DOCSLIB.ORG

Joelib Tutorial

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Joelib Tutorial JOELib Tutorial A Java based cheminformatics/computational chemistry package Dipl. Chem. Jörg K. Wegner JOELib Tutorial: A Java based cheminformatics/computational chemistry package by Dipl. Chem. Jörg K. Wegner Published $Date: 2004/03/16 09:16:14 $ Copyright © 2002, 2003, 2004 Dept. Computer Architecture, University of Tübingen, GermanyJörg K. Wegner Updated $Date: 2004/03/16 09:16:14 $ License This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation version 2 of the License. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. Documents PS (JOELibTutorial.ps), PDF (JOELibTutorial.pdf), RTF (JOELibTutorial.rtf) versions of this tutorial are available. Plucker E-Book (http://www.plkr.org) versions: HiRes-color (JOELib-HiRes-color.pdb), HiRes-grayscale (JOELib-HiRes-grayscale.pdb) (recommended), HiRes-black/white (JOELib-HiRes-bw.pdb), color (JOELib-color.pdb), grayscale (JOELib-grayscale.pdb), black/white (JOELib-bw.pdb) Revision History Revision $Revision: 1.5 $ $Date: 2004/03/16 09:16:14 $ $Id: JOELibTutorial.sgml,v 1.5 2004/03/16 09:16:14 wegner Exp $ Table of Contents Preface ........................................................................................................................................................i 1. Installing JOELib .................................................................................................................................1 Java Development Kit (JDK)............................................................................................................1 Ant - XML based makefile mechanism ............................................................................................1 Installing and starting JOELib ..........................................................................................................1 Linux/Unix ..............................................................................................................................1 Windows 2000/NT ..................................................................................................................2 Windows 95/98/XP .................................................................................................................2 Matlab toolbox..................................................................................................................................3 Using another JDK ..................................................................................................................3 2. JOELib basics .......................................................................................................................................4 Atoms................................................................................................................................................4 Accessing atoms ......................................................................................................................4 Chemical properties.................................................................................................................4 Bonds ................................................................................................................................................5 Accessing bonds ......................................................................................................................5 Chemical properties.................................................................................................................6 Molecule ...........................................................................................................................................7 Basics ......................................................................................................................................7 Chemical properties.................................................................................................................7 3. Molecule operation methods and classes ............................................................................................8 Molecule ...........................................................................................................................................8 Molecule data entries...............................................................................................................8 Molecule descriptors ...............................................................................................................8 Set and get descriptor data entries..................................................................................8 Using external calculated descriptors.............................................................................9 Available descriptors ...................................................................................................10 Writing your own descriptor and result classes ...........................................................10 SMiles ARbitrary Target Specification (SMARTS)-substructure search .......................................11 SMARTS basics ....................................................................................................................11 SMARTS definition...............................................................................................................11 Programmable Atom Typer (PATTY)...................................................................................12 SMARTS based structure modification.................................................................................12 Processes and filters........................................................................................................................13 Processes (internal, Java).......................................................................................................13 Process filters ........................................................................................................................13 External processes .................................................................................................................13 Input and output ..............................................................................................................................14 Supported input and output formats ......................................................................................14 XML respective Chemical Markup Language (CML).................................................15 CACTVS's clear text format (CTX).............................................................................16 Image writers (BMP, GIF, JPEG, PPM) ......................................................................18 iii Joint Commitee on Atomic and Molecular Physical Data (JCAMP)...........................17 Protein Data Base (PDB) .............................................................................................17 Portable Adobe Document Format (PDF)....................................................................18 Persistence Of Vision (POV) Ray Tracer ....................................................................18 Structured Data File (SDF) ..........................................................................................18 Simplified Molecular Input Line Entry System (SMILES) .........................................18 Sybyl (MOL2)..............................................................................................................19 Tinker (TINKER).........................................................................................................19 Writing your own import/export filter...................................................................................19 Assigning atom types, aromatic flags, hybridization and hydrogens..............................................19 Assigning aromaticity flags...................................................................................................20 Assigning atom hybridizations ..............................................................................................20 Assigning atom types ............................................................................................................20 Assigning implicite hydrogens ..............................................................................................20 Calculate descriptors and/or assign special atomtypes ..........................................................21 4. Used utilities........................................................................................................................................22 Development...................................................................................................................................22 Maintenance....................................................................................................................................22 5. Descriptors ..........................................................................................................................................24 Native values...................................................................................................................................24 Number of acidic groups .......................................................................................................24
Load more

Recommended publications
  • Open Data, Open Source, and Open Standards in Chemistry: the Blue Obelisk Five Years On" Journal of Cheminformatics Vol
    Oral Roberts University Digital Showcase College of Science and Engineering Faculty College of Science and Engineering Research and Scholarship 10-14-2011 Open Data, Open Source, and Open Standards in Chemistry: The lueB Obelisk five years on Andrew Lang Noel M. O'Boyle Rajarshi Guha National Institutes of Health Egon Willighagen Maastricht University Samuel Adams See next page for additional authors Follow this and additional works at: http://digitalshowcase.oru.edu/cose_pub Part of the Chemistry Commons Recommended Citation Andrew Lang, Noel M O'Boyle, Rajarshi Guha, Egon Willighagen, et al.. "Open Data, Open Source, and Open Standards in Chemistry: The Blue Obelisk five years on" Journal of Cheminformatics Vol. 3 Iss. 37 (2011) Available at: http://works.bepress.com/andrew-sid-lang/ 19/ This Article is brought to you for free and open access by the College of Science and Engineering at Digital Showcase. It has been accepted for inclusion in College of Science and Engineering Faculty Research and Scholarship by an authorized administrator of Digital Showcase. For more information, please contact [email protected]. Authors Andrew Lang, Noel M. O'Boyle, Rajarshi Guha, Egon Willighagen, Samuel Adams, Jonathan Alvarsson, Jean- Claude Bradley, Igor Filippov, Robert M. Hanson, Marcus D. Hanwell, Geoffrey R. Hutchison, Craig A. James, Nina Jeliazkova, Karol M. Langner, David C. Lonie, Daniel M. Lowe, Jerome Pansanel, Dmitry Pavlov, Ola Spjuth, Christoph Steinbeck, Adam L. Tenderholt, Kevin J. Theisen, and Peter Murray-Rust This article is available at Digital Showcase: http://digitalshowcase.oru.edu/cose_pub/34 Oral Roberts University From the SelectedWorks of Andrew Lang October 14, 2011 Open Data, Open Source, and Open Standards in Chemistry: The Blue Obelisk five years on Andrew Lang Noel M O'Boyle Rajarshi Guha, National Institutes of Health Egon Willighagen, Maastricht University Samuel Adams, et al.
    [Show full text]
  • A Study on Cheminformatics and Its Applications on Modern Drug Discovery
    Available online at www.sciencedirect.com Procedia Engineering 38 ( 2012 ) 1264 – 1275 Internatio na l Conference on Modeling Optimisatio n and Computing (ICMOC 2012) A Study on Cheminformatics and its Applications on Modern Drug Discovery B.Firdaus Begama and Dr. J.Satheesh Kumarb aResearch Scholar, Bharathiar University, Coimbatore, India, [email protected] bAssistant Professor, Bharathiar University, Coimbatore, India, [email protected] Abstract Discovering drugs to a disease is still a challenging task for medical researchers due to the complex structures of biomolecules which are responsible for disease such as AIDS, Cancer, Autism, Alzimear etc. Design and development of new efficient anti-drugs for the disease without any side effects are becoming mandatory in the recent history of human life cycle due to changes in various factors which includes food habit, environmental and migration in human life style. Cheminformaticds deals with discovering drugs based in modern drug discovery techniques which in turn rectifies complex issues in traditional drug discovery system. Cheminformatics tools, helps medical chemist for better understanding of complex structures of chemical compounds. Cheminformatics is a new emerging interdisciplinary field which primarily aims to discover Novel Chemical Entities [NCE] which ultimately results in design of new molecule [chemical data]. It also plays an important role for collecting, storing and analysing the chemical data. This paper focuses on cheminformatics and its applications on drug discovery and modern drug discovery techniques which helps chemist and medical researchers for finding solution to the complex disease. © 2012 Published by Elsevier Ltd. Selection and/or peer-review under responsibility of Noorul Islam Centre for Higher Education.
