DOCSLIB.ORG

EZH2-Deficient T-Cell Acute Lymphoblastic Leukemia Is Sensitized to CHK1 Inhibition Through Enhanced Replication Stress

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
EZH2-Deficient T-Cell Acute Lymphoblastic Leukemia Is Sensitized to CHK1 Inhibition Through Enhanced Replication Stress Published OnlineFirst April 29, 2020; DOI: 10.1158/2159-8290.CD-19-0789 RESEARCH ARTICLE EZH2 -Defi cient T-cell Acute Lymphoblastic Leukemia Is Sensitized to CHK1 Inhibition through Enhanced Replication Stress Theresa E. León 1 , Tanya Rapoz-D’Silva 1 , Cosetta Bertoli 2 , Sunniyat Rahman 1 , Michael Magnussen 1 , Brian Philip1 , Nadine Farah 1 , Simon E. Richardson 1 , Sara Ahrabi 1 , José Afonso Guerra-Assunção 3 , Rajeev Gupta4 , Elisabeth P. Nacheva 5 , Stephen Henderson 3 , Javier Herrero 3 , David C. Linch 1 , Robertus A.M. de Bruin2 , and Marc R. Mansour 1 Downloaded from cancerdiscovery.aacrjournals.org on September 30, 2021. © 2020 American Association for Cancer Research. Published OnlineFirst April 29, 2020; DOI: 10.1158/2159-8290.CD-19-0789 ABSTRACT Loss-of-function mutations of EZH2 , the enzymatic component of PRC2, have been associated with poor outcome and chemotherapy resistance in T-cell acute lymphoblastic leukemia (T-ALL). Using isogenic T-ALL cells, with and without CRISPR/Cas9–induced EZH2-inactivating mutations, we performed a cell-based synthetic lethal drug screen. EZH2-defi cient cells exhibited increased sensitivity to structurally diverse inhibitors of CHK1, an interaction that could be validated genetically. Furthermore, small-molecule inhibition of CHK1 had effi cacy in delaying tumor progression in isogenic EZH2-defi cient, but not EZH2 wild-type, T-ALL cellsin vivo , as well as in a pri- mary cell model of PRC2-mutant ALL. Mechanistically, EZH2 defi ciency resulted in a gene-expression signature of immature T-ALL cells, marked transcriptional upregulation of MYCN , increased replication stress, and enhanced dependency on CHK1 for cell survival. Finally, we demonstrate this phenotype is mediated through derepression of a distal PRC2-regulated MYCN enhancer. In conclusion, we highlight a novel and clinically exploitable pathway in high-risk EZH2-mutated T-ALL. SIGNIFICANCE: Loss-of-function mutations of PRC2 genes are associated with chemotherapy resist- ance in T-ALL, yet no specifi c therapy for this aggressive subtype is currently clinically available. Our work demonstrates that loss of EZH2 activity leads to MYCN-driven replication stress, resulting in increased sensitivity to CHK1 inhibition, a fi nding with immediate clinical relevance. INTRODUCTION (8–10 ), emphasizing the need to develop novel therapies for this high-risk subgroup of patients. Loss-of-function mutations and deletions of Enhancer of Synthetic lethal screening has shown great promise in iden- Zeste (Drosophila) homolog 2 (EZH2 ), the enzymatic compo- tifying novel therapeutic targets in tumors defi cient in a vari- nent of polycomb repressor complex 2 (PRC2), are recurrently ety of tumor suppressors ( 11 ). Perhaps the best-characterized found in T-cell acute lymphoblastic leukemia (T-ALL) and synthetic lethal interaction, targeting the DNA repair path- have been strongly associated with disease pathogenesis ( 1, way with PARP inhibitors in BRCA2-defi cient cells ( 12, 13 ), 2 ). Alterations of the