Journal name: OncoTargets and Therapy Article Designation: Original Research Year: 2018 Volume: 11 OncoTargets and Therapy Dovepress Running head verso: Dong et al Running head recto: The effect of TRIM37 on lung cancer cells open access to scientific and medical research DOI: 183303
Open Access Full Text Article Original Research TRIM37 targets AKT in the growth of lung cancer cells
Shumin Dong1 Background: TRIM37 is an ubiquitin E3 ligase. Growing evidence has demonstrated the Xueqin Pang2 high value of TRIM37 as a potential biomarker for diagnosis of certain cancers. However, the Haijun Sun3 biological function of TRIM37 in lung cancer is still unknown. Chunluan Yuan4 Materials and methods: In order to gain a deep insight into the function of TRIM37 in Chuanyong Mu5 lung cancer cells, in the present study lentiviral vector was used to mediate RNA interference Shiying Zheng6 and overexpression of TRIM37 in lung cancer cells (H292, H358, and H1299). In addition, a specific AKT inhibitor LY294002 was utilized to examine the correlation between the expres- 1 Department of Thoracic Surgery, sion of TRIM37 and AKT. The First Affiliated Hospital of Soochow University, The First Results: TRIM37 acts as a positive regulator of cell proliferation in lung cancer cells. More- People’s Hospital of Lianyungang City, over, cell apoptosis analyses showed the antiapoptosis function of TRIM37, which was mainly Lianyungang, Jiangsu 222000, People’s dependent on the regulation of BCL2 and BAX. Our results also indicated that AKT might be Republic of China; 2Department of Gastroenterology, The First Affiliated a target of TRIM37 in lung cancer cells. Hospital of Soochow University, Conclusion: This research not only helps in understanding the molecular mechanisms of TRIM37 Suzhou, Jiangsu 215006, People’s Republic of China; 3Department of in detail but also provides evidence to develop novel biomarkers for lung cancer diagnosis. Thoracic Surgery, The First People’s Keywords: TRIM37, cell proliferation, apoptosis, BCL2, BAX, AKT Hospital of Lianyungang City, Lianyungang, Jiangsu 222000, People’s Republic of China; 4Department of Introduction Oncology, The First People’s Hospital of Lianyungang City, Lianyungang, Lung cancer is one of the most commonly diagnosed cancers worldwide and has been ranked Jiangsu 222000, People’s Republic of as the top killer cancer all over the world.1,2 Though the traditional treatment (resection and China; 5Department of Respiratory Medicine, The First Affiliated Hospital radiotherapy) can contribute to fighting against the recurrence of lung cancer, the outcome of Soochow University, Suzhou, usually remains poor. Therefore, gaining a deep insight into the molecular mechanism Jiangsu 215006, People’s Republic of China; 6Department of Thoracic of lung cancer would help to develop new biomarkers and therapy for this disease. Surgery, The First Affiliated Hospital TRIM37 is one of the members of TRIM family, which is mapped on chromo- of Soochow University, Suzhou, some 17q22-23.3 TRIM37 serves as an ubiquitin E3 ligase and plays an essential role Jiangsu 215006, People’s Republic of China in oncogenesis. A previous report has shown that TRIM37 is upregulated in human colorectal cancer (CRC) and contributes to the development of CRC.4 Moreover, the Correspondence: Chuanyong Mu Department of Respiratory Medicine, expression of TRIM37 is significantly upregulated in pancreatic cancerous tissues, The First Affiliated Hospital of Soochow which indicates the oncogenic role of TRIM37 in pancreatic cancer.5 In addition, high University, Shizi Street No 188, Suzhou, 6 Jiangsu 215006, People’s Republic expression of TRIM37 is observed in osteosarcoma. Growing evidence has indicated of China that TRIM37 participates in the tumorigenesis of several cancers. However, the bio- Email [email protected] logical function of TRIM37 in lung cancer is less well understood. Shiying Zheng BCL2 mediates the intrinsic apoptosis pathway. A previous report has shown that Department of Thoracic Surgery, The BCL2 is also essential for cell cycle progression.7 The dysregulation of BCL2 not only First Affiliated Hospital of Soochow University, Shizi Street No 188, Suzhou, damages normal development but also contributes to tumor progression.8 The high Jiangsu 215006, People’s Republic level of BCL2 suppresses apoptosis in human lung cancer cells, which serves as the of China Email [email protected] antiapoptotic factor in this cancer.9 In addition, BAX belongs to the BCL2 family, which submit your manuscript | www.dovepress.com OncoTargets and Therapy 2018:11 7935–7945 7935 Dovepress © 2018 Dong et al. This work is published and licensed by Dove Medical Press Limited. The full terms of this license are available at https://www.dovepress.com/terms.php and incorporate the Creative Commons Attribution – Non Commercial (unported, v3.0) License (http://creativecommons.org/licenses/by-nc/3.0/). By accessing the work you http://dx.doi.org/10.2147/OTT.S183303 hereby accept the Terms. Non-commercial uses of the work are permitted without any further permission from Dove Medical Press Limited, provided the work is properly attributed. For permission for commercial use of this work, please see paragraphs 4.2 and 5 of our Terms (https://www.dovepress.com/terms.php). Dong et al Dovepress functions as proapoptotic marker.10 Therefore, the occurrence alcohols were used to deparaffinize and rehydrate samples. of cell apoptosis depends on the ratio of BAX/BCL2. Dysreg- Antigen retrieval was carried out through steam heating for ulation of the ratio of BAX/BCL2 may lead to carcinogenesis. 