    [Show full text]
  • Molecular Structure Input on the Web Peter Ertl
    Ertl Journal of Cheminformatics 2010, 2:1 http://www.jcheminf.com/content/2/1/1 REVIEW Open Access Molecular structure input on the web Peter Ertl Abstract A molecule editor, that is program for input and editing of molecules, is an indispensable part of every cheminfor- matics or molecular processing system. This review focuses on a special type of molecule editors, namely those that are used for molecule structure input on the web. Scientific computing is now moving more and more in the direction of web services and cloud computing, with servers scattered all around the Internet. Thus a web browser has become the universal scientific user interface, and a tool to edit molecules directly within the web browser is essential. The review covers a history of web-based structure input, starting with simple text entry boxes and early molecule editors based on clickable maps, before moving to the current situation dominated by Java applets. One typical example - the popular JME Molecule Editor - will be described in more detail. Modern Ajax server-side molecule editors are also presented. And finally, the possible future direction of web-based molecule editing, based on tech- nologies like JavaScript and Flash, is discussed. Introduction this trend and input of molecular structures directly A program for the input and editing of molecules is an within a web browser is therefore of utmost importance. indispensable part of every cheminformatics or molecu- In this overview a history of entering molecules into lar processing system. Such a program is known as a web applications will be covered, starting from simple molecule editor, molecular editor or structure sketcher.
    [Show full text]
  • Mannhold Methods and Principles in Medicinal Chemistry
    Molecular Drug Properties Edited by Raimund Mannhold Methods and Principles in Medicinal Chemistry Edited by R. Mannhold, H. Kubinyi, G. Folkers Editorial Board H. Timmerman, J. Vacca, H. van de Waterbeemd, T. Wieland Previous Volumes of this Series: G. Cruciani (ed.) T. Langer, R. D. Hofmann (eds.) Molecular Interaction Fields Pharmacophores and Vol. 27 Pharmacophore Searches 2006, ISBN 978-3-527-31087-6 Vol. 32 2006, ISBN 978-3-527-31250-4 M. Hamacher, K. Marcus, K. Stühler, A. van Hall, B. Warscheid, H. E. Meyer (eds.) E. Francotte, W. Lindner (eds.) Proteomics in Drug Research Chirality in Drug Research Vol. 28 Vol. 33 2006, ISBN 978-3-527-31226-9 2006, ISBN 978-3-527-31076-0 D. J. Triggle, M. Gopalakrishnan, W. Jahnke, D. A. Erlanson (eds.) D. Rampe, W. Zheng (eds.) Fragment-based Approaches Voltage-Gated Ion Channels in Drug Discovery as Drug Targets Vol. 34 Vol. 29 2006, ISBN 978-3-527-31291-7 2006, ISBN 978-3-527-31258-0 D. Rognan (ed.) J. Hüser (ed.) Ligand Design for G High-Throughput Screening Protein-coupled Receptors in Drug Discovery Vol. 30 Vol. 35 2006, ISBN 978-3-527-31284-9 2006, ISBN 978-3-527-31283-2 D. A. Smith, H. van de Waterbeemd, K. Wanner, G. Höfner (eds.) D. K. Walker Mass Spectrometry in Pharmacokinetics and Medicinal Chemistry Metabolism in Drug Design, Vol. 36 2nd Ed. 2007, ISBN 978-3-527-31456-0 Vol. 31 2006, ISBN 978-3-527-31368-6 Molecular Drug Properties Measurement and Prediction Edited by Raimund Mannhold Series Editors All books published by Wiley-VCH are carefully produced.