core components of PRC2, including has translated into clinically meaningful benefi ts in patients EZH2, EED , and SUZ12 , are particularly frequent in the early with breast and ovarian cancers ( 14, 15 ). Identifi cation of syn- T-cell precursor ALL subtype (ETP-ALL; refs. 1, 3 ), a subgroup thetic lethal interactions arising from epigenetic defi ciencies characterized by aberrant expression of myeloid and stem cell in cancer cells also offers promising therapeutic possibilities, markers ( 4 ). such as the sensitization to WEE1 inhibition observed in EZH2 catalyzes the trimethylation of histone H3 on Lys27 tumors with SETD2 loss ( 16 ). (H3K27me3), an epigenetic mark associated with transcrip- We hypothesized that EZH2 defi ciency would render T-ALL tional repression of genes involved in differentiation and cells dependent on distinct survival pathways that could be development ( 5 ). Importantly, work in mice has shown that exploited to provide a novel, less toxic, and more effi cacious EZH2 is required for normal B- and T-cell maturation ( 6 ), and therapeutic strategy for high-risk T-ALL. Through a targeted biallelic deletion of EZH2 leads to highly penetrant spontane- drug screen in isogenic T-ALL cells, we discovered that EZH2- ous T-ALL ( 7 ). Moreover, recent work associates loss of EZH2 defi cient T-ALL cells are highly sensitive to inhibition of with poor prognosis in T-ALL and acute myeloid leukemia the replication stress checkpoint kinase CHK1. Mechanisti- (AML), mediated through an increase in chemoresistance cally, loss of EZH2 was associated with marked upregulation of MYCN, a signifi cant increase in replication stress, and dependency on CHK1 for cell survival. 1 Department of Haematology, UCL Cancer Institute, University College London, London, United Kingdom. 2 MRC Laboratory for Molecular Cell Biology, University College London, London, United Kingdom. 3 Bill Lyons Informatics Centre, UCL Cancer Institute, University College London, RESULTS London, United Kingdom. 4 Stem Cell Laboratory, UCL Cancer Institute, The CHK1 Inhibitor MK8776 Selectively Kills University College London, London, United Kingdom. 5 Health Service Lab- oratories LLP, UCL Cancer Institute, London, United Kingdom. EZH2-Defi cient T-ALL Cells Note: Supplementary data for this article are available at Cancer Discovery To investigate synthetic lethal interactions that could be Online (http://cancerdiscovery.aacrjournals.org/). exploited in PRC2 defi cient T-ALL, we generated isogenic Jur- Corresponding Author: Marc R. Mansour, UCL Cancer Institute, London kat T-ALL cells using a double-nicking CRISPR/Cas9 strat- WC1E 6DD, United Kingdom. Phone: +4420-7679-6231; E-mail: m.mansour egy targeting exon 2 of EZH2, an approach that minimizes @ucl.ac.uk off-target effects ( 17 ). We generated two clones with bialellic Cancer Discov 2020;10:998–1017 frameshift mutations in EZH2 (EZH2-KO1 and EZH2-KO2) doi: 10.1158/2159-8290.CD-19-0789 that resulted in loss of EZH2 protein expression and a global © 2020 American Association for Cancer Research. absence of its functional mark H3K27me3 ( Fig. 1A and B ; JULY 2020 CANCER DISCOVERY | 999 Downloaded from cancerdiscovery.aacrjournals.org on September 30, 2021. © 2020 American Association for Cancer Research. Published OnlineFirst April 29, 2020; DOI: 10.1158/2159-8290.CD-19-0789 RESEARCH