15 minutes in 0.01 M citrate buffer at pH 6.0, and slides were Taken together, BCL2 family members have potential value rinsed three times with PBS (0.02 M) after natural cooling. as critical targets in lung cancer treatment.11,12 Then, the activity of endogenous peroxidase was suppressed The AKT pathway plays an essential role in various using Tris-buffered saline with Tween 20 containing 3% biological functions, which is commonly abnormal in human hydrogen peroxide for 10 minutes. The sections were incu- cancer.13 The activity of AKT protein relies on its phospho- bated with a primary antibody (TRIM37; Novus, St Charles, rylation. A previous report has indicated that the AKT phos- MO, USA) overnight at 4°C followed by biotin-labeled phorylation (p-AKT) on Thr308 correlates with the activity secondary antibody (Longislandbio, Shanghai, People’s of AKT protein in human non-small-cell lung cancer.14 The Republic of China) at room temperature for half an hour. PI3K/AKT pathway is involved in cell cycle and apoptosis of Then, hematoxylin was used for nuclear counterstaining after lung cancer cells.15 Some evidence has demonstrated that the slides were reacted with diaminobenzidine substrate. major function of TRIM37 in glioma cells is the inactivation of PI3K/AKT signaling pathway.16 Therefore, further studies RNA isolation and real-time PCR are needed to examine the relationship between TRIM37 and Total RNA from all samples was extracted using TRIzol AKT in lung cancer cells. reagent (Thermo Fisher Scientific). After that, cDNA syn- In the present study, we systematically analyzed the func- thesis kit (Thermo Fisher Scientific) was used to synthesize tion of TRIM37 and its possible targets in lung cancer cells. cDNA according to the instruction of the manufacturer. The RNA interference was used to knockdown the expression of conditions of real-time PCR were as follows: 95°C for 10 TRIM37 in lung cancer cells, while lentiviral vector was used to minutes followed by 40 cycles of 95°C for 15 seconds and mediate overexpression of TRIM37. Our data provide not only 60°C for 45 seconds. The expression was normalized to that a deep insight into the molecular mechanisms of TRIM37 but of GAPDH. The relative gene expression was calculated by also evidence to develop novel biomarkers for lung cancer. the 2−ΔΔCt method. All data represented the average of three replicates. The primer sequences used in this study are listed Materials and methods in the Supplementary materials. Tissue specimens and cell culture A total of 30 pairs of lung cancer tissues and adjacent non- Lentiviral vector-mediated RNA cancerous tissues were obtained from patients at the First Affiliated Hospital of Soochow University. Samples were interference and overexpression snap-frozen in liquid nitrogen and stored at -80°C for further of TRIM37 analysis. All patients provided written informed consent. This Lentiviral plasmids (pLKO.1) containing three shRNAs research was approved by the independent ethics committee of directed to various regions of human TRIM37 (NM_015294.5) the First Affiliated Hospital of Soochow University and was and a negative control shRNA (siNC) were synthesized carried out in accordance with the Declaration of Helsinki. (Major, Shanghai, People’s Republic of China), respectively. All the cell lines (A549, H1299, H1975, H358, H292, Lentiviral plasmid (pLVX-puro) containing the full length and 16HBE) used in this study were obtained from the cell of human TRIM37 cDNA sequence and the mock plasmid bank of Shanghai Institute for Biological Sciences (Shanghai, served as the negative control (oeNC). All of them were tran- People’s Republic of China). FBS (10%; Thermo Fisher siently transfected into lung cancer cells as indicated above Scientific, Waltham, MA, USA) was mixed into all culture using Lipofectamine 2000 (Thermo Fisher Scientific) accord- media along with 2 mM L-glutamine and 1% penicillin/ ing to the instruction of the manufacturer. Experiments were streptomycin (Solarbio, Beijing, People’s Republic of China). performed 48 hours after transfection. Detailed sequence Cells were grown in DMEM (TrueLine, Nashville, TN, USA) information about siTRIM37s is provided in Table S1. and were incubated in a 5% CO2 atmosphere at 37°C. Western blot Immunohistochemistry Whole-protein lysates were extracted from indicated cells In brief, all tissue samples were fixed on 10% formalin and (H292, H358, and H1299) using RIPA lysis buffer (JRDUN, embedded with paraffin. A set of xylene baths and graded Shanghai, People’s Republic of China) with EDTA-free
