Predictive Chemoinformatics Applications to the Pharmaceutical Industry

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Informatics predictive chemoinformatics applications to the pharmaceutical industry While significant advances in chemoinformatics present tremendous opportunities to improve human health, the future of chemoinformatics in the pharmaceutical industry is not without significant challenges. hemoinformatics is the result of collective development, chemoinformatics provides the tools By Dr Leslie J. advances in chemistry, biology, computer to compare expression of genes and proteins as well Browne and C sciences and statistics and refers to the as complex signalling processes in disease and nor- Laurie L.Taylor electronic tools, methods and data used for analy- mal tissues and impacts concretely on selection of sis and predictive computation of drug effects on therapeutic targets (Figure 2). Differential gene and complex biological processes (Figure 1). Scientific protein expression profiles related to a disease state milestones over the last 50 years which have con- (eg cancer) promise to help fine-tune diagnoses and tributed to the evolution of predictive chemoinfor- improve the accuracy of prognostic indicators to matics include the development of the DNA double best serve individual patient needs. Chemists can helix model by Watson and Crick (1953); sequenc- now design compounds with improved drug-like ing of the first protein-bovine insulin by Sanger qualities through computerised structure/activity (1955); protein crystallography by Perutz (1954); the first integrated circuit by Kilby at Texas Instruments (1958); recombinant DNA technology Figure 1 by Berg et al (1972); conception of the Internet by Human genome Cerf and Kahn (1974); development of 2-D gel sequenced 3000Mbp D. melangaster genome electrophoresis (1975); identification of protein sequenced 2001 structure NMR by Wuthrich (1980); creation of S. cerevisiae E.Coli 2000 genomes sequenced the first personal computers by IBM (1981); poly- H. influenzae genome 1996 merase chain reaction technology by Mullis et al sequenced 1995 Expressed Sequence (1985); creation of the SWISS-PROT database Tags (Ventner) 1994 Milestones in predictive (1986); the founding of the NCBI (1988); creation WWW protocols 1991 chemoinformatics of BLAST by Altschul (1990); development of developed (CERN) BLAST search programme WWW protocols by the CERN (1991); identifica- 1990 NCBI created (Altschul et al) tion and significance of ESTs by Ventner (1991); founded 1988 SWISS-PROT database sequencing of the entire genomes of H. influenzae, 1986 established Polymerase S.cerevisiae (12Mb), E. Coli (1995-1996); D Personal Computers Chain Reaction 1985 developed (IBM) Recombinant First protein melangaster (180Mb) in 2000; and the human (Mullis et al) 1981 2D gel DNA sequence DNA Double Helix 1980 genome 3000Mbp in 2001. electrophoresis (Berg et al) (Sanger) (Watson Crick) Protein Structure 1975 1974 by NMR (Wuthrich) 1972 Advances in chemoinformatics related to Internet 1958 1955 1954 1953 genomics, proteomics and computer-assisted chem- (Cerf and Kahn) First integrated Protein circuit (Kilby at TI) Crystallography ical modelling hold tremendous promise to improve (Perutz) human health. For pharmaceutical research and Drug Discovery World Fall 2002 71 Informatics Genes and drug response DNA Nucleus Cell membrane DRUG TARGETS DNA bases Chain of amino acids Gene mRNA Ribosome Altered protein Efficacy DNA Protein Variable vs variants variants responses toxicity Figure 2 modelling – often reducing the number of com- so high – about 1 in 10 drug candidates survives Cellular checkpoints for pounds tested, compared with conventional trial- from initiation of clinical evaluation to market therapeutic intervention and-error methods. Drugs themselves affect expres- launch (Figure 4) – even a modest improvement to sion of a wide variety of genes and proteins, and 1 in 5 halves the development cost. Many drug fail- individual patient responses to drugs differ in ures are the result of ‘off target’ activity, ie poor metabolism and toxicity. side effect profiles that offset the potential thera- Pharmaceutical companies are highly motivated peutic effect. Structure-based design algorithms to reduce the discovery-to-market time and cost. and structure-activity data of existing bioactive Increased R&D dollars dedicated to the business of compounds facilitate the design of new compounds discovering new therapeutics have not resulted in a with the critical ‘drug-like’ qualities, in addition to correspondingly increased number of successful potency and efficacy at the therapeutic target: a drugs on the market. The pre-market failure rate of necessity for successful pre-clinical and clinical drug candidates has been measured and remea- development. The ability to project the in vitro sured from varying perspectives but