 39(3), 267-74.

Cheng, J., Tiyaboonchai, A., Yamashita, Y. M. & Hunt, A. J. (2011) Asymmetric division of cyst stem cells in Drosophila testis is ensured by anaphase spindle repositioning. Development, 138(5), 831-7.

Cheng, L. (2004) Establishing a germ cell origin for metastatic tumors using OCT4 immunohistochemistry. Cancer, 101(9), 2006-10.

Chow LC, G. R., Broker TR, Roberts RJ. (2000 ) An amazing sequence arrangement at the 5' ends of adenovirus 2 messenger RNA. Rev Med Virol, 10(6), 10.

Cieply, B., Park, J. W., Nakauka-Ddamba, A., Bebee, T. W., Guo, Y., Shang, X., Lengner, C. J., Xing, Y. & Carstens, R. P. (2016) Multiphasic and Dynamic Changes in Alternative Splicing during Induction of Pluripotency Are Coordinated by Numerous RNA-Binding Proteins. Cell Rep, 15(2), 247-55.

Cieply, B., Riley, P. t., Pifer, P. M., Widmeyer, J., Addison, J. B., Ivanov, A. V., Denvir, J. & Frisch, S. M. (2012) Suppression of the epithelial-mesenchymal transition by Grainyhead-like- 2. Cancer Res, 72(9), 2440-53.

Clark, T. A., Schweitzer, A. C., Chen, T. X., Staples, M. K., Lu, G., Wang, H., Williams, A. & Blume, J. E. (2007) Discovery of tissue-specific exons using comprehensive human exon microarrays. Genome Biol, 8(4), R64.

Cole, C., Lau, S., Backen, A., Clamp, A., Rushton, G., Dive, C., Hodgkinson, C., McVey, R., Kitchener, H. & Jayson, G. C. (2010) Inhibition of FGFR2 and FGFR1 increases cisplatin sensitivity in ovarian cancer. Cancer Biol Ther, 10(5), 495-504.

Comijn, J., Berx, G., Vermassen, P., Verschueren, K., van Grunsven, L., Bruyneel, E., Mareel, M., Huylebroeck, D. & van Roy, F. (2001) The two-handed E box binding zinc finger protein SIP1 downregulates E-cadherin and induces invasion. Mol Cell, 7(6), 1267-78.

Costoya, J. A., Hobbs, R. M., Barna, M., Cattoretti, G., Manova, K., Sukhwani, M., Orwig, K. E., Wolgemuth, D. J. & Pandolfi, P. P. (2004) Essential role of Plzf in maintenance of spermatogonial stem cells. Nat Genet, 36(6), 653-9.

Darai, E., Walker-Combrouze, F., Fauconnier, A., Madelenat, P., Potet, F. & Scoazec, J. Y. (1998) Analysis of CD44 expression in serous and mucinous borderline tumours of the ovary: comparison with cystadenomas and overt carcinomas. Histopathology, 32(2), 151-9.

Davies, A. G., Spike, C. A., Shaw, J. E. & Herman, R. K. (1999) Functional overlap between the mec-8 gene and five sym genes in Caenorhabditis elegans. Genetics, 153(1), 117-34. de Cuevas, M. & Matunis, E. L. (2011) The stem cell niche: lessons from the Drosophila testis. Development, 138(14), 2861-9.

133 de Jong, J., Stoop, H., Gillis, A. J., Hersmus, R., van Gurp, R. J., van de Geijn, G. J., van Drunen, E., Beverloo, H. B., Schneider, D. T., Sherlock, J. K., Baeten, J., Kitazawa, S., van Zoelen, E. J., van Roozendaal, K., Oosterhuis, J. W. & Looijenga, L. H. (2008) Further characterization of the first seminoma cell line TCam-2. Genes Chromosomes Cancer, 47(3), 185-96.

De Medina, S. G., Popov, Z., Chopin, D. K., Southgate, J., Tucker, G. C., Delouvee, A., Thiery, J. P. & Radvanyi, F. (1999) Relationship between E-cadherin and fibroblast growth factor receptor 2b expression in bladder carcinomas. Oncogene, 18(41), 5722-6.

Del-Mazo, J., Brieno-Enriquez, M. A., Garcia-Lopez, J., Lopez-Fernandez, L. A. & De-Felici, M. (2013) Endocrine disruptors, gene deregulation and male germ cell tumors. Int J Dev Biol, 57(2-4), 225-39.

Derksen, P. W., Liu, X., Saridin, F., van der Gulden, H., Zevenhoven, J., Evers, B., van Beijnum, J. R., Griffioen, A. W., Vink, J., Krimpenfort, P., Peterse, J. L., Cardiff, R. D., Berns, A. & Jonkers, J. (2006) Somatic inactivation of E-cadherin and p53 in mice leads to metastatic lobular mammary carcinoma through induction of anoikis resistance and angiogenesis. Cancer Cell, 10(5), 437-49.

Deutsch, M. & Long, M. (1999) Intron-exon structures of eukaryotic model organisms. Nucleic Acids Res, 27(15), 3219-28.

Dittmar, K. A., Jiang, P., Park, J. W., Amirikian, K., Wan, J., Shen, S., Xing, Y. & Carstens, R. P. (2012) Genome-wide determination of a broad ESRP-regulated posttranscriptional network by high-throughput sequencing. Mol Cell Biol, 32(8), 1468-82.

Dolci, S., Campolo, F. & De Felici, M. (2015) Gonadal development and germ cell tumors in mouse and humans. Semin Cell Dev Biol, 45, 114-23.

Dominguez, C., Fisette, J. F., Chabot, B. & Allain, F. H. (2010) Structural basis of G-tract recognition and encaging by hnRNP F quasi-RRMs. Nat Struct Mol Biol, 17(7), 853-61.

Dougherty, G. J., Cooper, D. L., Memory, J. F. & Chiu, R. K. (1994) Ligand binding specificity of alternatively spliced CD44 isoforms. Recognition and binding of hyaluronan by CD44R1. J Biol Chem, 269(12), 9074-8.

Dredge, B. K., Stefani, G., Engelhard, C. C. & Darnell, R. B. (2005) Nova autoregulation reveals dual functions in neuronal splicing. EMBO J, 24(8), 1608-20.

Duffy, J. B. (2002) GAL4 system in Drosophila : a fly geneticist's Swiss army knife. Genesis, 34(1-2), 1-15.

Eddy, E. M. (1998) Regulation of gene expression during spermatogenesis. Semin Cell Dev Biol, 9(4), 451-7.

Eddy, E. M. (1999) Role of heat shock protein HSP70-2 in spermatogenesis. Rev Reprod, 4(1), 23-30.

Elliott, D. J. & Grellscheid, S. N. (2006) Alternative RNA splicing regulation in the testis. Reproduction, 132(6), 811-9. 134

Elloul, S., Elstrand, M. B., Nesland, J. M., Trope, C. G., Kvalheim, G., Goldberg, I., Reich, R. & Davidson, B. (2005) Snail, Slug, and Smad-interacting protein 1 as novel parameters of disease aggressiveness in metastatic ovarian and breast carcinoma. Cancer, 103(8), 1631-43.

Eppig, J. J. & Downs, S. M. (1984) Chemical signals that regulate mammalian oocyte maturation. Biol Reprod, 30(1), 1-11.

Eswarakumar, V. P., Monsonego-Ornan, E., Pines, M., Antonopoulou, I., Morriss-Kay, G. M. & Lonai, P. (2002) The IIIc alternative of Fgfr2 is a positive regulator of bone formation. Development, 129(16), 3783-93.

Ewen, K. A. & Koopman, P. (2010) Mouse germ cell development: from specification to sex determination. Mol Cell Endocrinol, 323(1), 76-93.

Facchini, G., Rossetti, S., Cavaliere, C., D'Aniello, C., Di Franco, R., Iovane, G., Grimaldi, G., Piscitelli, R., Muto, P., Botti, G., Perdona, S., Veneziani, B. M., Berretta, M. & Montanari, M. (2018) Exploring the molecular aspects associated with testicular germ cell tumors: a review. Oncotarget, 9(1), 1365-1379.

Fagoonee, S., Bearzi, C., Di Cunto, F., Clohessy, J. G., Rizzi, R., Reschke, M., Tolosano, E., Provero, P., Pandolfi, P. P., Silengo, L. & Altruda, F. (2013) The RNA binding protein ESRP1 fine-tunes the expression of pluripotency-related factors in mouse embryonic stem cells. PLoS One, 8(8), e72300.

Fagoonee, S., Picco, G., Orso, F., Arrigoni, A., Longo, D. L., Forni, M., Scarfo, I., Cassenti, A., Piva, R., Cassoni, P., Silengo, L., Tolosano, E., Aime, S., Taverna, D., Pandolfi, P. P., Brancaccio, M., Medico, E. & Altruda, F. (2017) The RNA-binding protein ESRP1 promotes human colorectal cancer progression. Oncotarget, 8(6), 10007-10024.

Faix, J. & Rottner, K. (2006) The making of filopodia. Curr Opin Cell Biol, 18(1), 18-25.

Falk, M. J. & Sondheimer, N. (2010) Mitochondrial genetic diseases. Curr Opin Pediatr, 22(6), 711-6.

Fang, H., Yang, Y., Li, C., Fu, S., Yang, Z., Jin, G., Wang, K., Zhang, J. & Jin, Y. (2010) Transcriptome analysis of early organogenesis in human embryos. Dev Cell, 19(1), 174-84.

Farnsworth, B., Radomska, K. J., Zimmermann, B., Kettunen, P., Jazin, E. & Emilsson, L. S. (2017) QKI6B mRNA levels are upregulated in schizophrenia and predict GFAP expression. Brain Res, 1669, 63-68.

Ferranti, F., D'Anselmi, F., Caruso, M., Lei, V., Dinicola, S., Pasqualato, A., Cucina, A., Palombo, A., Ricci, G., Catizone, A. & Bizzarri, M. (2013) TCam-2 seminoma cells exposed to egg-derived microenvironment modify their shape, adhesive pattern and migratory behaviour: a molecular and morphometric analysis. PLoS One, 8(10), e76192.

Forbes, A. & Lehmann, R. (1998) Nanos and Pumilio have critical roles in the development and function of Drosophila germline stem cells. Development, 125(4), 679-90.

Frickenhaus, M., Wagner, M., Mallik, M., Catinozzi, M. & Storkebaum, E. (2015) Highly efficient cell-type-specific gene inactivation reveals a key function for the Drosophila FUS homolog cabeza in neurons. Sci Rep, 5, 9107. 135

Fu, J., Bian, L., Zhao, L., Dong, Z., Gao, X., Luan, H., Sun, Y. & Song, H. (2010) Identification of genes for normalization of quantitative real-time PCR data in ovarian tissues. Acta Biochim Biophys Sin (Shanghai), 42(8), 568-74.

Fu, X.-D. & Maniatis, T. (1990) Factor required for mammalian spliceosome assembly is localized to discrete regions in the nucleus. Nature, 343, 437.

Fu, X. D. (1993) Specific commitment of different pre-mRNAs to splicing by single SR proteins. Nature, 365(6441), 82-5.

Gan, Q., Chepelev, I., Wei, G., Tarayrah, L., Cui, K., Zhao, K. & Chen, X. (2010) Dynamic regulation of alternative splicing and chromatin structure in Drosophila gonads revealed by RNA-seq. Cell Res, 20(7), 763-83.

Gillis, A. J., Stoop, H., Biermann, K., van Gurp, R. J., Swartzman, E., Cribbes, S., Ferlinz, A., Shannon, M., Oosterhuis, J. W. & Looijenga, L. H. (2011) Expression and interdependencies of pluripotency factors LIN28, OCT3/4, NANOG and SOX2 in human testicular germ cells and tumours of the testis. Int J Androl, 34(4 Pt 2), e160-74.

Girard, C., Will, C. L., Peng, J., Makarov, E. M., Kastner, B., Lemm, I., Urlaub, H., Hartmuth, K. & Luhrmann, R. (2012) Post-transcriptional spliceosomes are retained in nuclear speckles until splicing completion. Nat Commun, 3, 994.

Golestaneh, N., Kokkinaki, M., Pant, D., Jiang, J., DeStefano, D., Fernandez-Bueno, C., Rone, J. D., Haddad, B. R., Gallicano, G. I. & Dym, M. (2009) Pluripotent stem cells derived from adult human testes. Stem Cells Dev, 18(8), 1115-26.

Gottgens, E. L., Span, P. N. & Zegers, M. M. (2016) Roles and Regulation of Epithelial Splicing Regulatory Proteins 1 and 2 in Epithelial-Mesenchymal Transition. Int Rev Cell Mol Biol, 327, 163-194.

Gout, S. & Huot, J. (2008) Role of cancer microenvironment in metastasis: focus on colon cancer. Cancer Microenvironment, 1(1), 69-83.

Greaves, L. C., Reeve, A. K., Taylor, R. W. & Turnbull, D. M. (2012) Mitochondrial DNA and disease. J Pathol, 226(2), 274-86.

Gregory, P. A., Bert, A. G., Paterson, E. L., Barry, S. C., Tsykin, A., Farshid, G., Vadas, M. A., Khew-Goodall, Y. & Goodall, G. J. (2008) The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nat Cell Biol, 10(5), 593- 601.

Guaita, S., Puig, I., Franci, C., Garrido, M., Dominguez, D., Batlle, E., Sancho, E., Dedhar, S., De Herreros, A. G. & Baulida, J. (2002) Snail induction of epithelial to mesenchymal transition in tumor cells is accompanied by MUC1 repression and ZEB1 expression. J Biol Chem, 277(42), 39209-16.

Guan, K., Nayernia, K., Maier, L. S., Wagner, S., Dressel, R., Lee, J. H., Nolte, J., Wolf, F., Li, M., Engel, W. & Hasenfuss, G. (2006) Pluripotency of spermatogonial stem cells from adult mouse testis. Nature, 440(7088), 1199-203.

136

Guha, M., Srinivasan, S., Raman, P., Jiang, Y., Kaufman, B. A., Taylor, D., Dong, D., Chakrabarti, R., Picard, M., Carstens, R. P., Kijima, Y., Feldman, M. & Avadhani, N. G. (2018) Aggressive triple negative breast cancers have unique molecular signature on the basis of mitochondrial genetic and functional defects. Biochim Biophys Acta, 1864(4 Pt A), 1060-1071.

Gunthert, U., Hofmann, M., Rudy, W., Reber, S., Zoller, M., Haussmann, I., Matzku, S., Wenzel, A., Ponta, H. & Herrlich, P. (1991) A new variant of glycoprotein CD44 confers metastatic potential to rat carcinoma cells. Cell, 65(1), 13-24.

Guzeloglu-Kayisli, O., Lalioti, M. D., Babayev, E., Torrealday, S., Karakaya, C. & Seli, E. (2014) Human embryonic poly(A)-binding protein (EPAB) alternative splicing is differentially regulated in human oocytes and embryos. Mol Hum Reprod, 20(1), 59-65.

Hanahan, D. & Weinberg, R. A. (2011) Hallmarks of cancer: the next generation. Cell, 144(5), 646-74.

Hardy, R. W., Tokuyasu, K. T., Lindsley, D. L. & Garavito, M. (1979) The germinal proliferation center in the testis of Drosophila melanogaster. J Ultrastruct Res, 69(2), 180-90.

Hart, A. H., Hartley, L., Parker, K., Ibrahim, M., Looijenga, L. H., Pauchnik, M., Chow, C. W. & Robb, L. (2005) The pluripotency homeobox gene NANOG is expressed in human germ cell tumors. Cancer, 104(10), 2092-8.

Hartmann, B. & Valcarcel, J. (2009) Decrypting the genome's alternative messages. Curr Opin Cell Biol, 21(3), 377-86.

Hartshorne, G. M., Lyrakou, S., Hamoda, H., Oloto, E. & Ghafari, F. (2009) Oogenesis and cell death in human prenatal ovaries: what are the criteria for oocyte selection? Mol Hum Reprod, 15(12), 805-19.

Hayakawa, A., Saitoh, M. & Miyazawa, K. (2017) Dual Roles for Epithelial Splicing Regulatory Proteins 1 (ESRP1) and 2 (ESRP2) in Cancer Progression. Adv Exp Med Biol, 925, 33-40.

He, C., Zuo, Z., Chen, H., Zhang, L., Zhou, F., Cheng, H. & Zhou, R. (2007) Genome-wide detection of testis- and testicular cancer-specific alternative splicing. Carcinogenesis, 28(12), 2484-90.

Heidenberg, D. J., Barton, J. H., Young, D., Grinkemeyer, M. & Sesterhenn, I. A. (2012) N- cadherin Expression in Testicular Germ Cell and Gonadal Stromal Tumors. J Cancer, 3, 381- 9.

Heo, I., Joo, C., Cho, J., Ha, M., Han, J. & Kim, V. N. (2008) Lin28 mediates the terminal uridylation of let-7 precursor MicroRNA. Mol Cell, 32(2), 276-84.

Hoei-Hansen, C. E., Almstrup, K., Nielsen, J. E., Brask Sonne, S., Graem, N., Skakkebaek, N. E., Leffers, H. & Rajpert-De Meyts, E. (2005) Stem cell pluripotency factor NANOG is expressed in human fetal gonocytes, testicular carcinoma in situ and germ cell tumours. Histopathology, 47(1), 48-56.

137

Holley, S. A., Jackson, P. D., Sasai, Y., Lu, B., De Robertis, E. M., Hoffmann, F. M. & Ferguson, E. L. (1995) A conserved system for dorsal-ventral patterning in insects and vertebrates involving sog and chordin. Nature, 376(6537), 249-53.

Holmuhamedov, E., Lewis, L., Bienengraeber, M., Holmuhamedova, M., Jahangir, A. & Terzic, A. (2002) Suppression of human tumor cell proliferation through mitochondrial targeting. FASEB J, 16(9), 1010-6.

Holstein, A. F., Schulze, W. & Davidoff, M. (2003) Understanding spermatogenesis is a prerequisite for treatment. Reprod Biol Endocrinol, 1, 107.

Horiguchi, K., Sakamoto, K., Koinuma, D., Semba, K., Inoue, A., Inoue, S., Fujii, H., Yamaguchi, A., Miyazawa, K., Miyazono, K. & Saitoh, M. (2012) TGF-beta drives epithelial- mesenchymal transition through deltaEF1-mediated downregulation of ESRP. Oncogene, 31(26), 3190-201.

Hovhannisyan, R. H. & Carstens, R. P. (2007) Heterogeneous ribonucleoprotein m is a splicing regulatory protein that can enhance or silence splicing of alternatively spliced exons. J Biol Chem, 282(50), 36265-74.

Hovhannisyan, R. H., Warzecha, C. C. & Carstens, R. P. (2006) Characterization of sequences and mechanisms through which ISE/ISS-3 regulates FGFR2 splicing. Nucleic Acids Res, 34(1), 373-85.

Huber, M. A., Kraut, N. & Beug, H. (2005) Molecular requirements for epithelial- mesenchymal transition during tumor progression. Curr Opin Cell Biol, 17(5), 548-58.

Hugo, H., Ackland, M. L., Blick, T., Lawrence, M. G., Clements, J. A., Williams, E. D. & Thompson, E. W. (2007) Epithelial--mesenchymal and mesenchymal--epithelial transitions in carcinoma progression. J Cell Physiol, 213(2), 374-83.

Ishii, H., Saitoh, M., Sakamoto, K., Kondo, T., Katoh, R., Tanaka, S., Motizuki, M., Masuyama, K. & Miyazawa, K. (2014) Epithelial splicing regulatory proteins 1 (ESRP1) and 2 (ESRP2) suppress cancer cell motility via different mechanisms. J Biol Chem, 289(40), 27386-99.

Iwamori, N., Tominaga, K., Sato, T., Riehle, K., Iwamori, T., Ohkawa, Y., Coarfa, C., Ono, E. & Matzuk, M. M. (2016) MRG15 is required for pre-mRNA splicing and spermatogenesis. Proc Natl Acad Sci U S A, 113(37), E5408-15.

Izadyar, F., Pau, F., Marh, J., Slepko, N., Wang, T., Gonzalez, R., Ramos, T., Howerton, K., Sayre, C. & Silva, F. (2008) Generation of multipotent cell lines from a distinct population of male germ line stem cells. Reproduction, 135(6), 771-84.

Jain, S., Yang, P. & Farrell, S. A. (2010) A case of 8q22.1 microdeletion without the Nablus mask-like facial syndrome phenotype. Eur J Med Genet, 53(2), 108-10.

Jameson, S. A., Natarajan, A., Cool, J., DeFalco, T., Maatouk, D. M., Mork, L., Munger, S. C. & Capel, B. (2012) Temporal transcriptional profiling of somatic and germ cells reveals biased lineage priming of sexual fate in the fetal mouse gonad. PLoS Genet, 8(3), e1002575.

138

Jarrett, S. G., Lewin, A. S. & Boulton, M. E. (2010) The importance of mitochondria in age- related and inherited eye disorders. Ophthalmic Res, 44(3), 179-90.

Jeong, H. M., Han, J., Lee, S. H., Park, H. J., Lee, H. J., Choi, J. S., Lee, Y. M., Choi, Y. L., Shin, Y. K. & Kwon, M. J. (2017) ESRP1 is overexpressed in ovarian cancer and promotes switching from mesenchymal to epithelial phenotype in ovarian cancer cells. Oncogenesis, 6(10), e389.

Jerome, L. A. & Papaioannou, V. E. (2001) DiGeorge syndrome phenotype in mice mutant for the T-box gene, Tbx1. Nat Genet, 27(3), 286-91.

Jiang, H. L., Sun, H. F., Gao, S. P., Li, L. D., Huang, S., Hu, X., Liu, S., Wu, J., Shao, Z. M. & Jin, W. (2016) SSBP1 Suppresses TGFbeta-Driven Epithelial-to-Mesenchymal Transition and Metastasis in Triple-Negative Breast Cancer by Regulating Mitochondrial Retrograde Signaling. Cancer Res, 76(4), 952-64.

Johnson, D. E., Lee, P. L., Lu, J. & Williams, L. T. (1990) Diverse forms of a receptor for acidic and basic fibroblast growth factors. Mol Cell Biol, 10(9), 4728-36.

Jones, T. D., Ulbright, T. M., Eble, J. N., Baldridge, L. A. & Cheng, L. (2004) OCT4 staining in testicular tumors: a sensitive and specific marker for seminoma and embryonal carcinoma. Am J Surg Pathol, 28(7), 935-40.

Joo, J. H., Correia, G. P., Li, J. L., Lopez, M. C., Baker, H. V. & Sugrue, S. P. (2013) Transcriptomic analysis of PNN- and ESRP1-regulated alternative pre-mRNA splicing in human corneal epithelial cells. Invest Ophthalmol Vis Sci, 54(1), 697-707.

Kalluri, R. & Neilson, E. G. (2003) Epithelial-mesenchymal transition and its implications for fibrosis. J Clin Invest, 112(12), 1776-84.

Kalluri, R. & Weinberg, R. A. (2009) The basics of epithelial-mesenchymal transition. J Clin Invest, 119(6), 1420-8.

Kanai, Y., Kanai-Azuma, M., Noce, T., Saido, T. C., Shiroishi, T., Hayashi, Y. & Yazaki, K. (1996) Identification of two Sox17 messenger RNA isoforms, with and without the high mobility group box region, and their differential expression in mouse spermatogenesis. J Cell Biol, 133(3), 667-81.

Kanatsu-Shinohara, M., Lee, J., Inoue, K., Ogonuki, N., Miki, H., Toyokuni, S., Ikawa, M., Nakamura, T., Ogura, A. & Shinohara, T. (2008) Pluripotency of a single spermatogonial stem cell in mice. Biol Reprod, 78(4), 681-7.

Kannan, A., Wells, R. B., Sivakumar, S., Komatsu, S., Singh, K. P., Samten, B., Philley, J. V., Sauter, E. R., Ikebe, M., Idell, S., Gupta, S. & Dasgupta, S. (2016) Mitochondrial Reprogramming Regulates Breast Cancer Progression. Clin Cancer Res, 22(13), 3348-60.