7936 submit your manuscript | www.dovepress.com OncoTargets and Therapy 2018:11 Dovepress Dovepress The effect of TRIM37 on lung cancer cells protease inhibitor cocktail (Roche, Basel, Switzerland). China). All the procedures were performed using Boyden The protein concentration was estimated using an enhanced chambers (Costar; Corning, Corning, NY, USA). BCA protein assay kit (Thermo Fisher Scientific). An equal amount of total protein (25 µg) was fractionated on a 10% Invasion assay SDS-PAGE gel. Then, the gel was transferred to a nitrocel- This assay was also performed using Boyden chambers lulose membrane (EMD Millipore, Billerica, MA, USA) containing a polycarbonate filter coated with Matrigel overnight. After being blocked with 5% nonfat dry milk for on the upper surface. The procedure was performed as 1 hour at room temperature, the membrane was probed at indicated above. 4°C overnight with primary antibodies followed by secondary antibody anti-mouse IgG (1:1,000; Beyotime, Haimen, Xenograft model People’s Republic of China) for 1 hour at 37°C. An enhanced This assay was carried out according to the institute’s chemiluminescence system (Tanon, Shanghai, People’s guidelines for animal experiments and was approved by the Republic of China) was used for detecting protein expres- independent ethics committee of the First Affiliated Hospital sion value. The detailed information of primary antibodies of Soochow University, People’s Republic of China, and is provided in Table S2. all animals were treated in accordance with the Institutional Animal Care and Use Committee (IACUC) guidelines. Cell proliferation assay An equal number of siNC- and siTRIM37-transfected H358 cells (n 2 106) were subcutaneously injected into the right Cell Counting Kit-8 (CCK-8) assay (SAB, College Park, MD, = × flank of 4- to 6-week-old nude mice (n 26 for each group; USA) was performed to examine cell proliferation according = Shanghai Laboratory Animal Company, Shanghai, People’s to the protocol of the manufacturer. Briefly, cells transfected Republic of China). The length and width of the tumor were as indicated were seeded in 96-well plates and cultured for examined every 3 days for 33 days after injection. The volume 0, 24, 48, and 72 hours. CCK-8 solution (1:10) was mixed of the tumor was counted as length (width 2/2). Six weeks to each well and incubated for 1 hour. A microplate reader × after injection, six mice from the siNC- and siTRIM37- (Pulangxin, Beijing, People’s Republic of China) was used injected groups were sacrificed by cervical dislocation and to measure the OD values at a wavelength of 450 nm. Inde- tumor tissues were fixed in 4% formalin for further analysis. pendent triplicate experiments were carried out for each A total of 20 nude mice in each injected group as indicated time point. were used to measure mouse survival rate. Mouse survival was monitored daily for a total of 100 days. Cell apoptosis assay In brief, H292, H358, and H1299 cells were collected and Statistical analysis stained with Annexin V-fluorescein isothiocyanate apoptosis GraphPad Prism software Version 7.0 (GraphPad Software, detection kit (Beyotime) according to the instructions of the Inc., La Jolla, CA, USA) was utilized for statistical analyses. manufacturer at 48 hours after viral infection. A flow cytom- Data were expressed as mean ± SD of at least three samples. eter (BD, Franklin Lakes, NJ, USA) was used to determine Statistical significance was determined by one-way ANOVA cell apoptosis. for multiple comparisons. A P-value ,0.05 was considered to indicate statistical significance. Migration assay Briefly, the indicated TRIM37 siRNA cells were serum- Results starved for 24 hours followed by seeding in the upper The level of TRIM37 was upregulated in chamber, while the medium supplemented with 30% FBS lung cancer tissues and cell lines (Thermo Fisher Scientific) was placed in the lower chamber. The mRNA expression of TRIM37 was examined by quanti- After 24 hours of incubation, cells on the upper side of the tative real-time PCR in 30 pairs of lung cancer samples and filters were removed and the remaining cells were fixed in matched para-cancerous tissues. In addition, Western blot 4% formaldehyde and stained with 0.01% crystal violet was utilized to examine the protein level of TRIM37 in eight (Solarbio). Then, cells in the lower chamber were stained pairs of lung cancer samples and matched normal tissues. with crystal violet and counted under a microscope at ×200 As shown in Figure 1A and B, both the mRNA and protein magnification (Caikon, Shanghai, People’s Republic of levels of TRIM37 in lung cancer tissues were significantly
OncoTargets and Therapy 2018:11 submit your manuscript | www.dovepress.com 7937 Dovepress Dong et al Dovepress
$%7 7 7 7 1 1 1 1 75,0
*$3'+
7 7 7 7 1 1 1 1 3URWHLQ H[SUHVVLRQ 75,0 OHYHORI75,0 5HODWLYHP51$ OHYHORI75,0 1RUPDO 7XPRU 1RUPDO 7XPRU *$3'+
& ' 1RUPDO 7XPRU
H[SUHVVLRQ
75,0 OHYHORI75,0
P51$ î + + $ +%( + +
(
+%( + + + + $
75,0 OHYHORI75,0 5HODWLYHSURWHLQ *$3'+
+ + $ +%( + +