ARTICLE León et al. A EZH2-WT CD Jurkat 125 T-ALL cell line Unedited EZH2-KO Edited 100 MK8776 0.01 CRISPR/Cas9 D10A P = 0.03 double-nicking strategy 75 WT KO2KO1 value B 50 P 0.1 EZH2 MK8776 25 H3K27me3 cell viability (%) EZH2-KO 0 1 H3 0 25 50 75 100 125 0.0 0.5 1.0 1.5 2.0 EZH2-WT cell viability (%) Relative cell viability (EZH2-KO/WT) ratio EF125 125 EZH2-WT EZH2-WT EZH2-KO1 100 EZH2-KO1 100 EZH2-KO2 EZH2-KO2 75 75 50 IC50 50 IC50 WT 1,777 nmol/L WT 3,164 nmol/L Cell viability (%) KO1 805 nmol/L*** Cell viability (%) KO1 1,374 nmol/L*** 25 25 KO2 825 nmol/L*** KO2 1,513 nmol/L*** 0 0 2.0 2.5 3.0 3.5 2.0 2.5 3.0 3.5 MK8776 log (nmol/L) CCT245737 log (nmol/L) GH125 125 EZH2-WT EZH2-WT EZH2-KO1 EZH2-KO1 100 100 EZH2-KO2 EZH2-KO2 75 75 50 50 IC50 IC50 WT 1,212 nmol/L WT 300 nmol/L Cell viability (%) Cell viability (%) KO1 597 nmol/L*** KO1 180 nmol/L*** 25 25 KO2 600 nmol/L*** KO2 178 nmol/L*** 0 0 2.0 2.5 3.0 3.5 1.5 2.0 2.5 3.0 LY2603618 log (nmol/L) CHIR-124 log (nmol/L) IJDMSO MK8776 Live Annexin V+/Pl+ EZH2-WT WT 100 *** EZH2-KO Q2 Q2 *** Q1 Q1 Q4 Q4 80 *** Q3 Q3 60 *** EZH2-KO 40 Q2 Q2 Cells (%) Q1 Q1 20 Q4 Q4 Q3 Q3 0 Annexin-V 012012 MK8776 (µmol/L) PI 1000 | CANCER DISCOVERY JULY 2020 AACRJournals.org Downloaded from cancerdiscovery.aacrjournals.org on September 30, 2021. © 2020 American Association for Cancer Research. Published OnlineFirst April 29, 2020; DOI: 10.1158/2159-8290.CD-19-0789 CHK1 Inhibition in EZH2-Deficient T-ALL RESEARCH ARTICLE Supplementary Fig. S1A and S1B). EZH2-deficient clones had to MK8776 after preincubation with GSK126, a specific similar growth kinetics to their wild-type (WT) counterparts EZH2 inhibitor (Fig. 2D). Notably, incubation of cells with (Supplementary Fig. S1C, solid lines). GSK126 alone had no appreciable effect on cell growth (Sup- We assessed the relative sensitivity of EZH2-KO (EZH2- plementary Fig. S1C), EZH2 expression, or CHK1 protein KO1 cells, unless specified) and EZH2-WT cells to an in-house levels (Supplementary Fig. S3A). Following seven days of curated library of 219 commercially available compounds tar- EZH2 inhibition, a global decrease in H3K27me3 mark in geting specific chromatin-modifying enzymes, cell cycle, and treated cell lines was confirmed by Western blotting (Fig. 2E). DNA-repair processes, including small-molecule inhibitors Consistent with findings in our EZH2-KO clones, preincuba- that are already in clinical use for the treatment of cancer tion of Jurkat cells with GSK126 significantly increased their (Supplementary Table S1). The majority of drugs had similar sensitivity to CHK1 inhibition when exposed to MK8776 at effects on cell viability in both EZH2-WT and EZH2-KO cells doses corresponding their initial IC50 and IC75 (Fig. 2F; Sup- (Fig. 1C and D; Supplementary Table S2). However, MK8776, plementary Fig. S3B). Similar sensitization to MK8776 upon a CHK1 inhibitor that has been tested in early-phase clinical GSK126 preincubation was observed in PEER, CUTLL1, ALL- trials in solid tumors (18), demonstrated a significant dif- SIL, and PF-382 cell lines (Fig. 2E and F; Supplementary Fig. ferential reduction on cell viability in EZH2-KO cells com- S3B). These data not only support our results in isogenic pared with WT cells (P = 0.03 by two-tailed Student t test; EZH2-KO Jurkat cells, but also confirm that the observed Fig.