Karl, J. & Capel, B. (1998) Sertoli cells of the mouse testis originate from the coelomic epithelium. Dev Biol, 203(2), 323-33.

Katoh, S., Zheng, Z., Oritani, K., Shimozato, T. & Kincade, P. W. (1995) Glycosylation of CD44 negatively regulates its recognition of hyaluronan. J Exp Med, 182(2), 419-29.

139

Keren, H., Lev-Maor, G. & Ast, G. (2010) Alternative splicing and evolution: diversification, exon definition and function. Nat Rev Genet, 11(5), 345-55.

Kim, N., Alekseyenko, A. V., Roy, M. & Lee, C. (2007a) The ASAP II database: analysis and comparative genomics of alternative splicing in 15 animal species. Nucleic Acids Res, 35(Database issue), D93-8.

Kim, Y., Bingham, N., Sekido, R., Parker, K. L., Lovell-Badge, R. & Capel, B. (2007b) Fibroblast growth factor receptor 2 regulates proliferation and Sertoli differentiation during male sex determination. Proc Natl Acad Sci U S A, 104(42), 16558-63.

Kinebuchi, T., Kagawa, W., Kurumizaka, H. & Yokoyama, S. (2005) Role of the N-terminal domain of the human DMC1 protein in octamer formation and DNA binding. J Biol Chem, 280(31), 28382-7.

Klinck, R., Bramard, A., Inkel, L., Dufresne-Martin, G., Gervais-Bird, J., Madden, R., Paquet, E. R., Koh, C., Venables, J. P., Prinos, P., Jilaveanu-Pelmus, M., Wellinger, R., Rancourt, C., Chabot, B. & Abou Elela, S. (2008) Multiple alternative splicing markers for ovarian cancer. Cancer Res, 68(3), 657-63.

Kong, D., Li, Y., Wang, Z. & Sarkar, F. H. (2011) Cancer Stem Cells and Epithelial-to- Mesenchymal Transition (EMT)-Phenotypic Cells: Are They Cousins or Twins? Cancers (Basel), 3(1), 716-29.

Kossack, N., Meneses, J., Shefi, S., Nguyen, H. N., Chavez, S., Nicholas, C., Gromoll, J., Turek, P. J. & Reijo-Pera, R. A. (2009) Isolation and characterization of pluripotent human spermatogonial stem cell-derived cells. Stem Cells, 27(1), 138-49.

Krawczak, M., Reiss, J. & Cooper, D. N. (1992) The mutational spectrum of single base-pair substitutions in mRNA splice junctions of human genes: causes and consequences. Hum Genet, 90(1-2), 41-54.

Kuijk, E. W., Chuva de Sousa Lopes, S. M., Geijsen, N., Macklon, N. & Roelen, B. A. (2011) The different shades of mammalian pluripotent stem cells. Hum Reprod Update, 17(2), 254- 71.

Ladd, A. N., Charlet, N. & Cooper, T. A. (2001) The CELF family of RNA binding proteins is implicated in cell-specific and developmentally regulated alternative splicing. Mol Cell Biol, 21(4), 1285-96.

Ladd, A. N. & Cooper, T. A. (2002) Finding signals that regulate alternative splicing in the post-genomic era. Genome Biol, 3(11), reviews0008.

Landen, C. N., Jr., Birrer, M. J. & Sood, A. K. (2008) Early events in the pathogenesis of epithelial ovarian cancer. J Clin Oncol, 26(6), 995-1005.

Lee, P. L., Johnson, D. E., Cousens, L. S., Fried, V. A. & Williams, L. T. (1989) Purification and complementary DNA cloning of a receptor for basic fibroblast growth factor. Science, 245(4913), 57-60.

140

Leontieva, O. V. & Ionov, Y. (2009) RNA-binding motif protein 35A is a novel tumor suppressor for colorectal cancer. Cell Cycle, 8(3), 490-7.

Levanon, K., Crum, C. & Drapkin, R. (2008) New insights into the pathogenesis of serous ovarian cancer and its clinical impact. J Clin Oncol, 26(32), 5284-93.

Lewis, B. P., Shih, I. H., Jones-Rhoades, M. W., Bartel, D. P. & Burge, C. B. (2003) Prediction of mammalian microRNA targets. Cell, 115(7), 787-98.

Li, R., Liang, J., Ni, S., Zhou, T., Qing, X., Li, H., He, W., Chen, J., Li, F., Zhuang, Q., Qin, B., Xu, J., Li, W., Yang, J., Gan, Y., Qin, D., Feng, S., Song, H., Yang, D., Zhang, B., Zeng, L., Lai, L., Esteban, M. A. & Pei, D. (2010) A mesenchymal-to-epithelial transition initiates and is required for the nuclear reprogramming of mouse fibroblasts. Cell Stem Cell, 7(1), 51- 63.

Li, S., Lan, Z. J., Li, X., Lin, J. & Lei, Z. (2014) Role of postnatal expression of fgfr1 and fgfr2 in testicular germ cells on spermatogenesis and fertility in mice. J Reprod Infertil, 15(3), 122- 33.

Little, M., Georgas, K., Pennisi, D. & Wilkinson, L. (2010) Kidney development: two tales of tubulogenesis. Curr Top Dev Biol, 90, 193-229.

Liu, Y., Li, Q. C., Miao, Y., Xu, H. T., Dai, S. D., Wei, Q., Dong, Q. Z., Dong, X. J., Zhao, Y., Zhao, C. & Wang, E. H. (2009) Ablation of p120-catenin enhances invasion and metastasis of human lung cancer cells. Cancer Sci, 100(3), 441-8.

Looijenga, L. H., Hersmus, R., de Leeuw, B. H., Stoop, H., Cools, M., Oosterhuis, J. W., Drop, S. L. & Wolffenbuttel, K. P. (2010) Gonadal tumours and DSD. Best Pract Res Clin Endocrinol Metab, 24(2), 291-310.

Looijenga, L. H. & Oosterhuis, J. W. (2013) Pathobiology of germ cell tumors - applying the gossip test! Int J Dev Biol, 57(2-4), 289-98.

Lorenzatti, G., Huang, W., Pal, A., Cabanillas, A. M. & Kleer, C. G. (2011) CCN6 (WISP3) decreases ZEB1-mediated EMT and invasion by attenuation of IGF-1 receptor signaling in breast cancer. J Cell Sci, 124(Pt 10), 1752-8.

Lu, Z. X., Huang, Q., Park, J. W., Shen, S., Lin, L., Tokheim, C. J., Henry, M. D. & Xing, Y. (2015) Transcriptome-wide landscape of pre-mRNA alternative splicing associated with metastatic colonization. Mol Cancer Res, 13(2), 305-18.

Manku, G. & Culty, M. (2015) Mammalian gonocyte and spermatogonia differentiation: recent advances and remaining challenges. Reproduction, 149(3), R139-57.

Manley, J. L. & Tacke, R. (1996) SR proteins and splicing control. Genes Dev, 10(13), 1569- 79.

Marchler-Bauer, A., Bo, Y., Han, L., He, J., Lanczycki, C. J., Lu, S., Chitsaz, F., Derbyshire, M. K., Geer, R. C., Gonzales, N. R., Gwadz, M., Hurwitz, D. I., Lu, F., Marchler, G. H., Song, J. S., Thanki, N., Wang, Z., Yamashita, R. A., Zhang, D., Zheng, C., Geer, L. Y. & Bryant, S. H. (2017) CDD/SPARCLE: functional classification of proteins via subfamily domain architectures. Nucleic Acids Res, 45(D1), D200-D203. 141

Margolin, G., Khil, P. P., Kim, J., Bellani, M. A. & Camerini-Otero, R. D. (2014) Integrated transcriptome analysis of mouse spermatogenesis. BMC Genomics, 15, 39.

Maris, C., Dominguez, C. & Allain, F. H. (2005) The RNA recognition motif, a plastic RNA- binding platform to regulate post-transcriptional gene expression. FEBS J, 272(9), 2118-31.

Matsuda, Y., Ueda, J. & Ishiwata, T. (2012) Fibroblast growth factor receptor 2: expression, roles, and potential as a novel molecular target for colorectal cancer. Patholog Res Int, 2012, 574768.

McClellan, K. A., Gosden, R. & Taketo, T. (2003) Continuous loss of oocytes throughout meiotic prophase in the normal mouse ovary. Dev Biol, 258(2), 334-48.

McIver, S. C., Stanger, S. J., Santarelli, D. M., Roman, S. D., Nixon, B. & McLaughlin, E. A. (2012) A unique combination of male germ cell miRNAs coordinates gonocyte differentiation. PLoS One, 7(4), e35553.

McLaren, A. (1983) Primordial germ cells in mice. Bibl Anat, 24, 59-66.

McLaren, A. & Southee, D. (1997) Entry of mouse embryonic germ cells into meiosis. Dev Biol, 187(1), 107-13.

Meyer, S., Nolte, J., Opitz, L., Salinas-Riester, G. & Engel, W. (2010) Pluripotent embryonic stem cells and multipotent adult germline stem cells reveal similar transcriptomes including pluripotency-related genes. Mol Hum Reprod, 16(11), 846-55.

Miyake, H., Hara, I., Yamanaka, K., Gohji, K., Arakawa, S. & Kamidono, S. (1998) Expression patterns of CD44 adhesion molecule in testicular germ cell tumors and normal testes. Am J Pathol, 152(5), 1157-60.

Miyazono, K. & Koinuma, D. (2011) Arkadia--beyond the TGF-beta pathway. J Biochem, 149(1), 1-3.

Mizuno, Y., Gotoh, A., Kamidono, S. & Kitazawa, S. (1993) [Establishment and characterization of a new human testicular germ cell tumor cell line (TCam-2)]. Nihon Hinyokika Gakkai Zasshi, 84(7), 1211-8.

Mizutani, A., Koinuma, D., Seimiya, H. & Miyazono, K. (2016) The Arkadia-ESRP2 axis suppresses tumor progression: analyses in clear-cell renal cell carcinoma. Oncogene, 35(27), 3514-23.

Mullen, A. R., Wheaton, W. W., Jin, E. S., Chen, P. H., Sullivan, L. B., Cheng, T., Yang, Y., Linehan, W. M., Chandel, N. S. & DeBerardinis, R. J. (2011) Reductive carboxylation supports growth in tumour cells with defective mitochondria. Nature, 481(7381), 385-8.

Musunuru, K. (2003) Cell-specific RNA-binding proteins in human disease. Trends Cardiovasc Med, 13(5), 188-95.

Nagano, O. & Saya, H. (2004) Mechanism and biological significance of CD44 cleavage. Cancer Sci, 95(12), 930-5.

142

O'Bryan, M. K., Clark, B. J., McLaughlin, E. A., D'Sylva, R. J., O'Donnell, L., Wilce, J. A., Sutherland, J., O'Connor, A. E., Whittle, B., Goodnow, C. C., Ormandy, C. J. & Jamsai, D. (2013) RBM5 is a male germ cell splicing factor and is required for spermatid differentiation and male fertility. PLoS Genet, 9(7), e1003628.

Oatley, J. M. & Brinster, R. L. (2012) The germline stem cell niche unit in mammalian testes. Physiol Rev, 92(2), 577-95.

Oltean, S. & Bates, D. O. (2014) Hallmarks of alternative splicing in cancer. Oncogene, 33(46), 5311-8.

Onder, T. T., Gupta, P. B., Mani, S. A., Yang, J., Lander, E. S. & Weinberg, R. A. (2008) Loss of E-cadherin promotes metastasis via multiple downstream transcriptional pathways. Cancer Res, 68(10), 3645-54.

Oosterhuis, J. W. & Looijenga, L. H. (2005) Testicular germ-cell tumours in a broader perspective. Nat Rev Cancer, 5(3), 210-22.

Oronsky, B., Ray, C. M., Spira, A. I., Trepel, J. B., Carter, C. A. & Cottrill, H. M. (2017) A brief review of the management of platinum-resistant-platinum-refractory ovarian cancer. Med Oncol, 34(6), 103.

Orr-Urtreger, A., Bedford, M. T., Burakova, T., Arman, E., Zimmer, Y., Yayon, A., Givol, D. & Lonai, P. (1993) Developmental localization of the splicing alternatives of fibroblast growth factor receptor-2 (FGFR2). Dev Biol, 158(2), 475-86.

Ortiz, M. A., Noble, D., Sorokin, E. P. & Kimble, J. (2014) A new dataset of spermatogenic vs. oogenic transcriptomes in the nematode Caenorhabditis elegans. G3 (Bethesda), 4(9), 1765- 72.

Padmanabhan, K. & Richter, J. D. (2006) Regulated Pumilio-2 binding controls RINGO/Spy mRNA translation and CPEB activation. Genes Dev, 20(2), 199-209.

Pagliarini, D. J., Calvo, S. E., Chang, B., Sheth, S. A., Vafai, S. B., Ong, S. E., Walford, G. A., Sugiana, C., Boneh, A., Chen, W. K., Hill, D. E., Vidal, M., Evans, J. G., Thorburn, D. R., Carr, S. A. & Mootha, V. K. (2008) A mitochondrial protein compendium elucidates complex I disease biology. Cell, 134(1), 112-23.

Pajares, M. J., Ezponda, T., Catena, R., Calvo, A., Pio, R. & Montuenga, L. M. (2007) Alternative splicing: an emerging topic in molecular and clinical oncology. Lancet Oncol, 8(4), 349-57.

Palumbo, C., van Roozendaal, K., Gillis, A. J., van Gurp, R. H., de Munnik, H., Oosterhuis, J. W., van Zoelen, E. J. & Looijenga, L. H. (2002) Expression of the PDGF alpha-receptor 1.5 kb transcript, OCT-4, and c-KIT in human normal and malignant tissues. Implications for the early diagnosis of testicular germ cell tumours and for our understanding of regulatory mechanisms. J Pathol, 196(4), 467-77.

Pan, Q., Shai, O., Lee, L. J., Frey, B. J. & Blencowe, B. J. (2008) Deep surveying of alternative splicing complexity in the human transcriptome by high-throughput sequencing. Nat Genet, 40(12), 1413-5.

143

Pandey, U. B. & Nichols, C. D. (2011) Human disease models in Drosophila melanogaster and the role of the fly in therapeutic drug discovery. Pharmacol Rev, 63(2), 411-36.

Paronetto, M. P., Messina, V., Barchi, M., Geremia, R., Richard, S. & Sette, C. (2011) Sam68 marks the transcriptionally active stages of spermatogenesis and modulates alternative splicing in male germ cells. Nucleic Acids Res, 39(12), 4961-74.

Peinado, H., Quintanilla, M. & Cano, A. (2003) Transforming growth factor beta-1 induces snail transcription factor in epithelial cell lines: mechanisms for epithelial mesenchymal transitions. J Biol Chem, 278(23), 21113-23.

Polo, J. M., Anderssen, E., Walsh, R. M., Schwarz, B. A., Nefzger, C. M., Lim, S. M., Borkent, M., Apostolou, E., Alaei, S., Cloutier, J., Bar-Nur, O., Cheloufi, S., Stadtfeld, M., Figueroa, M. E., Robinton, D., Natesan, S., Melnick, A., Zhu, J., Ramaswamy, S. & Hochedlinger, K. (2012) A molecular roadmap of reprogramming somatic cells into iPS cells. Cell, 151(7), 1617- 32.

Prochazka, L., Tesarik, R. & Turanek, J. (2014) Regulation of alternative splicing of CD44 in cancer. Cell Signal, 26(10), 2234-9.

Pulkkinen, M. A., Spencer-Dene, B., Dickson, C. & Otonkoski, T. (2003) The IIIb isoform of fibroblast growth factor receptor 2 is required for proper growth and branching of pancreatic ductal epithelium but not for differentiation of exocrine or endocrine cells. Mech Dev, 120(2), 167-75.

Ramskold, D., Wang, E. T., Burge, C. B. & Sandberg, R. (2009) An abundance of ubiquitously expressed genes revealed by tissue transcriptome sequence data. PLoS Comput Biol, 5(12), e1000598.

Ray, H. J. & Niswander, L. A. (2016) Grainyhead-like 2 downstream targets act to suppress epithelial-to-mesenchymal transition during neural tube closure. Development, 143(7), 1192- 204.

Reinke, L. M., Xu, Y. & Cheng, C. (2012) Snail represses the splicing regulator epithelial splicing regulatory protein 1 to promote epithelial-mesenchymal transition. J Biol Chem, 287(43), 36435-42.

Revil, T., Gaffney, D., Dias, C., Majewski, J. & Jerome-Majewska, L. A. (2010) Alternative splicing is frequent during early embryonic development in mouse. BMC Genomics, 11, 399.

Revil, T. & Jerome-Majewska, L. A. (2013) During embryogenesis, esrp1 expression is restricted to a subset of epithelial cells and is associated with splicing of a number of developmentally important genes. Dev Dyn, 242(3), 281-90.

Roca, H., Hernandez, J., Weidner, S., McEachin, R. C., Fuller, D., Sud, S., Schumann, T., Wilkinson, J. E., Zaslavsky, A., Li, H., Maher, C. A., Daignault-Newton, S., Healy, P. N. & Pienta, K. J. (2013) Transcription factors OVOL1 and OVOL2 induce the mesenchymal to epithelial transition in human cancer. PLoS One, 8(10), e76773.

Rocha, M. C., Grady, J. P., Grunewald, A., Vincent, A., Dobson, P. F., Taylor, R. W., Turnbull, D. M. & Rygiel, K. A. (2015) A novel immunofluorescent assay to investigate oxidative 144

phosphorylation deficiency in mitochondrial myopathy: understanding mechanisms and improving diagnosis. Sci Rep, 5, 15037.

Sahebi, M., Hanafi, M. M., van Wijnen, A. J., Azizi, P., Abiri, R., Ashkani, S. & Taheri, S. (2016) Towards understanding pre-mRNA splicing mechanisms and the role of SR proteins. Gene, 587(2), 107-19.

Sakai, K., Kaku, T., Kamura, T., Kinukawa, N., Amada, S., Shigematsu, T., Hirakawa, T., Kobayashi, H., Ariyoshi, K. & Nakano, H. (1999) Comparison of p53, Ki-67, and CD44v6 expression between primary and matched metastatic lesions in ovarian cancer. Gynecol Oncol, 72(3), 360-6.

Samavarchi-Tehrani, P., Golipour, A., David, L., Sung, H. K., Beyer, T. A., Datti, A., Woltjen, K., Nagy, A. & Wrana, J. L. (2010) Functional genomics reveals a BMP-driven mesenchymal- to-epithelial transition in the initiation of somatic cell reprogramming. Cell Stem Cell, 7(1), 64- 77.

Santucci-Darmanin, S., Paul, R., Michiels, J. F., Saunieres, A., Desnuelle, C. & Paquis- Flucklinger, V. (1999) Alternative splicing of hMSH4: two isoforms in testis and abnormal transcripts in somatic tissues. Mamm Genome, 10(4), 423-7.

Savagner, P., Valles, A. M., Jouanneau, J., Yamada, K. M. & Thiery, J. P. (1994) Alternative splicing in fibroblast growth factor receptor 2 is associated with induced epithelial- mesenchymal transition in rat bladder carcinoma cells. Mol Biol Cell, 5(8), 851-62.

Schmid, R., Grellscheid, S. N., Ehrmann, I., Dalgliesh, C., Danilenko, M., Paronetto, M. P., Pedrotti, S., Grellscheid, D., Dixon, R. J., Sette, C., Eperon, I. C. & Elliott, D. J. (2013) The splicing landscape is globally reprogrammed during male meiosis. Nucleic Acids Res, 41(22), 10170-84.

Seandel, M., James, D., Shmelkov, S. V., Falciatori, I., Kim, J., Chavala, S., Scherr, D. S., Zhang, F., Torres, R., Gale, N. W., Yancopoulos, G. D., Murphy, A., Valenzuela, D. M., Hobbs, R. M., Pandolfi, P. P. & Rafii, S. (2007) Generation of functional multipotent adult stem cells from GPR125+ germline progenitors. Nature, 449(7160), 346-50.

Sebestyen, E., Singh, B., Minana, B., Pages, A., Mateo, F., Pujana, M. A., Valcarcel, J. & Eyras, E. (2016) Large-scale analysis of genome and transcriptome alterations in multiple tumors unveils novel cancer-relevant splicing networks. Genome Res, 26(6), 732-44.

Seftor, R. E., Seftor, E. A., Gehlsen, K. R., Stetler-Stevenson, W. G., Brown, P. D., Ruoslahti, E. & Hendrix, M. J. (1992) Role of the alpha v beta 3 integrin in human melanoma cell invasion. Proc Natl Acad Sci U S A, 89(5), 1557-61.

Shapiro, I. M., Cheng, A. W., Flytzanis, N. C., Balsamo, M., Condeelis, J. S., Oktay, M. H., Burge, C. B. & Gertler, F. B. (2011) An EMT-driven alternative splicing program occurs in human breast cancer and modulates cellular phenotype. PLoS Genet, 7(8), e1002218.

Shapouri, F., Saeidi, S., de Iongh, R. U., Casagranda, F., Western, P. S., McLaughlin, E. A., Sutherland, J. M., Hime, G. R. & Familari, M. (2016) Tob1 is expressed in developing and adult gonads and is associated with the P-body marker, Dcp2. Cell Tissue Res, 364(2), 443-51.

145

Sherwood, R. I., Jitianu, C., Cleaver, O., Shaywitz, D. A., Lamenzo, J. O., Chen, A. E., Golub, T. R. & Melton, D. A. (2007) Prospective isolation and global gene expression analysis of definitive and visceral endoderm. Dev Biol, 304(2), 541-55.

Shi, J., Zhou, Z., Di, W. & Li, N. (2013) Correlation of CD44v6 expression with ovarian cancer progression and recurrence. BMC Cancer, 13, 182.

Shimbori, M., Kijima, H., Sato, S., Yoshida, H., Sato, T., Terasaki-Fukuzawa, Y., Onoda, N., Kanabuchi, K., Abe, Y., Nakamura, M., Hattori, M., Ohno, E. & Kuramoto, H. (2003) Expression of CD44 in primary lung carcinomas using histological and cytological analyses. Anticancer Res, 23(1A), 115-21.

Skotheim, R. I. & Nees, M. (2007) Alternative splicing in cancer: noise, functional, or systematic? Int J Biochem Cell Biol, 39(7-8), 1432-49.

Sosulski, A., Horn, H., Zhang, L., Coletti, C., Vathipadiekal, V., Castro, C. M., Birrer, M. J., Nagano, O., Saya, H., Lage, K., Donahoe, P. K. & Pepin, D. (2016) CD44 Splice Variant v8- 10 as a Marker of Serous Ovarian Cancer Prognosis. PLoS One, 11(6), e0156595.

Spector, D. L., Fu, X. D. & Maniatis, T. (1991) Associations between distinct pre-mRNA splicing components and the cell nucleus. EMBO J, 10(11), 3467-81.

Speek, M., Njunkova, O., Pata, I., Valdre, E. & Kogerman, P. (2006) A potential role of alternative splicing in the regulation of the transcriptional activity of human GLI2 in gonadal tissues. BMC Mol Biol, 7, 13.

Spradling, A., Fuller, M. T., Braun, R. E. & Yoshida, S. (2011) Germline stem cells. Cold Spring Harb Perspect Biol, 3(11), a002642.

St Johnston, D. (2002) The art and design of genetic screens: Drosophila melanogaster. Nat Rev Genet, 3(3), 176-88.

Stamenkovic, I., Aruffo, A., Amiot, M. & Seed, B. (1991) The hematopoietic and epithelial forms of CD44 are distinct polypeptides with different adhesion potentials for hyaluronate- bearing cells. EMBO J, 10(2), 343-8.

Steele, I. A., Edmondson, R. J., Leung, H. Y. & Davies, B. R. (2006) Ligands to FGF receptor 2-IIIb induce proliferation, motility, protection from cell death and cytoskeletal rearrangements in epithelial ovarian cancer cell lines. Growth Factors, 24(1), 45-53.

