DOCSLIB.ORG

Cheminformatics: Applications on Modern Drug Discovery

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cheminformatics: Applications on Modern Drug Discovery Short Communication iMedPub Journals Journal of In Silico & In Vitro Pharmacology 2020 www.imedpub.com ISSN 2469-6692 Vol.6 No.3:14 Cheminformatics: Applications on Gutema W. Dagne* Modern Drug Discovery University of Melbourne, Melbourne, Victoria, Australia Abstract *Corresponding author: Finding medications to an infection is as yet a difficult assignment for clinical Gutema W Dagne specialists because of the complex structures of biomolecules which are liable for illness, for example, AIDS, Cancer, Autism, Alzimear and so on Plan also, [email protected] improvement of new productive enemies of medications for the illness with no results are getting compulsory in the ongoing history of human existence University of Melbourne, Melbourne, cycle because of changes in different components which incorporates food propensity, natural and movement in human existence style. Cheminformatics Victoria, Australia. manages finding drugs situated in current medication revelation strategies which thus redress complex issues in customary medication disclosure framework. Cheminformatics instruments, makes a difference clinical scientist for better Citation: Dagne GW. (2020) comprehension of complex structures of synthetic mixes. Cheminformatics is another arising interdisciplinary field which essentially expects to find Novel Cheminformatics: Applications on Modern Chemical Entities (NCE) which at last brings about plan of new particle [chemical Drug Discovery. In Silico In Vitro Pharmacol data]. It additionally assumes a significant function for gathering, putting away and Vol.6 No.3:14 dissecting the substance information. This paper centers around cheminformatics and its applications on medication revelation and present day drug disclosure methods which helps scientific expert and clinical specialists for discovering answer for the intricate sickness. Keywords: Drug Discovery; Cheminformatics; Biochemistry Received: November 25, 2020; Accepted: November 27, 2020; Published: December 02, 2020 Introduction of a substrate within its enzyme receptor, and the catalysis of a biochemical reaction by an enzyme. The term Cheminformatics additionally alluded as Cheminformatics assumes a vital function to keep up and access Chemoinformatics/Chemiinformatics/Chemical data/Chemical colossal measure of substance information, delivered by physicist informatics has been perceived as of late as a particular order (in excess of 45 million synthetic mixes are known and the number in computational atomic sciences. Cheminformatics is otherwise may increment in million consistently,) by utilizing an appropriate called interface science as it consolidates Physics, Chemistry, information base. Additionally, the field of science needs a novel Biology, Mathematics, Biochemistry, Statistics and informatics. method for information extraction from information to display The essential focal point of cheminformatics is to break down/ complex connections between the structure of the substance mimic/demonstrating/control substance data which can spoke compound and natural action and the impact of response to either in 2D structure or in 3D structure. Industry areas, for condition on synthetic reactivity. Cheminformatics has more example, agrochemicals, food and drug are unmistakable regions extensive scope of utilization and impact if cheminformatics in a where cheminformatics assumes critical function in the ongoing few explicit examination zones. history of atomic sciences. Cheminformatics has mainly dealt with small molecules, whereas Applications bioinformatics addresses genes, proteins, and other larger The range of applications of cheminformatics is rich indeed; any chemical compounds. Chem and Bioinformatics complements field of chemistry can profit from its methods. The following each other for bimolecular process, like structure and function of lists different areas of chemistry and indicates some typical proteins, the binding of a ligand to its binding site, the conversion applications of cheminformatics: © Copyright iMedPub | This article is available from: https://pharmacology.imedpub.com/ 1 Journal of In Silico & ARCHIVOSIn Vitro Pharmacology DE MEDICINA 2020 ISSNISSN 2469-6692 1698-9465 Vol.6 No.3:14 a) Storing data generated through experiments or from Modern Drug Discovery Process molecular simulation Retrieval of chemical Structures from 1. Target Identification & Validation chemical database (Software libraries) 2. Lead Identification b) Prediction of physical, chemical and biological properties of chemical compounds 3. Lead Optimization 4. Pre-Clinical Trial c) Elucidation of the structure of a compound based on spectroscopic data 5. Development Process d) Structure, Substructure, Similarity and diversity searching • Clinical Trial from chemical database • Approval from the Authority and Drug in Market e) High Throughput Screening (HTS) is the integration of Conclusion technologies (laboratory automation, assay technology, Normal life expectancy of Human being is steadily diminishing micro plate based instrumentation, etc.) to quickly screen in the ongoing clinical history due to the higher impact of new chemical compounds in search of a desired activity sicknesses. Distinguishing and understanding basic and useful f) Docking-Interaction between two macromolecules conduct of synthetic mixes/biomolecules are one of the difficult issues for clinical specialists. Cheminformatics is an arising field g) Drug Discovery which is utilized for better comprehension of biomolecules. This h) Molecular Science, Materials Science, Food Science paper essentially centers on cheminformatics and its applications on medication revelation, issues of conventional disclosure and (Nutraceuticals), Atmospheric chemistry, Polymer significance of current medication revelation framework. This chemistry, Textile Industry, Combinatorial organic synthesis thus helps scientific experts and analysts for creating drugs (COS) without results. 2 This article is available from: https://pharmacology.imedpub.com/.
