Polymorphisms of Cytochrome P450 Genes in Three Ethnic Groups From

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Balkan Med J 2012; 29: 252-60 • DOI: 10.5152/balkanmedj.2012.039 252 Original Article © Trakya University Faculty of Medicine Polymorphisms of Cytochrome P450 Genes in Three Ethnic Groups from Russia Gülnaz Korytina1, Olga Kochetova1, Leysan Akhmadishina1, Elena Viktorova2, Tatyana Victorova1 1Institute of Biochemistry and Genetics, Genomics, Ufa, Russian Federation 2George-August University of Göttingen, Genomics, Göttingen, Germany ABSTRACT Objective: To determine the prevalence of the most common allelic variants of CYP1A1, CYP1A2, CYP1B1, CYP2C9, CYP2E1, CYP2F1, CYP2J2 and CYP2S1 in a representative sample of the three ethnic groups (Russians, Tatars and Bashkirs) from Republic of Bashkortostan (Russia), and compare the results with existing data published for other populations. Material and Methods: CYPs genotypes were determined in 742 DNA samples of healthy unrelated individuals representative of three ethnic groups. The CYPs gene polymorphisms were examined using the PCR-RLFP method. Results: Analysis of the CYP1A1 (rs1048943, rs4646903), CYP1A2 (rs762551), CYP2E1 (rs2031920) allele, genotype and haplotype frequencies revealed significant differences among healthy residents of the Republic of Bashkortostan of different ethnicities. Distribution of allele and genotype frequen- cies of CYP1A2 (rs35694136), CYP1B1 (rs1056836), CYP2C9 (rs1799853, rs1057910), CYP2F1 (rs11399890), CYP2J2 (rs890293), CYP2S1 (rs34971233, rs338583) genes were similar in Russians, Tatars, and Bashkirs. Analysis of the CYPs genes allele frequency distribution patterns among the ethnic groups from the Republic of Bashkortostan in comparison with the different populations worldwide was conducted. Conclusion: The peculiarities of the allele frequency distribution of CYPs genes in the ethnic groups of the Republic of Bashkortostan should be taken into consideration in association and pharmacogenetic studies. The results of the present investigation will be of great help in elucidating the genetic background of drug response, susceptibility to cancer and complex diseases, as well as in determining the toxic potentials of environmental pollutants in our region. Key Words: Pharmacogenetics, genetic polymorphism, ethnic-related differences CYPs variants in three ethnic groups from Russia Received: 05.10.2011 Accepted: 22.05.2012 Introduction sion involves tissue specific factors, each binding to a certain regulatory element in the 5’ terminal gene region (1-4). The human cytochrome P450 superfamily (CYPs) includes CYPs gene polymorphisms differ markedly in frequency 57 functionally active genes. Genetic polymorphisms in CYPs among different ethnic and racial groups (2, 3, 5, 6). may influence inter-individual variation in human sensitivity to The Republic of Bashkortostan is located in the Southern damaging environmental factors and predisposition to com- part of the Urals. It is a sovereign state under the jurisdiction plex diseases. of Russia. The Republic of Bashkortostan has an exclusive loca- CYPs belong to a group of enzymes that metabolize hun- tion on the border of two continents - Europe and Asia. Repre- dreds of various compounds. Enzymes of the group facilitate sentatives of 70 nations and ethnicities live in the Republic of the incorporation of activated oxygen directly into a substrate Bashkortostan, including Russians (39.3%), Tatars (28.4%) and molecule to produce a more hydrophilic oxidized product Bashkirs (21.9%). This region since ancient times was the scene and water molecule. CYPs perform two important functions of intense ethnic and cultural interactions of ethnic groups of in mammals: they are involved in metabolizing endogenous li- different origins. The current population of the Republic of pophilic substrates, such as steroids, arachidonates, and reti- Bashkortostan is extremely heterogeneous in its ethnic com- noids, and in transforming exogenous compounds. CYPs play position, linguistic and anthropological background (6). The a role in the activation of many procarcinogens (1, 2). study of autosomal DNA markers showed the presence in the Enzymes of the CYP1, CYP2, and CYP3 families are in- gene pool of peoples of Bashkortostan a significant proportion volved in metabolizing exogenous substrates, while members of Caucasoid traits -50 to 90%. Thus, caught at the border be- of other families are involved in the metabolism of endog- tween Europe and Asia, these peoples have preserved traces enous compounds such as vitamin D, retinoic acid, choles- of the mixing of two races, -one from the East, and another- terol and steroid hormones. Expression of the CYPs genes is from the West (7). In addition, it was found that the similarity regulated via several pathways. Inducible transcription is acti- of language