Load more

Recommended publications
  • The DEAD-Box RNA Helicase-Like Utp25 Is an SSU Processome Component
    Downloaded from rnajournal.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press The DEAD-box RNA helicase-like Utp25 is an SSU processome component J. MICHAEL CHARETTE1,2 and SUSAN J. BASERGA1,2,3 1Department of Molecular Biophysics & Biochemistry, Yale University School of Medicine, New Haven, Connecticut 06520, USA 2Department of Therapeutic Radiology, Yale University School of Medicine, New Haven, Connecticut 06520, USA 3Department of Genetics, Yale University School of Medicine, New Haven, Connecticut 06520, USA ABSTRACT The SSU processome is a large ribonucleoprotein complex consisting of the U3 snoRNA and at least 43 proteins. A database search, initiated in an effort to discover additional SSU processome components, identified the uncharacterized, conserved and essential yeast nucleolar protein YIL091C/UTP25 as one such candidate. The C-terminal DUF1253 motif, a domain of unknown function, displays limited sequence similarity to DEAD-box RNA helicases. In the absence of the conserved DEAD-box sequence, motif Ia is the only clearly identifiable helicase element. Since the yeast homolog is nucleolar and interacts with components of the SSU processome, we examined its role in pre-rRNA processing. Genetic depletion of Utp25 resulted in slowed growth. Northern analysis of pre-rRNA revealed an 18S rRNA maturation defect at sites A0,A1, and A2. Coimmunoprecipitation confirmed association with U3 snoRNA and with Mpp10, and with components of the t-Utp/UtpA, UtpB, and U3 snoRNP subcomplexes. Mutation of the conserved motif Ia residues resulted in no discernable temperature- sensitive or cold-sensitive growth defects, implying that this motif is dispensable for Utp25 function.
    [Show full text]
  • Analysis of Gene Expression Data for Gene Ontology
    ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION A Thesis Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Master of Science Robert Daniel Macholan May 2011 ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION Robert Daniel Macholan Thesis Approved: Accepted: _______________________________ _______________________________ Advisor Department Chair Dr. Zhong-Hui Duan Dr. Chien-Chung Chan _______________________________ _______________________________ Committee Member Dean of the College Dr. Chien-Chung Chan Dr. Chand K. Midha _______________________________ _______________________________ Committee Member Dean of the Graduate School Dr. Yingcai Xiao Dr. George R. Newkome _______________________________ Date ii ABSTRACT A tremendous increase in genomic data has encouraged biologists to turn to bioinformatics in order to assist in its interpretation and processing. One of the present challenges that need to be overcome in order to understand this data more completely is the development of a reliable method to accurately predict the function of a protein from its genomic information. This study focuses on developing an effective algorithm for protein function prediction. The algorithm is based on proteins that have similar expression patterns. The similarity of the expression data is determined using a novel measure, the slope matrix. The slope matrix introduces a normalized method for the comparison of expression levels throughout a proteome. The algorithm is tested using real microarray gene expression data. Their functions are characterized using gene ontology annotations. The results of the case study indicate the protein function prediction algorithm developed is comparable to the prediction algorithms that are based on the annotations of homologous proteins.
    [Show full text]
  • Homeobox Gene Methylation in Lung Cancer Studied by Genome-Wide Analysis with a Microarray-Based Methylated Cpg Island Recovery Assay
    Homeobox gene methylation in lung cancer studied by genome-wide analysis with a microarray-based methylated CpG island recovery assay Tibor Rauch*, Zunde Wang*, Xinmin Zhang†, Xueyan Zhong*, Xiwei Wu‡, Sean K. Lau§, Kemp H. Kernstine¶, Arthur D. Riggs*ʈ, and Gerd P. Pfeifer*ʈ *Division of Biology, ‡Division of Information Sciences, §Division of Pathology, and ¶Division of Surgery, Beckman Research Institute of the City of Hope, Duarte, CA 91010; and †NimbleGen Systems, Inc., Madison, WI 53711 Contributed by Arthur D. Riggs, February 5, 2007 (sent for review December 11, 2006) De novo methylation of CpG islands is a common phenomenon in and in this way they are key determinants of cell identity and human cancer, but the mechanisms of cancer-associated DNA potential targets during tumorigenesis. methylation are not known. We have used tiling arrays in combi- We recently developed a DNA methylation detection technique, nation with the methylated CpG island recovery assay to investi- the methylated CpG island recovery assay (MIRA) (12). This gate methylation of CpG islands genome-wide and at high reso- technique is based on the high affinity of a complex of the MBD2b lution. We find that all four HOX gene clusters on chromosomes 2, and MBD3L1 proteins for CpG-methylated DNA (13) and is 7, 12, and 17 are preferential targets for DNA methylation in cancer compatible with microarray-based methodology (14). We previ- cell lines and in early-stage lung cancer. CpG islands associated ously found that several homeobox genes were methylated in a lung with many other homeobox genes, such as SIX, LHX, PAX, DLX, and cancer cell line (14).