Load more

Recommended publications
  • The Alexandria Library, a Quantum-Chemical Database of Molecular Properties for Force field Development 9 2017 Received: October 1 1 1 Mohammad M
    www.nature.com/scientificdata OPEN Data Descriptor: The Alexandria library, a quantum-chemical database of molecular properties for force field development 9 2017 Received: October 1 1 1 Mohammad M. Ghahremanpour , Paul J. van Maaren & David van der Spoel Accepted: 19 February 2018 Published: 10 April 2018 Data quality as well as library size are crucial issues for force field development. In order to predict molecular properties in a large chemical space, the foundation to build force fields on needs to encompass a large variety of chemical compounds. The tabulated molecular physicochemical properties also need to be accurate. Due to the limited transparency in data used for development of existing force fields it is hard to establish data quality and reusability is low. This paper presents the Alexandria library as an open and freely accessible database of optimized molecular geometries, frequencies, electrostatic moments up to the hexadecupole, electrostatic potential, polarizabilities, and thermochemistry, obtained from quantum chemistry calculations for 2704 compounds. Values are tabulated and where available compared to experimental data. This library can assist systematic development and training of empirical force fields for a broad range of molecules. Design Type(s) data integration objective • molecular physical property analysis objective Measurement Type(s) physicochemical characterization Technology Type(s) Computational Chemistry Factor Type(s) Sample Characteristic(s) 1 Uppsala Centre for Computational Chemistry, Science for Life Laboratory, Department of Cell and Molecular Biology, Uppsala University, Husargatan 3, Box 596, SE-75124 Uppsala, Sweden. Correspondence and requests for materials should be addressed to D.v.d.S. (email: [email protected]).
    [Show full text]
  • Semantic Web Integration of Cheminformatics Resources with the SADI Framework Leonid L Chepelev1* and Michel Dumontier1,2,3
    Chepelev and Dumontier Journal of Cheminformatics 2011, 3:16 http://www.jcheminf.com/content/3/1/16 METHODOLOGY Open Access Semantic Web integration of Cheminformatics resources with the SADI framework Leonid L Chepelev1* and Michel Dumontier1,2,3 Abstract Background: The diversity and the largely independent nature of chemical research efforts over the past half century are, most likely, the major contributors to the current poor state of chemical computational resource and database interoperability. While open software for chemical format interconversion and database entry cross-linking have partially addressed database interoperability, computational resource integration is hindered by the great diversity of software interfaces, languages, access methods, and platforms, among others. This has, in turn, translated into limited reproducibility of computational experiments and the need for application-specific computational workflow construction and semi-automated enactment by human experts, especially where emerging interdisciplinary fields, such as systems chemistry, are pursued. Fortunately, the advent of the Semantic Web, and the very recent introduction of RESTful Semantic Web Services (SWS) may present an opportunity to integrate all of the existing computational and database resources in chemistry into a machine-understandable, unified system that draws on the entirety of the Semantic Web. Results: We have created a prototype framework of Semantic Automated Discovery and Integration (SADI) framework SWS that exposes the QSAR descriptor functionality of the Chemistry Development Kit. Since each of these services has formal ontology-defined input and output classes, and each service consumes and produces RDF graphs, clients can automatically reason about the services and available reference information necessary to complete a given overall computational task specified through a simple SPARQL query.