Figure 1 Expression of TRIM37 in lung cancer tissues and cell lines. Notes: (A) The mRNA expression of TRIM37 in lung cancer and matched para-cancerous tissues (n=30 for each group). ***P,0.001 vs normal. (B) The protein level of TRIM37 in lung cancer and matched para-cancerous tissues (n=8 for each group). ***P,0.001 vs normal. (C) The protein level of TRIM37 analyzed by immunohistochemistry in lung cancer and matched para-cancerous tissues. (D and E) The mRNA and protein expression level of TRIM37 in different lung cancer cell lines, respectively. ***P,0.001 vs 16HBE cells. upregulated as compared with normal tissues. Moreover, Knockdown and overexpression of immunohistochemistry was used to further investigate the TRIM37 in lung cancer cells protein level of TRIM37 in lung cancer and normal tissues. To silence the expression of TRIM37, three shRNAs target- The results also suggested that TRIM37 was upregulated ing human TRIM37 gene (siTRIM37; RNAi1-1, RNAi1-2, in tumor tissues (Figure 1C). Then, the mRNA and protein RNAi1-3) and a negative control shRNA (siNC) were expression level of TRIM37 was detected in five lung cancer synthesized and transfected to H292 and H358 cell lines, cell lines, including H292, H358, H1299, A549, and H1975, respectively. The untreated cells acted as blank control using a human bronchial epithelial cell line (16HBE) as (BLANK). As shown in Figure 2A and B, all the TRIM37- normal control. As shown in Figure 1D and E, the mRNA siRNAs were able to strongly reduce endogenous TRIM37. and protein expression levels of TRIM37 were significantly Cells transfected with RNAi1-1 and RNAi1-2 showed upregulated in lung cancer cell lines, especially in H292 lower TRIM37 level than RNAi1-3. Therefore, RNAi1-1 and H358 cells, compared with 16HBE cells. On the other and RNAi1-2 were chosen for further study. In addition, hand, the H1299 cells showed relatively lower level of H1299 cells were transfected with a plasmid overexpress- TRIM37 than other lung cancer cell lines. Based on these ing TRIM37 (oeTRIM37) and a mock plasmid (oeNC), results, H292, H358, and H1299 cell lines were chosen for respectively. As shown by the TRIM37 mRNA and protein further study. levels in Figure 2C and D, a remarkable overexpression
7938 submit your manuscript | www.dovepress.com OncoTargets and Therapy 2018:11 Dovepress Dovepress The effect of TRIM37 on lung cancer cells
A B 2 3 1.5 1.0 H358 H358 H358 cell BLANK siNC RNAi1-1 RNAi1- RNAi1- H292 0.8 H292 1.0 TRIM37 0.6 *** *** *** *** GAPDH 0.4 0.5 *** of TRIM37 *** 0.2 ***
Relative mRNA *** level of TRIM37
*** 1 2 3 Relative protei n *** expression level *** *** 0.0 0.0 H292 cell BLANK siNC RNAi1- RNAi1- RNAi1- 1 2 3 1 2 3 1 2 1 3 siNC siNC siNC siNC BLANK RNAi1-RNAi1-RNAi1- BLANK RNAi1-RNAi1-RNAi1- TRIM37 BLANK RNAi1-RNAi1-RNAi1-3 BLANK RNAi1-RNAi1-2RNAi1-
GAPDH C D BLANK oeNC oeTRIM37 60 *** 1.0 40 0.8 *** TRIM37 20 0.6 0.4 expression 2 1 0.2 GAPDH level of TRIM37 level of TRIM37 0 Relative protei n 0.0 mRNA BLANK oeNC oeTRIM37 BLANK oeNC oeTRIM37
Figure 2 Knockdown and overexpression of TRIM37 in lung cancer cell lines. Notes: (A and B) The mRNA and protein level of TRIM37 after transfection of siRNAs into H358 and H292 cells, respectively. ***P,0.001 vs siNC. (C and D) The mRNA and protein level of TRIM37 after transfection of oeTRIM37 into H1299 cells. ***P,0.001 vs oeNC. Abbreviation: BLANK, blank control. of TRIM37 was observed in oeTRIM37-transfected cells. or H358 cells. Thus, these data suggested a role for TRIM37 Hence, the oeTRIM37 cells were chosen for the following in the promotion of lung cancer cells metastasis. TRIM37 overexpression analysis. Knockdown of TRIM37 affected the Suppression of TRIM37 inhibited cell activity of BCL2, BAX, and AKT development and metastasis As shown in Figure 3E and F, the mRNA and protein The function of TRIM37 in the proliferation of lung cancer expression level of BCL2 was remarkably downregulated cells was examined through CCK-8 assays. siNC, RNAi1-1, in TRIM37 siRNA cells, which was contrary to the expres- and RNAi1-2 were transfected to H358 and H292 cells, sion pattern of BAX. These results were consistent with our respectively. As shown in Figure 3A, there was no obvious expectation. Moreover, the AKT level showed no obvious difference between BLANK and siNC groups in cell prolif- difference among all transfected cells as indicated above. eration of the two lung cancer cell lines. However, the cell However, the protein level of p-AKT was highly decreased growth rate of the two cell lines in siTRIM37 group was in siTRIM37 cells, which indicated that the activity of AKT significantly decreased at 24, 48, and 72 hours compared was deeply suppressed when TRIM37 was knocked down. with siNC group. Thus, these data suggested that TRIM37 These results might reflect the interaction between AKT and is a positive regulator of cell proliferation of lung cancer TRIM37 in lung cancer cells. cells. Next, Annexin V-FITC/propidium iodide staining assay was performed to investigate the effects of TRIM37 on The function of TRIM37 was inhibited by cell apoptosis of lung cancer cells. As shown in Figure 3B, a specific PI3K/AKT inhibitor LY294002 the cell apoptosis ratio of the two cell lines was obviously A specific AKT inhibitor LY294002 (10 µM) was used to higher in siTRIM37 group than in siNC group. These result further determine the relationship between TRIM37 and indicated the antiapoptosis function of TRIM37 in lung AKT. As shown in Figure 4A, the cell proliferation rate of cancer cells. oeTRIM37 was significantly upregulated as compared with Moreover, we also examined the effect of siTRIM37 that of oeNC cells. However, a remarkable decrease in cell on lung cancer cells migration and invasion. As shown in proliferation rate was observed after the cells were treated Figure 3C and D, both the RNAi1-1 and RNAi1-2 signifi- with LY294002. Moreover, the cell apoptosis rate was signifi- cantly inhibited the migration and invasion ability of H292 cantly inhibited by oeTRIM37 in lung cancer cells. However,