plays a smaller role than the geographical prox- vated via a ligand-specific receptor, while constitutive expres- imity of populations. If, for example, people from the Russian Address for Correspondence: Dr. Gülnaz Korytina, Institute of Biochemistry and Genetics, Genomics, Ufa, Russian Federation E-mail: [email protected] Balkan Med J Korytina et al. 2012; 29: 252-60 Cytochrome P450 Genes in Russian Ethnic Groups 253 Ryazan and Kursk regions have only 2-3% of Mongoloid types procedure, gels were stained with 0.1 μg/mL ethidium bro- mtDNA, while the Russians who live on the border between mide for 15 min and photographed in transmitted UV light. Europe and Asia, have 10-12%. This is due to their mixing with Alleles were identified against a marker 100 bp DNA ladder the Turkic peoples in the South Ural region (8). Fermentas (Lithuania). Activity of enzymes, as well as the rate of the metabolic processes in the human body and, consequently, frequency of Statistical analysis the incidence for pathological diseases in the range of differ- Allele and genotype frequencies of the polymorphisms, ent populations vary substantially among them. This variability as well as errors, and confidence intervals were calculated in not only accounts for different environmental and social con- the Statistica v.6.0 program (www.statistica.com StatSoft ditions of the population, lifestyle and diet, but importantly, Inc., USA). Genotype frequency distributions were tested for the genetic background which causes variability in metabolic agreement with the Hardy-Weinberg equilibrium performing parameters. It follows that the pathogenetic relationships be- χ2 test using electronic calculator [http://www.genes.org.uk/ tween some genetic characteristics with individual response to software/hardy-weinberg.html]. CYP1A1 and CYP1A2 haplo- environmental factors can be detected only when the analysis type frequencies, and the values of normalized linkage disequi- includes consideration of specific population characteristics of librium coefficient (Lewontin’s coefficient),D ’, were computed study groups, particularly ethnic heterogeneity. using the expectation maximization algorithm and maximum The purpose of the present study was to investigate the likelihood method with the Haploview 4.2 (10). Differences in prevalence of the most common allelic variants of CYP1A1, allele, genotype and haplotype frequencies distributions be- CYP1A2, CYP1B1, CYP2C9, CYP2E1, CYP2F1, CYP2J2, and tween the ethnic groups were tested for significance by the CYP2S1 in a representative sample of the three ethnic groups χ2 test using the Statistica v. 6.0 programs (www.statistica. (Russians, Tatars and Bashkirs) from the Republic of Bashkor- com StatSoft Inc., USA) and Haploview 4.2 (10). tostan (Russia), and comparing the results with existing data published for other populations. Results Material and Methods Polymorphic variants of the CYPs genes were examined in three ethnic groups residing in the Republic of Bashkorto- DNA samples stan. Genotype frequencies distributions of the CYPs genes The total number of 742 DNA samples of healthy unrelated in all ethnic groups were examined for Hardy-Weinberg individuals, representatives of three ethnic groups, historically proportions. Statistical analysis showed that the genotype dispersed over the territory of the Republic of Bashkortostan frequencies of the CYPs polymorphism do not deviate from (South Ural Region of Russia) have been analyzed in this study. the Hardy-Weinberg proportions in all the considered ethnic There were 319 individuals classified as Russians, 279 Tatars, groups (Russians, Tatars and Bashkirs). Observed counts and and 144 Bashkirs. frequencies of the variant genotypes, alleles and halpotypes Prior to implementation, the present study was approved of the CYP1A1, CYP1A2, CYP1B1, CYP2C9, CYP2E1, CYP2F1, by the Independent Ethics Committee (IEC) of the Institute of CYP2J2 and CYP2S1 are shown in Table 2, 3 and 4. Biochemistry and Genetics, Ufa Scientific Centre of Russian Academy of Sciences, Ufa, Russia. Blood samples were col- CYP1A1 lected during research expeditions in 2004-2008. Ethnic origin Significant interethnic differences were found for the dis- (up to the third generation) was derived by direct interviews tribution of the CYP1A1 polymorphism rs1048943, 2454A>G with examined persons. Peripheral blood samples were col- (χ2=14.466, df=4, p=0.006 and χ2=10.03, df=2, p=0.007, for lected into EDTA tubes and stored at -20oC until DNA isola- genotype and allele, respectively) (Table 2, 3). For Russians tion. Genomic DNA was isolated from white blood cells (10 and Tatars, the genotype and allele frequencies distributions mL) by a standard procedure of phenol–chloroform extraction were similar (p=0.49 and p=0.302,
Recommended publications
  • Identification and Developmental Expression of the Full Complement Of