    [Show full text]
  • Flexible Heuristic Algorithm for Automatic Molecule Fragmentation: Application to the UNIFAC Group Contribution Model Simon Müller*
    Müller J Cheminform (2019) 11:57 https://doi.org/10.1186/s13321-019-0382-3 Journal of Cheminformatics RESEARCH ARTICLE Open Access Flexible heuristic algorithm for automatic molecule fragmentation: application to the UNIFAC group contribution model Simon Müller* Abstract A priori calculation of thermophysical properties and predictive thermodynamic models can be very helpful for developing new industrial processes. Group contribution methods link the target property to contributions based on chemical groups or other molecular subunits of a given molecule. However, the fragmentation of the molecule into its subunits is usually done manually impeding the fast testing and development of new group contribution methods based on large databases of molecules. The aim of this work is to develop strategies to overcome the challenges that arise when attempting to fragment molecules automatically while keeping the defnition of the groups as simple as possible. Furthermore, these strategies are implemented in two fragmentation algorithms. The frst algorithm fnds only one solution while the second algorithm fnds all possible fragmentations. Both algorithms are tested to frag- ment a database of 20,000 molecules for use with the group contribution model Universal Quasichemical Func- tional Group Activity Coefcients+ (UNIFAC). Comparison of the results with a reference database shows that both algorithms are capable of successfully fragmenting all the molecules automatically. Furthermore, when applying them on a larger database it is shown, that the newly developed algorithms are capable of fragmenting structures previously thought not possible to fragment. Keywords: Molecule fragmentation, Cheminformatics, RDKit, Property prediction, Group contribution method, UNIFAC, Incrementation Introduction named QSPR methods (Quantitative Structure Property Cheminformatics is a growing feld due to the increas- Relationship).
    [Show full text]
  • Chemical Database Projects Delivered by RSC Escience
    Chemical Database Projects Delivered by RSC eScience at the FDA Meeting “Development of a Freely Distributable Data System for the Registration of Substances” Antony Williams RSC eScience . What was once just ChemSpider is much more… . ChemSpider Reactions . Chemicals Validation and Standardization Platform . Learn Chemistry Wiki . National Chemical Database Service . Open PHACTS . PharmaSea . Global Chemistry Hub We are known for ChemSpider… . The Free Chemical Database . A central hub for chemists to source information . >28 million unique chemical records . Aggregated from >400 data sources . Chemicals, spectra, CIF files, movies, images, podcasts, links to patents, publications, predictions . A central hub for chemists to deposit & curate data We Want to Answer Questions . Questions a chemist might ask… . What is the melting point of n-heptanol? . What is the chemical structure of Xanax? . Chemically, what is phenolphthalein? . What are the stereocenters of cholesterol? . Where can I find publications about xylene? . What are the different trade names for Ketoconazole? . What is the NMR spectrum of Aspirin? . What are the safety handling issues for Thymol Blue? I want to know about “Vincristine” Vincristine: Identifiers and Properties Vincristine: Vendors and Sources Vincristine: Articles How did we build it? . We deal in Molfiles or SDF files – with coordinates . Deposit anything that has an InChI – we support what InChI can handle, good and bad . Standardization based on “InChI standardization” . InChIs aggregate (certain) tautomers The InChI Identifier Downsides of InChI . Good for small molecules – but no polymers, issues with inorganics, organometallics, imperfect stereochemistry. ChemSpider is “small molecules” . InChI used as the “deduplicator” – FIRST version of a compound into the database becomes THE structure to deduplicate against… Side Effects of InChI Usage SMILES by comparison… Side Effects of InChI Usage Searches: The INTERNET Search by InChI ChemSpider Google Search http://www.chemspider.com/google/ How did we build it? .