    [Show full text]
  • Semantic Web Integration of Cheminformatics Resources with the SADI Framework Leonid L Chepelev1* and Michel Dumontier1,2,3
    Chepelev and Dumontier Journal of Cheminformatics 2011, 3:16 http://www.jcheminf.com/content/3/1/16 METHODOLOGY Open Access Semantic Web integration of Cheminformatics resources with the SADI framework Leonid L Chepelev1* and Michel Dumontier1,2,3 Abstract Background: The diversity and the largely independent nature of chemical research efforts over the past half century are, most likely, the major contributors to the current poor state of chemical computational resource and database interoperability. While open software for chemical format interconversion and database entry cross-linking have partially addressed database interoperability, computational resource integration is hindered by the great diversity of software interfaces, languages, access methods, and platforms, among others. This has, in turn, translated into limited reproducibility of computational experiments and the need for application-specific computational workflow construction and semi-automated enactment by human experts, especially where emerging interdisciplinary fields, such as systems chemistry, are pursued. Fortunately, the advent of the Semantic Web, and the very recent introduction of RESTful Semantic Web Services (SWS) may present an opportunity to integrate all of the existing computational and database resources in chemistry into a machine-understandable, unified system that draws on the entirety of the Semantic Web. Results: We have created a prototype framework of Semantic Automated Discovery and Integration (SADI) framework SWS that exposes the QSAR descriptor functionality of the Chemistry Development Kit. Since each of these services has formal ontology-defined input and output classes, and each service consumes and produces RDF graphs, clients can automatically reason about the services and available reference information necessary to complete a given overall computational task specified through a simple SPARQL query.
    [Show full text]
  • Introduction to Bioinformatics (Elective) – SBB1609
    SCHOOL OF BIO AND CHEMICAL ENGINEERING DEPARTMENT OF BIOTECHNOLOGY Unit 1 – Introduction to Bioinformatics (Elective) – SBB1609 1 I HISTORY OF BIOINFORMATICS Bioinformatics is an interdisciplinary field that develops methods and software tools for understanding biologicaldata. As an interdisciplinary field of science, bioinformatics combines computer science, statistics, mathematics, and engineering to analyze and interpret biological data. Bioinformatics has been used for in silico analyses of biological queries using mathematical and statistical techniques. Bioinformatics derives knowledge from computer analysis of biological data. These can consist of the information stored in the genetic code, but also experimental results from various sources, patient statistics, and scientific literature. Research in bioinformatics includes method development for storage, retrieval, and analysis of the data. Bioinformatics is a rapidly developing branch of biology and is highly interdisciplinary, using techniques and concepts from informatics, statistics, mathematics, chemistry, biochemistry, physics, and linguistics. It has many practical applications in different areas of biology and medicine. Bioinformatics: Research, development, or application of computational tools and approaches for expanding the use of biological, medical, behavioral or health data, including those to acquire, store, organize, archive, analyze, or visualize such data. Computational Biology: The development and application of data-analytical and theoretical methods, mathematical modeling and computational simulation techniques to the study of biological, behavioral, and social systems. "Classical" bioinformatics: "The mathematical, statistical and computing methods that aim to solve biological problems using DNA and amino acid sequences and related information.” The National Center for Biotechnology Information (NCBI 2001) defines bioinformatics as: "Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline.
    [Show full text]
  • Cheminformatics and Chemical Information