Strutz, F., Zeisberg, M., Ziyadeh, F. N., Yang, C. Q., Kalluri, R., Muller, G. A. & Neilson, E. G. (2002) Role of basic fibroblast growth factor-2 in epithelial-mesenchymal transformation. Kidney Int, 61(5), 1714-28.

Svingen, T., Jorgensen, A. & Rajpert-De Meyts, E. (2014) Validation of endogenous normalizing genes for expression analyses in adult human testis and germ cell neoplasms. Mol Hum Reprod, 20(8), 709-18.

Szabo, P. E., Hubner, K., Scholer, H. & Mann, J. R. (2002) Allele-specific expression of imprinted genes in mouse migratory primordial germ cells. Mech Dev, 115(1-2), 157-60.

146

Takeda, J., Suzuki, Y., Nakao, M., Barrero, R. A., Koyanagi, K. O., Jin, L., Motono, C., Hata, H., Isogai, T., Nagai, K., Otsuki, T., Kuryshev, V., Shionyu, M., Yura, K., Go, M., Thierry- Mieg, J., Thierry-Mieg, D., Wiemann, S., Nomura, N., Sugano, S., Gojobori, T. & Imanishi, T. (2006) Large-scale identification and characterization of alternative splicing variants of human gene transcripts using 56,419 completely sequenced and manually annotated full-length cDNAs. Nucleic Acids Res, 34(14), 3917-28.

Takeuchi, Y., Molyneaux, K., Runyan, C., Schaible, K. & Wylie, C. (2005) The roles of FGF signaling in germ cell migration in the mouse. Development, 132(24), 5399-409.

Tan, A. S., Baty, J. W., Dong, L. F., Bezawork-Geleta, A., Endaya, B., Goodwin, J., Bajzikova, M., Kovarova, J., Peterka, M., Yan, B., Pesdar, E. A., Sobol, M., Filimonenko, A., Stuart, S., Vondrusova, M., Kluckova, K., Sachaphibulkij, K., Rohlena, J., Hozak, P., Truksa, J., Eccles, D., Haupt, L. M., Griffiths, L. R., Neuzil, J. & Berridge, M. V. (2015) Mitochondrial genome acquisition restores respiratory function and tumorigenic potential of cancer cells without mitochondrial DNA. Cell Metab, 21(1), 81-94.

Thannickal, V. J. & Fanburg, B. L. (2000) Reactive oxygen species in cell signaling. Am J Physiol Lung Cell Mol Physiol, 279(6), L1005-28.

Thiery, J. P., Acloque, H., Huang, R. Y. & Nieto, M. A. (2009) Epithelial-mesenchymal transitions in development and disease. Cell, 139(5), 871-90.

Thiery, J. P. & Sleeman, J. P. (2006) Complex networks orchestrate epithelial-mesenchymal transitions. Nat Rev Mol Cell Biol, 7(2), 131-42.

Todaro, M., Gaggianesi, M., Catalano, V., Benfante, A., Iovino, F., Biffoni, M., Apuzzo, T., Sperduti, I., Volpe, S., Cocorullo, G., Gulotta, G., Dieli, F., De Maria, R. & Stassi, G. (2014) CD44v6 is a marker of constitutive and reprogrammed cancer stem cells driving colon cancer metastasis. Cell Stem Cell, 14(3), 342-56.

Ueda, J., Matsuda, Y., Yamahatsu, K., Uchida, E., Naito, Z., Korc, M. & Ishiwata, T. (2014) Epithelial splicing regulatory protein 1 is a favorable prognostic factor in pancreatic cancer that attenuates pancreatic metastases. Oncogene, 33(36), 4485-95.

Ule, J., Ule, A., Spencer, J., Williams, A., Hu, J. S., Cline, M., Wang, H., Clark, T., Fraser, C., Ruggiu, M., Zeeberg, B. R., Kane, D., Weinstein, J. N., Blume, J. & Darnell, R. B. (2005) Nova regulates brain-specific splicing to shape the synapse. Nat Genet, 37(8), 844-52.

Upadhyay, M., Samal, J., Kandpal, M., Singh, O. V. & Vivekanandan, P. (2013) The Warburg effect: insights from the past decade. Pharmacol Ther, 137(3), 318-30.

Uy, B., McGlashan, S. R. & Shaikh, S. B. (2011) Measurement of reactive oxygen species in the culture media using Acridan Lumigen PS-3 assay. J Biomol Tech, 22(3), 95-107.

Vajda, N. A., Brimacombe, K. R., LeMasters, K. E. & Ladd, A. N. (2009) Muscleblind-like 1 is a negative regulator of TGF-beta-dependent epithelial-mesenchymal transition of atrioventricular canal endocardial cells. Dev Dyn, 238(12), 3266-72. van den Bergen, J. A., Miles, D. C., Sinclair, A. H. & Western, P. S. (2009) Normalizing gene expression levels in mouse fetal germ cells. Biol Reprod, 81(2), 362-70.

147

Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A. & Speleman, F. (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol, 3(7), RESEARCH0034.

Vasudevan, S., Seli, E. & Steitz, J. A. (2006) Metazoan oocyte and early embryo development program: a progression through translation regulatory cascades. Genes Dev, 20(2), 138-46.

Venables, J. P. (2006) Unbalanced alternative splicing and its significance in cancer. Bioessays, 28(4), 378-86.

Vergara, D., Merlot, B., Lucot, J. P., Collinet, P., Vinatier, D., Fournier, I. & Salzet, M. (2010) Epithelial-mesenchymal transition in ovarian cancer. Cancer Lett, 291(1), 59-66.

Vincent, A. M., Russell, J. W., Low, P. & Feldman, E. L. (2004) Oxidative stress in the pathogenesis of diabetic neuropathy. Endocr Rev, 25(4), 612-28.

Wakabayashi-Ito, N., Belvin, M. P., Bluestein, D. A. & Anderson, K. V. (2001) fusilli, an essential gene with a maternal role in Drosophila embryonic dorsal-ventral patterning. Dev Biol, 229(1), 44-54.

Waldbaum, S. & Patel, M. (2010) Mitochondrial dysfunction and oxidative stress: a contributing link to acquired epilepsy? J Bioenerg Biomembr, 42(6), 449-55.

Wallace, D. C. (2012) Mitochondria and cancer. Nat Rev Cancer, 12(10), 685-98.

Wang, A., Lu, L., Wang, Y., Sun, Y., Zhang, Y., Guo, C., Gu, Y. & Liu, A. (2014) [Expression and clinicopathologic significance of CD44v6/CD24 in ovarian serous carcinomas]. Zhonghua Bing Li Xue Za Zhi, 43(1), 20-4.

Wang, E. T., Sandberg, R., Luo, S., Khrebtukova, I., Zhang, L., Mayr, C., Kingsmore, S. F., Schroth, G. P. & Burge, C. B. (2008) Alternative isoform regulation in human tissue transcriptomes. Nature, 456(7221), 470-6.

Warzecha, C. C. & Carstens, R. P. (2012) Complex changes in alternative pre-mRNA splicing play a central role in the epithelial-to-mesenchymal transition (EMT). Semin Cancer Biol, 22(5-6), 417-27.

Warzecha, C. C., Jiang, P., Amirikian, K., Dittmar, K. A., Lu, H., Shen, S., Guo, W., Xing, Y. & Carstens, R. P. (2010) An ESRP-regulated splicing programme is abrogated during the epithelial-mesenchymal transition. EMBO J, 29(19), 3286-300.

Warzecha CC, J. P., Amirikian K, Dittmar KA, Lu H, Shen S, Guo W, Xing Y, Carstens RP. (2010) An ESRP-regulated splicing programme is abrogated during the epithelial- mesenchymal transition. EMBO J, 29(19), 15.

Warzecha, C. C., Sato, T. K., Nabet, B., Hogenesch, J. B. & Carstens, R. P. (2009a) ESRP1 and ESRP2 are epithelial cell-type-specific regulators of FGFR2 splicing. Mol Cell, 33(5), 591- 601.

148

Warzecha, C. C., Shen, S., Xing, Y. & Carstens, R. P. (2009b) The epithelial splicing factors ESRP1 and ESRP2 positively and negatively regulate diverse types of alternative splicing events. RNA Biol, 6(5), 546-62.

West, J. A., Viswanathan, S. R., Yabuuchi, A., Cunniff, K., Takeuchi, A., Park, I. H., Sero, J. E., Zhu, H., Perez-Atayde, A., Frazier, A. L., Surani, M. A. & Daley, G. Q. (2009) A role for Lin28 in primordial germ-cell development and germ-cell malignancy. Nature, 460(7257), 909-13.

White-Cooper, H. (2010) Molecular mechanisms of gene regulation during Drosophila spermatogenesis. Reproduction, 139(1), 11-21.

White-Cooper, H. & Davidson, I. (2011) Unique aspects of transcription regulation in male germ cells. Cold Spring Harb Perspect Biol, 3(7).

Will, C. L. & Luhrmann, R. (2011) Spliceosome structure and function. Cold Spring Harb Perspect Biol, 3(7).

Wolgemuth, D. J., Laurion, E. & Lele, K. M. (2002) Regulation of the mitotic and meiotic cell cycles in the male germ line. Recent Prog Horm Res, 57, 75-101.

Wrobel, G. & Primig, M. (2005) Mammalian male germ cells are fertile ground for expression profiling of sexual reproduction. Reproduction, 129(1), 1-7.

Xiang, X., Deng, Z., Zhuang, X., Ju, S., Mu, J., Jiang, H., Zhang, L., Yan, J., Miller, D. & Zhang, H. G. (2012) Grhl2 determines the epithelial phenotype of breast cancers and promotes tumor progression. PLoS One, 7(12), e50781.

Xin, Y., Grace, A., Gallagher, M. M., Curran, B. T., Leader, M. B. & Kay, E. W. (2001) CD44V6 in gastric carcinoma: a marker of tumor progression. Appl Immunohistochem Mol Morphol, 9(2), 138-42.

Xu, Q., Modrek, B. & Lee, C. (2002) Genome-wide detection of tissue-specific alternative splicing in the human transcriptome. Nucleic Acids Res, 30(17), 3754-66.

Xu, X., Weinstein, M., Li, C., Naski, M., Cohen, R. I., Ornitz, D. M., Leder, P. & Deng, C. (1998) Fibroblast growth factor receptor 2 (FGFR2)-mediated reciprocal regulation loop between FGF8 and FGF10 is essential for limb induction. Development, 125(4), 753-65.

Yae, T., Tsuchihashi, K., Ishimoto, T., Motohara, T., Yoshikawa, M., Yoshida, G. J., Wada, T., Masuko, T., Mogushi, K., Tanaka, H., Osawa, T., Kanki, Y., Minami, T., Aburatani, H., Ohmura, M., Kubo, A., Suematsu, M., Takahashi, K., Saya, H. & Nagano, O. (2012) Alternative splicing of CD44 mRNA by ESRP1 enhances lung colonization of metastatic cancer cell. Nat Commun, 3, 883.

Yamada, S., Kohu, K., Ishii, T., Ishidoya, S., Hiramatsu, M., Kanto, S., Fukuzaki, A., Adachi, Y., Endoh, M., Moriya, T., Sasaki, H., Satake, M. & Arai, Y. (2004) Gene expression profiling identifies a set of transcripts that are up-regulated inhuman testicular seminoma. DNA Res, 11(5), 335-44.

149

Yamaguchi, A., Goi, T., Yu, J., Hirono, Y., Ishida, M., Iida, A., Kimura, T., Takeuchi, K., Katayama, K. & Hirose, K. (2002) Expression of CD44v6 in advanced gastric cancer and its relationship to hematogenous metastasis and long-term prognosis. J Surg Oncol, 79(4), 230-5.

Yang, Y. Y., Yin, G. L. & Darnell, R. B. (1998) The neuronal RNA-binding protein Nova-2 is implicated as the autoantigen targeted in POMA patients with dementia. Proc Natl Acad Sci U S A, 95(22), 13254-9.

Ye, H. & Ulbright, T. M. (2012) Difficult differential diagnoses in testicular pathology. Arch Pathol Lab Med, 136(4), 435-46.

Ye, X. & Weinberg, R. A. (2015) Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression. Trends Cell Biol, 25(11), 675-86.

Yeo, G., Holste, D., Kreiman, G. & Burge, C. B. (2004) Variation in alternative splicing across human tissues. Genome Biol, 5(10), R74.

Yi, B. R., Kim, T. H., Kim, Y. S. & Choi, K. C. (2015) Alteration of epithelial-mesenchymal transition markers in human normal ovaries and neoplastic ovarian cancers. Int J Oncol, 46(1), 272-80.

Yorishima, T., Nagai, N. & Ohama, K. (1997) Expression of CD44 alternative splicing variants in primary and lymph node metastatic lesions of gynecological cancer. Hiroshima J Med Sci, 46(1), 21-9.

Yoshida, K., Kondoh, G., Matsuda, Y., Habu, T., Nishimune, Y. & Morita, T. (1998) The mouse RecA-like gene Dmc1 is required for homologous chromosome synapsis during meiosis. Mol Cell, 1(5), 707-18.

Young, J. C., Jaiprakash, A., Mithraprabhu, S., Itman, C., Kitazawa, R., Looijenga, L. H. & Loveland, K. L. (2011) TCam-2 seminoma cell line exhibits characteristic foetal germ cell responses to TGF-beta ligands and retinoic acid. Int J Androl, 34(4 Pt 2), e204-17.

Zhang, X., Ibrahimi, O. A., Olsen, S. K., Umemori, H., Mohammadi, M. & Ornitz, D. M. (2006) Receptor specificity of the fibroblast growth factor family. The complete mammalian FGF family. J Biol Chem, 281(23), 15694-700.

Zhao, Q., Caballero, O. L., Davis, I. D., Jonasch, E., Tamboli, P., Yung, W. K., Weinstein, J. N., Kenna Shaw for, T. r. n., Strausberg, R. L. & Yao, J. (2013) Tumor-specific isoform switch of the fibroblast growth factor receptor 2 underlies the mesenchymal and malignant phenotypes of clear cell renal cell carcinomas. Clin Cancer Res, 19(9), 2460-72.

Zheng, D. Q., Woodard, A. S., Fornaro, M., Tallini, G. & Languino, L. R. (1999) Prostatic carcinoma cell migration via alpha(v)beta3 integrin is modulated by a focal adhesion kinase pathway. Cancer Res, 59(7), 1655-64.

Zheng, K., Wu, X., Kaestner, K. H. & Wang, P. J. (2009) The pluripotency factor LIN28 marks undifferentiated spermatogonia in mouse. BMC Dev Biol, 9, 38.

Zhou, D. X., Liu, Y. X. & Xue, Y. H. (2012) Expression of CD44v6 and Its Association with Prognosis in Epithelial Ovarian Carcinomas. Patholog Res Int, 2012, 908206. 150

Zoller, M. (2011) CD44: can a cancer-initiating cell profit from an abundantly expressed molecule? Nat Rev Cancer, 11(4), 254-67.

151

Appendix

152

Appendix A1: pGIPZ-lentiviral shRNAmir map (Kindly provided by Associate Professor Russ P. Carstens, University of Pennsylvania School of Medicine)

153

Appendix A2: List of genes which differentially expressed after silencing of ESRP1