    Identification and Developmental Expression of the Full Complement Of

    Goldstone et al. BMC Genomics 2010, 11:643 http://www.biomedcentral.com/1471-2164/11/643 RESEARCH ARTICLE Open Access Identification and developmental expression of the full complement of Cytochrome P450 genes in Zebrafish Jared V Goldstone1, Andrew G McArthur2, Akira Kubota1, Juliano Zanette1,3, Thiago Parente1,4, Maria E Jönsson1,5, David R Nelson6, John J Stegeman1* Abstract Background: Increasing use of zebrafish in drug discovery and mechanistic toxicology demands knowledge of cytochrome P450 (CYP) gene regulation and function. CYP enzymes catalyze oxidative transformation leading to activation or inactivation of many endogenous and exogenous chemicals, with consequences for normal physiology and disease processes. Many CYPs potentially have roles in developmental specification, and many chemicals that cause developmental abnormalities are substrates for CYPs. Here we identify and annotate the full suite of CYP genes in zebrafish, compare these to the human CYP gene complement, and determine the expression of CYP genes during normal development. Results: Zebrafish have a total of 94 CYP genes, distributed among 18 gene families found also in mammals. There are 32 genes in CYP families 5 to 51, most of which are direct orthologs of human CYPs that are involved in endogenous functions including synthesis or inactivation of regulatory molecules. The high degree of sequence similarity suggests conservation of enzyme activities for these CYPs, confirmed in reports for some steroidogenic enzymes (e.g. CYP19, aromatase; CYP11A, P450scc; CYP17, steroid 17a-hydroxylase), and the CYP26 retinoic acid hydroxylases. Complexity is much greater in gene families 1, 2, and 3, which include CYPs prominent in metabolism of drugs and pollutants, as well as of endogenous substrates.
  • 2016 SOT Enterocytes

    2016 SOT Enterocytes

    Human Enterocytes: Isolation, Cryopreservation, Characterization, and Application in The Evaluation of Drug-Food Interactions Albert P. Li, Qian Yang, David Ho, Carol J. Loretz, Stephen N. Ring, Kirsten Amaral, Utkarsh Doshi, In Vitro ADMET Laboratories Inc., Columbia, MD and Malden, MA Introduction Results Why Enterocytes Successful Isolation and Comparison of Enterocytes and Hepatocytes in Drug Metabolizing Enzyme Activities (pmol/min/million enterocytes) Drug Gene Expression Substrate • Key cell type for oral bioavailability (as a Cryopreservation from Metabolizing Substrate Metabolite HE3005 HE3006 HE3007 HE3008 HE3009 HE3010 HE3011 HE3014 HE3015 HE3016 HE3020 HE3027 HE3029 Conc. (µM) function of permeability, metabolism, efflux) Multiple Donors Enzyme P450 Isoforms CYP2C9 Diclofenac 25 4-OH Diclofenac 1.68 0.59 0.91 0.46 1.18 1.21 0.03 0.44 2.50 2.05 0.31 2.02 0.86 First pass metabolism before the liver • CYP3A4/5 Midazolam 20 1-OH-Midazolam 2.67 0.13 0.99 0.87 0.72 0.46 0.09 0.40 2.55 0.99 0.49 0.68 0.59 Lot Gender Race Age (Years) -ΔCт -ΔCт Ratio of enterocyte to Gene name 2 enterocytes 2 hepatocytes 7-OH Coumarin UGT 7-OH Coumarin 100 8.38 2.30 3.08 1.80 4.32 2.56 1.01 3.55 7.33 5.71 5.83 3.68 6.55 • Target of drug-interactions with orally co- hepatocytes Glucuronide HE3005 M C 23 Sulfate administered substances CYP1A2 0.0000 0.1333 0.00 7-OH Coumarin 100 7-OH Coumarin Sulfate 8.72 2.04 4.04 1.79 7.78 3.32 1.70 2.66 5.23 4.13 1.84 2.69 3.65 HE3006 M C 47 Transferase CYP2B6 0.0024 1.0304 0.00 • Target of enterotoxicity of ingested
  • Synonymous Single Nucleotide Polymorphisms in Human Cytochrome