OncoTargets and Therapy 2018:11 submit your manuscript | www.dovepress.com 7939 Dovepress Dong et al Dovepress this suppression effect of TRIM37 was partly reduced after Western blot was performed to analyze the protein oeTRIM37 cells were treated with LY294002 (Figure 4B). level of BCL2, BAX, AKT, and p-AKT in oeNC, oeNC + Additionally, the cell migration and invasion ability analysis LY294002, oeTRIM37, and oeTRIM37 + LY294002 cells, also showed similar results (Figure 4C). respectively. As shown in Figure 4D, the BCL2 level was
$
+FHOO + FHOO
2'YDOXHLQ 2'YDOXHLQ
KRXU KRXUV KRXUV KRXUV KRXU KRXUV KRXUV KRXUV
%/$1. VL1& 51$L 51$L
% + %/$1. VL1& 51$L 51$L *DWH 3 *DWH 3 *DWH 3 *DWH 3 48/ 485 48/ 485 48/ 485 48/ 485
+ +
)/$ )/$ )/$ )/$
4// 4/5 4// 4/5 4// 4/5 4// 4/5 )/$ )/$ )/$ )/$
+ %/$1. VL1& 51$L 51$L
$SRSWRVLV *DWH 3 *DWH 3 *DWH 3 *DWH 3 48/ 485 48/ 485 48/ 485 48/ 485
VL1& VL1& %/$1. %/$1. 51$L51$L 51$L51$L )/$ )/$ )/$ )/$
4// 4/5 4// 4/5 4// 4/5 4// 4/5 )/$ )/$ )/$ )/$
& + %/$1. VL1& 51$L 51$L
%/$1. VL1& 51$L 51$L 0LJUDWLRQ
%/$1. VL1& 51$L 51$L
&HOOQXPEHU
,QYDVLRQ 0LJUDWLRQ ,QYDVLRQ
' + %/$1. VL1& 51$L 51$L
%/$1. VL1& 0LJUDWLRQ 51$L 51$L
%/$1. VL1& 51$L 51$L
&HOOQXPEHU
,QYDVLRQ 0LJUDWLRQ ,QYDVLRQ
Figure 3 (Continued)
7940 submit your manuscript | www.dovepress.com OncoTargets and Therapy 2018:11 Dovepress Dovepress The effect of TRIM37 on lung cancer cells
( ) + + +FHOOV %/$1. VL1& 51$L 51$L %/$1. VL1& %&/ 51$L 51$L %$;
H[SUHVVLRQ $.7
LQ+FHOOV
OHYHORI%&/
P51$ S$.7
5HODWLYHSURWHLQOHYHO %&/ %$; $.7 S$.7 VL1& VL1& *$3'+ %/$1. 51$L51$L %/$1. 51$L51$L
%/$1. VL1& + + + FHOOV %/$1. VL1& 51$L 51$L 51$L 51$L %&/
%$;
H[SUHVVLRQ $.7
OHYHORI%$; LQ+ FHOOV S$.7 P51$
5HODWLYHSURWHLQOHYHO %&/ %$; $.7 S$.7 VL1& VL1& *$3'+ %/$1. 51$L51$L %/$1. 51$L51$L
Figure 3 Knockdown of TRIM37 inhibited cell proliferation and apoptosis. Notes: (A) Cell proliferation was detected at 0, 24, 48, and 72 hours after transfection with siNC, siTRIM371-1, and siTRIM371-2 in H358 and H292 cells. **P,0.01 vs siNC, and ***P,0.001 vs siNC. (B) Cell apoptosis profile of cells as indicated above. ***P,0.001 vs siNC. (C and D) H292 and H358 cells transfected with indicated TRIM37 siRNAs, and cell migration and invasion were analyzed as described in the “Materials and methods” section, respectively. Magnification,× 200. ***P,0.001 vs siNC group. (E) The mRNA expression level of BCL2 and BAX in cells as indicated above. ***P,0.001 vs siNC. (F) The protein level of BCL2, BAX, AKT, and p-AKT in cells as indicated above. ***P,0.001 vs siNC. Abbreviation: BLANK, blank control. highly increased in oeTRIM37 cells as compared with oeNC the siTRIM37-transfected cells contributed to prolong the cells. However, the protein level of BCL2 was significantly survival length of nude mice (Figure 5C). downregulated after the oeNC and oeTRIM37 cells were treated with LY294002. The protein level of BAX showed Discussion the opposite expression pattern to BCL2. Moreover, the Lung cancer is a highly invasive, rapidly metastasizing, and AKT level showed no significant difference among the cells. prevalent cancer all over the world.1 Much attention has However, the protein level of p-AKT was deeply inhibited been paid to explore the effective methods for its treatment. after the cells were treated with LY294002, which sup- Although the tumorigenic mechanism of lung cancer is pressed the activity of AKT. Taken together, these results still not fully understood, some factors have been found demonstrated that AKT might be a target of TRIM37 in to have high value as biomarkers for diagnosing it at an lung cancer cells. early stage. In this study, we systematically analyzed the function Knockdown of TRIM37 inhibited of a positive tumor regulator TRIM37 in lung cancer cells. tumorigenicity of lung cancer cells in vivo To obtain reliable results, RNA interference was used to In order to investigate the function of TRIM37 in tumori- silence the expression of TRIM37. On the other hand, lenti- genicity in vivo, an equal number of H358 cells transfected viral vector was used to mediate overexpression of TRIM37. with siRNA and siTRIM37 were hypodermically injected The results from those two analyses were consistent, which into nude mice (n=6 for each group) and tumor forma- showed that our results were reliable. tion was determined every 3 days for 33 days (starting at The CCK-8 assay suggested TRIM37 as a positive regu- day 12). As shown in Figure 5A and B, although both the lator of cell proliferation of lung cancer cells. A previous injected cells were capable of developing tumors, it was report indicated that TRIM37 mediated cell proliferation in easily identified that the TRIM37-siRNA cells significantly pediatric osteosarcoma.6 In addition, TRIM44 and TRIM59 suppressed the tumor growth rate. The volume and weight have been reported to promote proliferation of lung cancer of TRIM37-siRNA tumors showed highly significant reduc- cells.17,18 Therefore, we suspected that all the TRIM proteins tion as compared with that of siNC tumors. In addition, contribute to proliferation of lung cancer cells.