always leads effects of a candidate drug into predictive models to the unavoidable conclusion that the process is of broader in vivo systemic effects earlier in the inefficient. More than 50% of failures are due to discovery process, will benefit the industry by lack of efficacy or unexpected animal toxicity. reducing failure rates, the developer by reducing (Figure 3). It now costs an average of $800 million costs and the consumer by helping get better drugs to bring a new product to market1. This includes, to the market. of course, the cost of the numerous failures and Despite the expense and time committed to their consumption of R&D dollars – a cost that is drug development, approved drugs have fre- passed on to the consumer. Since the failure rate is quently been withdrawn from the market due to 72 Drug Discovery World Fall 2002 Informatics severe adverse drug reactions (ADR). Between October 1997 and September 1998, a number of Causes of drug failure FDA-approved drugs were withdrawn, but not before being prescribed to 20 million patients in the US alone2. Animal toxicity Pharmacokinetics Importantly, the side effects that resulted in the 17% 7% ADR might have been measured and potentially designed out of the drug candidates had there been a means of identifying in advance the full spectrum Miscellaneous 7% of its potential side effects. While additional pre- market animal and human evaluation might decrease the number of drugs withdrawn from the market, the additional cost would be significant. In contrast, new chemoinformatics tools can be used Adverse effects to identify potential liabilities and benefits much 16% earlier in the discovery process. Identifying and Efficacy eliminating likely failures earlier permits efforts to Commercial 46% be focused on higher quality compounds, resulting 7% in more efficacious drugs produced at lower over- Figure 3 all cost. Chemogenomics applied to the discovery of new therapeutic agents Overview: While the physiological response of animals to drug treatment is the mainstay of efficacy and safety evaluation for drug develop- ment, the nature of conventional pre-clinical evaluation methods means that only a few important physiological parameters can be Better efficacy and toxicology assessed at a time. The new options provided by predictions will reduce attrition genomics and proteomics is to assess broadly the effect of a compound on the system as a whole 400 1 by looking at the transcriptome and the pro- Validated Lead Candidate IND/Phase 1 Phase II Phase III NDA 3rd year teome. As the tools are developed, it will be pos- idea compound on market sible to look not only at mRNA in high through- 200 put but also the resultant individual protein, its 50 conformation and its phosphorylation state, etc 0.1 to get the fullest possible picture of what is hap- pening at the molecular level in response to com- 12 pound treatment. Chemogenomics – or ‘pharmacology with 0.01 genomics tools’ – combines the strengths of tradi- tional pharmacology and the mechanistic 3 approach to drug discovery. Since an intact bio- survivingFraction of programmes 1 logical system is the focus of the evaluation, it is 0.001 contextually information-rich. The effects of a Basic Discovery Pre-clinical Clinical compound are examined in the context of other biological processes it affects in addition to the Discovery Pre-clinical Clinical ADME ADME To xicity target for which it was designed. For example, To xicity 12% ADME 20% 33% 34% To xicity this approach allows for compensatory and regu- 40% 38% latory mechanisms to influence the phenotypic outcome, as measured by the genomic response of Efficacy Efficacy Efficacy the system. Furthermore, since the analysis views 40% 33% 50% all, or at least a large proportion of, induced Figure 4 genomic changes within an organism, an Drug Discovery World Fall 2002 73 Informatics Figure 5 COMPOUNDS Gene expression class signatures DNA crosslinking signatures Statin signatures PPARa signatures SIGNATURES NSAID signatures Hepatotox signatures Sulindac Busulfan Cisplatin Ibuprofen Naproxen Clofibrate Lovastatin enofibrate Dicumarol Fluvastatin Diolofenac Bezafibrate Simvastatin F Gemfibrozil Carboplatin Atorvastatin Progesterone Indomethacin Clofibric Acid Beta Estradiol Norethindrone Ethinylestradiol Ethylene Glycol Ethylene Diethylstilbestrol Carbon Tetrachloride 1 Naphthyl Isothiocya 1 Naphthyl Bis 2 Ethylhexyl Phtha Bis 2 Ethylhexyl improved understanding of the breadth of com- information effectively to make key drug discovery pound action on target-related genes, as well as decisions. One approach is to characterise the unrelated genes, is possible. effects of existing, well-understood drugs in While the immediate promise of chemoge- chemogenomic
Recommended publications
  • Semantic Web Integration of Cheminformatics Resources with the SADI Framework Leonid L Chepelev1* and Michel Dumontier1,2,3