    Cheminformatics and Chemical Information Matt Sundling Advisor: Prof. Curt Breneman Department of Chemistry and Chemical Biology/Center for Biotechnology and Interdisciplinary Studies Rensselaer Polytechnic Institute Rensselaer Exploratory Center for Cheminformatics Research http://reccr.chem.rpi.edu/ Many thanks to Theresa Hepburn! Upcoming lecture plug: Prof. Curt Breneman DSES Department November 15th Advances in Cheminformatics: Applications in Biotechnology, Drug Design and Bioseparations Cheminformatics is about collecting, storing, and analyzing [usually large amounts of] chemical data. •Pharmaceutical research •Materials design •Computational/Automated techniques for analysis •Virtual high-throughput screening (VHTS) QSAR - quantitative structure-activity relationship Molecular Model Activity Structures O N N Cl AAACCTCATAGGAAGCA TACCAGGAATTACATCA … Molecular Model Activity Structures O N N Cl AAACCTCATAGGAAGCATACCA GGAATTACATCA… Structural Descriptors Physiochemical Descriptors Topological Descriptors Geometrical Descriptors Molecular Descriptors Model Activity Structures Acitivty: bioactivity, ADME/Tox evaluation, hERG channel effects, p-456 isozyme inhibition, anti- malarial efficacy, etc… Structural Descriptors Physiochemical Descriptors Topological Descriptors Molecule D1 D2 … Activity (IC50) molecule #1 21 0.1 Geometrical Descriptors = molecule #2 33 2.1 molecule #3 10 0.9 + … Activity Molecular Descriptors Model Activity Structures Goal: Minimize the error: ∑((yi −f xi)) f1(x) f2(x) Regression Models: linear, multi-linear,
    [Show full text]
  • Committee on Publications and Cheminformatics Data Standards (CPCDS)
    Committee on Publications and Cheminformatics Data Standards (CPCDS) Report to the Bureau, April 2020 Leah McEwen, Committee Chair I. Executive Summary The IUPAC Committee on Publications and Cheminformatics Data Standards (CPCDS) advises on issues related to dissemination of information, primarily of IUPAC outputs. The portfolio is expanding and diversifying, in types of content, modes of publication and potential readership. Publication of IUPAC recommendations, technical reports and other information resources remains at the core of IUPAC dissemination activity and that of CPCDS. Increasingly the committee also focuses on the development and dissemination of chemical data and information standards to facilitate robust communication in the digital environment. Further details on these two priority areas are provided in Appendix A (Subcommittee on Publications: Report to CPCDS) and Appendix B (CPCDS Chair’s Statement: Towards a “Digital IUPAC”). The 2018-2019 biennium brought stability to key systems and workflows including those supporting IUPAC’s flagship journal Pure and Applied Chemistry (PAC) and online access to the Compendium of Chemical Terminology (a.k.a., the “Gold Book”). A number of collaborative symposia and workshops with strategic partners including CODATA and the GO FAIR Chemistry Implementation Network (ChIN) surfaced use cases and infrastructure needs for digital science among diverse community stakeholders. These activities lay the groundwork for developing a robust and systematic program for Digital IUPAC and “the creation of a consistent and interoperable global framework for human and machine-readable chemical information,” as articulated in the CPCDS Terms of Reference. This vision will be a critical component of success for IUPAC’s contribution towards the United Nations Sustainable Development Goals.
    [Show full text]
  • Optimizing the Use of Open-Source Software Applications in Drug
    DDT • Volume 11, Number 3/4 • February 2006 REVIEWS TICS INFORMA Optimizing the use of open-source • software applications in drug discovery Reviews Werner J. Geldenhuys1, Kevin E. Gaasch2, Mark Watson2, David D. Allen1 and Cornelis J.Van der Schyf1,3 1Department of Pharmaceutical Sciences, School of Pharmacy,Texas Tech University Health Sciences Center, Amarillo,TX, USA 2West Texas A&M University, Canyon,TX, USA 3Pharmaceutical Chemistry, School of Pharmacy, North-West University, Potchefstroom, South Africa Drug discovery is a time consuming and costly process. Recently, a trend towards the use of in silico computational chemistry and molecular modeling for computer-aided drug design has gained significant momentum. This review investigates the application of free and/or open-source software in the drug discovery process. Among the reviewed software programs are applications programmed in JAVA, Perl and Python, as well as resources including software libraries. These programs might be useful for cheminformatics approaches to drug discovery, including QSAR studies, energy minimization and docking studies in drug design endeavors. Furthermore, this review explores options for integrating available computer modeling open-source software applications in drug discovery programs. To bring a new drug to the market is very costly, with the current of combinatorial approaches and HTS. The addition of computer- price tag approximating US$800 million, according to data reported aided drug design technologies to the R&D approaches of a com- in a recent study [1]. Therefore, it is not surprising that pharma- pany, could lead to a reduction in the cost of drug design and ceutical companies are seeking ways to optimize costs associated development by up to 50% [6,7].