OncoTargets and Therapy 2018:11 submit your manuscript | www.dovepress.com 7941 Dovepress Dong et al Dovepress
$ ' < RH1& RH1&/< RH1& RH1&/RH75,0RH75,0/< RH75,0 %&/ RH75,0/<
%$;
$.7
+ FHOO S$.7 2'YDOXHLQ
*$3'+ 5HODWLYHSURWHLQOHYHO KRXU %&/ %$; $.7 S$.7 KRXUV KRXUV KRXUV
% RH1& RH75,0 RH1& /< RH75,0 /< *DWH 3 *DWH 3 *DWH 3 *DWH 3 48/ 485 48/ 485 48/ 485 48/ 485
)/$ )/$ )/$ )/$ 4// 4/5 4// 4/5 4// 4/5 4// 4/5
$SRSWRVLV )/$ )/$ )/$ )/$
RH1& RH1& RH75,0 /< RH75,0/<
& RH1& RH75,0 RH1& /< RH75,0 /< RH1& RH1&/< RH75,0 0LJUDWLRQ RH75,0/< RH1& RH75,0 RH1& /< RH75,0 /<
&HOOQXPEH U
,QYDVLRQ 0LJUDWLRQ ,QYDVLRQ
Figure 4 The function of TRIM37 was inhibited by a specific AKT inhibitor LY294002. Notes: (A) Cell proliferation was detected at 0, 24, 48, and 72 hours after transfection with oeNC, oeNC + LY294002, oeTRIM37, and oeTRIM37 + LY294002 in H1299 cells. *P,0.05 vs oeNC, **P,0.01 vs oeNC, and ***P,0.001 vs oeNC. (B) Cell apoptosis profile of cells as indicated above. **P,0.01 vs oeNC and ***P,0.001 vs oeNC. (C) The cell migration and invasion data of H1299 cells transfected with oeNC and oeTRIM37 as well as treated with LY294002. **P,0.01 vs oeNC and ***P,0.001 vs oeNC. (D) The protein level of BCL2, BAX, AKT, and p-AKT in cells as indicated above. **P,0.01 vs oeNC and ***P,0.001 vs oeNC.
$ % VL1& &
VL1& VL75,0 VL1& VL75,0 VL75,0
J
PP 3HUFHQW XPRUZHLJKW VXUYLYDO XPRUYROXPH 7 7 VL1& VL75,0 7LPH GD\V 7LPH GD\V
Figure 5 Knockdown of TRIM37 in lung cancer cells inhibited tumor growth in vivo. Notes: H358 cells transfected with siRNA control (siNC) or siTRIM37 were subcutaneously injected into athymic nude mice. (A and B) The tumor volume and weight in nude mice injected with H358 cells transfected with siNC and siTRIM37. *P,0.05 vs siNC, **P,0.01 vs siNC, and ***P,0.001 vs siNC. (C) The survival rate of nude mice injected with H358 cells transfected with siNC and siTRIM37.