    Semantic Web Integration of Cheminformatics Resources with the SADI Framework Leonid L Chepelev1* and Michel Dumontier1,2,3

    Chepelev and Dumontier Journal of Cheminformatics 2011, 3:16 http://www.jcheminf.com/content/3/1/16 METHODOLOGY Open Access Semantic Web integration of Cheminformatics resources with the SADI framework Leonid L Chepelev1* and Michel Dumontier1,2,3 Abstract Background: The diversity and the largely independent nature of chemical research efforts over the past half century are, most likely, the major contributors to the current poor state of chemical computational resource and database interoperability. While open software for chemical format interconversion and database entry cross-linking have partially addressed database interoperability, computational resource integration is hindered by the great diversity of software interfaces, languages, access methods, and platforms, among others. This has, in turn, translated into limited reproducibility of computational experiments and the need for application-specific computational workflow construction and semi-automated enactment by human experts, especially where emerging interdisciplinary fields, such as systems chemistry, are pursued. Fortunately, the advent of the Semantic Web, and the very recent introduction of RESTful Semantic Web Services (SWS) may present an opportunity to integrate all of the existing computational and database resources in chemistry into a machine-understandable, unified system that draws on the entirety of the Semantic Web. Results: We have created a prototype framework of Semantic Automated Discovery and Integration (SADI) framework SWS that exposes the QSAR descriptor functionality of the Chemistry Development Kit. Since each of these services has formal ontology-defined input and output classes, and each service consumes and produces RDF graphs, clients can automatically reason about the services and available reference information necessary to complete a given overall computational task specified through a simple SPARQL query.
  • Joelib Tutorial

    Joelib Tutorial

    JOELib Tutorial A Java based cheminformatics/computational chemistry package Dipl. Chem. Jörg K. Wegner JOELib Tutorial: A Java based cheminformatics/computational chemistry package by Dipl. Chem. Jörg K. Wegner Published $Date: 2004/03/16 09:16:14 $ Copyright © 2002, 2003, 2004 Dept. Computer Architecture, University of Tübingen, GermanyJörg K. Wegner Updated $Date: 2004/03/16 09:16:14 $ License This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation version 2 of the License. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. Documents PS (JOELibTutorial.ps), PDF (JOELibTutorial.pdf), RTF (JOELibTutorial.rtf) versions of this tutorial are available. Plucker E-Book (http://www.plkr.org) versions: HiRes-color (JOELib-HiRes-color.pdb), HiRes-grayscale (JOELib-HiRes-grayscale.pdb) (recommended), HiRes-black/white (JOELib-HiRes-bw.pdb), color (JOELib-color.pdb), grayscale (JOELib-grayscale.pdb), black/white (JOELib-bw.pdb) Revision History Revision $Revision: 1.5 $ $Date: 2004/03/16 09:16:14 $ $Id: JOELibTutorial.sgml,v 1.5 2004/03/16 09:16:14 wegner Exp $ Table of Contents Preface ........................................................................................................................................................i 1. Installing JOELib
  • Cheminformatics and Chemical Information