    [Show full text]
  • Joelib Tutorial
    JOELib Tutorial A Java based cheminformatics/computational chemistry package Dipl. Chem. Jörg K. Wegner JOELib Tutorial: A Java based cheminformatics/computational chemistry package by Dipl. Chem. Jörg K. Wegner Published $Date: 2004/03/16 09:16:14 $ Copyright © 2002, 2003, 2004 Dept. Computer Architecture, University of Tübingen, GermanyJörg K. Wegner Updated $Date: 2004/03/16 09:16:14 $ License This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation version 2 of the License. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. Documents PS (JOELibTutorial.ps), PDF (JOELibTutorial.pdf), RTF (JOELibTutorial.rtf) versions of this tutorial are available. Plucker E-Book (http://www.plkr.org) versions: HiRes-color (JOELib-HiRes-color.pdb), HiRes-grayscale (JOELib-HiRes-grayscale.pdb) (recommended), HiRes-black/white (JOELib-HiRes-bw.pdb), color (JOELib-color.pdb), grayscale (JOELib-grayscale.pdb), black/white (JOELib-bw.pdb) Revision History Revision $Revision: 1.5 $ $Date: 2004/03/16 09:16:14 $ $Id: JOELibTutorial.sgml,v 1.5 2004/03/16 09:16:14 wegner Exp $ Table of Contents Preface ........................................................................................................................................................i 1. Installing JOELib
    [Show full text]
  • Predicting Outcomes of Catalytic Reactions Using Machine Learning
    Predicting outcomes of catalytic reactions using ma- chine learning† Trevor David Rhone,∗a Robert Hoyt,a Christopher R. O’Connor,b Matthew M. Montemore,b,c Challa S.S.R. Kumar,b,c Cynthia M. Friend,b,c and Efthimios Kaxiras a,c Predicting the outcome of a chemical reaction using efficient computational models can be used to develop high-throughput screening techniques. This can significantly reduce the number of experiments needed to be performed in a huge search space, which saves time, effort and ex- pense. Recently, machine learning methods have been bolstering conventional structure-activity relationships used to advance understanding of chemical reactions. We have developed a model to predict the products of catalytic reactions on the surface of oxygen-covered and bare gold using machine learning. Using experimental data, we developed a machine learning model that maps reactants to products, using a chemical space representation. This involves predicting a chemical space value for the products, and then matching this value to a molecular structure chosen from a database. The database was developed by applying a set of possible reaction outcomes using known reaction mechanisms. Our machine learning approach complements chemical intuition in predicting the outcome of several types of chemical reactions. In some cases, machine learn- ing makes correct predictions where chemical intuition fails. We achieve up to 93% prediction accuracy for a small data set of less than two hundred reactions. 1 Introduction oped to aid in reaction prediction, they have generally involved Efficient prediction of reaction products has long been a major encoding this intuition into a set of rules, and have not been goal of the organic chemistry community 1–3 and the drug discov- widely adopted 2,6–9.
    [Show full text]
  • Cheminformatics and Chemical Information
    Cheminformatics and Chemical Information Matt Sundling Advisor: Prof. Curt Breneman Department of Chemistry and Chemical Biology/Center for Biotechnology and Interdisciplinary Studies Rensselaer Polytechnic Institute Rensselaer Exploratory Center for Cheminformatics Research http://reccr.chem.rpi.edu/ Many thanks to Theresa Hepburn! Upcoming lecture plug: Prof. Curt Breneman DSES Department November 15th Advances in Cheminformatics: Applications in Biotechnology, Drug Design and Bioseparations Cheminformatics is about collecting, storing, and analyzing [usually large amounts of] chemical data. •Pharmaceutical research •Materials design •Computational/Automated techniques for analysis •Virtual high-throughput screening (VHTS) QSAR - quantitative structure-activity relationship Molecular Model Activity Structures O N N Cl AAACCTCATAGGAAGCA TACCAGGAATTACATCA … Molecular Model Activity Structures O N N Cl AAACCTCATAGGAAGCATACCA GGAATTACATCA… Structural Descriptors Physiochemical Descriptors Topological Descriptors Geometrical Descriptors Molecular Descriptors Model Activity Structures Acitivty: bioactivity, ADME/Tox evaluation, hERG channel effects, p-456 isozyme inhibition, anti- malarial efficacy, etc… Structural Descriptors Physiochemical Descriptors Topological Descriptors Molecule D1 D2 … Activity (IC50) molecule #1 21 0.1 Geometrical Descriptors = molecule #2 33 2.1 molecule #3 10 0.9 + … Activity Molecular Descriptors Model Activity Structures Goal: Minimize the error: ∑((yi −f xi)) f1(x) f2(x) Regression Models: linear, multi-linear,