7942 submit your manuscript | www.dovepress.com OncoTargets and Therapy 2018:11 Dovepress Dovepress The effect of TRIM37 on lung cancer cells
A previous study showed that knockdown of TRIM9 References induced apoptosis of lung cancer cells through mediating 1. Lemjabbar-Alaoui H, Hassan OU, Yang YW, Buchanan P. Lung BCL2 and other related proteins.19 In the present study, the cancer: Biology and treatment options. Biochim Biophys Acta. 2015; cell apoptosis results indicated the antiapoptosis function of 1856(2):189–210. 2. Alberg AJ, Brock MV, Ford JG, Samet JM, Spivack SD. Diagnosis TRIM37 in lung cancer cells. Moreover, our results showed and Management of Lung Cancer, 3rd ed: American College of Chest that the protein level of a pair of cell apoptosis factors (BCL2 Physicians Evidence-Based Clinical Practice Guidelines. Epidemiology of Lung Cancer. 2016;143(5). and BAX) was deeply influenced when TRIM37 was knocked 3. Kallijärvi J, Lahtinen U, Hämäläinen R, Lipsanen-Nyman M, Palvimo JJ, down or overexpressed in lung cancer cells, which indicates Lehesjoki AE. TRIM37 defective in mulibrey nanism is a novel RING that TRIM37 can serve as an apoptotic marker of primary lung finger ubiquitin E3 ligase.Exp Cell Res. 2005;308(1):146–155. 4. Hu CE, Gan J. TRIM37 promotes epithelial‑mesenchymal transition 20 cancer. Hence, we suspected that the antiapoptosis function in colorectal cancer. Mol Med Rep. 2017;15(3):1057–1062. of TRIM37 was mainly through the regulation of BCL2 and 5. Jiang J, Tian S, Yu C, Chen M, Sun C. TRIM37 promoted the growth and migration of the pancreatic cancer cells. Tumour Biol. 2016;37(2): BAX. Moreover, we also evaluated the function of TRIM37 2629–2634. in cell migration and invasion in lung cancer cells. Our results 6. Tao Y, Xin M, Cheng H, et al. TRIM37 promotes tumor cell proliferation indicated that the level of TRIM37 was positively correlated and drug resistance in pediatric osteosarcoma. Oncol Lett. 2017;14(6): 6365–6372. with the ability of migration and invasion of lung cancer cells. 7. Viant C, Guia S, Hennessy RJ, et al. Cell cycle progression dictates the Previous reports have demonstrated that TRIM37 promoted requirement for BCL2 in natural killer cell survival. J Exp Med. 2017; 5,21 214(2):491–510. cell metastasis in pancreatic cancer cells. Our results also 8. Cui J, Placzek WJ. Post-Transcriptional Regulation of Anti-Apoptotic insisted this conclusion, which suggested that TRIM37 is a BCL2 Family Members. Int J Mol Sci. 2018;19(1):E308. positive regulator of cell metastasis. 9. Sun SY, Yue P, Zhou JY, et al. Overexpression of BCL2 blocks TNF-related apoptosis-inducing ligand (TRAIL)-induced apoptosis in It has been reported that TRIM11 functions in lung cancer human lung cancer cells. Biochem Biophys Res Commun. 2001;280(3): cells via enhancing the activity of PI3K/AKT.22 Previous reports 788–797. 10. Gessner C, Liebers U, Kuhn H, et al. BAX and p16INK4A are inde- have demonstrated that the oncogenes TRIM22 and TRIM44 pendent positive prognostic markers for advanced tumour stage of contribute to the activity of P13/AKT in lung cancer cells.23,24 nonsmall cell lung cancer. Eur Respir J. 2002;19(1):134–140. Moreover, knockdown of TRIM37 in glioma cells led to the 11. Han B, Park D, Li R, et al. Small-Molecule Bcl2 BH4 Antagonist for Lung Cancer Therapy. Cancer Cell. 2015;27(6):852–863. 16 inactivation of PI3K/AKT signaling pathway. In this study, 12. Chen MJ, Wu DW, Wang GC, Wang YC, Chen CY, Lee H. MicroRNA- our results indicated that TRIM37 could activate PI3K/AKT. 630 may confer favorable cisplatin-based chemotherapy and clinical outcomes in non-small cell lung cancer by targeting Bcl-2. Oncotarget. Therefore, we conclude that TRIM37 may promote lung cancer 2018;9(17):13758–13767. cell development through PI3K/AKT signaling pathway. 13. Yoshizawa A, Fukuoka J, Shimizu S, et al. Overexpression of phospho- Moreover, some evidence has suggested that the activity eIF4E is associated with survival through AKT pathway in non-small cell lung cancer. Clin Cancer Res. 2010;16(1):240–248. 25,26 of AKT is vital for retaining BAX in the cytoplasm. 14. Vincent EE, Elder DJ, Thomas EC, et al. Akt phosphorylation on In addition, the AKT protein also functions to upregulate the Thr308 but not on Ser473 correlates with Akt protein kinase activity 27,28 in human non-small cell lung cancer. Br J Cancer. 2011;104(11): expression of BCL2. Therefore, we suggest that TRIM37/ 1755–1761. AKT/BCL2 pathway might be a novel target for regulating 15. Xu X, Zhang Y, Qu D, Jiang T, Li S. Osthole induces G2/M arrest and cell apoptosis in lung cancer cells. apoptosis in lung cancer A549 cells by modulating PI3K/Akt pathway. J Exp Clin Cancer Res. 2011;30:33. 16. Tang SL, Gao YL, Wen-Zhong H. Knockdown of TRIM37 suppresses Conclusion the proliferation, migration and invasion of glioma cells through the In the present study, we examined the effect of TRIM37 inactivation of PI3K/Akt signaling pathway. Biomed Pharmacother. 2018;99:59–64. knockdown and overexpression in lung cancer cells. Our 17. Xing Y, Meng Q, Chen X, et al. TRIM44 promotes proliferation and results not only help in better understanding of TRIM37 in metastasis in non‑small cell lung cancer via mTOR signaling pathway. Oncotarget. 2016;7(21):30479–30491. lung cancer but also provide evidence that TRIM37 might 18. Zhan W, Han T, Zhang C, et al. TRIM59 Promotes the Proliferation serve as a novel biomarker in clinical application. and Migration of Non-Small Cell Lung Cancer Cells by Upregulating Cell Cycle Related Proteins. PLoS One. 2015;10(11):e0142596. 19. Wang X, Shu Y, Shi H, Lv X, Zou H, Shi W. TRIM9 is up-regulated Acknowledgments in human lung cancer and involved in cell proliferation and apoptosis. This study was supported by the National Natural Science Int J Clin Exp Med. 2016;9(6):10461–10469. Foundation of China (No 81401943). Shumin Dong and 20. Porebska I, Wyrodek E, Kosacka M, Adamiak J, Jankowska R, Harłozińska-Szmyrka A. Apoptotic markers p53, Bcl-2 and Bax in Xueqin Pang are co-first authors for this study. primary lung cancer. In Vivo. 2006;20(5):599–604. 21. Jiang J, Yu C, Chen M, Tian S, Sun C. Over-expression of TRIM37 promotes cell migration and metastasis in hepatocellular carcinoma by Disclosure activating Wnt/β-catenin signaling. Biochem Biophys Res Commun. The authors report no conflicts of interest in this work. 2015;464(4):1120–1127.