    Cheminformatics and Chemical Information

    Cheminformatics and Chemical Information Matt Sundling Advisor: Prof. Curt Breneman Department of Chemistry and Chemical Biology/Center for Biotechnology and Interdisciplinary Studies Rensselaer Polytechnic Institute Rensselaer Exploratory Center for Cheminformatics Research http://reccr.chem.rpi.edu/ Many thanks to Theresa Hepburn! Upcoming lecture plug: Prof. Curt Breneman DSES Department November 15th Advances in Cheminformatics: Applications in Biotechnology, Drug Design and Bioseparations Cheminformatics is about collecting, storing, and analyzing [usually large amounts of] chemical data. •Pharmaceutical research •Materials design •Computational/Automated techniques for analysis •Virtual high-throughput screening (VHTS) QSAR - quantitative structure-activity relationship Molecular Model Activity Structures O N N Cl AAACCTCATAGGAAGCA TACCAGGAATTACATCA … Molecular Model Activity Structures O N N Cl AAACCTCATAGGAAGCATACCA GGAATTACATCA… Structural Descriptors Physiochemical Descriptors Topological Descriptors Geometrical Descriptors Molecular Descriptors Model Activity Structures Acitivty: bioactivity, ADME/Tox evaluation, hERG channel effects, p-456 isozyme inhibition, anti- malarial efficacy, etc… Structural Descriptors Physiochemical Descriptors Topological Descriptors Molecule D1 D2 … Activity (IC50) molecule #1 21 0.1 Geometrical Descriptors = molecule #2 33 2.1 molecule #3 10 0.9 + … Activity Molecular Descriptors Model Activity Structures Goal: Minimize the error: ∑((yi −f xi)) f1(x) f2(x) Regression Models: linear, multi-linear,
  • Committee on Publications and Cheminformatics Data Standards (CPCDS)

    Committee on Publications and Cheminformatics Data Standards (CPCDS)

    Committee on Publications and Cheminformatics Data Standards (CPCDS) Report to the Bureau, April 2020 Leah McEwen, Committee Chair I. Executive Summary The IUPAC Committee on Publications and Cheminformatics Data Standards (CPCDS) advises on issues related to dissemination of information, primarily of IUPAC outputs. The portfolio is expanding and diversifying, in types of content, modes of publication and potential readership. Publication of IUPAC recommendations, technical reports and other information resources remains at the core of IUPAC dissemination activity and that of CPCDS. Increasingly the committee also focuses on the development and dissemination of chemical data and information standards to facilitate robust communication in the digital environment. Further details on these two priority areas are provided in Appendix A (Subcommittee on Publications: Report to CPCDS) and Appendix B (CPCDS Chair’s Statement: Towards a “Digital IUPAC”). The 2018-2019 biennium brought stability to key systems and workflows including those supporting IUPAC’s flagship journal Pure and Applied Chemistry (PAC) and online access to the Compendium of Chemical Terminology (a.k.a., the “Gold Book”). A number of collaborative symposia and workshops with strategic partners including CODATA and the GO FAIR Chemistry Implementation Network (ChIN) surfaced use cases and infrastructure needs for digital science among diverse community stakeholders. These activities lay the groundwork for developing a robust and systematic program for Digital IUPAC and “the creation of a consistent and interoperable global framework for human and machine-readable chemical information,” as articulated in the CPCDS Terms of Reference. This vision will be a critical component of success for IUPAC’s contribution towards the United Nations Sustainable Development Goals.
  • Scalable Analysis of Large Datasets in Life Sciences

    Scalable Analysis of Large Datasets in Life Sciences

    Scalable Analysis of Large Datasets in Life Sciences LAEEQ AHMED Doctoral Thesis in Computer Science Stockholm, Sweden 2019 Division of Computational Science and Technology School of Electrical Engineerning and Computer Science KTH Royal Institute of Technology TRITA-EECS-AVL-2019:69 SE-100 44 Stockholm ISBN: 978-91-7873-309-5 SWEDEN Akademisk avhandling som med tillstånd av Kungl Tekniska högskolan framlägges till offentlig granskning för avläggande av teknologie doktorsexamen i elektrotek- nik och datavetenskap tisdag den 3:e Dec 2019, klockan 10.00 i sal Kollegiesalen, Brinellvägen 8, KTH-huset, Kungliga Tekniska Högskolan. © Laeeq Ahmed, 2019 Tryck: Universitetsservice US AB To my respected parents, my beloved wife and my lovely brother and sister Abstract We are experiencing a deluge of data in all fields of scientific and business research, particularly in the life sciences, due to the development of better instrumentation and the rapid advancements that have occurred in informa- tion technology in recent times. There are major challenges when it comes to handling such large amounts of data. These range from the practicalities of managing these large volumes of data, to understanding the meaning and practical implications of the data. In this thesis, I present parallel methods to efficiently manage, process, analyse and visualize large sets of data from several life sciences fields at a rapid rate, while building and utilizing various machine learning techniques in a novel way. Most of the work is centred on applying the latest Big Data Analytics frameworks for creating efficient virtual screening strategies while working with large datasets. Virtual screening is a method in cheminformatics used for Drug discovery by searching large libraries of molecule structures.
  • Cheminformatics for Genome-Scale Metabolic Reconstructions