    Synonymous Single Nucleotide Polymorphisms in Human Cytochrome

    DMD Fast Forward. Published on February 9, 2009 as doi:10.1124/dmd.108.026047 DMD #26047 TITLE PAGE: A BIOINFORMATICS APPROACH FOR THE PHENOTYPE PREDICTION OF NON- SYNONYMOUS SINGLE NUCLEOTIDE POLYMORPHISMS IN HUMAN CYTOCHROME P450S LIN-LIN WANG, YONG LI, SHU-FENG ZHOU Department of Nutrition and Food Hygiene, School of Public Health, Peking University, Beijing 100191, P. R. China (LL Wang & Y Li) Discipline of Chinese Medicine, School of Health Sciences, RMIT University, Bundoora, Victoria 3083, Australia (LL Wang & SF Zhou). 1 Copyright 2009 by the American Society for Pharmacology and Experimental Therapeutics. DMD #26047 RUNNING TITLE PAGE: a) Running title: Prediction of phenotype of human CYPs. b) Author for correspondence: A/Prof. Shu-Feng Zhou, MD, PhD Discipline of Chinese Medicine, School of Health Sciences, RMIT University, WHO Collaborating Center for Traditional Medicine, Bundoora, Victoria 3083, Australia. Tel: + 61 3 9925 7794; fax: +61 3 9925 7178. Email: [email protected] c) Number of text pages: 21 Number of tables: 10 Number of figures: 2 Number of references: 40 Number of words in Abstract: 249 Number of words in Introduction: 749 Number of words in Discussion: 1459 d) Non-standard abbreviations: CYP, cytochrome P450; nsSNP, non-synonymous single nucleotide polymorphism. 2 DMD #26047 ABSTRACT Non-synonymous single nucleotide polymorphisms (nsSNPs) in coding regions that can lead to amino acid changes may cause alteration of protein function and account for susceptivity to disease. Identification of deleterious nsSNPs from tolerant nsSNPs is important for characterizing the genetic basis of human disease, assessing individual susceptibility to disease, understanding the pathogenesis of disease, identifying molecular targets for drug treatment and conducting individualized pharmacotherapy.
  • CYP2F1 (NM 000774) Human Tagged ORF Clone Product Data

    CYP2F1 (NM 000774) Human Tagged ORF Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC223097 CYP2F1 (NM_000774) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: CYP2F1 (NM_000774) Human Tagged ORF Clone Tag: Myc-DDK Symbol: CYP2F1 Synonyms: C2F1; CYP2F; CYPIIF1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 CYP2F1 (NM_000774) Human Tagged ORF Clone – RC223097 ORF Nucleotide >RC223097 representing NM_000774 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACAGCATAAGCACAGCCATCTTACTCCTGCTCCTGGCTCTCGTCTGTCTGCTCCTGACCCTAAGCT CAAGAGATAAGGGAAAGCTGCCTCCGGGACCCAGACCCCTCTCAATCCTGGGAAACCTGCTGCTGCTTTG CTCCCAAGACATGCTGACTTCTCTCACTAAGCTGAGCAAGGAGTATGGCTCCATGTACACAGTGCACCTG GGACCCAGGCGGGTGGTGGTCCTCAGCGGGTACCAAGCTGTGAAGGAGGCCCTGGTGGACCAGGGAGAGG AGTTTAGTGGCCGCGGTGACTACCCTGCCTTTTTCAACTTTACCAAGGGCAATGGCATCGCCTTCTCCAG TGGGGATCGATGGAAGGTCCTGAGACAGTTCTCTATCCAGATTCTACGGAATTTCGGGATGGGGAAGAGA AGCATTGAGGAGCGAATCCTAGAGGAGGGCAGCTTCCTGCTGGCGGAGCTGCGGAAAACTGAAGGCGAGC CCTTTGACCCCACGTTTGTGCTGAGTCGCTCAGTGTCCAACATTATCTGTTCCGTGCTCTTCGGCAGCCG CTTCGACTATGATGATGAGCGTCTGCTCACCATTATCCGCCTTATCAATGACAACTTCCAAATCATGAGC
  • Metabolic Activation and Toxicological Evaluation of Polychlorinated Biphenyls in Drosophila Melanogaster T

    Metabolic Activation and Toxicological Evaluation of Polychlorinated Biphenyls in Drosophila Melanogaster T