Gene logFC PValue FDR

GSTA9P -3.3076 8.38E-29 1.47E-27

NDP -3.30385 1.16E-32 2.46E-31

LGALS14 -2.85702 9.19E-27 1.45E-25

RP11-798K23.4 -2.67319 1.63E-23 2.08E-22

ESRP1 -2.63382 0 0

KCNIP4 -2.58371 8.75E-132 5.45E-129

HTR1B -2.47601 1.20E-151 1.12E-148

TLR4 -2.45714 2.28E-47 9.78E-46

IL1RAP -2.43604 3.35E-89 5.99E-87

DEFB1 -2.43439 7.84E-61 5.52E-59

STON1-GTF2A1L -2.3944 8.32E-19 7.52E-18

SMYD1 -2.37062 1.16E-10 5.58E-10

VWC2 -2.35171 2.72E-39 8.06E-38

POSTN -2.30578 2.74E-73 2.98E-71

TKTL1 -2.30432 2.31E-90 4.26E-88

GLYATL2 -2.24955 6.51E-99 1.54E-96

RXFP1 -2.21092 2.72E-10 1.27E-09

CD34 -2.17154 2.58E-102 6.48E-100

ROPN1 -2.15702 1.51E-11 7.87E-11

TEX11 -2.1373 3.15E-13 1.91E-12

SGCD -2.09523 3.15E-26 4.79E-25

C5orf46 -2.02442 6.60E-97 1.52E-94

TMEM64 -2.01303 1.24E-167 1.61E-164

NCMAP -1.99646 2.83E-54 1.58E-52

NRXN1 -1.97356 4.20E-134 2.83E-131

RUNDC3B -1.92201 6.41E-17 5.10E-16

CDH6 -1.90074 1.73E-46 7.09E-45

SERPINB4 -1.89798 1.24E-20 1.28E-19

NKX2-5 -1.88253 4.28E-49 2.03E-47

MAOA -1.87269 2.08E-24 2.83E-23

SERPINB3 -1.85984 3.86E-13 2.32E-12

RP11-193H5.1 -1.85295 1.15E-42 3.98E-41

ABHD17AP1 -1.82653 9.72E-37 2.57E-35

HHIP-AS1 -1.80321 3.30E-19 3.08E-18

154

RMRP -1.77602 0.012540973 0.021758814

RP11-123C21.1 -1.74677 6.00E-08 2.22E-07

KLRB1 -1.744 1.76E-18 1.56E-17

TRIM28 -1.73982 0 0

CLC -1.73231 5.39E-09 2.21E-08

PTH2R -1.73019 3.74E-09 1.56E-08

EPHA7 -1.72983 1.60E-108 4.90E-106

SOX21 -1.68881 2.65E-45 1.04E-43

GSTA3 -1.66958 4.39E-211 1.23E-207

C14orf37 -1.66237 3.06E-168 4.29E-165

ABHD17AP6 -1.65268 5.93E-09 2.42E-08

XAGE1B -1.61748 0.129343045 0.176182635

APBA1 -1.61732 1.15E-58 7.29E-57

CNTN1 -1.6165 5.83E-128 3.16E-125

CRADD -1.61168 5.50E-45 2.12E-43

TMEM255A -1.59719 5.62E-140 4.50E-137

GRB14 -1.59167 1.12E-13 6.98E-13

C4orf48 -1.58163 6.01E-05 0.000154078

RP11-999E24.3 -1.58109 3.76E-14 2.45E-13

COL8A2 -1.56428 2.80E-08 1.07E-07

AC140542.2 -1.54762 1.19E-26 1.86E-25

TRHDE -1.54531 1.46E-05 4.09E-05

GADL1 -1.53101 1.40E-19 1.33E-18

RP11-81H14.2 -1.5281 1.89E-06 5.91E-06

GALNT14 -1.51147 1.00E-16 7.90E-16

MT1CP -1.5002 5.69E-06 1.68E-05

ISPD -1.48258 9.03E-118 3.30E-115

PUDP -1.47304 4.88E-222 1.64E-218

BOLA3P3 -1.46968 1.37E-05 3.86E-05

SOX5 -1.46778 6.37E-114 2.19E-111

BRK1 -1.45635 1.14E-224 4.80E-221

IL15 -1.45472 9.67E-26 1.43E-24

TCL1A -1.44759 5.73E-42 1.90E-40

CNKSR3 -1.44583 4.39E-34 1.01E-32

GRIA1 -1.44278 7.13E-12 3.83E-11

C9orf135 -1.43166 7.38E-60 4.99E-58

155

WWC2 -1.42661 1.16E-168 1.78E-165

MMGT1 -1.41812 5.56E-159 6.24E-156

ICAM3 -1.41534 3.69E-48 1.66E-46

RP11-153M7.3 -1.41184 1.83E-13 1.13E-12

DMRTA1 -1.40795 2.31E-83 3.35E-81

TMEM200A -1.39497 5.02E-16 3.78E-15

RP11-386G11.10 -1.38617 1.03E-13 6.42E-13

SLC28A3 -1.37918 2.04E-61 1.46E-59

RP11-798K23.5 -1.37861 1.20E-14 8.14E-14

RP11-320A16.1 -1.37102 2.56E-06 7.89E-06

HERC3 -1.36845 1.73E-64 1.41E-62

NECAB1 -1.35042 1.75E-51 8.92E-50

ABHD2 -1.34482 1.42E-136 1.04E-133

PABPC5 -1.34179 3.60E-05 9.51E-05

NPFFR2 -1.33458 1.21E-102 3.12E-100

DPP10-AS1 -1.33298 4.34E-16 3.28E-15

EDIL3 -1.3294 2.29E-10 1.07E-09

MT1DP -1.32765 6.69E-05 0.000170282

CP -1.31878 5.67E-08 2.10E-07

POPDC3 -1.31287 3.12E-17 2.54E-16

RP1-261D10.1 -1.30999 1.51E-14 1.01E-13

NUDT11 -1.30886 1.08E-11 5.71E-11

ALCAM -1.30549 1.23E-119 5.16E-117

EYS -1.30338 4.35E-05 0.000113534

RP11-91I8.3 -1.30263 7.62E-06 2.22E-05

BOLA3 -1.29749 3.26E-103 8.70E-101

FAM26E -1.29504 2.03E-56 1.22E-54

ELOVL7 -1.29436 3.14E-87 5.03E-85

ZCCHC16 -1.29362 9.86E-17 7.76E-16

PPARGC1A -1.29227 2.15E-31 4.25E-30

LINC00189 -1.28741 1.80E-05 4.98E-05

TLL1 -1.28695 8.70E-48 3.84E-46

LINC00504 -1.2867 0.000160566 0.000386503

GBA3 -1.28008 1.15E-41 3.76E-40

GDPD1 -1.27905 2.04E-27 3.33E-26

PCOLCE2 -1.27674 1.96E-59 1.30E-57

156

RAI2 -1.27568 2.46E-51 1.25E-49

PCDH9 -1.2634 1.66E-05 4.63E-05

AC009014.3 -1.24776 1.07E-11 5.66E-11

AC018462.2 -1.24093 4.32E-22 4.99E-21

TUBAP2 -1.2349 4.19E-08 1.57E-07

PLAC1 -1.23403 3.36E-05 8.93E-05

LRRC8B -1.23041 7.28E-46 2.91E-44

WNT2 -1.22812 6.82E-26 1.02E-24

AGA -1.22347 1.97E-35 4.89E-34

AC079135.1 -1.21744 7.08E-05 0.000179487

E2F5 -1.21649 6.57E-103 1.73E-100

IRAK1BP1 -1.21069 1.20E-69 1.15E-67

DCC -1.20664 6.01E-16 4.50E-15

NLRP9 -1.20066 5.86E-21 6.22E-20

PLPP4 -1.19595 1.11E-08 4.42E-08

ANOS1 -1.19074 5.42E-125 2.60E-122

CNTNAP2 -1.18773 3.90E-05 0.000102607

RP11-351I24.3 -1.18349 2.67E-26 4.08E-25

CCDC160 -1.16722 8.58E-08 3.12E-07

GSTA4 -1.16407 2.40E-120 1.03E-117

AC092155.1 -1.16181 3.47E-05 9.21E-05

LMO2 -1.16126 7.92E-61 5.55E-59

TMEM169 -1.16065 3.59E-07 1.22E-06

SLC35D2 -1.15925 1.48E-83 2.17E-81

SLC6A5 -1.15914 8.03E-12 4.29E-11

EGFLAM -1.15604 3.83E-88 6.50E-86

B4GALT1-AS1 -1.15398 1.83E-06 5.75E-06

SMIM14 -1.14812 1.11E-63 8.91E-62

SOX21-AS1 -1.14345 2.00E-19 1.89E-18

STAMBPL1 -1.14124 4.99E-06 1.48E-05

GIPC2 -1.14088 3.12E-31 6.13E-30

AR -1.14061 1.22E-48 5.68E-47

STOM -1.13922 1.50E-174 2.80E-171

CRYL1 -1.13825 1.24E-12 7.12E-12

PDE4B -1.13821 5.59E-16 4.19E-15

GNG2 -1.13596 3.48E-13 2.10E-12

157

RP11-554L12.1 -1.13442 9.40E-07 3.06E-06

FUT9 -1.13268 1.17E-05 3.32E-05

METTL7A -1.13238 3.88E-74 4.27E-72

HACD4 -1.13102 3.98E-35 9.77E-34

SGMS1 -1.12951 3.98E-45 1.54E-43

VAMP3 -1.12143 4.63E-137 3.54E-134

NAV3 -1.11967 4.19E-47 1.77E-45

TBX5 -1.11742 3.48E-08 1.32E-07

MOXD1 -1.11417 5.80E-31 1.13E-29

SFTA1P -1.11406 8.55E-05 0.000214351

PQLC3 -1.10591 1.42E-27 2.33E-26

HAUS1P1 -1.10415 4.22E-05 0.000110393

GPC4 -1.10364 1.29E-67 1.16E-65

GPNMB -1.1017 2.48E-125 1.23E-122

RP11-6N17.4 -1.10067 1.81E-20 1.85E-19

DOCK11P1 -1.09831 1.33E-05 3.76E-05

CDC14C -1.09576 1.21E-17 1.01E-16

PTER -1.08892 3.22E-29 5.81E-28

CTC-431G16.2 -1.0887 0.00029865 0.000691099

SORD2P -1.08851 0.000153843 0.00037165

AC111200.7 -1.08812 8.75E-05 0.000218854

KIF5C -1.08796 1.93E-29 3.50E-28

TMCC2 -1.08641 4.29E-73 4.63E-71

RP11-281H11.1 -1.08627 5.16E-11 2.58E-10

SRD5A2 -1.08587 3.03E-05 8.11E-05

MCF2 -1.08464 7.98E-20 7.74E-19

KLF7 -1.08377 1.92E-112 6.20E-110

GALNT16 -1.08255 4.76E-88 8.00E-86

RPL23AP49 -1.08131 1.53E-07 5.41E-07

FBXO16 -1.08009 3.27E-14 2.15E-13

PCDH7 -1.08009 7.45E-69 6.92E-67

IRX6 -1.07963 2.58E-79 3.34E-77

TMEM245 -1.07505 2.29E-130 1.38E-127

BNC2 -1.07473 1.05E-62 7.91E-61

F2RL2 -1.07204 1.45E-05 4.08E-05

PAK6 -1.06995 3.17E-59 2.07E-57

158

TSPAN12 -1.06948 7.50E-11 3.70E-10

EGFLAM-AS1 -1.0694 0.000391004 0.000887715

RP11-418H16.1 -1.06876 0.000515393 0.001144781

RASSF6 -1.06848 0.000638244 0.00139518

UTF1 -1.06586 0.013610546 0.023442862

VTCN1 -1.06582 1.39E-47 6.08E-46

ITGB8 -1.06425 1.08E-46 4.47E-45

RP11-166A12.1 -1.06187 3.97E-12 2.18E-11

NINJ2 -1.06182 4.84E-11 2.43E-10

HAUS1 -1.05345 3.27E-88 5.61E-86

PRR9 -1.05294 0.00037007 0.00084326

PEX3 -1.05261 7.76E-83 1.12E-80

ZNF511 -1.04987 3.67E-107 1.06E-104

FAM162B -1.04669 9.94E-33 2.13E-31

RP4-791C19.1 -1.04598 0.001856164 0.003751355

SH3BGRL -1.04431 1.89E-24 2.59E-23

NOX4 -1.04001 4.44E-06 1.33E-05

PCYT1A -1.0368 4.46E-91 8.73E-89

QPCT -1.03589 6.57E-60 4.45E-58

RP11-66N11.8 -1.03356 0.000638048 0.001394933

GSTA2 -1.03218 6.45E-54 3.53E-52

ERMN -1.02902 5.12E-32 1.05E-30

ALPK1 -1.0236 0.001364484 0.002818616

SLC44A3 -1.02163 1.26E-24 1.74E-23

PSMA6P2 -1.02102 9.57E-08 3.47E-07

LINC01164 -1.0209 2.16E-07 7.52E-07

BNIP3L -1.02046 2.66E-99 6.38E-97

GTF2E1 -1.02015 1.23E-56 7.51E-55

TRIL -1.01853 1.73E-74 1.96E-72

ZNF385B -1.01722 0.00022656 0.000533376

TSPO -1.01384 0.00399199 0.007630598

KIAA0895 -1.01379 6.81E-44 2.51E-42

GUCA1A -1.01366 1.51E-18 1.35E-17

FBP1 -1.01108 6.88E-13 4.06E-12

ADRA2A -1.00953 1.52E-14 1.02E-13

ART5 -1.00864 3.26E-27 5.23E-26

159

RP5-872K7.8 -1.00654 0.000355249 0.000811356

SCAMP5 -1.00559 8.22E-48 3.64E-46

PDXDC1 -1.00455 9.32E-38 2.59E-36

AREG -1.00207 0.001814691 0.003675044

RP11-26L20.4 -1.00152 4.63E-05 0.000120322

LY75 -1.00055 6.46E-10 2.91E-09

ATP7A -1.00039 2.36E-32 4.94E-31

NSF -1.00038 1.53E-21 1.69E-20

NAA50 -0.99686 7.89E-128 4.15E-125

SOSTDC1 -0.99645 1.24E-125 6.33E-123

GDF3 -0.99568 2.40E-07 8.32E-07

CAPZA2 -0.99421 1.74E-68 1.60E-66

AC098973.2 -0.99267 3.73E-11 1.88E-10

SMKR1 -0.99258 0.001074116 0.002262706

RP11-540O11.1 -0.98952 0.001240296 0.002581417

FAM234B -0.98846 1.13E-87 1.85E-85

RWDD4P1 -0.988 0.000934161 0.001988047

SOX2-OT -0.98734 2.26E-33 5.05E-32

ACADL -0.98727 2.68E-59 1.75E-57

AC109642.1 -0.98483 4.62E-05 0.000120137

ID1 -0.9848 8.42E-22 9.56E-21

TMEM14A -0.98311 7.82E-48 3.47E-46

ADO -0.97664 1.11E-65 9.56E-64

PRSS12 -0.97527 5.91E-57 3.64E-55

RP11-567G11.1 -0.97487 0.000355763 0.00081242

TMEM167B -0.97438 2.13E-65 1.79E-63

VPS35 -0.97374 5.95E-121 2.63E-118

LBH -0.97242 1.09E-147 9.66E-145

RP11-314A20.1 -0.97165 0.000205256 0.000486215

RAB10 -0.97114 8.89E-130 4.99E-127

FECH -0.96987 5.75E-63 4.38E-61

DDX60 -0.96911 7.06E-16 5.26E-15

TGFBI -0.96801 4.22E-75 4.86E-73

HAND1 -0.9679 7.06E-72 7.19E-70

C8orf88 -0.96615 9.66E-15 6.60E-14

CDH10 -0.96542 1.51E-15 1.09E-14

160

GLO1 -0.96472 1.41E-119 5.80E-117

CTD-3035D6.1 -0.96364 1.40E-14 9.45E-14

FBLN5 -0.96338 1.31E-62 9.78E-61

CABYR -0.96039 2.06E-76 2.51E-74

NPM1P25 -0.95892 4.19E-08 1.57E-07

GPC3 -0.95701 1.92E-74 2.16E-72

HKDC1 -0.95251 6.17E-06 1.82E-05

RPSAP14 -0.95195 2.47E-05 6.70E-05

ERO1A -0.94868 7.65E-79 9.75E-77

C19orf12 -0.94758 4.40E-58 2.77E-56

RBP1 -0.94629 1.74E-07 6.13E-07

RP11-304L19.1 -0.94583 1.37E-08 5.41E-08

HOPX -0.94559 2.48E-08 9.54E-08

OR7E156P -0.94532 5.39E-07 1.80E-06

PLB1 -0.94508 4.18E-12 2.30E-11

NPTX2 -0.94452 3.59E-05 9.50E-05

MRVI1 -0.94319 4.41E-101 1.08E-98

LRP12 -0.94242 1.27E-41 4.14E-40

STEAP2 -0.94226 0.000395923 0.000897672

LNX1 -0.94198 1.05E-75 1.26E-73

TMEM19 -0.94074 1.55E-24 2.13E-23

SF3A3P1 -0.93984 4.18E-11 2.11E-10

CETN2 -0.93952 2.57E-84 3.86E-82

NPM1P18 -0.93899 2.35E-08 9.04E-08

HEPH -0.93848 3.81E-23 4.73E-22

ATP8A1 -0.93789 8.64E-66 7.49E-64

PRRT4 -0.93771 0.000467349 0.001045243

CRYBG3 -0.93763 1.17E-09 5.15E-09

GSTA1 -0.93398 0.001702238 0.003461478

GPX7 -0.9308 1.47E-20 1.51E-19

LUZP2 -0.93065 8.84E-29 1.55E-27

LPAR5 -0.92977 2.84E-07 9.80E-07

CH17-472G23.2 -0.92952 0.000172077 0.0004125

LIM2 -0.92825 3.10E-05 8.28E-05

FAM3C -0.92444 2.01E-56 1.22E-54

HHEX -0.92434 1.39E-08 5.48E-08

161

LAPTM4BP2 -0.92005 8.19E-13 4.78E-12

TMEM256 -0.91979 1.19E-17 9.95E-17

BTBD10P1 -0.91931 1.98E-06 6.19E-06

BEX5 -0.91851 0.002716289 0.005354588

C15orf65 -0.91808 0.000218738 0.000515828

RBM24 -0.91741 1.33E-82 1.88E-80

POLR3G -0.91712 1.07E-21 1.21E-20

KIF1BP -0.91672 6.71E-87 1.07E-84

CTD-2292M16.8 -0.9164 0.001173123 0.002451012

FAM3C2 -0.91492 1.89E-53 1.02E-51

COPZ2 -0.91461 0.000310799 0.000716256

DSCR4-IT1 -0.91352 0.003241913 0.00630066

TGM5 -0.91346 7.00E-09 2.83E-08

TUBA1A -0.91097 1.65E-89 2.98E-87

SUMF1 -0.90961 4.70E-48 2.10E-46

ELL2P1 -0.90937 3.11E-11 1.58E-10

TMED5 -0.90689 1.20E-82 1.71E-80

HDDC2 -0.90547 4.33E-72 4.46E-70

IFIT5 -0.90507 3.60E-25 5.14E-24

IL1R1 -0.90374 6.98E-45 2.66E-43

ZNF14 -0.90269 1.40E-42 4.81E-41

RP11-63A11.1 -0.90256 3.56E-29 6.39E-28

PIPOX -0.90242 8.35E-06 2.42E-05

POLR3K -0.90156 3.61E-40 1.11E-38

RPSAP4 -0.90155 5.37E-07 1.80E-06

ZNF429 -0.90056 2.41E-27 3.89E-26

C19orf81 -0.89889 0.012144183 0.021129221

GNG4 -0.89879 7.01E-15 4.84E-14

CTD-2620I22.2 -0.89791 0.001133925 0.002376817

KYNU -0.89644 7.62E-08 2.78E-07

ST8SIA6 -0.8961 1.30E-29 2.38E-28

ASS1 -0.8961 2.72E-45 1.06E-43

ADH5P4 -0.89518 0.000240673 0.000564703

SNAI2 -0.89474 3.57E-20 3.56E-19

UHMK1 -0.89465 4.03E-123 1.88E-120

ZNF252P -0.89462 1.67E-61 1.21E-59

162

RP11-18B3.3 -0.89412 0.001999984 0.004021244

MAP3K13 -0.89406 3.92E-08 1.47E-07

UBL5P2 -0.89266 7.74E-05 0.000195383

F8A3 -0.89116 0.000667475 0.00145454

CCND2-AS1 -0.89056 0.010399225 0.018347531

NPM1P39 -0.89038 1.19E-88 2.09E-86

DBT -0.89037 6.33E-45 2.42E-43

ANXA3 -0.8896 5.66E-95 1.24E-92

LYPLA1P3 -0.88929 5.06E-55 2.88E-53

PLCL1 -0.88915 0.002085803 0.004182796

SERF1A -0.88873 0.001021214 0.00215802

ATP6V0A4 -0.88806 2.50E-26 3.83E-25

CBR3 -0.88802 2.50E-15 1.79E-14

SMIM1 -0.88744 8.58E-05 0.000214984

ZHX2 -0.88716 9.15E-81 1.25E-78

NPM1P6 -0.88699 1.39E-36 3.64E-35

ZNF93 -0.88582 1.02E-50 5.04E-49

COCH -0.88576 1.26E-46 5.17E-45

CCSAP -0.88566 1.38E-90 2.63E-88

CHCHD2P9 -0.88491 0.000261272 0.000609719

GUCY1A3 -0.88429 3.56E-17 2.89E-16

GLRX -0.88426 1.09E-59 7.29E-58

RPS18P12 -0.88403 2.70E-87 4.37E-85

AC012146.7 -0.88341 8.85E-12 4.71E-11

AADACL3 -0.8833 3.29E-14 2.16E-13

RP11-357H14.17 -0.88289 1.07E-10 5.19E-10

DDAH1 -0.88278 2.83E-17 2.31E-16

S100A9 -0.88145 0.005568211 0.010342632

NDUFB8 -0.88067 1.39E-44 5.21E-43

RPS6KA2 -0.88009 1.15E-46 4.71E-45

RPS3AP47 -0.87986 0.001107755 0.002325706

RPSAP19 -0.87817 3.36E-46 1.36E-44

PRICKLE1 -0.87734 9.65E-87 1.52E-84

RPSAP18 -0.87654 6.73E-10 3.02E-09

SORBS2 -0.8755 1.57E-08 6.16E-08

NCEH1 -0.87416 3.94E-55 2.25E-53

163

RP11-748H22.1 -0.8731 0.0006124 0.001342348

PIR -0.87264 5.18E-40 1.58E-38

MLLT3 -0.87036 1.03E-05 2.95E-05

U47924.6 -0.86972 1.37E-27 2.24E-26

MID2 -0.86872 9.79E-19 8.82E-18

HHIP -0.86708 1.38E-15 1.00E-14

FAM134B -0.86558 9.64E-43 3.34E-41

ARCN1 -0.86552 3.43E-111 1.07E-108

LGALS3 -0.8644 2.80E-31 5.50E-30

MUT -0.8637 7.62E-35 1.83E-33

RP11-249L21.4 -0.86353 6.30E-07 2.09E-06

LINC00623 -0.86321 1.16E-11 6.11E-11

SPDYC -0.8613 6.72E-05 0.000170837

EPHX4 -0.86073 1.24E-06 3.97E-06

SRD5A3 -0.86053 6.03E-57 3.70E-55

ITGAV -0.85977 7.49E-35 1.81E-33

RP11-234A1.1 -0.8586 3.00E-112 9.54E-110

PLCD4 -0.85818 2.54E-16 1.94E-15

HDAC9 -0.85811 4.76E-58 2.99E-56

DSTNP2 -0.85743 3.60E-40 1.11E-38

PSPHP1 -0.85698 7.29E-35 1.77E-33

TUBB2A -0.85695 2.79E-72 2.91E-70

RPSAP15 -0.85677 1.78E-63 1.38E-61

LYPD5 -0.85584 1.91E-07 6.68E-07

LAMTOR4 -0.85574 3.42E-43 1.22E-41

PTAR1 -0.85507 1.59E-61 1.15E-59

LACE1 -0.85494 2.15E-28 3.69E-27

DENND2D -0.85212 0.003570837 0.006881881

COX6A1 -0.85161 2.16E-70 2.12E-68

ZNF257 -0.85154 8.39E-31 1.62E-29

SNHG9 -0.85029 1.84E-09 7.92E-09

TRAF3IP2-AS1 0.850431 9.30E-15 6.36E-14

DOCK1 0.85064 2.74E-104 7.82E-102

P2RY11 0.851183 6.64E-15 4.61E-14

CDK3 0.851739 4.17E-06 1.25E-05

DOCK3 0.854588 3.40E-29 6.11E-28

164

TMEM63A 0.854632 3.94E-44 1.46E-42

VILL 0.855349 1.11E-21 1.25E-20

RP11-3D4.3 0.855671 0.00027543 0.000640006

CTC-425O23.2 0.855751 0.000999192 0.00211547

NTAN1P2 0.855945 0.003568276 0.006878208

MMP17 0.856411 5.85E-11 2.91E-10

CTC-304I17.5 0.856931 5.88E-06 1.74E-05

ZNF213-AS1 0.857432 3.53E-09 1.48E-08

PLA2G4C 0.858498 0.004383588 0.008298968

IL23A 0.858517 6.51E-07 2.15E-06

FAM182B 0.859106 0.000211377 0.000499659

RP11-206L10.9 0.859345 3.82E-05 0.000100728

AC010642.1 0.859577 1.50E-06 4.76E-06

SCAMP4 0.859701 3.46E-54 1.91E-52

VIL1 0.859846 0.00058208 0.001281232

LAMB3 0.860496 2.93E-09 1.24E-08

RP11-81A1.6 0.860968 5.41E-16 4.07E-15

TNNT3 0.861392 9.00E-12 4.78E-11

SLC17A7 0.861558 0.000876924 0.001873586

GGT1 0.86164 2.95E-09 1.24E-08

RP11-55K13.1 0.861871 0.00265355 0.005241352

RGMA 0.861927 2.86E-22 3.34E-21

AGAP4 0.862362 4.02E-13 2.41E-12

RP11-1114A5.4 0.862997 7.59E-05 0.000191749

TSPYL2 0.864273 2.26E-42 7.68E-41

TAPT1 0.86432 1.79E-18 1.58E-17

RDH13 0.865304 0.0022454 0.004482539

MT-TM 0.865535 0.001416442 0.002917704

AF011889.5 0.866691 0.001889723 0.003810938

EPM2AIP1 0.867262 1.46E-26 2.26E-25

RP11-504P24.3 0.867551 2.57E-12 1.44E-11

PYGO2 0.867622 1.37E-60 9.53E-59

PP14571 0.867729 4.47E-08 1.67E-07

CACNA1H 0.868845 9.18E-37 2.44E-35

AC005786.7 0.869028 0.001133937 0.002376817

ITLN2 0.869349 8.78E-10 3.90E-09

165

FHOD1 0.8697 3.38E-59 2.19E-57

RP11-561N12.5 0.869964 0.000129639 0.000316282

KLHL17 0.871088 3.81E-32 7.87E-31

ALPPL2 0.871451 1.11E-09 4.90E-09

RP11-115D19.1 0.871792 0.000505964 0.001125918

RGS11 0.87229 1.17E-07 4.17E-07

ERCC5 0.872913 6.63E-15 4.60E-14

IL11 0.872946 1.03E-07 3.72E-07

CD48 0.873389 3.71E-05 9.78E-05

CTC-304I17.6 0.87343 0.000487649 0.001087175

ZNF767P 0.874305 3.83E-18 3.33E-17

RP11-87C12.5 0.874396 0.000452644 0.001014378

UBA7 0.875198 0.004713829 0.008881196

AC024560.3 0.875664 4.22E-27 6.73E-26

NOL4L 0.875683 8.18E-17 6.46E-16

WDR83 0.875787 1.89E-14 1.26E-13

CTD-2619J13.14 0.876227 6.94E-14 4.42E-13

ADGRB2 0.876502 3.10E-06 9.45E-06

RP11-465B22.3 0.876669 0.000119887 0.000294225

AP000892.6 0.876991 0.001019973 0.002155669