    Cheminformatics for Genome-Scale Metabolic Reconstructions

    CHEMINFORMATICS FOR GENOME-SCALE METABOLIC RECONSTRUCTIONS John W. May European Molecular Biology Laboratory European Bioinformatics Institute University of Cambridge Homerton College A thesis submitted for the degree of Doctor of Philosophy June 2014 Declaration This thesis is the result of my own work and includes nothing which is the outcome of work done in collaboration except where specifically indicated in the text. This dissertation is not substantially the same as any I have submitted for a degree, diploma or other qualification at any other university, and no part has already been, or is currently being submitted for any degree, diploma or other qualification. This dissertation does not exceed the specified length limit of 60,000 words as defined by the Biology Degree Committee. This dissertation has been typeset using LATEX in 11 pt Palatino, one and half spaced, according to the specifications defined by the Board of Graduate Studies and the Biology Degree Committee. June 2014 John W. May to Róisín Acknowledgements This work was carried out in the Cheminformatics and Metabolism Group at the European Bioinformatics Institute (EMBL-EBI). The project was fund- ed by Unilever, the Biotechnology and Biological Sciences Research Coun- cil [BB/I532153/1], and the European Molecular Biology Laboratory. I would like to thank my supervisor, Christoph Steinbeck for his guidance and providing intellectual freedom. I am also thankful to each member of my thesis advisory committee: Gordon James, Julio Saez-Rodriguez, Kiran Patil, and Gos Micklem who gave their time, advice, and guidance. I am thankful to all members of the Cheminformatics and Metabolism Group.
  • Print Special Issue Flyer

    Print Special Issue Flyer

    IMPACT FACTOR 4.411 an Open Access Journal by MDPI Cheminformatics, Past, Present, and Future: From Chemistry to Nanotechnology and Complex Systems Guest Editors: Message from the Guest Editors Prof. Dr. Humbert González- Cheminformatics techniques form have been interesting Díaz tools in the effort to explore large chemical spaces, [email protected] reducing at the same time animal testing as well as costs in Dr. Aliuska Duardo-Sanchez terms of materials and human resources on drug discovery [email protected] processes in medicinal chemistry. In addition, with the emergence of nanotechnologies, cheminformatics needs Prof. Dr. Alejandro Pazos to deal with drug–nanoparticle systems used as drug Sierra [email protected] delivery systems, drug co-therapy systems, etc. This brings to mind the application of cheminformatics in areas beyond drug discovery such as the fuel industry, polymer sciences, materials science, and biomedical engineering. Deadline for manuscript submissions: In this context, we propose to open this new issue to closed (15 November 2020) discuss with all colleagues worldwide all the past, present, and future challenges of cheminformatics. The present Special Issue is also associated with MOL2NET-05, the International Conference on Multidisciplinary Sciences, ISSN: 2624-5078, MDPI SciForum, Basel, Switzerland, 2019. The link of the conference: https://mol2net- 05.sciforum.net/. We especially encourage submissions of papers from colleagues worldwide to the conference (short communications) and complete versions (full papers) to the present Special Issue. mdpi.com/si/31770 SpeciaIslsue IMPACT FACTOR 4.411 an Open Access Journal by MDPI Editor-in-Chief Message from the Editor-in-Chief Prof.
  • Trust, but Verify: on the Importance of Chemical Structure Curation in Cheminformatics and QSAR Modeling Research

    Trust, but Verify: on the Importance of Chemical Structure Curation in Cheminformatics and QSAR Modeling Research