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Continuous MLL-ENL Expression Is Necessary to Establish a ''Hox Code'' and Maintain Immortalization of Hematopoietic Progenitor Cells
    Research Article Continuous MLL-ENL Expression Is Necessary to Establish a ‘‘Hox Code’’ and Maintain Immortalization of Hematopoietic Progenitor Cells Sarah J. Horton,1 David G. Grier,3 Glenda J. McGonigle,3 Alexander Thompson,3 Michelle Morrow,1 Inusha De Silva,1 Dale A. Moulding,1 Dimitris Kioussis,2 Terence R.J. Lappin,3 Hugh J.M. Brady,1 and Owen Williams1 1Molecular Haematology and Cancer Biology Unit, Institute of Child Health, University College London; 2Division of Molecular Immunology, National Institute for Medical Research, London, United Kingdom; and 3Department of Child Health, Queen’s University, Belfast, United Kingdom Abstract essential for definitive hematopoiesis and that it is required to The t[(11;19)(p22;q23)] translocation, which gives rise to the maintain, but not to initiate, the expression of multiple Hox genes MLL-ENL fusion protein, is commonly found in infant acute during embryogenesis (5–9). Some Hox genes are oncogenic when leukemias of both the myeloid and lymphoid lineage. To overexpressed in hematopoietic progenitor cells (10, 11). Taken investigate the molecular mechanism of immortalization by together, this suggests that aberrant regulation of Hox genes by MLL-ENL we established a Tet-regulatable system of MLL- MLL fusion proteins is the basis for leukemias involving MLL ENL expression in primary hematopoietic progenitor cells. translocations (12). Several recent publications do indeed suggest Immortalized myeloid cell lines were generated, which that Hox genes may play an important role in leukemia induced by are dependent on continued MLL-ENL expression for their MLL fusion proteins (13–16). survival and proliferation. These cells either terminally MLL translocations result in the generation of an in-frame differentiate or die when MLL-ENL expression is turned chimeric fusion in which MLL is joined to one of over 40 different off with doxycycline.
    [Show full text]
  • Genetic and Genomic Analysis of Hyperlipidemia, Obesity and Diabetes Using (C57BL/6J × TALLYHO/Jngj) F2 Mice
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Nutrition Publications and Other Works Nutrition 12-19-2010 Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P. Stewart Marshall University Hyoung Y. Kim University of Tennessee - Knoxville, [email protected] Arnold M. Saxton University of Tennessee - Knoxville, [email protected] Jung H. Kim Marshall University Follow this and additional works at: https://trace.tennessee.edu/utk_nutrpubs Part of the Animal Sciences Commons, and the Nutrition Commons Recommended Citation BMC Genomics 2010, 11:713 doi:10.1186/1471-2164-11-713 This Article is brought to you for free and open access by the Nutrition at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Nutrition Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Stewart et al. BMC Genomics 2010, 11:713 http://www.biomedcentral.com/1471-2164/11/713 RESEARCH ARTICLE Open Access Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P Stewart1, Hyoung Yon Kim2, Arnold M Saxton3, Jung Han Kim1* Abstract Background: Type 2 diabetes (T2D) is the most common form of diabetes in humans and is closely associated with dyslipidemia and obesity that magnifies the mortality and morbidity related to T2D. The genetic contribution to human T2D and related metabolic disorders is evident, and mostly follows polygenic inheritance. The TALLYHO/ JngJ (TH) mice are a polygenic model for T2D characterized by obesity, hyperinsulinemia, impaired glucose uptake and tolerance, hyperlipidemia, and hyperglycemia.