KCNMB3 0.877132 2.68E-05 7.22E-05

GPRIN1 0.877146 3.28E-20 3.28E-19

RP11-158H5.7 0.877196 0.000540991 0.001197381

PTOV1-AS1 0.877495 1.34E-06 4.28E-06

TLE2 0.878052 1.57E-21 1.73E-20

AFG3L1P 0.878396 2.29E-48 1.04E-46

RP11-109N23.6 0.87844 0.000657621 0.001433858

C8G 0.878455 0.000323416 0.000744109

CTD-2501M5.1 0.878537 0.003078254 0.006011426

SLC47A1 0.87859 8.75E-09 3.51E-08

AC009404.2 0.878681 2.63E-08 1.01E-07

CLN3 0.878832 1.01E-05 2.90E-05

DTX3 0.878942 2.46E-20 2.50E-19

CATSPER2 0.879655 3.40E-06 1.03E-05

GS1-124K5.11 0.87983 2.20E-19 2.07E-18

RP11-762H8.2 0.880284 1.14E-05 3.24E-05

166

GPT 0.881559 0.001303252 0.002701417

ITGB1BP2 0.881933 1.42E-05 4.00E-05

RP11-274B21.3 0.882283 2.64E-08 1.01E-07

PLXND1 0.882512 3.77E-60 2.57E-58

MTG1 0.882637 2.89E-24 3.88E-23

ATP1B2 0.883634 7.08E-08 2.60E-07

UBE2Q2P1 0.88552 8.62E-06 2.50E-05

RP11-285F7.2 0.885808 1.47E-06 4.67E-06

WASH4P 0.886417 3.06E-05 8.19E-05

CTB-129O4.1 0.886999 7.11E-05 0.000180318

NOXA1 0.887032 4.79E-09 1.97E-08

LINC00115 0.887249 0.000776579 0.001670654

RP5-906A24.1 0.887527 0.007598229 0.013751862

MST1R 0.887713 3.53E-13 2.13E-12

SLC26A6 0.888282 4.89E-57 3.04E-55

AC083843.1 0.888394 2.58E-11 1.32E-10

RP11-214K3.21 0.888585 0.006325317 0.011609182

MCFD2 0.88883 5.33E-119 2.14E-116

MIR4435-2HG 0.888991 8.99E-23 1.08E-21

ITGA2B 0.889693 1.69E-14 1.13E-13

RP11-370I10.12 0.892973 0.000144681 0.000350927

TSPEAR-AS1 0.892997 1.37E-08 5.40E-08

KIF12 0.893282 8.20E-15 5.63E-14

NPB 0.893426 9.96E-05 0.000247082

RTEL1 0.89405 2.43E-07 8.45E-07

ACAP3 0.89471 6.42E-37 1.71E-35

KCNH1 0.895096 0.00230627 0.004595329

SNORD94 0.896905 0.002171875 0.004343492

LA16c-431H6.7 0.897292 0.00171456 0.003485693

PHF24 0.897364 4.33E-34 9.98E-33

SHOX 0.897826 1.21E-12 6.95E-12

IGFBPL1 0.897926 6.71E-30 1.24E-28

SDSL 0.898294 0.001876724 0.003788946

RP11-600F24.7 0.898677 0.000182867 0.000436561

MTND2P28 0.899127 4.07E-22 4.71E-21

CA8 0.900616 7.76E-62 5.67E-60

167

CCDC116 0.902325 6.50E-06 1.91E-05

CACNB1 0.90265 2.64E-08 1.01E-07

ZNF335 0.903441 7.79E-79 9.85E-77

MMP25-AS1 0.905202 6.98E-23 8.48E-22

RP11-216L13.19 0.905798 4.42E-08 1.65E-07

PRR22 0.906605 5.06E-12 2.76E-11

ABCA7 0.906723 1.03E-15 7.60E-15

WASH5P 0.906857 3.94E-13 2.37E-12

GOLGA8A 0.908282 5.39E-18 4.64E-17

RFXAP 0.908532 3.97E-10 1.82E-09

RP11-274B21.13 0.908789 1.69E-05 4.70E-05

ANKRD52 0.909001 1.19E-135 8.36E-133

KIAA0895L 0.909448 2.18E-36 5.66E-35

C9orf172 0.910175 1.16E-07 4.15E-07

GLI1 0.910397 3.54E-14 2.31E-13

USP32P3 0.910603 5.42E-08 2.01E-07

MFSD13A 0.9115 5.84E-29 1.04E-27

EHBP1L1 0.911883 9.74E-27 1.53E-25

AC005682.5 0.912394 2.28E-14 1.51E-13

TSTA3 0.91304 2.48E-06 7.65E-06

POMT1 0.913469 7.84E-43 2.72E-41

ZSCAN4 0.913532 3.04E-14 2.00E-13

SNORD93 0.913783 0.0051602 0.009644414

RP11-196G18.22 0.915025 8.16E-13 4.76E-12

FAM90A27P 0.915418 0.001928132 0.003884669

AGER 0.915783 0.001417062 0.002918624

RP11-439E19.10 0.915827 0.001257549 0.002613769

ZDHHC11 0.916067 2.91E-14 1.91E-13

PAXBP1-AS1 0.917211 0.000779428 0.001676139

RP11-7F17.8 0.917331 0.000160725 0.000386776

GABPB1-AS1 0.917566 1.35E-14 9.10E-14

SNORA5C 0.918433 2.48E-05 6.72E-05

RP11-54O7.1 0.91874 1.21E-05 3.45E-05

TIAF1 0.918989 1.07E-05 3.07E-05

PCSK4 0.919237 1.14E-05 3.25E-05

ZGPAT 0.920158 1.46E-18 1.30E-17

168

GFPT2 0.920302 1.92E-23 2.44E-22

CLUHP3 0.920302 2.15E-38 6.11E-37

CAPS 0.920371 4.06E-15 2.86E-14

NOL12 0.920376 6.18E-10 2.79E-09

FLI1 0.920666 8.48E-10 3.78E-09

RP11-274B21.2 0.921154 1.62E-22 1.92E-21

RP4-794I6.4 0.921444 5.09E-16 3.83E-15

DMPK 0.922119 6.84E-28 1.15E-26

ZNF580 0.924015 1.06E-10 5.12E-10

FOXH1 0.924698 5.88E-14 3.78E-13

ANK2 0.925825 9.73E-91 1.88E-88

FOXA2 0.926265 3.55E-22 4.12E-21

RASSF9 0.926315 3.47E-14 2.26E-13

RP11-77P6.2 0.926838 3.76E-06 1.13E-05

FRMD6-AS1 0.927911 9.73E-06 2.80E-05

AP001062.7 0.928092 3.39E-36 8.73E-35

CARD9 0.928764 8.15E-06 2.37E-05

MYH3 0.929251 2.25E-05 6.13E-05

ABCB6 0.929302 1.29E-13 8.04E-13

PKD1P5 0.930714 0.000394322 0.000894524

MT-TL1 0.930998 1.48E-08 5.81E-08

ZNF276 0.931138 2.41E-32 5.05E-31

TSPEAR-AS2 0.931787 4.13E-08 1.55E-07

RP11-355F16.1 0.932023 0.00024854 0.000582106

KRT15 0.93214 0.001402194 0.002890834

RP11-527J8.1 0.932525 0.003974575 0.0075999

CTD-3220F14.1 0.932619 0.000506792 0.001127314

ANKRD13B 0.933131 7.15E-08 2.62E-07

AC005306.3 0.933502 7.27E-09 2.94E-08

AC025171.1 0.934088 0.001072313 0.002259474

XIST 0.934209 1.06E-21 1.19E-20

AC005329.7 0.93422 1.32E-05 3.74E-05

RP11-723O4.3 0.934394 0.001594059 0.003256458

VGF 0.934797 6.89E-14 4.39E-13

MT-ND4L 0.935084 2.13E-11 1.10E-10

ERV3-1 0.93517 2.09E-18 1.84E-17

169

SCN8A 0.935491 2.37E-84 3.63E-82

DUSP8P5 0.936866 4.96E-06 1.47E-05

TRIM67 0.937422 0.003548846 0.00684185

LINC00632 0.93755 1.02E-09 4.50E-09

RASGRF2 0.939115 1.18E-38 3.39E-37

TSC22D1-AS1 0.939891 0.005568947 0.010342857

CARMIL3 0.940177 2.75E-05 7.40E-05

RP11-242D8.1 0.940911 1.09E-16 8.54E-16

RP11-598D12.4 0.942151 4.01E-06 1.21E-05

TCAP 0.942157 0.000587042 0.001290634

KCNJ14 0.944331 1.27E-05 3.59E-05

MT-CO3 0.94654 7.97E-15 5.48E-14

AOC2 0.946582 5.40E-13 3.21E-12

RP1-80N2.3 0.947718 0.00059504 0.00130668

LINC00621 0.948021 4.42E-06 1.32E-05

LL0XNC01-7P3.1 0.948295 2.13E-08 8.26E-08

CTD-2649C14.2 0.948633 0.00037141 0.00084597

MLLT6 0.948907 5.20E-13 3.09E-12

NME2 0.94897 7.75E-08 2.83E-07

SCNN1D 0.950022 3.95E-07 1.34E-06

CCDC183 0.950041 0.000425886 0.000959398

RP11-332H14.2 0.950068 1.87E-16 1.44E-15

IGSF10 0.950696 0.000567178 0.00125023

BMS1P1 0.950773 1.09E-13 6.79E-13

TGM1 0.952241 1.49E-21 1.66E-20

NPR2 0.952301 3.31E-06 1.01E-05

CYP26B1 0.952499 2.28E-05 6.22E-05

RYR3 0.952804 1.53E-38 4.37E-37

KLK1 0.95292 0.000882533 0.001884852

CALU 0.953408 2.71E-144 2.28E-141

MIR130B 0.954426 1.85E-14 1.23E-13

SEC31B 0.955522 6.06E-14 3.88E-13

EGLN2 0.95628 1.18E-24 1.64E-23

MT-CO1 0.956395 1.13E-13 7.08E-13

SNORD62B 0.956605 1.91E-05 5.28E-05

FBXO43 0.957003 6.76E-05 0.00017184

170

RP11-441O15.3 0.95764 8.72E-06 2.52E-05

CAPN12 0.957718 4.27E-06 1.28E-05

MAPK8IP3 0.957762 1.47E-47 6.39E-46

SMG1P7 0.957887 4.67E-20 4.61E-19

CERS4 0.95847 2.67E-60 1.83E-58

SMPD3 0.95868 0.001836521 0.003714781

AOC3 0.958877 2.50E-11 1.28E-10

RP11-496I9.1 0.959093 6.10E-06 1.80E-05

CTD-2228K2.7 0.960361 1.04E-24 1.45E-23

AIFM3 0.960605 0.000300018 0.000693692

ANTXR1 0.961602 1.52E-25 2.22E-24

RP11-143K11.7 0.963007 0.000242493 0.000568657

PRICKLE4 0.963874 1.73E-26 2.68E-25

CTC-260F20.3 0.964034 4.15E-05 0.000108717

SH3GL1P1 0.964667 0.00042271 0.000952755

CTD-2083E4.4 0.964748 6.48E-05 0.000165449

RP11-677M14.2 0.964951 0.003995643 0.007634978

SV2C 0.965376 3.89E-94 8.29E-92

RP11-181G12.2 0.966422 5.69E-05 0.000146416

RP5-855D21.3 0.967211 2.36E-05 6.41E-05

AC068134.10 0.967634 0.000506207 0.001126162

RP11-631N16.4 0.969093 3.34E-06 1.02E-05

WSB1 0.969496 6.54E-37 1.74E-35

RP11-440L14.1 0.969546 6.43E-08 2.37E-07

IL18BP 0.970149 2.67E-33 5.93E-32

PRR36 0.970801 6.52E-12 3.52E-11

COLEC12 0.971122 6.78E-53 3.58E-51

FOXN3 0.972436 7.35E-123 3.34E-120

MT-ND2 0.972563 3.47E-23 4.34E-22

SRRM2-AS1 0.973935 1.22E-06 3.91E-06

PNKP 0.97488 1.87E-35 4.64E-34

CBSL 0.976365 3.94E-07 1.34E-06

RP11-727A23.5 0.976878 9.20E-10 4.08E-09

HYPK 0.977116 3.04E-07 1.05E-06

GIGYF1 0.977835 1.17E-63 9.30E-62

PLEKHG5 0.978297 1.04E-42 3.59E-41

171

A2M-AS1 0.978494 0.001223252 0.002548784

MTND1P23 0.978987 1.21E-15 8.84E-15

SHC2 0.979139 5.76E-48 2.57E-46

Y_RNA 0.979148 4.73E-13 2.83E-12

ESAM 0.979183 2.08E-19 1.96E-18

TPH1 0.979629 0.002052695 0.004119841

FTLP14 0.979803 1.67E-08 6.52E-08

RTBDN 0.98011 2.57E-06 7.92E-06

SEMA3B 0.980438 0.000244135 0.000572269

MTCO1P12 0.980996 1.19E-05 3.38E-05

RP11-159D12.8 0.981221 1.08E-38 3.11E-37

INHBA 0.981242 1.14E-05 3.24E-05

TNRC6C-AS1 0.98148 0.000349283 0.000798816

RPS20P22 0.981631 3.37E-05 8.96E-05

ITGAM 0.98177 5.38E-12 2.93E-11

TMEM88 0.982329 3.67E-06 1.11E-05

LOXHD1 0.982549 0.000565273 0.001246486

SH3BP5-AS1 0.982692 9.91E-12 5.25E-11

AC006262.6 0.982831 1.26E-10 6.06E-10

ASB16-AS1 0.982851 6.01E-18 5.14E-17

RP11-274B21.14 0.983444 3.57E-09 1.49E-08

MUC19 0.983543 2.48E-17 2.03E-16

CTD-3131K8.2 0.98396 0.002090752 0.00419222

MAN2C1 0.984263 4.45E-21 4.77E-20

TRAF1 0.984423 1.15E-08 4.57E-08

RP11-794G24.1 0.985059 8.50E-09 3.41E-08

RP4-563E14.1 0.985911 5.90E-05 0.000151303

RP11-723J4.3 0.985963 0.002163988 0.004329263

GOLGA8B 0.986131 4.72E-27 7.49E-26

MT-ND4 0.986879 4.12E-13 2.47E-12

FKBP11 0.987351 7.89E-32 1.60E-30

ATP12A 0.987614 4.29E-23 5.31E-22

RP11-801F7.1 0.988568 0.001824255 0.003692189

CAMK1 0.988635 3.39E-05 9.01E-05

C1RL-AS1 0.989169 0.000544492 0.00120401

ISLR2 0.9892 0.00050615 0.001126162

172

MT-CYB 0.989895 7.24E-17 5.74E-16

CLEC4A 0.992265 0.001075944 0.002265989

CTD-2619J13.17 0.99386 6.32E-08 2.33E-07

CTD-2368P22.1 0.994302 7.97E-19 7.23E-18

CELSR3 0.994841 5.98E-46 2.41E-44

LENG8 0.995332 3.29E-31 6.44E-30

CTB-92J24.2 0.99571 9.94E-09 3.97E-08

ANKRD10-IT1 0.996212 2.06E-17 1.70E-16

FLJ16779 0.996706 5.41E-36 1.39E-34

AC079807.2 0.997399 0.000172442 0.000413315

RP1-101A2.1 0.999116 0.001070336 0.00225559

CMB9-55F22.1 0.999159 1.70E-14 1.14E-13

INF2 0.999805 3.47E-37 9.38E-36

PI4KAP2 1.001059 1.70E-38 4.84E-37

HOXC8 1.001165 1.12E-06 3.61E-06

AMER2 1.001632 3.51E-08 1.32E-07

STAG3L1 1.002002 5.78E-08 2.14E-07

PAPLN 1.002199 1.07E-23 1.39E-22

HNF4A 1.003001 0.000272167 0.000633407

PECAM1 1.003534 1.46E-05 4.11E-05

RP11-640N20.4 1.003731 0.001540728 0.003155173

ESPN 1.005353 4.74E-06 1.41E-05

SFI1 1.005488 1.94E-23 2.46E-22

MT-ND1 1.005845 6.67E-18 5.70E-17

ANKRD18CP 1.006424 1.69E-05 4.69E-05

RP11-244B22.10 1.007748 1.70E-16 1.32E-15

MZF1 1.008464 1.85E-35 4.60E-34

LLNLR-304A6.2 1.009337 0.000138888 0.00033785

RP11-802E16.3 1.010229 3.09E-05 8.25E-05

PLXNB1 1.010308 7.98E-92 1.58E-89

GDNF 1.011348 0.000121448 0.000297709

CIRBP 1.011698 1.08E-45 4.29E-44

MTATP6P1 1.011706 4.47E-22 5.15E-21

OSBPL7 1.012427 6.41E-11 3.18E-10

CTD-2196E14.6 1.013007 3.61E-05 9.53E-05

CAPN14 1.013285 6.99E-08 2.57E-07

173

RP11-544I20.2 1.013318 0.000247108 0.000578915

FAM86FP 1.013919 0.000187134 0.000446316

VLDLR-AS1 1.014057 0.000543887 0.001203145

MYLK2 1.014221 3.28E-07 1.13E-06

FOXD2-AS1 1.014228 0.001052864 0.002221275

AC008753.4 1.015812 1.47E-08 5.77E-08

GRM4 1.016264 1.60E-76 1.97E-74

RP11-499P20.2 1.019547 0.000260745 0.000608573

PLEKHD1 1.019827 0.000210792 0.000498486

RP4-591C20.9 1.020388 2.45E-24 3.30E-23

RP11-923I11.8 1.020938 8.46E-09 3.40E-08

NDUFA13 1.020987 2.98E-10 1.38E-09

ANKRD18B 1.021162 5.14E-21 5.47E-20

NSMF 1.021205 5.00E-46 2.02E-44

AP001626.2 1.021801 7.78E-05 0.000196175

ERFE 1.022061 1.36E-12 7.80E-12

GPR78 1.022082 0.002194994 0.004387641

ACSF2 1.022176 2.93E-41 9.46E-40

E2F2 1.022652 3.67E-44 1.36E-42

LTBP3 1.024074 1.03E-33 2.34E-32

RP11-66N24.3 1.024529 1.71E-06 5.39E-06

FAM184A 1.025057 1.24E-71 1.26E-69

CTC-425O23.5 1.025084 3.04E-10 1.41E-09

GFRA2 1.025358 0.001065991 0.002247279

RENBP 1.025928 2.34E-13 1.43E-12

LRRFIP1P1 1.026789 4.75E-10 2.16E-09

C6orf136 1.027018 0.000480374 0.001072378

RP11-87G24.2 1.027252 0.000339525 0.000778404

SKIDA1 1.027836 1.67E-22 1.98E-21

C1S 1.029171 1.32E-31 2.64E-30

CYP4A22-AS1 1.030065 0.000469061 0.001048654

COL27A1 1.030999 1.66E-63 1.30E-61

XXbac-B444P24.13 1.031986 8.79E-10 3.91E-09

AHSA2 1.032022 2.08E-13 1.28E-12

CYP4F25P 1.032643 9.31E-06 2.69E-05

MST1 1.032774 1.05E-13 6.59E-13

174

RP1-59D14.5 1.033532 0.000256369 0.000599025

NPPB 1.034003 1.69E-18 1.50E-17

MSTO2P 1.03419 2.42E-20 2.46E-19

CTD-2017F17.2 1.034482 2.63E-05 7.10E-05

RDH5 1.035866 0.000652928 0.001425055

CTD-2210P24.3 1.036744 1.16E-27 1.91E-26

WFIKKN1 1.038552 5.97E-05 0.000153123

ZBTB7C 1.038753 6.53E-33 1.41E-31

FOXP3 1.041404 0.000434345 0.000976403

ILDR2 1.042565 5.55E-30 1.03E-28

RP11-218C14.8 1.042682 0.000738072 0.001595567

TMEM86B 1.042927 4.27E-12 2.35E-11

SNORA72 1.043087 3.60E-05 9.51E-05

SLC9A5 1.043122 5.24E-06 1.56E-05

TNFRSF25 1.043421 3.19E-24 4.27E-23

ZDHHC11B 1.043597 2.41E-05 6.54E-05

RP11-74C13.4 1.043796 0.00106863 0.002252278

PIDD1 1.044829 4.84E-16 3.65E-15

TPTE2P1 1.044887 0.000169303 0.000406545

RP11-434D12.1 1.044991 0.000243201 0.000570158

ADIRF-AS1 1.045172 2.02E-15 1.46E-14

ARHGAP8 1.046166 1.63E-11 8.52E-11

NGFR 1.050211 7.60E-14 4.82E-13

CAPN10-AS1 1.050545 2.85E-15 2.04E-14

PNISR 1.050742 2.87E-32 5.99E-31

RP4-583P15.10 1.050843 3.07E-06 9.36E-06

DDX3Y 1.051033 1.09E-107 3.23E-105

SNORA3B 1.052958 0.000111126 0.000273844

MYL7 1.053177 1.71E-11 8.91E-11

SNCG 1.053354 5.23E-13 3.11E-12

MLLT4-AS1 1.053702 4.50E-05 0.000116997

LHX4 1.05381 6.45E-14 4.12E-13

NR1D1 1.054502 1.60E-30 3.05E-29

CTB-12O2.1 1.054655 0.00091937 0.001958799

CPLX2 1.05527 0.000520632 0.001155349

AC008982.2 1.05587 6.41E-07 2.12E-06

175

EFNA3 1.05615 6.25E-07 2.07E-06

HAUS7 1.056249 0.000114669 0.000281994

MT-ATP6 1.056372 7.96E-19 7.22E-18

ZNF692 1.057239 6.22E-72 6.38E-70

BRICD5 1.057369 1.39E-24 1.91E-23

PLEKHG2 1.058844 1.71E-113 5.76E-111

TRPV6 1.059106 6.58E-06 1.93E-05

CTD-2373N4.3 1.059272 1.32E-30 2.53E-29

RP3-508I15.21 1.059303 0.000418199 0.000943725

PDE1B 1.059362 1.58E-06 5.00E-06

S100A14 1.05968 6.29E-14 4.02E-13

PCSK7 1.061235 2.30E-90 4.26E-88

BTBD19 1.062097 7.86E-14 4.98E-13

DOK3 1.062148 4.49E-32 9.25E-31

IQGAP2 1.06223 1.26E-31 2.52E-30

IGDCC4 1.062961 2.33E-34 5.45E-33

RP11-209K10.2 1.063249 0.000548116 0.001210908

CRHBP 1.065327 1.64E-24 2.25E-23

TBC1D3L 1.06568 9.64E-05 0.000239671

SYPL2 1.067591 5.84E-12 3.17E-11

LCAT 1.070356 3.80E-77 4.74E-75

DNAJB5 1.070697 7.63E-39 2.22E-37

CHMP4A 1.070698 1.45E-06 4.62E-06

FOXL2NB 1.071174 3.32E-13 2.01E-12

RNF165 1.072312 4.91E-07 1.65E-06

RP11-104N10.2 1.073423 1.52E-14 1.02E-13

YJEFN3 1.073677 8.75E-25 1.22E-23

SNORA5A 1.07412 0.000430296 0.000968426

DDX12P 1.074277 2.79E-68 2.54E-66

RP11-497H17.1 1.074565 0.001478062 0.003035341

AP000347.2 1.075073 2.82E-07 9.72E-07

RP11-268J15.5 1.075528 2.62E-25 3.76E-24

RP6-24A23.8 1.075683 0.002177807 0.004354838

TWIST2 1.076451 0.00017345 0.000415554

CYP4F32P 1.077329 1.74E-13 1.07E-12

NDUFV2 1.079376 2.37E-09 1.01E-08

176

MSH4 1.080386 0.001788719 0.003625503

UBAP1L 1.082218 1.00E-11 5.31E-11

TMEM229A 1.083055 7.00E-28 1.17E-26

RGL3 1.084754 1.03E-14 7.00E-14

RP11-22B23.1 1.084851 2.19E-45 8.66E-44

RP11-360K13.1 1.085684 9.59E-05 0.000238663

WNK4 1.089306 1.88E-20 1.92E-19

RP5-1074L1.4 1.089577 9.84E-11 4.79E-10

LRRC75B 1.090038 2.91E-10 1.35E-09

CEBPB-AS1 1.090745 1.58E-09 6.85E-09

FSTL4 1.091127 6.16E-27 9.73E-26

PHLDA1 1.091335 1.79E-118 6.83E-116

F2 1.092995 7.63E-05 0.000192631

PBX4 1.094562 6.92E-19 6.31E-18

MT-CO2 1.09484 7.02E-21 7.40E-20

LA16c-380H5.5 1.094992 6.40E-12 3.46E-11

BLACAT1 1.096678 1.21E-32 2.58E-31

RP11-294J22.7 1.097304 0.000127151 0.000310692

RPL32P3 1.09737 4.15E-25 5.89E-24

RP11-175P13.3 1.097567 0.000330037 0.000758364

UNC13A 1.097942 6.89E-13 4.06E-12

JMJD7-PLA2G4B 1.098095 1.04E-22 1.25E-21

RP11-392E22.9 1.098201 2.54E-05 6.86E-05

GRID2 1.098858 5.90E-11 2.94E-10

STYK1 1.099154 4.07E-27 6.51E-26

RP5-965G21.3 1.09969 2.91E-14 1.91E-13

COL7A1 1.103316 5.39E-63 4.12E-61

PGPEP1 1.104997 5.97E-40 1.81E-38

CTD-2621I17.3 1.108065 4.01E-05 0.000105161

DNMT3L 1.108257 2.27E-45 8.96E-44

PPP1R3E 1.108512 1.03E-14 7.01E-14

ZNF512B 1.108934 1.52E-103 4.13E-101

NKX2-1 1.109709 2.64E-11 1.35E-10

RP11-10C24.2 1.109794 6.05E-05 0.000155041

RP11-351C21.2 1.111771 0.000177399 0.000424471

TRGV9 1.112011 0.000171579 0.000411365

177

RP11-715J22.6 1.112114 0.00017474 0.000418406

MT-ATP8 1.113781 5.49E-14 3.54E-13

RP11-235E17.6 1.113919 3.59E-06 1.09E-05

LPAL2 1.114079 0.000441817 0.000991833

RP11-158L12.4 1.117283 2.40E-32 5.03E-31

NTS 1.11801 4.11E-40 1.26E-38

KCNC3 1.1193 3.53E-62 2.62E-60

RP11-108L7.4 1.122132 8.90E-05 0.000222545

CLDN15 1.122399 6.97E-19 6.35E-18

RP11-230C9.2 1.12279 1.60E-06 5.05E-06

SNORD14A 1.123224 2.74E-05 7.38E-05

RP13-20L14.10 1.127335 5.77E-09 2.36E-08

COL22A1 1.129869 1.40E-55 8.18E-54

MAF 1.130041 0.000102749 0.000254505

MAPK12 1.130655 1.39E-10 6.67E-10

GDPD3 1.13209 3.09E-17 2.52E-16

AC141928.1 1.132662 2.74E-54 1.53E-52

INE1 1.135098 4.85E-06 1.44E-05

FIGNL2 1.137416 8.40E-14 5.31E-13

KRTCAP2 1.138008 7.97E-26 1.18E-24