    J. Chem. Inf. Model. XXXX, xxx, 000 A Trust, But Verify: On the Importance of Chemical Structure Curation in Cheminformatics and QSAR Modeling Research Denis Fourches,† Eugene Muratov,†,‡ and Alexander Tropsha*,† Laboratory for Molecular Modeling, Eshelman School of Pharmacy, University of North Carolina, Chapel Hill, North Carolina 27599, and Laboratory of Theoretical Chemistry, Department of Molecular Structure, A.V. Bogatsky Physical-Chemical Institute NAS of Ukraine, Odessa, 65080, Ukraine Received May 5, 2010 1. INTRODUCTION to the prediction performances of the derivative QSAR models. They also presented several illustrative examples With the recent advent of high-throughput technologies of incorrect structures generated from either correct or for both compound synthesis and biological screening, there incorrect SMILES. The main conclusions of the study were is no shortage of publicly or commercially available data that small structural errors within a data set could lead to sets and databases1 that can be used for computational drug 2 significant losses of predictive ability of QSAR models. The discovery applications (reviewed recently in Williams et al. ). authors further demonstrated that manual curation of struc- Rapid growth of large, publicly available databases (such 3 4 tural data leads to substantial increase in the model predic- as PubChem or ChemSpider containing more than 20 tivity. This conclusion becomes especially important in light million molecular records each) enabled by experimental of the aforementioned study of Oprea et al.6 that cited a projects such as NIH’s Molecular Libraries and Imaging significant error rate in medicinal chemistry literature. Initiative5 provides new opportunities for the development Alarmed by these conclusions, we have examined several of cheminformatics methodologies and their application to popular public databases of bioactive molecules to assess knowledge discovery in molecular databases.
  • Chemoinformatics for Green Chemistry

    Chemoinformatics for Green Chemistry

    Contents LIST OF PAPERS .................................................................................... 3 LISTS OF ACRONYMS AND ABBREVIATIONS ............................... 4 INTRODUCTION .................................................................................. 7 BACKGROUND .............................................................................................7 AIMS OF THE THESIS ..................................................................................9 METHODOLOGY ............................................................................... 11 QUANTITATIVE STRUCTURE-PROPERTY RELATIONSHIPS (QSPR)......11 Linear Free Energy Relationships (LFER)...............................................11 Linear Solvation Energy Relationship (LSER).........................................12 Reversed-Phase Liquid Chromatography (RPLC).....................................14 Quantitative Structure-Retention Relationships (QSRR) .........................14 Global Linear Solvation Energy Relationship (LSER)..............................15 Molecular Descriptors ...............................................................................16 The Definition of the Applicability Domain ..............................................17 The Distance-Based Approach Using PLS.......................................17 The Williams Plot .............................................................................18 Associative Neural Networks (ASNN)..............................................19 DATA ANALYSIS ........................................................................................20
  • The Literature of Chemoinformatics: 1978–2018

    The Literature of Chemoinformatics: 1978–2018

    International Journal of Molecular Sciences Editorial The Literature of Chemoinformatics: 1978–2018 Peter Willett Information School, University of Sheffield, Sheffield S1 4DP, UK; p.willett@sheffield.ac.uk Received: 17 July 2020; Accepted: 31 July 2020; Published: 4 August 2020 Abstract: This article presents a study of the literature of chemoinformatics, updating and building upon an analogous bibliometric investigation that was published in 2008. Data on outputs in the field, and citations to those outputs, were obtained by means of topic searches of the Web of Science Core Collection. The searches demonstrate that chemoinformatics is by now a well-defined sub-discipline of chemistry, and one that forms an essential part of the chemical educational curriculum. There are three core journals for the subject: The Journal of Chemical Information and Modeling, the Journal of Cheminformatics, and Molecular Informatics, and, having established itself, chemoinformatics is now starting to export knowledge to disciplines outside of chemistry. Keywords: bibliometrics; cheminformatics; chemoinformatics; scientometrics 1. Introduction Increasing use is being made of bibliometric methods to analyze the published academic literature, with studies focusing on, e.g., author productivity, the articles appearing in a specific journal, the characteristics of bibliographic frequency distributions, new metrics for research evaluation, and the citations to publications in a specific subject area inter alia (e.g., [1–6]). There have been many bibliometric studies of various aspects of chemistry over the years, with probably the earliest such study being the famous 1926 paper by Lotka in which he discussed author productivity based in part on an analysis of publications in Chemical Abstracts [7].
  • Cheminformatics-Aided Pharmacovigilance: Application To