    [Show full text]
  • Committee on Publications and Cheminformatics Data Standards (CPCDS)
    Committee on Publications and Cheminformatics Data Standards (CPCDS) Report to the Bureau, April 2020 Leah McEwen, Committee Chair I. Executive Summary The IUPAC Committee on Publications and Cheminformatics Data Standards (CPCDS) advises on issues related to dissemination of information, primarily of IUPAC outputs. The portfolio is expanding and diversifying, in types of content, modes of publication and potential readership. Publication of IUPAC recommendations, technical reports and other information resources remains at the core of IUPAC dissemination activity and that of CPCDS. Increasingly the committee also focuses on the development and dissemination of chemical data and information standards to facilitate robust communication in the digital environment. Further details on these two priority areas are provided in Appendix A (Subcommittee on Publications: Report to CPCDS) and Appendix B (CPCDS Chair’s Statement: Towards a “Digital IUPAC”). The 2018-2019 biennium brought stability to key systems and workflows including those supporting IUPAC’s flagship journal Pure and Applied Chemistry (PAC) and online access to the Compendium of Chemical Terminology (a.k.a., the “Gold Book”). A number of collaborative symposia and workshops with strategic partners including CODATA and the GO FAIR Chemistry Implementation Network (ChIN) surfaced use cases and infrastructure needs for digital science among diverse community stakeholders. These activities lay the groundwork for developing a robust and systematic program for Digital IUPAC and “the creation of a consistent and interoperable global framework for human and machine-readable chemical information,” as articulated in the CPCDS Terms of Reference. This vision will be a critical component of success for IUPAC’s contribution towards the United Nations Sustainable Development Goals.
    [Show full text]
  • Umansysprop V1.0: an Online and Open-Source Facility for Molecular Property Prediction and Atmospheric Aerosol Calculations
    UManSysProp V1.0: An Online and Open-Source Facility for Molecular Property Prediction and Atmospheric Aerosol Calculations Topping, David and Barley, Mark and Bane, Michael and Higham, Nicholas J. and Aumont, Berbard and Dingle, Nicholas and McFiggans, Gordon 2016 MIMS EPrint: 2016.13 Manchester Institute for Mathematical Sciences School of Mathematics The University of Manchester Reports available from: http://eprints.maths.manchester.ac.uk/ And by contacting: The MIMS Secretary School of Mathematics The University of Manchester Manchester, M13 9PL, UK ISSN 1749-9097 Geosci. Model Dev., 9, 899–914, 2016 www.geosci-model-dev.net/9/899/2016/ doi:10.5194/gmd-9-899-2016 © Author(s) 2016. CC Attribution 3.0 License. UManSysProp v1.0: an online and open-source facility for molecular property prediction and atmospheric aerosol calculations David Topping1,2, Mark Barley2, Michael K. Bane3, Nicholas Higham4, Bernard Aumont5, Nicholas Dingle6, and Gordon McFiggans2 1National Centre for Atmospheric Science, Manchester, M13 9PL, UK 2Centre for Atmospheric Science, University of Manchester, Manchester, M13 9PL, UK 3High End Compute, Manchester, M13 9PL, UK 4School of Mathematics, University of Manchester, Manchester, M13 9PL, UK 5LISA, UMR CNRS 7583, Universite Paris Est Creteil et Universite Paris Diderot, Creteil, France 6Numerical Algorithms Group (NAG), Ltd Peter House Oxford Street, Manchester, M1 5AN, UK Correspondence to: David Topping ([email protected]) Received: 1 September 2015 – Published in Geosci. Model Dev. Discuss.: 3 November 2015 Revised: 3 February 2016 – Accepted: 16 February 2016 – Published: 1 March 2016 Abstract. In this paper we describe the development and opment of a user community.