MIR222HG 1.139674 2.49E-23 3.13E-22

CDK11A 1.139965 3.96E-15 2.80E-14

RP5-908M14.10 1.140079 1.33E-08 5.24E-08

RP11-468E2.4 1.140836 1.97E-07 6.90E-07

CSF1 1.141588 2.70E-23 3.38E-22

MUC3A 1.142516 1.82E-15 1.31E-14

NDST2 1.14292 5.07E-05 0.000131149

RP11-685N10.1 1.147019 5.55E-11 2.77E-10

TAPBPL 1.147127 3.40E-06 1.03E-05

FAM65C 1.147195 1.56E-05 4.36E-05

RP5-1180D12.1 1.147544 1.87E-05 5.17E-05

DNMT3B 1.147568 4.57E-175 9.62E-172

RP11-568K15.1 1.150487 2.77E-30 5.21E-29

SCARNA15 1.152264 7.88E-13 4.60E-12

RP11-7F18.2 1.152357 1.46E-09 6.36E-09

MRPL38 1.152596 2.22E-22 2.60E-21

178

MIR17HG 1.152605 3.81E-18 3.31E-17

PRR5-ARHGAP8 1.153578 4.98E-05 0.000128926

CLCNKA 1.156274 0.000705146 0.001530683

GS1-279B7.2 1.156517 0.000340335 0.000779836

KLRA1P 1.15783 2.60E-26 3.97E-25

RP11-1334A24.5 1.157861 2.40E-07 8.34E-07

MICALL2 1.159001 2.12E-27 3.44E-26

LINC01163 1.159641 3.92E-05 0.00010315

RP11-767N6.2 1.160349 0.000420208 0.000947504

KCNIP2 1.161619 5.41E-09 2.22E-08

IGFL4 1.162134 0.000334234 0.00076711

LAG3 1.162369 5.28E-15 3.70E-14

RP11-574K11.29 1.162431 1.79E-08 6.95E-08

LINC00265 1.163165 2.08E-43 7.48E-42

PTCHD1 1.164078 7.26E-36 1.85E-34

ZSCAN12P1 1.165843 5.61E-05 0.000144387

CHKB-CPT1B 1.166138 1.85E-05 5.12E-05

CTD-2517M22.14 1.166318 6.48E-09 2.63E-08

RP1-131F15.3 1.166719 7.79E-14 4.94E-13

CH507-528H12.1 1.16748 8.84E-17 6.98E-16

MBL1P 1.167552 1.07E-07 3.84E-07

CNDP1 1.168334 0.000143767 0.000348912

RP11-80H8.4 1.170627 1.76E-09 7.58E-09

CHST1 1.170967 6.12E-09 2.49E-08

PDIA2 1.172055 1.67E-25 2.44E-24

PKD1P6 1.172448 2.15E-08 8.32E-08

HNRNPA1P16 1.172669 1.17E-06 3.78E-06

STAG3L5P 1.173238 4.05E-24 5.38E-23

CCDC154 1.173797 0.001203169 0.002509735

DDX47 1.174242 1.65E-09 7.15E-09

OCLM 1.175927 1.42E-05 4.00E-05

AQP3 1.180937 8.92E-63 6.76E-61

RFPL4B 1.181209 1.98E-08 7.69E-08

LGALS9 1.181816 1.42E-06 4.54E-06

KIAA1024 1.182548 4.57E-13 2.74E-12

SEMA6D 1.182855 2.14E-37 5.84E-36

179

ANKRD20A4 1.183263 0.000176467 0.00042236

NALT1 1.183387 4.01E-05 0.000105357

RP11-797A18.6 1.183414 4.72E-05 0.000122506

SULT1A1 1.183695 1.34E-44 5.01E-43

RP3-368A4.6 1.184637 1.45E-19 1.38E-18

EXOC3L1 1.186929 2.03E-05 5.58E-05

ATG9B 1.188175 4.59E-21 4.92E-20

SNX15 1.188528 2.88E-07 9.93E-07

PI4KAP1 1.191123 1.26E-53 6.82E-52

GPR135 1.193712 2.75E-05 7.38E-05

LYNX1 1.19469 1.25E-59 8.33E-58

LINC00893 1.195635 3.64E-06 1.10E-05

NCF2 1.197083 0.000314757 0.000724981

RNF207 1.198481 4.28E-19 3.97E-18

MFI2-AS1 1.200183 3.58E-11 1.81E-10

VLDLR 1.201828 1.54E-79 2.01E-77

ADAMTS13 1.201848 3.32E-12 1.85E-11

TBX6 1.203177 4.41E-07 1.49E-06

RP11-218F10.3 1.203581 4.49E-05 0.000116997

RP11-244O19.1 1.205261 7.94E-09 3.20E-08

HYAL1 1.205598 1.29E-09 5.66E-09

AGAP12P 1.207017 4.04E-07 1.37E-06

CHD5 1.207601 5.16E-11 2.58E-10

RP11-1277A3.2 1.208411 2.23E-09 9.53E-09

DFFBP1 1.208591 3.89E-05 0.000102419

C9orf47 1.208862 1.58E-10 7.53E-10

U2AF1 1.208866 9.34E-19 8.42E-18

CTD-3222D19.8 1.209164 8.55E-12 4.56E-11

SEMA6B 1.20953 4.23E-15 2.97E-14

AGAP6 1.209701 2.44E-49 1.18E-47

CTD-2013N17.6 1.209819 6.84E-12 3.69E-11

LL22NC03-2H8.5 1.210619 1.21E-15 8.86E-15

PKDCC 1.210935 1.30E-79 1.71E-77

NKX3-1 1.211238 1.86E-10 8.81E-10

SULT4A1 1.211915 1.75E-22 2.07E-21

AC068134.6 1.21231 8.97E-07 2.93E-06

180

RDH12 1.212869 0.000127873 0.000312276

PPP1R1B 1.213712 2.62E-14 1.72E-13

RP11-21K12.2 1.216103 6.75E-13 3.98E-12

RP11-180C16.1 1.217008 2.03E-10 9.58E-10

EME2 1.217268 6.92E-50 3.38E-48

BBS1 1.217501 2.30E-09 9.81E-09

RP11-274B21.4 1.218293 4.68E-21 5.00E-20

ZGLP1 1.222418 7.09E-06 2.08E-05

RP11-649A18.4 1.223513 8.87E-08 3.22E-07

MIR92B 1.224444 9.73E-20 9.40E-19

MYL5 1.225122 9.99E-18 8.44E-17

CYP46A1 1.226185 2.08E-05 5.72E-05

HRH2 1.226432 1.84E-07 6.47E-07

SLC22A31 1.229375 7.94E-09 3.20E-08

PRSS53 1.229467 1.87E-15 1.35E-14

FAM83E 1.229691 2.56E-06 7.88E-06

SNORD19 1.229793 4.55E-06 1.36E-05

PCF11-AS1 1.230648 1.96E-06 6.13E-06

LINC01108 1.231432 1.76E-06 5.54E-06

RP11-631N16.2 1.23188 4.81E-11 2.41E-10

RNF24 1.233327 7.67E-165 9.21E-162

RP11-305E6.4 1.234497 0.000332909 0.00076456

VSTM2A 1.235295 2.68E-05 7.22E-05

LINC01089 1.237329 4.33E-48 1.94E-46

SBK2 1.238309 2.53E-10 1.18E-09

LIME1 1.241962 1.10E-26 1.72E-25

GRB7 1.242604 9.06E-102 2.24E-99

RP5-855D21.2 1.24273 0.000144389 0.000350321

VAMP1 1.24292 8.72E-62 6.35E-60

RP11-649A18.5 1.243327 2.42E-05 6.57E-05

GABBR1 1.243365 8.01E-12 4.29E-11

SNORD63 1.243855 3.32E-11 1.69E-10

RP5-1142A6.10 1.243863 1.36E-07 4.84E-07

SLC25A25-AS1 1.245177 1.25E-36 3.29E-35

LINC00894 1.245532 7.86E-09 3.17E-08

RP11-334C17.5 1.246221 5.30E-24 6.99E-23

181

RP11-355O1.11 1.247696 1.43E-09 6.25E-09

DPF1 1.247725 6.13E-19 5.62E-18

CCDC183-AS1 1.24989 1.27E-13 7.92E-13

MAPK11 1.250729 2.15E-06 6.68E-06

RN7SL381P 1.251308 5.26E-05 0.000135977

CCND3 1.254492 3.03E-93 6.37E-91

MYO15B 1.254959 9.83E-35 2.35E-33

RP11-154J22.1 1.255147 0.000220084 0.000518927

HMCN2 1.256425 4.75E-07 1.60E-06

RP11-338N10.3 1.257627 1.06E-06 3.44E-06

PCBP3-OT1 1.25805 4.10E-06 1.23E-05

CCDC88B 1.258442 5.60E-12 3.04E-11

ATG16L2 1.259792 3.65E-19 3.39E-18

RAD51-AS1 1.260381 1.62E-21 1.79E-20

DIO3OS 1.260802 7.08E-22 8.07E-21

EBLN2 1.261179 5.42E-11 2.71E-10

RP11-1020A11.1 1.262887 3.92E-05 0.00010315

BMS1P4 1.26289 6.55E-11 3.25E-10

RAPGEFL1 1.263191 4.14E-21 4.45E-20

RP11-345P4.10 1.264344 6.36E-05 0.000162294

TNNT2 1.26543 6.73E-16 5.02E-15

RP11-338K17.6 1.271008 1.70E-06 5.36E-06

TAS1R3 1.271726 3.01E-05 8.05E-05

RP4-561L24.3 1.275606 9.83E-05 0.000244122

RP11-20I23.2 1.276154 1.18E-12 6.77E-12

AC074212.5 1.276289 7.63E-07 2.51E-06

RP3-467L1.6 1.277013 2.50E-07 8.67E-07

Mar-11 1.277163 1.11E-06 3.59E-06

CTC-479C5.12 1.277625 5.14E-13 3.06E-12

DLG4 1.281467 8.95E-22 1.01E-20

CEACAM1 1.281903 4.95E-39 1.45E-37

NOX5 1.282219 2.49E-05 6.74E-05

AC068580.5 1.287334 1.56E-05 4.35E-05

AGAP7P 1.288978 6.34E-09 2.58E-08

KB-1440D3.13 1.289018 6.46E-07 2.14E-06

MIR940 1.289757 4.80E-08 1.79E-07

182

RP5-864K19.4 1.291755 8.00E-06 2.33E-05

CTD-2311M21.3 1.293505 2.42E-08 9.30E-08

SNORD12B 1.29366 1.31E-07 4.66E-07

RP11-260M2.1 1.294576 1.05E-05 3.02E-05

RP11-37C7.3 1.297417 0.001649928 0.003359981

WDR97 1.297619 7.95E-10 3.55E-09

PCOLCE 1.297647 1.01E-14 6.88E-14

IRF9 1.301263 1.01E-15 7.45E-15

CTD-2547G23.4 1.30133 3.82E-14 2.48E-13

TPPP 1.30136 2.04E-29 3.71E-28

RBM14-RBM4 1.304345 1.07E-09 4.73E-09

RP11-388C12.8 1.306168 4.86E-09 2.00E-08

DLEC1 1.308153 2.10E-30 3.96E-29

NFYC-AS1 1.308729 2.27E-11 1.17E-10

SSPO 1.308868 1.19E-13 7.43E-13

TEN1-CDK3 1.309414 9.85E-15 6.72E-14

RUNX2 1.311778 2.73E-07 9.42E-07

FAM159B 1.314061 1.47E-17 1.23E-16

ATHL1 1.315296 9.51E-51 4.73E-49

SYT6 1.317081 8.16E-22 9.28E-21

IGSF22 1.317599 3.52E-18 3.07E-17

AC144831.1 1.320297 3.58E-07 1.22E-06

RP11-472I20.4 1.324217 7.27E-13 4.28E-12

RP11-44M6.7 1.325372 3.09E-06 9.43E-06

RP5-882C2.2 1.326205 1.43E-09 6.22E-09

IFITM2 1.326596 8.73E-06 2.53E-05

GET4 1.327379 5.67E-76 6.86E-74

GRIK5 1.327555 4.31E-08 1.61E-07

PRRT2 1.329659 5.97E-14 3.83E-13

LINC00923 1.332434 2.27E-05 6.20E-05

RP11-504P24.9 1.332554 8.01E-06 2.33E-05

XKR4 1.333357 1.34E-06 4.27E-06

ST8SIA5 1.333598 2.40E-14 1.59E-13

HPGD 1.334379 3.74E-157 3.70E-154

NFATC4 1.335238 4.09E-30 7.62E-29

RP11-629O1.2 1.339071 8.64E-05 0.000216513

183

PSG6 1.339173 0.000200439 0.000475944

RP5-1139B12.2 1.342796 4.18E-07 1.41E-06

SCN1B 1.343596 1.20E-14 8.14E-14

SNORD4A 1.344316 7.56E-06 2.21E-05

LOX 1.34622 7.49E-16 5.57E-15

RP4-583P15.15 1.349 2.51E-11 1.29E-10

RP5-984P4.6 1.350565 1.46E-10 6.99E-10

CTD-2020K17.1 1.350857 1.21E-10 5.85E-10

LINC00937 1.352312 1.15E-20 1.19E-19

COL5A1 1.353352 8.08E-174 1.36E-170

SNHG4 1.354085 2.55E-15 1.83E-14

LINC00599 1.354477 3.61E-49 1.73E-47

AARSD1 1.354908 7.05E-14 4.48E-13

N4BP2L2-IT2 1.357403 2.60E-06 7.98E-06

EIF4A1 1.359047 1.36E-32 2.88E-31

SNORA71B 1.360357 1.02E-07 3.67E-07

ANK1 1.360358 3.19E-33 7.05E-32

CTD-2002H8.2 1.361983 4.11E-06 1.23E-05

CASC10 1.36396 7.36E-23 8.94E-22

YY2 1.364287 8.90E-07 2.91E-06

RP11-425M5.7 1.36462 3.74E-16 2.84E-15

ZFHX2 1.364832 6.34E-45 2.42E-43

RASSF10 1.365343 1.74E-07 6.11E-07

MFAP5 1.365808 8.63E-134 5.58E-131

C9orf173-AS1 1.368083 3.82E-05 0.000100571

RP11-196G11.4 1.37005 6.49E-06 1.91E-05

LA16c-380H5.3 1.371074 8.99E-08 3.26E-07

PIF1 1.371771 4.16E-72 4.32E-70

CH507-513H4.1 1.372982 1.52E-25 2.22E-24

MOBP 1.373583 3.75E-07 1.28E-06

NEURL1 1.374066 3.04E-82 4.26E-80

RP11-523H20.3 1.374302 1.18E-05 3.35E-05

CR1L 1.376472 1.58E-14 1.06E-13

ALKBH6 1.37773 8.49E-33 1.82E-31

MIR25 1.377786 2.52E-14 1.66E-13

RP11-972P1.11 1.386199 1.24E-07 4.42E-07

184

GABRE 1.388397 2.13E-20 2.17E-19

RP11-286N22.16 1.389037 3.84E-07 1.30E-06

CTD-2562G15.3 1.389771 9.46E-07 3.08E-06

CNKSR2 1.390756 1.09E-12 6.30E-12

MPZ 1.391955 8.53E-19 7.70E-18

ENPP7P8 1.39313 1.13E-05 3.22E-05

RP11-336K24.12 1.393633 1.11E-07 3.98E-07

HRAT92 1.394806 9.76E-13 5.66E-12

PILRB 1.395177 2.21E-25 3.19E-24

KREMEN2 1.398437 7.63E-17 6.04E-16

RP13-941N14.1 1.398737 1.25E-05 3.54E-05

SLC4A4 1.400224 3.49E-25 4.99E-24

SNORD6 1.402253 4.22E-08 1.58E-07

ADAMTS8 1.402456 9.82E-33 2.10E-31

ZNF488 1.402746 2.12E-43 7.63E-42

HDAC10 1.405212 5.62E-10 2.54E-09

LINC01021 1.409036 4.38E-09 1.81E-08

PCBP2-OT1 1.410983 1.46E-05 4.10E-05

SCART1 1.412312 1.04E-06 3.37E-06

SNORA71C 1.412995 1.70E-06 5.36E-06

ZNF467 1.413126 7.05E-47 2.94E-45

LEAP2 1.413296 1.05E-07 3.77E-07

CTD-2574D22.3 1.414949 4.09E-07 1.38E-06

RP11-505K9.4 1.415205 1.78E-05 4.93E-05

CTC-479C5.10 1.422977 7.03E-11 3.48E-10

FLJ35934 1.424269 1.36E-10 6.51E-10

GPR4 1.425107 3.04E-10 1.41E-09

STAM-AS1 1.425374 1.00E-08 3.99E-08

AF011889.2 1.428341 2.34E-05 6.37E-05

ZNF469 1.431621 1.51E-07 5.35E-07

RP11-481J2.4 1.433059 7.02E-07 2.31E-06

AIRE 1.433764 1.57E-14 1.05E-13

RASGRP2 1.436087 4.75E-41 1.52E-39

PDE8B 1.437539 1.43E-12 8.20E-12

PAQR6 1.438447 7.21E-46 2.89E-44

RP11-261P9.4 1.43885 1.08E-07 3.90E-07

185

GGT5 1.440812 5.34E-09 2.19E-08

ANKLE1 1.440877 6.63E-07 2.19E-06

GPS2 1.441075 2.13E-11 1.10E-10

SLC7A3 1.442529 1.78E-69 1.69E-67

ARL6IP4 1.445108 1.04E-11 5.51E-11

PRKCG 1.445185 1.81E-09 7.80E-09

MALAT1 1.448287 3.70E-60 2.53E-58

COL1A1 1.449049 2.20E-78 2.76E-76

LINC01176 1.450385 1.95E-10 9.20E-10

PHF21B 1.453682 2.60E-52 1.35E-50

PNPLA7 1.453927 2.94E-09 1.24E-08

ACHE 1.455802 1.80E-29 3.29E-28

DDX39B 1.457102 1.79E-30 3.40E-29

RP11-43N16.4 1.45965 3.30E-12 1.84E-11

TNS2 1.459918 9.61E-27 1.51E-25

MYO1G 1.461724 2.96E-13 1.80E-12

MIR24-2 1.466394 1.15E-15 8.43E-15

RP11-109L13.1 1.470752 8.97E-07 2.93E-06

FAM95B1 1.471734 3.92E-28 6.66E-27

ZMYND10 1.476701 4.84E-47 2.04E-45

PEAR1 1.476704 4.25E-12 2.34E-11

RAPGEF3 1.481461 7.01E-14 4.46E-13

RP5-1092A3.4 1.487839 3.90E-09 1.62E-08

CTD-2622I13.3 1.4899 8.41E-10 3.74E-09

RNA5SP82 1.495211 1.68E-06 5.29E-06

LTB4R 1.499276 2.66E-32 5.56E-31

SOX11 1.50325 1.83E-18 1.62E-17

TTLL3 1.504146 1.66E-19 1.57E-18

MIR34A 1.511344 2.27E-47 9.78E-46

CD99L2 1.51145 1.86E-158 1.96E-155

RP3-461F17.3 1.511992 3.80E-07 1.29E-06

RP11-331F4.5 1.514305 8.45E-16 6.27E-15

ECEL1P1 1.515074 1.03E-65 8.88E-64

SPACA6 1.515924 5.79E-59 3.71E-57

SLFNL1-AS1 1.51886 2.76E-21 3.01E-20

BTNL9 1.522358 4.50E-24 5.95E-23

186

CTA-228A9.3 1.523081 4.36E-14 2.82E-13

RP11-390K5.6 1.52318 3.18E-09 1.34E-08

C2orf48 1.525961 3.38E-13 2.04E-12

CHKB 1.526204 8.58E-16 6.36E-15

PTOV1-AS2 1.527064 1.22E-31 2.45E-30

RP11-264B17.3 1.527161 3.53E-07 1.21E-06

AMH 1.527182 1.78E-20 1.82E-19

RP5-890O3.9 1.531453 8.16E-15 5.61E-14

ASMTL-AS1 1.53843 8.75E-37 2.32E-35

MIR647 1.538546 8.21E-09 3.30E-08

MIR1254-1 1.538896 1.14E-08 4.52E-08

MIR302D 1.539628 7.42E-08 2.71E-07

RP11-124N19.4 1.542254 1.74E-11 9.06E-11

ADAMTSL5 1.546443 3.62E-26 5.48E-25

ALS2CL 1.547573 9.32E-28 1.54E-26

AC008088.4 1.548107 5.59E-07 1.86E-06

NTN1 1.552738 6.16E-104 1.70E-101

LINC00106 1.558089 8.49E-23 1.03E-21

LTB4R2 1.565822 5.23E-29 9.33E-28

LINC00482 1.566123 1.06E-06 3.42E-06

MMRN2 1.569243 2.84E-08 1.08E-07

RP11-46H11.11 1.570592 7.60E-07 2.50E-06

NEAT1 1.572664 5.71E-42 1.90E-40

SLC16A9 1.579745 6.87E-80 9.11E-78

LRTM2 1.583263 2.50E-07 8.66E-07

NPTN-IT1 1.585112 1.01E-15 7.43E-15

ASPG 1.592914 7.47E-07 2.45E-06

SOX1 1.59657 1.71E-06 5.39E-06

HERC2P2 1.600492 2.85E-113 9.41E-111

RP11-2B6.2 1.601046 1.28E-21 1.43E-20

AP000662.4 1.603998 1.95E-25 2.83E-24

TRIM17 1.604008 2.69E-40 8.43E-39

MIAT 1.604203 8.97E-09 3.59E-08

AC012531.25 1.605541 2.71E-09 1.15E-08

SLC5A5 1.605808 1.59E-25 2.31E-24

CTD-2537I9.13 1.613477 1.24E-07 4.43E-07

187

RAB17 1.618121 9.01E-41 2.87E-39

UNC13C 1.628072 1.21E-23 1.56E-22

HS3ST4 1.628313 8.48E-22 9.62E-21

RP11-57H14.2 1.631075 7.23E-07 2.38E-06

RP11-486O12.2 1.637855 8.17E-21 8.57E-20

CTA-204B4.2 1.639679 1.38E-17 1.15E-16

LINC01123 1.642691 2.73E-13 1.66E-12

KRT16P3 1.646757 7.68E-42 2.54E-40

SPATA25 1.656778 3.42E-09 1.43E-08

CNN1 1.658676 5.86E-33 1.26E-31

ADGRA2 1.661014 6.32E-25 8.90E-24

RPL36A 1.66152 1.38E-15 1.01E-14

APLN 1.67198 1.88E-13 1.15E-12

HRH3 1.675159 2.16E-13 1.33E-12

AC007191.4 1.680568 2.33E-18 2.06E-17

RP11-363N22.3 1.685289 5.07E-14 3.27E-13

PHKG1 1.696466 8.94E-21 9.37E-20

C1orf220 1.699461 1.29E-09 5.64E-09

PDGFRB 1.699516 2.30E-37 6.28E-36

HAGHL 1.702406 3.60E-07 1.23E-06

CACNG8 1.705226 5.56E-22 6.37E-21

FAM150B 1.718792 1.15E-20 1.19E-19

RP11-573D15.2 1.731553 3.98E-08 1.50E-07

IRF4 1.732557 6.90E-62 5.07E-60

MIR367 1.732838 1.07E-19 1.03E-18

EXTL3-AS1 1.745384 1.91E-13 1.18E-12

CBLN3 1.754101 7.86E-07 2.58E-06

AMT 1.757381 5.65E-08 2.10E-07

RP13-15M17.1 1.763209 4.65E-07 1.56E-06

MAMDC4 1.767126 2.93E-25 4.20E-24

GOLGA7B 1.773905 4.65E-10 2.12E-09

RP5-901A4.1 1.774773 1.33E-08 5.25E-08

SPNS1 1.778644 6.79E-16 5.06E-15

RP11-417L19.5 1.779331 2.43E-13 1.49E-12

ABCC8 1.786897 4.23E-09 1.75E-08

PABPC1L 1.789021 1.07E-37 2.96E-36

188

ENO1-IT1 1.797191 1.40E-08 5.50E-08

CPT1B 1.810708 1.83E-14 1.22E-13

GAD1 1.814875 9.06E-09 3.63E-08

ADAMTS10 1.815357 2.74E-10 1.28E-09

RP13-1032I1.11 1.821143 1.25E-08 4.93E-08

RP11-94C24.13 1.82148 1.61E-24 2.20E-23

HYAL4 1.835842 5.22E-15 3.66E-14

C1orf61 1.83863 6.95E-119 2.72E-116

KRT16P1 1.843755 4.80E-43 1.69E-41

RP13-492C18.2 1.850532 1.65E-12 9.37E-12

NPIPA1 1.852644 4.72E-07 1.59E-06

RP11-507K2.6 1.852715 4.54E-07 1.53E-06

GCKR 1.857791 1.32E-16 1.03E-15

RP11-85I17.2 1.862524 1.90E-11 9.87E-11

COL5A3 1.86568 1.52E-23 1.95E-22

TMEM215 1.873947 1.91E-09 8.19E-09

SLC26A10 1.880968 4.42E-11 2.22E-10

ANKRD20A2 1.884896 1.30E-08 5.12E-08

MIR296 1.886073 2.53E-08 9.72E-08

COL25A1 1.891949 2.36E-41 7.65E-40

LIN28A 1.905114 0 0

MIR205HG 1.914738 8.91E-49 4.16E-47

ADAMTS14 1.920369 1.87E-09 8.06E-09

PLK5 1.920468 1.40E-07 4.97E-07

SHH 1.920698 6.24E-09 2.54E-08

GPR173 1.95005 6.90E-08 2.54E-07

RP11-416N2.4 1.963149 2.73E-40 8.53E-39

AC007038.7 1.975421 3.71E-09 1.55E-08

RP11-834C11.15 1.985235 3.19E-08 1.21E-07

RP11-122G18.11 1.993411 1.24E-08 4.90E-08

RP11-54O7.17 2.002374 2.68E-18 2.35E-17

LINC00173 2.015644 4.47E-09 1.85E-08

NAT16 2.023509 2.92E-10 1.36E-09

C11orf16 2.069674 1.08E-09 4.77E-09

RP11-10J21.4 2.097113 7.38E-09 2.98E-08

KRT16P2 2.130607 2.13E-24 2.89E-23

189

GRM2 2.138299 2.83E-192 6.80E-189

BDNF 2.229294 5.48E-80 7.31E-78

TMEM151B 2.256017 3.16E-09 1.33E-08

OTOF 2.317653 3.79E-75 4.39E-73

FAM110C 2.335057 2.15E-97 5.02E-95

CTD-3216D2.5 2.347629 7.89E-20 7.66E-19

RTEL1-TNFRSF6B 2.38655 1.25E-59 8.33E-58

IBA57-AS1 2.401563 2.09E-09 8.92E-09

RP11-74E22.8 2.451404 1.29E-10 6.19E-10

BCRP3 3.082205 1.42E-40 4.47E-39

AC108463.2 3.34462 6.44E-23 7.85E-22

CTD-2311M21.2 3.817022 1.17E-88 2.08E-86

Appendix A3: List of genes which differentially spliced after silencing of ESRP1

GeneID Chr Symbol NExons P.Value FDR 57669 chr2 EPB41L5 26 1.09E-58 1.09E-54 100528016 chr11 NA 20 9.27E-42 4.62E-38 1500 chr11 CTNND1 19 1.29E-40 4.30E-37 9826 chr1 ARHGEF11 41 2.41E-36 6.02E-33 6709 chr9 SPTAN1 56 5.88E-29 1.17E-25 8727 chr9 CTNNAL1 20 1.80E-28 2.99E-25 8615 chr4 USO1 25 6.07E-27 8.65E-24 25953 chr2 PNKD 12 3.99E-25 4.98E-22 7168 chr15 TPM1 14 8.66E-25 9.60E-22 6434 chr3 TRA2B 11 7.20E-24 7.18E-21 6894 chr1 TARBP1 30 2.87E-23 2.61E-20 29959 chr2 NRBP1 19 3.87E-22 3.22E-19 824 chr1 CAPN2 22 1.85E-21 1.42E-18 2035 chr1 EPB41 17 2.13E-21 1.52E-18 9618 chr17 TRAF4 8 1.25E-20 8.32E-18