    Cheminformatics-Aided Pharmacovigilance: Application To

    Low Y. et al. J Am Med Inform Assoc 2015;0:1–11. doi:10.1093/jamia/ocv127, Research and Applications Journal of the American Medical Informatics Association Advance Access published October 24, 2015 RECEIVED 27 March 2015 Cheminformatics-aided pharmacovigilance: REVISED 6 July 2015 ACCEPTED 11 July 2015 application to Stevens-Johnson Syndrome Yen S Low1,2, Ola Caster3,4, Tomas Bergvall3, Denis Fourches1, Xiaoling Zang1, G Niklas Nore´n3,5, Ivan Rusyn2, Ralph Edwards3, Alexander Tropsha1 ABSTRACT .................................................................................................................................................... Objective Quantitative Structure-Activity Relationship (QSAR) models can predict adverse drug reactions (ADRs), and thus provide early warnings of potential hazards. Timely identification of potential safety concerns could protect patients and aid early diagnosis of ADRs among the exposed. Our objective was to determine whether global spontaneous reporting patterns might allow chemical substructures associated with Stevens- Johnson Syndrome (SJS) to be identified and utilized for ADR prediction by QSAR models. RESEARCH AND APPLICATIONS Materials and Methods Using a reference set of 364 drugs having positive or negative reporting correlations with SJS in the VigiBase global repo- sitory of individual case safety reports (Uppsala Monitoring Center, Uppsala, Sweden), chemical descriptors were computed from drug molecular structures. Random Forest and Support Vector Machines methods were used to develop QSAR models, which were validated by external 5-fold cross validation. Models were employed for virtual screening of DrugBank to predict SJS actives and inactives, which were corroborated using Downloaded from knowledge bases like VigiBase, ChemoText, and MicroMedex (Truven Health Analytics Inc, Ann Arbor, Michigan). Results We developed QSAR models that could accurately predict if drugs were associated with SJS (area under the curve of 75%–81%).
  • The Tonnabytes Big Data Challenge

    The Tonnabytes Big Data Challenge

    The Tonnabytes Big Data Challenge: Transforming Science and Education Kirk Borne George Mason University Ever since we first began to explore our world… … humans have asked questions and … … have collected evidence (data) to help answer those questions. Astronomy: the world’s second oldest profession ! Characteristics of Big Data • Big quantities of data are acquired everywhere now. But… • What do we mean by “big”? • Gigabytes? Terabytes? Petabytes? Exabytes? • The meaning of “big” is domain-specific and resource- dependent (data storage, I/O bandwidth, computation cycles, communication costs) • I say … we all are dealing with our own “tonnabytes” • There are 4 dimensions to the Big Data challenge: 1. Volume (tonnabytes data challenge) 2. Complexity (variety, curse of dimensionality) 3. Rate of data and information flowing to us (velocity) 4. Verification (verifying inference-based models from data) • Therefore, we need something better to cope with the data tsunami … Data Science – Informatics – Data Mining Examples of Recommendations**: Inference from Massive or Complex Data • Advances in fundamental mathematics and statistics are needed to provide the language, structure, and tools for many needed methodologies of data-enabled scientific inference. – Example : Machine learning in massive data sets • Algorithmic advances in handling massive and complex data are crucial. • Visualization (visual analytics) and citizen science (human computation or data processing) will play key roles. • ** From the NSF report: Data-Enabled Science in the Mathematical and Physical Sciences, (2010) http://www.cra.org/ccc/docs/reports/DES-report_final.pdf This graphic says it all … • Clustering – examine the data and find the data clusters (clouds), without considering what the items are = Characterization ! • Classification – for each new data item, try to place it within a known class (i.e., a known category or cluster) = Classify ! • Outlier Detection – identify those data items that don’t fit into the known classes or clusters = Surprise ! Graphic provided by Professor S.