    [Show full text]
  • Rabbit Anti-HOXA6/FITC Conjugated Antibody
    SunLong Biotech Co.,LTD Tel: 0086-571- 56623320 Fax:0086-571- 56623318 E-mail:[email protected] www.sunlongbiotech.com Rabbit Anti-HOXA6/FITC Conjugated antibody SL11294R-FITC Product Name: Anti-HOXA6/FITC Chinese Name: FITC标记的同源盒基因HOXA6蛋白抗体 HOX1B; Homeo box 1B; Homeo box A6; Homeobox 1B; Homeobox A6; Homeobox protein Hox A6; Homeobox protein Hox-1B; Homeobox protein Hox-A6 antibody Alias: Homeobox protein HoxA6; HOX 1; Hox 1B; HOX1; HOX1.2; Hox1B; HOXA6; HX A6; HXA6; HXA6_HUMAN. Organism Species: Rabbit Clonality: Polyclonal React Species: Human,Mouse,Rat,Dog,Pig,Horse,Sheep, ICC=1:50-200IF=1:50-200 Applications: not yet tested in other applications. optimal dilutions/concentrations should be determined by the end user. Molecular weight: 23kDa Form: Lyophilized or Liquid Concentration: 1mg/ml immunogen: KLH conjugated synthetic peptide derived from human HOXA6/HOX1B (171-233aa) Lsotype: IgG Purification: affinitywww.sunlongbiotech.com purified by Protein A Storage Buffer: 0.01M TBS(pH7.4) with 1% BSA, 0.03% Proclin300 and 50% Glycerol. Store at -20 °C for one year. Avoid repeated freeze/thaw cycles. The lyophilized antibody is stable at room temperature for at least one month and for greater than a year Storage: when kept at -20°C. When reconstituted in sterile pH 7.4 0.01M PBS or diluent of antibody the antibody is stable for at least two weeks at 2-4 °C. background: The Hox homeobox genes encode proteins that are transcriptional regulators with an established role in embryonic development. HoxA6 (homeobox A6), also known as Product Detail: HOX1B, is a 233 amino acid protein that localizes to the nucleus.
    [Show full text]
  • Increased HOXA5 Expression Provides a Selective Advantage for Gain of Whole Chromosome 7 in IDH Wild-Type Glioblastoma
    Downloaded from genesdev.cshlp.org on May 11, 2018 - Published by Cold Spring Harbor Laboratory Press Increased HOXA5 expression provides a selective advantage for gain of whole chromosome 7 in IDH wild-type glioblastoma Patrick J. Cimino,1,2,17 Youngmi Kim,1,17 Hua-Jun Wu,3,4,5 Jes Alexander,1 Hans-Georg Wirsching,1,6 Frank Szulzewsky,1 Ken Pitter,7 Tatsuya Ozawa,1,8 Jiguang Wang,9,10,16 Julio Vazquez,11 Sonali Arora,1 Raul Rabadan,9,10 Ross Levine,12 Franziska Michor,3,4,5,13,14,15 and Eric C. Holland1 1Division of Human Biology, Fred Hutchinson Cancer Research Center, Seattle, Washington 98109, USA; 2Department of Pathology, Division of Neuropathology, University of Washington, Seattle, Washington 98104, USA; 3Department of Biostatistics and Computational Biology, Dana-Farber Cancer Institute, Harvard T.H. Chan School of Public Health, Boston, Massachusetts 02215, USA; 4Department of Biostatistics, Harvard T.H. Chan School of Public Health, Boston, Massachusetts 02115, USA; 5Department of Stem Cell and Regenerative Biology, Harvard University, Cambridge, Massachusetts 02138, USA; 6Department of Neurology, University Hospital Zurich, Zurich 8091, Switzerland; 7Department of Cancer Biology and Genetics, Memorial Sloan Kettering Cancer Center, New York, New York 10065, USA; 8Division of Brain Tumor Translational Research, National Cancer Center Research Institute, Tokyo 104-0045, Japan; 9Department of Biomedical Informatics, Columbia University, New York, New York 10027, USA; 10Department of Systems Biology, Columbia University, New York,
    [Show full text]
  • Functional Genomics Atlas of Synovial Fibroblasts Defining Rheumatoid Arthritis
    medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Functional genomics atlas of synovial fibroblasts defining rheumatoid arthritis heritability Xiangyu Ge1*, Mojca Frank-Bertoncelj2*, Kerstin Klein2, Amanda Mcgovern1, Tadeja Kuret2,3, Miranda Houtman2, Blaž Burja2,3, Raphael Micheroli2, Miriam Marks4, Andrew Filer5,6, Christopher D. Buckley5,6,7, Gisela Orozco1, Oliver Distler2, Andrew P Morris1, Paul Martin1, Stephen Eyre1* & Caroline Ospelt2*,# 1Versus Arthritis Centre for Genetics and Genomics, School of Biological Sciences, Faculty of Biology, Medicine and Health, The University of Manchester, Manchester, UK 2Department of Rheumatology, Center of