190

2130 chr22 EWSR1 18 2.18E-20 1.36E-17 56243 chr10 KIAA1217 17 3.42E-20 2.01E-17 4666 chr12 NACA 8 1.09E-19 6.04E-17 23265 chr17 EXOC7 21 1.39E-19 7.27E-17 11079 chr1 RER1 9 1.95E-18 9.74E-16 10897 chr11 YIF1A 8 3.14E-18 1.49E-15 23259 chr8 DDHD2 20 1.22E-17 5.51E-15 2222 chr8 FDFT1 10 1.57E-17 6.60E-15 55103 chr1 RALGPS2 19 1.59E-17 6.60E-15 100996928 chr7 C7orf55-LUC7L2 11 1.82E-17 7.24E-15 23334 chr1 SZT2 34 2.05E-17 7.87E-15 10299 chr5 MARCH6 27 1.21E-16 4.48E-14 57556 chr5 SEMA6A 21 1.90E-16 6.77E-14 2263 chr10 FGFR2 19 4.68E-16 1.61E-13 3275 chr21 PRMT2 12 1.60E-15 5.32E-13

26091 chr10 HERC4 26 1.94E-15 6.23E-13 56924 chr15 PAK6 10 2.51E-15 7.83E-13 9748 chr10 SLK 19 2.62E-15 7.93E-13 9761 chr12 MLEC 6 3.59E-15 1.05E-12 4048 chr12 LTA4H 20 5.22E-15 1.49E-12 3655 chr2 ITGA6 26 5.49E-15 1.52E-12 3836 chr3 KPNA1 15 6.18E-15 1.64E-12 6301 chr1 SARS 12 6.28E-15 1.64E-12 55095 chr19 SAMD4B 15 6.56E-15 1.64E-12 3479 chr12 IGF1 5 6.57E-15 1.64E-12 5879 chr7 RAC1 6 1.34E-14 3.27E-12 55959 chr20 SULF2 20 1.96E-14 4.67E-12 334 chr11 APLP2 18 2.32E-14 5.39E-12 6432 chr2 SRSF7 9 2.92E-14 6.62E-12 100526740 chr7 ATP5J2-PTCD1 9 3.48E-14 7.72E-12 159091 chrX FAM122C 9 3.62E-14 7.86E-12 85440 chr1 DOCK7 48 3.73E-14 7.91E-12 1915 chr6 EEF1A1 8 3.96E-14 8.23E-12 2017 chr11 CTTN 19 4.56E-14 9.29E-12 51535 chr12 PPHLN1 14 5.00E-14 9.98E-12 3191 chr19 HNRNPL 15 7.05E-14 1.38E-11 9589 chr6 WTAP 10 2.00E-13 3.84E-11 7534 chr8 YWHAZ 10 2.31E-13 4.35E-11 9555 chr5 H2AFY 11 2.90E-13 5.35E-11 59338 chr10 PLEKHA1 13 3.14E-13 5.66E-11 84668 chr7 FAM126A 12 3.18E-13 5.66E-11 8880 chr1 FUBP1 21 4.62E-13 8.08E-11 6675 chr1 UAP1 10 5.61E-13 9.65E-11 23396 chr19 PIP5K1C 13 6.36E-13 1.07E-10 57181 chr2 SLC39A10 12 6.82E-13 1.13E-10 201595 chr3 STT3B 17 6.92E-13 1.13E-10

191

9055 chr15 PRC1 15 7.73E-13 1.23E-10 9191 chr1 DEDD 6 7.79E-13 1.23E-10 55186 chr3 SLC25A36 10 7.93E-13 1.24E-10 80194 chr11 TMEM134 8 9.97E-13 1.53E-10 376267 chr14 RAB15 8 1.02E-12 1.54E-10 55362 chr6 TMEM63B 24 1.29E-12 1.92E-10 4179 chr1 CD46 14 1.43E-12 2.09E-10 84545 chr10 MRPL43 7 1.47E-12 2.11E-10 7203 chr1 CCT3 16 1.48E-12 2.11E-10 79036 chr19 KXD1 8 2.32E-12 3.25E-10 283899 chr16 INO80E 8 2.44E-12 3.39E-10 4201 chr6 MEA1 5 2.83E-12 3.86E-10 79902 chr17 NUP85 21 3.26E-12 4.40E-10 5936 chr11 RBM4 5 3.63E-12 4.83E-10 2987 chr1 GUK1 10 4.02E-12 5.27E-10 3178 chr12 HNRNPA1 10 4.11E-12 5.33E-10 140890 chr5 SREK1 14 4.21E-12 5.33E-10 11083 chr20 DIDO1 17 4.22E-12 5.33E-10 79587 chr13 CARS2 17 5.37E-12 6.70E-10 3572 chr5 IL6ST 18 6.41E-12 7.90E-10 79913 chr20 ACTR5 10 6.72E-12 8.17E-10 5074 chr12 PAWR 7 7.74E-12 9.30E-10 4074 chr12 M6PR 9 9.61E-12 1.14E-09 10109 chr2 ARPC2 12 1.29E-11 1.50E-09 10844 chr10 TUBGCP2 19 1.29E-11 1.50E-09 6158 chr19 RPL28 5 1.43E-11 1.64E-09 57060 chr3 PCBP4 14 1.89E-11 2.14E-09 7064 chr19 THOP1 14 2.40E-11 2.69E-09 50626 chr8 CYHR1 7 2.47E-11 2.73E-09 207 chr14 AKT1 15 2.62E-11 2.88E-09 11168 chr9 PSIP1 17 2.68E-11 2.90E-09 55256 chr2 ADI1 5 4.45E-11 4.77E-09 51150 chr1 SDF4 8 4.71E-11 5.00E-09 5829 chr12 PXN 15 5.37E-11 5.64E-09 10287 chr20 RGS19 6 5.96E-11 6.19E-09 5362 chr1 PLXNA2 34 6.64E-11 6.78E-09 64225 chr2 ATL2 14 6.66E-11 6.78E-09 51574 chr4 LARP7 13 7.26E-11 7.32E-09 2288 chr12 FKBP4 11 7.70E-11 7.68E-09 84859 chr3 LRCH3 22 7.97E-11 7.87E-09 839 chr4 CASP6 8 9.65E-11 9.43E-09 152137 chr3 CCDC50 12 9.92E-11 9.61E-09 10460 chr4 TACC3 17 1.05E-10 1.01E-08 100506469 chr19 TMEM147-AS1 4 1.07E-10 1.01E-08 149986 chr20 LSM14B 11 1.07E-10 1.01E-08 55627 chr2 SMPD4 20 1.14E-10 1.06E-08 192

8896 chr7 BUD31 7 1.23E-10 1.13E-08 55666 chr17 NPLOC4 19 1.27E-10 1.16E-08 144402 chr12 CPNE8 21 1.38E-10 1.25E-08 249 chr1 ALPL 13 1.41E-10 1.27E-08 11338 chr19 U2AF2 13 1.46E-10 1.30E-08 8842 chr4 PROM1 30 1.59E-10 1.40E-08 84240 chr5 ZCCHC9 7 1.64E-10 1.43E-08 11328 chr7 FKBP9 11 1.91E-10 1.65E-08 2588 chr16 GALNS 14 1.92E-10 1.65E-08 23096 chrX IQSEC2 16 1.99E-10 1.69E-08 23392 chr9 KIAA0368 50 2.03E-10 1.72E-08 3189 chr10 HNRNPH3 11 2.10E-10 1.76E-08 1894 chr3 ECT2 26 2.51E-10 2.07E-08 2686 chr20 GGT7 16 2.51E-10 2.07E-08 11335 chr7 CBX3 8 3.34E-10 2.73E-08 64708 chr2 COPS7B 8 3.43E-10 2.78E-08 2597 chr12 GAPDH 9 4.04E-10 3.25E-08 79573 chr1 TTC13 21 4.30E-10 3.44E-08 8837 chr2 CFLAR 13 4.68E-10 3.71E-08 22985 chr14 ACIN1 21 4.76E-10 3.74E-08 5478 chr7 PPIA 6 5.09E-10 3.97E-08 6428 chr6 SRSF3 7 5.30E-10 4.10E-08 23360 chr11 FNBP4 19 5.62E-10 4.29E-08 79822 chr18 ARHGAP28 18 5.63E-10 4.29E-08 23366 chr7 KIAA0895 4 5.70E-10 4.31E-08 64236 chr8 PDLIM2 10 6.77E-10 5.07E-08 6464 chr1 SHC1 13 6.99E-10 5.20E-08 51253 chr1 MRPL37 8 7.20E-10 5.32E-08 81688 chr6 C6orf62 7 7.27E-10 5.33E-08 100526693 chr3 ARPC4-TTLL3 5 7.58E-10 5.52E-08 55422 chr19 ZNF331 5 8.88E-10 6.38E-08 6710 chr14 SPTB 31 8.90E-10 6.38E-08 51529 chr17 ANAPC11 6 8.96E-10 6.38E-08 84513 chr8 PLPP5 9 9.15E-10 6.47E-08 56834 chr11 GPR137 10 9.99E-10 7.02E-08 56975 chr7 FAM20C 10 1.03E-09 7.17E-08 54963 chr20 UCKL1 14 1.05E-09 7.27E-08 23214 chr16 XPO6 25 1.15E-09 7.93E-08 23398 chr5 PPWD1 12 1.18E-09 8.03E-08 5805 chr11 PTS 7 1.33E-09 9.01E-08 58190 chr2 CTDSP1 9 1.71E-09 1.15E-07 51593 chr7 SRRT 21 1.91E-09 1.28E-07 55795 chr13 PCID2 15 2.02E-09 1.33E-07 10772 chr1 SRSF10 7 2.02E-09 1.33E-07 53635 chr19 PTOV1 14 2.12E-09 1.39E-07 6284 chr1 S100A13 10 2.33E-09 1.52E-07

193

801 chr14 CALM1 7 2.37E-09 1.53E-07 10904 chr20 BLCAP 4 2.44E-09 1.56E-07 875 chr21 CBS 6 2.45E-09 1.56E-07 5211 chr21 PFKL 26 2.51E-09 1.59E-07 51182 chr10 HSPA14 16 2.82E-09 1.78E-07 8607 chr3 RUVBL1 12 2.95E-09 1.85E-07 7392 chr19 USF2 8 3.30E-09 2.06E-07 26119 chr1 LDLRAP1 10 3.83E-09 2.37E-07 26502 chr17 NARF 12 4.20E-09 2.59E-07 55844 chr10 PPP2R2D 10 4.88E-09 2.98E-07 55718 chr16 POLR3E 21 5.25E-09 3.19E-07 6134 chrX RPL10 6 6.73E-09 4.07E-07 3707 chr1 ITPKB 9 7.49E-09 4.50E-07 54939 chr15 COMMD4 9 7.61E-09 4.55E-07 8531 chr12 YBX3 11 7.83E-09 4.65E-07 65980 chr5 BRD9 17 7.98E-09 4.70E-07 55740 chr1 ENAH 15 8.00E-09 4.70E-07 100526694 chr9 NA 8 8.08E-09 4.72E-07 51586 chr22 MED15 19 8.77E-09 5.08E-07 51526 chr20 OSER1 6 9.07E-09 5.23E-07 80011 chr16 FAM192A 9 9.26E-09 5.31E-07 998 chr1 CDC42 6 1.00E-08 5.72E-07 377 chr12 ARF3 6 1.04E-08 5.88E-07 54020 chr21 SLC37A1 21 1.05E-08 5.91E-07 101928378 chr19 NA 5 1.06E-08 5.91E-07 54531 chr19 MIER2 16 1.06E-08 5.91E-07 3516 chr4 RBPJ 13 1.08E-08 5.97E-07 100533955 chr17 NA 22 1.11E-08 6.11E-07 79034 chr7 C7orf26 7 1.18E-08 6.45E-07 90411 chr2 MCFD2 5 1.36E-08 7.44E-07 1112 chr14 FOXN3 6 1.45E-08 7.84E-07 101927233 chr5 NA 2 1.45E-08 7.84E-07 26973 chr11 CHORDC1 12 1.47E-08 7.90E-07 134728 chr6 IRAK1BP1 5 1.52E-08 8.09E-07 2677 chr2 GGCX 15 1.53E-08 8.10E-07 29035 chr16 C16orf72 5 1.53E-08 8.10E-07 2752 chr1 GLUL 8 1.84E-08 9.65E-07 282969 chr10 FUOM 7 2.04E-08 1.06E-06 6171 chr12 RPL41 2 2.06E-08 1.07E-06 9578 chr14 CDC42BPB 38 2.17E-08 1.12E-06 80013 chr10 MINDY3 14 2.57E-08 1.32E-06 9066 chr11 SYT7 12 2.77E-08 1.41E-06 64423 chr14 INF2 23 2.77E-08 1.41E-06 9685 chr5 CLINT1 14 3.14E-08 1.59E-06 4942 chr10 OAT 10 3.17E-08 1.60E-06 10921 chr16 RNPS1 8 3.19E-08 1.60E-06 194

5792 chr1 PTPRF 35 3.33E-08 1.66E-06 8939 chr9 FUBP3 21 3.46E-08 1.72E-06 63939 chr20 FAM217B 5 3.63E-08 1.79E-06 10024 chr12 TROAP 15 3.85E-08 1.89E-06 387522 chr20 TMEM189-UBE2V1 8 4.58E-08 2.24E-06 6625 chr19 SNRNP70 12 4.76E-08 2.32E-06 51547 chr17 SIRT7 9 4.93E-08 2.39E-06 55761 chr11 TTC17 26 5.22E-08 2.50E-06 51427 chr7 ZNF107 2 5.22E-08 2.50E-06 2940 chr6 GSTA3 8 5.42E-08 2.59E-06 85015 chr6 USP45 12 5.62E-08 2.67E-06 81894 chr10 SLC25A28 5 6.45E-08 3.04E-06 9883 chr7 POM121 12 6.46E-08 3.04E-06 84268 chr17 RPAIN 7 6.50E-08 3.04E-06 23594 chr16 ORC6 8 6.98E-08 3.25E-06 5883 chr11 RAD9A 10 7.84E-08 3.64E-06 100133941 chr6 CD24 3 7.88E-08 3.64E-06 7167 chr12 TPI1 8 8.70E-08 4.00E-06 57679 chr2 ALS2 34 9.21E-08 4.21E-06 4636 chr4 MYL5 2 9.56E-08 4.35E-06 137964 chr8 GPAT4 14 9.78E-08 4.44E-06 10458 chr17 BAIAP2 15 9.88E-08 4.46E-06 7317 chrX UBA1 30 9.95E-08 4.47E-06 3094 chr5 HINT1 5 1.05E-07 4.68E-06 199990 chr1 FAAP20 5 1.31E-07 5.83E-06 54540 chr5 FAM193B 12 1.35E-07 6.00E-06 3831 chr14 KLC1 18 1.44E-07 6.37E-06 5985 chr12 RFC5 13 1.46E-07 6.41E-06 9762 chr20 LZTS3 5 1.47E-07 6.41E-06 57452 chr14 GALNT16 16 1.49E-07 6.47E-06 5297 chr22 PI4KA 54 1.54E-07 6.66E-06 3420 chr20 IDH3B 13 1.54E-07 6.66E-06 389677 chr8 RBM12B 6 1.56E-07 6.72E-06 9088 chr16 PKMYT1 10 1.59E-07 6.81E-06 102724064 chr11 AP001107.9 2 1.72E-07 7.33E-06 9904 chr12 RBM19 25 1.75E-07 7.41E-06 57167 chr20 SALL4 6 1.91E-07 8.08E-06 153527 chr5 ZMAT2 7 1.96E-07 8.24E-06 255762 chr16 PDZD9 3 2.02E-07 8.45E-06 3985 chr22 LIMK2 16 2.02E-07 8.45E-06 256281 chr14 NUDT14 4 2.16E-07 8.96E-06 7073 chr10 TIAL1 13 2.17E-07 9.00E-06 84617 chr18 TUBB6 6 2.26E-07 9.28E-06 55684 chr9 RABL6 16 2.26E-07 9.28E-06 191 chr20 AHCY 12 2.30E-07 9.40E-06 100533970 chr17 NA 4 2.48E-07 1.01E-05

195

1639 chr2 DCTN1 28 2.73E-07 1.10E-05 60491 chr2 NIF3L1 8 2.73E-07 1.10E-05 79647 chr1 AKIRIN1 6 2.81E-07 1.13E-05 1973 chr17 EIF4A1 11 3.00E-07 1.20E-05 8567 chr11 MADD 32 3.01E-07 1.20E-05 1725 chr19 DHPS 10 3.01E-07 1.20E-05 997 chr19 CDC34 6 3.03E-07 1.20E-05 145781 chr15 GCOM1 16 3.26E-07 1.28E-05 10101 chr16 NUBP2 9 3.33E-07 1.31E-05 1353 chr17 COX11 5 3.35E-07 1.31E-05 152007 chr9 GLIPR2 6 3.41E-07 1.33E-05 9373 chr9 PLAA 15 3.51E-07 1.36E-05 10335 chr11 MRVI1 5 3.62E-07 1.40E-05 902 chr5 CCNH 10 3.66E-07 1.41E-05 541471 chr2 MIR4435-2HG 3 3.82E-07 1.47E-05 79847 chr10 MFSD13A 8 3.88E-07 1.48E-05 81887 chrX LAS1L 14 4.11E-07 1.57E-05 57142 chr2 RTN4 9 4.40E-07 1.66E-05 4735 chr2 SEPT2 15 4.40E-07 1.66E-05 5393 chr4 EXOSC9 14 5.03E-07 1.89E-05 636 chr12 BICD1 11 5.03E-07 1.89E-05 84196 chr1 USP48 28 5.23E-07 1.95E-05 26024 chr7 PTCD1 8 5.48E-07 2.04E-05 11030 chr8 RBPMS 14 5.55E-07 2.06E-05 10147 chr19 SUGP2 10 6.08E-07 2.24E-05 8539 chr11 API5 15 6.10E-07 2.24E-05 55738 chr20 ARFGAP1 16 6.79E-07 2.49E-05 9266 chr19 CYTH2 12 6.89E-07 2.52E-05 7165 chr20 TPD52L2 10 6.97E-07 2.54E-05 81873 chr9 ARPC5L 5 7.41E-07 2.68E-05 339287 chr17 MSL1 10 7.41E-07 2.68E-05 9988 chr7 DMTF1 20 7.65E-07 2.76E-05 51690 chr19 LSM7 5 7.90E-07 2.84E-05 412 chrX STS 11 8.38E-07 3.00E-05 11068 chr3 CYB561D2 7 8.47E-07 3.02E-05 3074 chr5 HEXB 15 8.57E-07 3.04E-05 6728 chr5 SRP19 6 9.17E-07 3.24E-05 10944 chr11 C11orf58 7 9.93E-07 3.50E-05 2976 chr2 GTF3C2 21 1.09E-06 3.82E-05 81888 chr1 HYI 9 1.12E-06 3.92E-05 6138 chr3 RPL15 4 1.17E-06 4.08E-05 84798 chr19 C19orf48 6 1.25E-06 4.34E-05 54849 chr16 DEF8 13 1.29E-06 4.46E-05 8473 chrX OGT 22 1.30E-06 4.47E-05 9146 chr17 HGS 23 1.31E-06 4.50E-05 5786 chr20 PTPRA 28 1.35E-06 4.63E-05 196

2037 chr6 EPB41L2 20 1.37E-06 4.68E-05 101929206 chr19 NA 2 1.47E-06 5.01E-05 7050 chr18 TGIF1 5 1.50E-06 5.09E-05 56647 chr10 BCCIP 9 1.54E-06 5.20E-05 91574 chr12 C12orf65 4 1.55E-06 5.21E-05 26751 chr2 SH3YL1 11 1.58E-06 5.32E-05 100534595 chr11 NA 24 1.69E-06 5.65E-05 22980 chr16 TCF25 19 2.00E-06 6.68E-05 2232 chr17 FDXR 13 2.19E-06 7.30E-05 9295 chr1 SRSF11 11 2.64E-06 8.74E-05 955 chr20 ENTPD6 16 2.78E-06 9.19E-05 7171 chr19 TPM4 9 2.93E-06 9.64E-05 10482 chr11 NXF1 20 2.94E-06 9.64E-05 55110 chr12 MAGOHB 6 3.08E-06 0.000100844 83637 chr7 ZMIZ2 21 3.19E-06 0.000103941 26036 chr6 ZNF451 15 3.41E-06 0.000110816 5902 chr22 RANBP1 9 3.43E-06 0.00011121 64062 chr13 RBM26 22 3.48E-06 0.000112253 4054 chr11 LTBP3 15 3.49E-06 0.000112313 90203 chr20 SNX21 4 3.54E-06 0.000113574 10782 chr19 ZNF274 7 3.56E-06 0.000113766 84838 chr1 ZNF496 11 3.58E-06 0.000114028 1793 chr10 DOCK1 52 3.67E-06 0.000116521 8677 chr19 STX10 7 3.72E-06 0.000117869 89849 chr11 ATG16L2 2 3.76E-06 0.000118697 56113 chr5 PCDHGA2 4 3.79E-06 0.000119234 10228 chr1 STX6 9 4.13E-06 0.000129602 3038 chr16 HAS3 3 4.30E-06 0.000134424 51776 chr2 MAP3K20 12 4.38E-06 0.000136679 7106 chr11 TSPAN4 10 4.58E-06 0.000141979 8034 chr10 SLC25A16 11 4.58E-06 0.000141979 2907 chr8 GRINA 7 4.66E-06 0.000143993 219743 chr10 TYSND1 5 4.70E-06 0.00014455 64760 chr8 FAM160B2 18 4.76E-06 0.000146175 1453 chr17 CSNK1D 11 4.92E-06 0.000150647 9898 chr1 UBAP2L 30 5.27E-06 0.00016069 84292 chr19 WDR83 8 5.30E-06 0.000161268 152815 chr4 THAP6 5 5.42E-06 0.000164368 2817 chr2 GPC1 10 5.55E-06 0.000167793 6242 chr2 RTKN 14 6.04E-06 0.000182031 54454 chr2 ATAD2B 29 6.13E-06 0.000184063 51447 chr3 IP6K2 6 6.56E-06 0.000196557 11285 chr5 B4GALT7 6 6.66E-06 0.000199032 4055 chr12 LTBR 11 7.06E-06 0.000210212 2651 chr6 GCNT2 4 7.38E-06 0.000218982 200845 chr3 KCTD6 3 7.48E-06 0.000221289