    [Show full text]
  • Scalable Analysis of Large Datasets in Life Sciences
    Scalable Analysis of Large Datasets in Life Sciences LAEEQ AHMED Doctoral Thesis in Computer Science Stockholm, Sweden 2019 Division of Computational Science and Technology School of Electrical Engineerning and Computer Science KTH Royal Institute of Technology TRITA-EECS-AVL-2019:69 SE-100 44 Stockholm ISBN: 978-91-7873-309-5 SWEDEN Akademisk avhandling som med tillstånd av Kungl Tekniska högskolan framlägges till offentlig granskning för avläggande av teknologie doktorsexamen i elektrotek- nik och datavetenskap tisdag den 3:e Dec 2019, klockan 10.00 i sal Kollegiesalen, Brinellvägen 8, KTH-huset, Kungliga Tekniska Högskolan. © Laeeq Ahmed, 2019 Tryck: Universitetsservice US AB To my respected parents, my beloved wife and my lovely brother and sister Abstract We are experiencing a deluge of data in all fields of scientific and business research, particularly in the life sciences, due to the development of better instrumentation and the rapid advancements that have occurred in informa- tion technology in recent times. There are major challenges when it comes to handling such large amounts of data. These range from the practicalities of managing these large volumes of data, to understanding the meaning and practical implications of the data. In this thesis, I present parallel methods to efficiently manage, process, analyse and visualize large sets of data from several life sciences fields at a rapid rate, while building and utilizing various machine learning techniques in a novel way. Most of the work is centred on applying the latest Big Data Analytics frameworks for creating efficient virtual screening strategies while working with large datasets. Virtual screening is a method in cheminformatics used for Drug discovery by searching large libraries of molecule structures.
    [Show full text]
  • Cheminformatics for Genome-Scale Metabolic Reconstructions
    CHEMINFORMATICS FOR GENOME-SCALE METABOLIC RECONSTRUCTIONS John W. May European Molecular Biology Laboratory European Bioinformatics Institute University of Cambridge Homerton College A thesis submitted for the degree of Doctor of Philosophy June 2014 Declaration This thesis is the result of my own work and includes nothing which is the outcome of work done in collaboration except where specifically indicated in the text. This dissertation is not substantially the same as any I have submitted for a degree, diploma or other qualification at any other university, and no part has already been, or is currently being submitted for any degree, diploma or other qualification. This dissertation does not exceed the specified length limit of 60,000 words as defined by the Biology Degree Committee. This dissertation has been typeset using LATEX in 11 pt Palatino, one and half spaced, according to the specifications defined by the Board of Graduate Studies and the Biology Degree Committee. June 2014 John W. May to Róisín Acknowledgements This work was carried out in the Cheminformatics and Metabolism Group at the European Bioinformatics Institute (EMBL-EBI). The project was fund- ed by Unilever, the Biotechnology and Biological Sciences Research Coun- cil [BB/I532153/1], and the European Molecular Biology Laboratory. I would like to thank my supervisor, Christoph Steinbeck for his guidance and providing intellectual freedom. I am also thankful to each member of my thesis advisory committee: Gordon James, Julio Saez-Rodriguez, Kiran Patil, and Gos Micklem who gave their time, advice, and guidance. I am thankful to all members of the Cheminformatics and Metabolism Group.
    [Show full text]
  • Bringing Open Source to Drug Discovery
    Bringing Open Source to Drug Discovery Chris Swain Cambridge MedChem Consulting Standing on the shoulders of giants • There are a huge number of people involved in writing open source software • It is impossible to acknowledge them all individually • The slide deck will be available for download and includes 25 slides of details and download links – Copy on my website www.cambridgemedchemconsulting.com Why us Open Source software? • Allows access to source code – You can customise the code to suit your needs – If developer ceases trading the code can continue to be developed – Outside scrutiny improves stability and security What Resources are available • Toolkits • Databases • Web Services • Workflows • Applications • Scripts Toolkits • OpenBabel (htttp://openbabel.org) is a chemical toolbox – Ready-to-use programs, and complete programmer's toolkit – Read, write and convert over 110 chemical file formats – Filter and search molecular files using SMARTS and other methods, KNIME add-on – Supports molecular modeling, cheminformatics, bioinformatics – Organic chemistry, inorganic chemistry, solid-state materials, nuclear chemistry – Written in C++ but accessible from Python, Ruby, Perl, Shell scripts… Toolkits • OpenBabel • R • CDK • OpenCL • RDkit • SciPy • Indigo • NumPy • ChemmineR • Pandas • Helium • Flot • FROWNS • GNU Octave • Perlmol • OpenMPI Toolkits • RDKit (http://www.rdkit.org) – A collection of cheminformatics and machine-learning software written in C++ and Python. – Knime nodes – The core algorithms and data structures are written in C ++. Wrappers are provided to use the toolkit from either Python or Java. – Additionally, the RDKit distribution includes a PostgreSQL-based cartridge that allows molecules to be stored in relational database and retrieved via substructure and similarity searches.
    [Show full text]