    [Show full text]
  • Scalable Analysis of Large Datasets in Life Sciences
    Scalable Analysis of Large Datasets in Life Sciences LAEEQ AHMED Doctoral Thesis in Computer Science Stockholm, Sweden 2019 Division of Computational Science and Technology School of Electrical Engineerning and Computer Science KTH Royal Institute of Technology TRITA-EECS-AVL-2019:69 SE-100 44 Stockholm ISBN: 978-91-7873-309-5 SWEDEN Akademisk avhandling som med tillstånd av Kungl Tekniska högskolan framlägges till offentlig granskning för avläggande av teknologie doktorsexamen i elektrotek- nik och datavetenskap tisdag den 3:e Dec 2019, klockan 10.00 i sal Kollegiesalen, Brinellvägen 8, KTH-huset, Kungliga Tekniska Högskolan. © Laeeq Ahmed, 2019 Tryck: Universitetsservice US AB To my respected parents, my beloved wife and my lovely brother and sister Abstract We are experiencing a deluge of data in all fields of scientific and business research, particularly in the life sciences, due to the development of better instrumentation and the rapid advancements that have occurred in informa- tion technology in recent times. There are major challenges when it comes to handling such large amounts of data. These range from the practicalities of managing these large volumes of data, to understanding the meaning and practical implications of the data. In this thesis, I present parallel methods to efficiently manage, process, analyse and visualize large sets of data from several life sciences fields at a rapid rate, while building and utilizing various machine learning techniques in a novel way. Most of the work is centred on applying the latest Big Data Analytics frameworks for creating efficient virtual screening strategies while working with large datasets. Virtual screening is a method in cheminformatics used for Drug discovery by searching large libraries of molecule structures.
    [Show full text]
  • Cheminformatics for Genome-Scale Metabolic Reconstructions
    CHEMINFORMATICS FOR GENOME-SCALE METABOLIC RECONSTRUCTIONS John W. May European Molecular Biology Laboratory European Bioinformatics Institute University of Cambridge Homerton College A thesis submitted for the degree of Doctor of Philosophy June 2014 Declaration This thesis is the result of my own work and includes nothing which is the outcome of work done in collaboration except where specifically indicated in the text. This dissertation is not substantially the same as any I have submitted for a degree, diploma or other qualification at any other university, and no part has already been, or is currently being submitted for any degree, diploma or other qualification. This dissertation does not exceed the specified length limit of 60,000 words as defined by the Biology Degree Committee. This dissertation has been typeset using LATEX in 11 pt Palatino, one and half spaced, according to the specifications defined by the Board of Graduate Studies and the Biology Degree Committee. June 2014 John W. May to Róisín Acknowledgements This work was carried out in the Cheminformatics and Metabolism Group at the European Bioinformatics Institute (EMBL-EBI). The project was fund- ed by Unilever, the Biotechnology and Biological Sciences Research Coun- cil [BB/I532153/1], and the European Molecular Biology Laboratory. I would like to thank my supervisor, Christoph Steinbeck for his guidance and providing intellectual freedom. I am also thankful to each member of my thesis advisory committee: Gordon James, Julio Saez-Rodriguez, Kiran Patil, and Gos Micklem who gave their time, advice, and guidance. I am thankful to all members of the Cheminformatics and Metabolism Group.
    [Show full text]
  • Print Special Issue Flyer
    IMPACT FACTOR 4.411 an Open Access Journal by MDPI Cheminformatics, Past, Present, and Future: From Chemistry to Nanotechnology and Complex Systems Guest Editors: Message from the Guest Editors Prof. Dr. Humbert González- Cheminformatics techniques form have been interesting Díaz tools in the effort to explore large chemical spaces, [email protected] reducing at the same time animal testing as well as costs in Dr. Aliuska Duardo-Sanchez terms of materials and human resources on drug discovery [email protected] processes in medicinal chemistry. In addition, with the emergence of nanotechnologies, cheminformatics needs Prof. Dr. Alejandro Pazos to deal with drug–nanoparticle systems used as drug Sierra [email protected] delivery systems, drug co-therapy systems, etc. This brings to mind the application of cheminformatics in areas beyond drug discovery such as the fuel industry, polymer sciences, materials science, and biomedical engineering. Deadline for manuscript submissions: In this context, we propose to open this new issue to closed (15 November 2020) discuss with all colleagues worldwide all the past, present, and future challenges of cheminformatics. The present Special Issue is also associated with MOL2NET-05, the International Conference on Multidisciplinary Sciences, ISSN: 2624-5078, MDPI SciForum, Basel, Switzerland, 2019. The link of the conference: https://mol2net- 05.sciforum.net/. We especially encourage submissions of papers from colleagues worldwide to the conference (short communications) and complete versions (full papers) to the present Special Issue. mdpi.com/si/31770 SpeciaIslsue IMPACT FACTOR 4.411 an Open Access Journal by MDPI Editor-in-Chief Message from the Editor-in-Chief Prof.
    [Show full text]