197

100534599 chr3 ISY1-RAB43 12 7.56E-06 0.00022314 55744 chr7 COA1 7 7.63E-06 0.000224558 22902 chr4 RUFY3 18 7.72E-06 0.000226493 6130 chr9 RPL7A 5 8.00E-06 0.000233523 4430 chr2 MYO1B 31 8.01E-06 0.000233523 55311 chr19 ZNF444 5 8.14E-06 0.000236617 309 chr5 ANXA6 26 8.20E-06 0.000237884 54206 chr1 ERRFI1 5 8.31E-06 0.000240363 4097 chr17 MAFG 3 8.70E-06 0.000250956 4150 chr16 MAZ 7 8.83E-06 0.00025371 9509 chr5 ADAMTS2 13 8.95E-06 0.000256537 1121 chrX CHM 4 9.19E-06 0.000262676 84310 chr7 C7orf50 6 9.63E-06 0.000274284 55268 chr1 ECHDC2 11 9.65E-06 0.000274284 92291 chr2 CAPN13 23 9.86E-06 0.000279288 9063 chr18 PIAS2 14 1.00E-05 0.000282483 8611 chr5 PLPP1 7 1.02E-05 0.000287741 4343 chr1 MOV10 22 1.05E-05 0.000295851 64432 chr3 MRPS25 4 1.07E-05 0.000299628 100532735 chr2 NA 7 1.07E-05 0.000299867 905 chr2 CCNT2 11 1.08E-05 0.000299952 3177 chr11 SLC29A2 12 1.08E-05 0.000299952 29123 chr16 ANKRD11 12 1.10E-05 0.000304815 11011 chr17 TLK2 13 1.11E-05 0.000307791 10533 chr3 ATG7 18 1.17E-05 0.000322979 11188 chr3 NISCH 21 1.18E-05 0.000322979 29914 chr1 UBIAD1 3 1.21E-05 0.000332722 23524 chr16 SRRM2 16 1.22E-05 0.000334339 51390 chr6 AIG1 7 1.27E-05 0.000346443 10539 chr10 GLRX3 12 1.29E-05 0.000349411 81926 chr19 ABHD17A 5 1.29E-05 0.00035096 51115 chr8 RMDN1 12 1.33E-05 0.000359704 23404 chr9 EXOSC2 10 1.34E-05 0.000361424 28985 chrX MCTS1 6 1.35E-05 0.000363749 7410 chr9 VAV2 28 1.36E-05 0.000364518 4869 chr5 NPM1 5 1.45E-05 0.000387549 128710 chr20 SLX4IP 2 1.51E-05 0.000401688 5214 chr10 PFKP 23 1.54E-05 0.000409833 56893 chr1 UBQLN4 10 1.59E-05 0.00042166 1911 chr12 PHC1 9 1.75E-05 0.000461128 23215 chr1 PRRC2C 36 1.75E-05 0.000461128 11244 chr8 ZHX1 4 1.76E-05 0.000461128 8310 chr4 ACOX3 2 1.76E-05 0.000461128 7170 chr1 TPM3 9 1.78E-05 0.000465419 348654 chr2 GEN1 14 1.80E-05 0.00046894 54780 chr10 NSMCE4A 13 1.85E-05 0.000481309 198

128218 chr1 TMEM125 4 1.96E-05 0.000507898 220064 chr11 ORAOV1 6 2.12E-05 0.000548891 64147 chr3 KIF9 5 2.17E-05 0.000561537 10616 chr20 RBCK1 13 2.18E-05 0.000562885 80004 chr16 ESRP2 16 2.31E-05 0.000594468 81608 chr4 FIP1L1 19 2.32E-05 0.000594468 25798 chr7 BRI3 5 2.35E-05 0.000600051 5426 chr12 POLE 51 2.41E-05 0.000613061 6813 chr19 STXBP2 20 2.41E-05 0.000613061 101927797 chr21 NA 3 2.46E-05 0.000625574 10006 chr10 ABI1 10 2.51E-05 0.000635133 4926 chr11 NUMA1 27 2.52E-05 0.000636542 56944 chr1 OLFML3 4 2.53E-05 0.000636883 283870 chr16 BRICD5 2 2.54E-05 0.000638702 26229 chr11 B3GAT3 6 2.74E-05 0.000685509 800 chr7 CALD1 16 2.78E-05 0.000695444 6387 chr10 CXCL12 4 2.84E-05 0.000708718 7072 chr2 TIA1 11 3.06E-05 0.000761513 255403 chr4 ZNF718 2 3.10E-05 0.000768282 23612 chr1 PHLDA3 3 3.19E-05 0.00078925 157697 chr8 ERICH1 7 3.31E-05 0.000816999 6809 chr11 STX3 12 3.33E-05 0.000820593 22846 chr14 VASH1 9 3.43E-05 0.000842946 100526842 chr18 RPL17-C18orf32 6 3.46E-05 0.000848726 3150 chr21 HMGN1 9 3.62E-05 0.000885476 51651 chr17 PTRH2 3 3.82E-05 0.000931806 157695 chr8 TDRP 3 4.09E-05 0.00099546 288 chr10 ANK3 22 4.25E-05 0.001029172 10078 chr11 TSSC4 4 4.25E-05 0.001029172 6651 chr21 SON 15 4.32E-05 0.00104422 39 chr6 ACAT2 7 4.38E-05 0.001055222 6397 chr17 SEC14L1 19 4.39E-05 0.001055222 100288123 chr19 AC012615.6 3 4.62E-05 0.001108733 55226 chr11 NAT10 30 4.86E-05 0.001163277 100505678 chr5 STARD4-AS1 3 4.98E-05 0.001187871 144097 chr11 C11orf84 7 5.11E-05 0.001216325 84957 chr11 RELT 9 5.22E-05 0.00123943 642658 chr8 SCX 2 5.25E-05 0.001243665 54845 chr8 ESRP1 16 5.48E-05 0.00129494 130872 chr2 AHSA2 7 5.66E-05 0.001333729 3875 chr12 KRT18 7 6.02E-05 0.001416501 4193 chr12 MDM2 12 6.11E-05 0.001434097 421 chr22 ARVCF 18 6.21E-05 0.001453764 7982 chr7 ST7 16 6.50E-05 0.001518006 55119 chr1 PRPF38B 7 6.55E-05 0.001525413 284565 chr1 NBPF15 8 6.66E-05 0.001548162

199

79637 chr17 ARMC7 4 6.82E-05 0.001581513 116228 chr1 COX20 4 7.17E-05 0.001659083 23181 chr21 DIP2A 37 7.23E-05 0.001668864 4134 chr3 MAP4 20 7.25E-05 0.001670949 3755 chr20 KCNG1 3 7.35E-05 0.001689921 10461 chr2 MERTK 20 7.54E-05 0.001729557 6142 chr19 RPL18A 4 7.74E-05 0.001771105 23218 chr3 NBEAL2 52 7.95E-05 0.001812098 84687 chr17 PPP1R9B 11 7.96E-05 0.001812098 29097 chr1 CNIH4 7 8.18E-05 0.001859 7390 chr10 UROS 12 8.61E-05 0.001951526 3845 chr12 KRAS 6 8.84E-05 0.002000256 5519 chr11 PPP2R1B 16 9.24E-05 0.002076619 54596 chr1 L1TD1 5 9.24E-05 0.002076619 26031 chr7 OSBPL3 23 9.24E-05 0.002076619 90196 chr20 SYS1 5 9.64E-05 0.002160571 101060691 chr10 NUTM2B-AS1 7 9.77E-05 0.00218408 100507577 chr16 NA 2 0.000106224 0.002370431 56882 chr1 CDC42SE1 6 0.000116529 0.002594583 137682 chr8 NDUFAF6 9 0.000119373 0.002651986 3964 chr1 LGALS8 12 0.000125002 0.00277087 6431 chr20 SRSF6 7 0.000127772 0.002826005 8313 chr17 AXIN2 11 0.000131981 0.002912644 949 chr12 SCARB1 13 0.000137476 0.003027201 3704 chr20 ITPA 10 0.000139779 0.00307106 573 chr9 BAG1 7 0.000140083 0.00307106 80150 chr11 ASRGL1 8 0.000140617 0.003075996 56101 chr5 PCDHGB5 4 0.000145655 0.003179234 9123 chr17 SLC16A3 5 0.00015002 0.003267349 54477 chr12 PLEKHA5 27 0.000154097 0.003348847 100529241 chr2 HSPE1-MOB4 9 0.000160904 0.003489173 54832 chr15 VPS13C 16 0.00016247 0.003515475 401466 chr8 C8orf59 5 0.000164454 0.003550706 4245 chr5 MGAT1 4 0.000171706 0.003699272 51564 chr12 HDAC7 25 0.000172808 0.003714995 57473 chr20 ZNF512B 17 0.000174239 0.003737707 23085 chr12 ERC1 19 0.000184297 0.003944993 100533106 chr8 ZHX1-C8orf76 6 0.000185221 0.003956277 11065 chr20 UBE2C 7 0.000187711 0.004000883 115992 chr16 RNF166 6 0.000191939 0.004082284 2077 chr19 ERF 5 0.000194894 0.004136316 94239 chr7 H2AFV 6 0.000196176 0.004154674 9881 chr3 TRANK1 2 0.000197068 0.004164729 100527943 chr20 TGIF2-C20orf24 4 0.000201362 0.00424648 8435 chr12 SOAT2 4 0.00020181 0.00424695 388524 chr19 NA 2 0.000203926 0.004282451 200

55697 chr16 VAC14 20 0.000204952 0.004294945 4670 chr19 HNRNPM 16 0.000207004 0.004328855 64769 chr1 MEAF6 8 0.000207706 0.004334456 3654 chrX IRAK1 13 0.000211862 0.004411949 54496 chr16 PRMT7 19 0.000223758 0.004649981 54757 chr17 FAM20A 11 0.000225972 0.004684718 51421 chr3 AMOTL2 11 0.000226369 0.004684718 9967 chr1 THRAP3 13 0.000234053 0.004833702 84324 chr12 SARNP 12 0.000235391 0.0048513 8932 chr18 MBD2 8 0.000238559 0.004906437 59307 chr11 SIGIRR 8 0.000240786 0.004942065 101927117 chr20 NA 3 0.000241436 0.004945224 5300 chr19 PIN1 5 0.000246334 0.005035213 92715 chr9 DPH7 8 0.000249608 0.005091706 8495 chr11 PPFIBP2 22 0.000254487 0.005171265 3190 chr9 HNRNPK 18 0.000254545 0.005171265 9753 chr6 ZSCAN12 3 0.000259217 0.005255471 128977 chr22 C22orf39 2 0.00026807 0.005423929 55776 chr6 SAYSD1 3 0.000285919 0.005773361 9987 chr4 HNRNPDL 9 0.00029243 0.005892912 7428 chr3 VHL 4 0.000293404 0.005900621 9175 chr3 MAP3K13 2 0.000295259 0.005925971 5250 chr12 SLC25A3 8 0.000298018 0.005954644 29103 chr13 DNAJC15 6 0.000298414 0.005954644 123096 chr14 SLC25A29 7 0.000298928 0.005954644 11098 chr11 PRSS23 2 0.000299075 0.005954644 64081 chr10 PBLD 2 0.000302199 0.006004846 203260 chr9 CCDC107 4 0.000308666 0.006118835 503538 chr19 A1BG-AS1 2 0.000309162 0.006118835 1173 chr3 AP2M1 12 0.000311832 0.006159455 6526 chr21 SLC5A3 2 0.000321324 0.006334395 414189 chr10 AGAP6 3 0.000340151 0.006692315 47 chr17 ACLY 29 0.000361815 0.007104537 5032 chr19 P2RY11 2 0.000365141 0.00715576 100526737 chr11 RBM14-RBM4 3 0.000368294 0.007203393 65125 chr12 WNK1 29 0.000370711 0.007236478 100529262 chr19 NA 10 0.000372692 0.007260933 667 chr6 DST 50 0.000378962 0.007368696 92305 chr4 TMEM129 4 0.000385362 0.007478565 6421 chr1 SFPQ 13 0.000402092 0.007788101 4204 chrX MECP2 4 0.000403503 0.00780028 4311 chr3 MME 22 0.000405795 0.007829412 647166 chr13 NA 3 0.000406733 0.00783235 100506930 chr19 LINC00665 3 0.00040964 0.007873144 84333 chr10 PCGF5 11 0.000417857 0.008001652 7378 chr7 UPP1 10 0.000418172 0.008001652

201

51082 chr13 POLR1D 4 0.000418733 0.008001652 196294 chr11 IMMP1L 6 0.000425021 0.008106272 64983 chr7 MRPL32 4 0.000429477 0.008175635 7701 chr2 ZNF142 10 0.000430679 0.008182907 6687 chr16 SPG7 18 0.000437737 0.008275767 6235 chr14 RPS29 4 0.000438171 0.008275767 128 chr4 ADH5 9 0.000438693 0.008275767 100129405 chr1 NA 5 0.000439539 0.008275767 4731 chr21 NDUFV3 5 0.000439715 0.008275767 10220 chr12 GDF11 4 0.000445139 0.008362075 8904 chr20 CPNE1 19 0.000447925 0.008398586 203286 chr9 ANKS6 5 0.000451668 0.008452889 5550 chr6 PREP 16 0.000455568 0.008509904 311 chr10 ANXA11 17 0.000466842 0.008690631 27235 chr4 COQ2 7 0.000466985 0.008690631 10400 chr17 PEMT 7 0.000470654 0.008742596 10413 chr11 YAP1 9 0.000484305 0.008969662 26528 chr19 DAZAP1 14 0.000484676 0.008969662 8558 chr16 CDK10 12 0.000504717 0.00932324 257397 chrX TAB3 8 0.000508786 0.009381028 6199 chr11 RPS6KB2 16 0.000512626 0.009434406 64770 chr3 CCDC14 11 0.000515009 0.009446723 11180 chr3 WDR6 7 0.00051519 0.009446723 4802 chr1 NFYC 11 0.000524853 0.009606255 2181 chr2 ACSL3 17 0.000531245 0.009705439 9704 chr19 DHX34 18 0.000532735 0.009714863 9673 chr1 SLC25A44 6 0.000543144 0.009886617 100529211 chr17 NA 5 0.00054528 0.009907403 11143 chr17 KAT7 15 0.000567286 0.010288514 4820 chr3 NKTR 13 0.000568844 0.010298035 9584 chr20 RBM39 18 0.000575947 0.010407739 10973 chr6 ASCC3 43 0.00058896 0.010623649 29979 chr9 UBQLN1 12 0.000592311 0.01066481 92714 chr9 ARRDC1 6 0.000596863 0.010713936 51409 chr3 HEMK1 10 0.000597188 0.010713936 10732 chr20 TCFL5 7 0.000600129 0.010736863 129563 chr2 DIS3L2 14 0.000600618 0.010736863 5208 chr1 PFKFB2 11 0.00060182 0.010739093 226 chr16 ALDOA 11 0.000609719 0.010860622 23081 chr9 KDM4C 23 0.000617887 0.010986496 55839 chr16 CENPN 12 0.000626042 0.011111692 204 chr1 AK2 5 0.000627901 0.011124887 26164 chr20 MTG2 8 0.000647743 0.01145609 23380 chr1 SRGAP2 20 0.00065727 0.011604018 79415 chr17 C17orf62 7 0.00066502 0.011720102 10210 chr9 TOPORS 3 0.000682887 0.01201376 202

23261 chr1 CAMTA1 6 0.000690731 0.012130355 6322 chrX SCML1 5 0.000693882 0.012164274 5031 chr11 P2RY6 2 0.000708572 0.012400013 4673 chr12 NAP1L1 16 0.000722809 0.012627004 22916 chr3 NCBP2 5 0.000735283 0.012822462 5894 chr3 RAF1 18 0.000767544 0.013361694 9184 chr10 BUB3 8 0.00077332 0.013438791 1119 chr11 CHKA 13 0.000790959 0.013721418 3104 chr1 ZBTB48 10 0.000849793 0.014716467 9378 chr2 NRXN1 2 0.000864193 0.014939903 7458 chr7 EIF4H 5 0.00088646 0.015298343 6726 chr1 SRP9 3 0.000926196 0.015956489 100533183 chr12 RFLNA 4 0.000948277 0.016308734 9489 chr17 PGS1 10 0.001011471 0.01736562 57494 chr12 RIMKLB 9 0.001040012 0.017824948 29954 chr14 POMT2 22 0.001051486 0.017990691 55758 chr1 RCOR3 14 0.001076153 0.018353923 2671 chr16 GFER 2 0.001076396 0.018353923 9129 chr1 PRPF3 17 0.001103004 0.018775538 3151 chr1 HMGN2 5 0.001123824 0.019097343 57179 chr5 KIAA1191 9 0.001132718 0.019193366 128414 chr20 NKAIN4 8 0.001133323 0.019193366 3257 chr10 HPS1 20 0.001176168 0.019862692 78987 chr3 CRELD1 11 0.001176827 0.019862692 83596 chr19 BCL2L12 7 0.001190376 0.020057435 57038 chr6 RARS2 21 0.001197981 0.020151542 55603 chr6 FAM46A 2 0.001214693 0.020398262 9821 chr8 RB1CC1 24 0.001221327 0.020475195 100529063 chr14 BCL2L2-PABPN1 8 0.001260282 0.021060644 8641 chr5 PCDHGB4 4 0.001260472 0.021060644 813 chr7 CALU 9 0.001310357 0.021857537 1514 chr9 CTSL 9 0.001332533 0.022190344 1487 chr4 CTBP1 10 0.001359398 0.02259999 5834 chr20 PYGB 20 0.001379184 0.022890779 8527 chr2 DGKD 29 0.00139147 0.02305634 5097 chr5 PCDH1 7 0.001411832 0.023354938 55756 chr8 INTS9 18 0.001423963 0.023516601 5757 chr2 PTMA 6 0.001432496 0.02361843 79868 chrX ALG13 7 0.001439951 0.023702156 132320 chr4 SCLT1 7 0.001453551 0.023886603 63933 chr6 MCUR1 9 0.001505989 0.024707637 84988 chr8 PPP1R16A 8 0.001520476 0.024904343 65059 chr2 RAPH1 14 0.001557635 0.025471162 23590 chr10 PDSS1 9 0.001611532 0.026309378 9804 chr1 TOMM20 5 0.001643502 0.026787476 55028 chr17 C17orf80 7 0.001649424 0.026840145

203

219931 chr11 TPCN2 22 0.001679084 0.027232187 202333 chr5 CMYA5 2 0.001681637 0.027232187 116983 chr1 ACAP3 16 0.001681707 0.027232187 8438 chr1 RAD54L 18 0.001728802 0.027935043 100507178 chr1 SLFNL1-AS1 2 0.001730712 0.027935043 81846 chr11 SBF2 38 0.001758278 0.028334123 25994 chr3 HIGD1A 4 0.00176155 0.028341071 6550 chr5 SLC9A3 4 0.001769974 0.028430735 9092 chr11 SART1 20 0.001805879 0.028960838 790952 chr3 ESRG 4 0.001814318 0.029049468 400410 chr15 ST20 3 0.001864176 0.029799921 119391 chr10 GSTO2 6 0.001961922 0.03131228 6154 chr17 RPL26 3 0.001970822 0.031404074 55152 chr3 DALRD3 7 0.001974381 0.031410603 348235 chr17 SKA2 4 0.002001021 0.03178374 10087 chr5 COL4A3BP 18 0.002053707 0.032568717 60559 chr4 SPCS3 5 0.002122861 0.033611967 83759 chr11 RBM4B 4 0.002143165 0.033879674 26018 chr3 LRIG1 19 0.002150293 0.033938558 23164 chr17 MPRIP 22 0.002182727 0.034396048 2258 chrX FGF13 7 0.002194865 0.034532776 6692 chr15 SPINT1 11 0.002281956 0.035846479 29893 chr17 PSMC3IP 7 0.002301179 0.036091609 84436 chr19 ZNF528 3 0.002316257 0.036271063 57228 chr12 SMAGP 5 0.002322083 0.036305297 65981 chr12 CAPRIN2 18 0.002330606 0.03638153 8996 chr16 NOL3 4 0.002388297 0.037223843 79676 chr12 OGFOD2 8 0.002412633 0.03754449 55829 chr15 SELENOS 7 0.002425465 0.037685385 10916 chrX MAGED2 15 0.002467307 0.038275869 11078 chr22 TRIOBP 14 0.002477513 0.038374523 80152 chr16 CENPT 15 0.002514618 0.038888853 9328 chr9 GTF3C5 12 0.002562616 0.039569813 55249 chr1 YY1AP1 11 0.002594076 0.039961955 6389 chr5 SDHA 14 0.002599356 0.039961955 10466 chr7 COG5 22 0.002600031 0.039961955 10767 chr6 HBS1L 19 0.002651682 0.040660527 126328 chr19 NDUFA11 5 0.002653634 0.040660527 284702 chr1 NA 2 0.00267304 0.040835198 285761 chr6 DCBLD1 2 0.002673221 0.040835198 51377 chr1 UCHL5 14 0.00268799 0.04099801 100534593 chr20 NA 20 0.002708876 0.041253497 220074 chr11 LRTOMT 7 0.002724781 0.041432459 96610 chr22 NA 11 0.0027516 0.041776574 81671 chr17 VMP1 12 0.002756618 0.041789158 54058 chr21 C21orf58 3 0.002847751 0.043105176 204

8940 chr22 TOP3B 20 0.002868576 0.043354621 7329 chr16 UBE2I 8 0.002873332 0.043360789 57558 chr11 USP35 4 0.002909117 0.043824192 1017 chr12 CDK2 7 0.002912826 0.043824192 114971 chr11 PTPMT1 3 0.002919691 0.043861324 284371 chr19 ZNF841 2 0.002968725 0.044530882 727957 chr8 MROH1 42 0.002976841 0.044585572 23583 chr12 SMUG1 2 0.003027565 0.045277298 3454 chr21 IFNAR1 11 0.00309639 0.046237262 101930085 chr7 AC018647.2 2 0.003126306 0.046614207 3921 chr3 RPSA 6 0.003134994 0.046673971 100190939 chr13 NA 5 0.003198278 0.047526558 26152 chr20 ZNF337 5 0.003201789 0.047526558 6157 chr11 RPL27A 5 0.003302871 0.048932474 5708 chr3 PSMD2 21 0.003306315 0.048932474 57491 chr5 AHRR 2 0.003373083 0.049846678

205

Minerva Access is the Institutional Repository of The University of Melbourne

Author/s: Saeidi, Seyedeh Shaghayegh

Title: ESRP1 is a novel marker of germ cell development and gonadal cancer

Date: 2018

Persistent Link: http://hdl.handle.net/11343/214520

File Description: ESRP1 is a novel marker of germ cell development and gonadal cancer

Terms and Conditions: Terms and Conditions: Copyright in works deposited in Minerva Access is retained by the copyright owner. The work may not be altered without permission from the copyright owner. Readers may only download, print and save electronic copies of whole works for their own personal non-commercial use. Any use that exceeds these limits requires permission from the copyright owner. Attribution is essential when quoting or paraphrasing from these works.