OncoTargets and Therapy 2018:11 submit your manuscript | www.dovepress.com 7943 Dovepress Dong et al Dovepress
22. Wang X, Shi W, Shi H, et al. TRIM11 overexpression promotes prolif- 26. Yamaguchi H, Wang HG. The protein kinase PKB/Akt regulates cell eration, migration and invasion of lung cancer cells. J Exp Clin Cancer survival and apoptosis by inhibiting Bax conformational change. Res. 2016;35(1):100. Oncogene. 2001;20(53):7779–7786. 23. Liu L, Zhou XM, Yang FF, et al. TRIM22 confers poor prognosis and 27. Marinov M, Ziogas A, Pardo OE, et al. AKT/mTOR pathway activa- promotes epithelial-mesenchymal transition through regulation of AKT/ tion and BCL-2 family proteins modulate the sensitivity of human GSK3β/β-catenin signaling in non-small cell lung cancer. Oncotarget. small cell lung cancer cells to RAD001. Clin Cancer Res. 2009;15(4): 2017;8(37):62069–62080. 1277–1287. 24. Xing Y, Meng Q, Chen X, Wang X, et al. TRIM44 promotes prolifera- 28. Pugazhenthi S, Nesterova A, Sable C, et al. Akt/protein kinase B up- tion and metastasis in non-small cell lung cancer via mTOR signaling regulates Bcl-2 expression through cAMP-response element-binding pathway. Oncotarget. 2016;7(21):30479–30491. protein. J Biol Chem. 2000;275(15):10761–10766. 25. Tsuruta F, Masuyama N, Gotoh Y. The phosphatidylinositol 3-kinase (PI3K)-Akt pathway suppresses Bax translocation to mitochondria. J Biol Chem. 2002;277(16):14040–14047.
7944 submit your manuscript | www.dovepress.com OncoTargets and Therapy 2018:11 Dovepress Dovepress The effect of TRIM37 on lung cancer cells
Supplementary materials H. sapiens BAX, apoptosis regulator, transcript Primer sequence information variant 1, mRNA Homo sapiens TRIM37, transcript variant 2, mRNA NCBI Reference Sequence: NM_001291428.1 NCBI Reference Sequence: NM_001005207.4 Primer F: 5′ CTGAGCGAGTGTCTCAAG 3′ Primer F: 5′ TGGACTTACTCGCAAATG 3′ Primer R: 5′ CAGCCCATGATGGTTCTG 3′ Primer R: 5′ ATCTGGTGGTGACAAATC 3′ Pos: 244-485 C Pos: 1645-1874 C Amplified product: size: 242 bps, product GC: 57% Amplified product: size: 230 bps, product GC: 39% H. sapiens GAPDH, transcript variant 1, mRNA H. sapiens BCL2, apoptosis regulator, transcript NCBI Reference Sequence: NM_001256799.2 variant alpha, mRNA Primer F: 5′ AATCCCATCACCATCTTC 3′ NCBI Reference Sequence: NM_000633.2 Primer R: 5′ AGGCTGTTGTCATACTTC 3′ Primer F: 5′ GCAGTGTGGTCTCCGAATGTC 3′ Pos: 436-653 Primer R: 5′ CATTGCCTCTCCTCACGTTCC 3′ Amplified product: size: 218 bps Pos: 2277-2521 C Amplified product: size: 245 bps, product GC: 56%
Table S1 Homo sapiens TRIM37 (NM_001005207.4) RNAi targeting locus information RNAi targeting locus Sequence Name Locus position (bp) RNAi1-1 595–613 GCTCCAAACTGTGTTGTTT RNAi1-2 968–986 GGAACTGATCAGCTTAGTT RNAi1-3 2,501–2,519 GCGAGTGCCCTCTGATTTA
Table S2 The primary antibodies information Antibody name Source Dilution factor TRIM37 CST, Danvers, MA, USA 1:1,000 BCL2 Abcam, Cambridge, UK 1:1,000 BAX Abcam 1:1,000 AKT CST 1:1,000 p-AKT CST 1:2,000 GAPDH CST 1:2,000
OncoTargets and Therapy Dovepress Publish your work in this journal OncoTargets and Therapy is an international, peer-reviewed, open patient perspectives such as quality of life, adherence and satisfaction. access journal focusing on the pathological basis of all cancers, potential The manuscript management system is completely online and includes targets for therapy and treatment protocols employed to improve the a very quick and fair peer-review system, which is all easy to use. Visit management of cancer patients. The journal also focuses on the impact http://www.dovepress.com/testimonials.php to read real quotes from of management programs and new therapeutic agents and protocols on published authors.
Submit your manuscript here: http://www.dovepress.com/oncotargets-and-therapy-journal
OncoTargets and Therapy 2018:11 submit your manuscript | www.dovepress.com 7945 Dovepress