Experimental Rheumatology, University Hospital Zurich, University of Zurich, Zurich, Switzerland 3Department of Rheumatology, University Medical Centre, Ljubljana, Slovenia 4Schulthess Klinik, Zurich, Switzerland 5Institute of Inflammation and Ageing, University of Birmingham, Birmingham, UK 6NIHR Birmingham Biomedical Research Centre, University Hospitals Birmingham NHS Foundation Trust, University of Birmingham, Birmingham, UK 7Kennedy Institute of Rheumatology, University of Oxford Roosevelt Drive Headington Oxford UK *These authors contributed equally #corresponding author: [email protected] NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. 1 medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Long Noncoding RNA ANRIL Promotes Non–Small Cell Lung
    Published OnlineFirst December 12, 2014; DOI: 10.1158/1535-7163.MCT-14-0492 Cancer Biology and Signal Transduction Molecular Cancer Therapeutics Long Noncoding RNA ANRIL Promotes Non–Small Cell Lung Cancer Cell Proliferation and Inhibits Apoptosis by Silencing KLF2 and P21 Expression Feng-qi Nie1, Ming Sun2, Jin-song Yang3, Min Xie2, Tong-peng Xu1, Rui Xia2, Yan-wen Liu2, Xiang-hua Liu2, Er-bao Zhang2, Kai-hua Lu1, and Yong-qian Shu1 Abstract Recent evidence highlights long noncoding RNAs (lncRNA) was increased in NSCLC tissues, and its expression level was as crucial regulators of cancer biology that contribute to essen- significantly correlated with tumor–node–metastasis stages and tial cancer cell functions such as cell proliferation, apoptosis, tumor size. Moreover, patients with high levels of ANRIL and metastasis. In non–small cell lung cancer (NSCLC), several expression had a relatively poor prognosis. In addition, taking lncRNAs' expressions are misregulated and have been nomi- advantage of loss-of-function experiments in NSCLC cells, we nated as critical actors in NSCLC tumorigenesis. LncRNA ANRIL found that knockdown of ANRIL expression could impair cell was first found to be required for the PRC2 recruitment to and proliferation and induce cell apoptosis both in vitro and vivo. silencing of p15INK4B, the expression of which is induced by the Furthermore, we uncover that ANRIL could not repress p15 ATM–E2F1 signaling pathway. Our previous study showed that expression in PC9 cells, but through silencing of KLF2 and P21 ANRIL was significantly upregulated in gastric cancer, and it transcription. Thus, we conclusively demonstrate that lncRNA could promote cell proliferation and inhibit cell apoptosis by ANRIL plays a key role in NSCLC development by associating silencing of miR99a and miR449a transcription.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • 1 Title 1 Loss of PABPC1 Is Compensated by Elevated PABPC4
    bioRxiv preprint doi: https://doi.org/10.1101/2021.02.07.430165; this version posted February 15, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 1 Title 2 Loss of PABPC1 is compensated by elevated PABPC4 and correlates with transcriptome 3 changes 4 5 Jingwei Xie1, 2, Xiaoyu Wei1, Yu Chen1 6 7 1 Department of Biochemistry and Groupe de recherche axé sur la structure des 8 protéines, McGill University, Montreal, Quebec H3G 0B1, Canada 9 10 2 To whom correspondence should be addressed: Dept. of Biochemistry, McGill 11 University, Montreal, QC H3G 0B1, Canada. E-mail: [email protected]. 12 13 14 15 Abstract 16 Cytoplasmic poly(A) binding protein (PABP) is an essential translation factor that binds to 17 the 3' tail of mRNAs to promote translation and regulate mRNA stability. PABPC1 is the 18 most abundant of several PABP isoforms that exist in mammals. Here, we used the 19 CRISPR/Cas genome editing system to shift the isoform composition in HEK293 cells. 20 Disruption of PABPC1 elevated PABPC4 levels. Transcriptome analysis revealed that the 21 shift in the dominant PABP isoform was correlated with changes in key transcriptional 22 regulators. This study provides insight into understanding the role of PABP isoforms in 23 development and differentiation. 24 Keywords 25 PABPC1, PABPC4, c-Myc 26 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.07.430165; this version posted February 15, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]