    www.nature.com/scientificreports OPEN Metabolic activation and toxicological evaluation of polychlorinated biphenyls in Drosophila melanogaster T. Idda1,7, C. Bonas1,7, J. Hofmann1, J. Bertram1, N. Quinete1,2, T. Schettgen1, K. Fietkau3, A. Esser1, M. B. Stope4, M. M. Leijs3, J. M. Baron3, T. Kraus1, A. Voigt5,6 & P. Ziegler1* Degradation of polychlorinated biphenyls (PCBs) is initiated by cytochrome P450 (CYP) enzymes and includes PCB oxidation to OH-metabolites, which often display a higher toxicity than their parental compounds. In search of an animal model refecting PCB metabolism and toxicity, we tested Drosophila melanogaster, a well-known model system for genetics and human disease. Feeding Drosophila with lower chlorinated (LC) PCB congeners 28, 52 or 101 resulted in the detection of a human-like pattern of respective OH-metabolites in fy lysates. Feeding fies high PCB 28 concentrations caused lethality. Thus we silenced selected CYPs via RNA interference and analyzed the efect on PCB 28-derived metabolite formation by assaying 3-OH-2′,4,4′-trichlorobiphenyl (3-OHCB 28) and 3′-OH-4′,4,6′-trichlorobiphenyl (3′-OHCB 28) in fy lysates. We identifed several drosophila CYPs (dCYPs) whose knockdown reduced PCB 28-derived OH-metabolites and suppressed PCB 28 induced lethality including dCYP1A2. Following in vitro analysis using a liver-like CYP-cocktail, containing human orthologues of dCYP1A2, we confrm human CYP1A2 as a PCB 28 metabolizing enzyme. PCB 28-induced mortality in fies was accompanied by locomotor impairment, a common phenotype of neurodegenerative disorders. Along this line, we show PCB 28-initiated caspase activation in diferentiated fy neurons.
  • A Transcriptomic Approach to Elucidate the Physiological Significance Of

    A Transcriptomic Approach to Elucidate the Physiological Significance Of

    Madanayake et al. BMC Genomics 2013, 14:833 http://www.biomedcentral.com/1471-2164/14/833 RESEARCH ARTICLE Open Access A transcriptomic approach to elucidate the physiological significance of human cytochrome P450 2S1 in bronchial epithelial cells Thushara W Madanayake1, Ingrid E Lindquist2, Nicholas P Devitt2, Joann Mudge2 and Aaron M Rowland1* Abstract Background: Cytochrome P450 2S1 (CYP2S1) is an orphan P450 with an unknown biological function. Data from our laboratory and others suggest that CYP2S1 may have an important physiological role in modulating the synthesis and metabolism of bioactive lipids including prostaglandins and retinoids. CYP2S1 expression is elevated in multiple epithelial-derived cancers as well as in the chronic hyperproliferative disease psoriasis. Whether CYP2S1 expression in proliferative disease is protective, detrimental, or neutral to disease progression remains to be determined. Two human bronchial epithelial cells (BEAS-2B) were constructed to represent chronic depletion of CYP2S1 using short-hairpin RNA (shRNA) silencing directed toward the 3’UTR (759) and exon 3 (984) of the CYP2S1 gene and compared with a non-targeting shRNA control (SCRAM). Both CYP2S1 mRNA and protein were depleted by approximately 75% in stable cell lines derived from both targeted shRNA constructs (759 and 984). To elucidate the biological significance of CYP2S1, we analyzed transcriptome alterations in response to CYP2S1 depletion in human lung cells. Results: RNA-sequencing (RNA-seq) analysis was performed to compare the transcriptome of the control (SCRAM) and the CYP2S1-depleted (759) BEAS-2B cell lines. Transcriptomes of the replicates from the two cell lines were found to be distinct populations as determined using Principal Component Analysis and hierarchical clustering.
  • Strong Correlation Between Air-Liquid Interface Cultures and in Vivo Transcriptomics of Nasal Brush Biopsy

    Strong Correlation Between Air-Liquid Interface Cultures and in Vivo Transcriptomics of Nasal Brush Biopsy

    Am J Physiol Lung Cell Mol Physiol 318: L1056–L1062, 2020. First published April 1, 2020; doi:10.1152/ajplung.00050.2020. RAPID REPORT Translational Physiology Strong correlation between air-liquid interface cultures and in vivo transcriptomics of nasal brush biopsy X Baishakhi Ghosh,1 Bongsoo Park,1 Debarshi Bhowmik,2 Kristine Nishida,3 Molly Lauver,3 Nirupama Putcha,3 Peisong Gao,4 Murugappan Ramanathan, Jr.,5 Nadia Hansel,3 Shyam Biswal,1 and Venkataramana K. Sidhaye1,3 1Department of Environmental Health and Engineering, Johns Hopkins Bloomberg School of Public Health, Baltimore, Maryland; 2Department of Biology, Johns Hopkins University, Baltimore, Maryland; 3Department of Pulmonary and Critical Care Medicine, Johns Hopkins School of Medicine, Baltimore, Maryland; 4Division of Allergy and Clinical Immunology, Johns Hopkins School of Medicine, Baltimore, Maryland; and 5Department of Otolaryngology-Head and Neck Surgery, Johns Hopkins School of Medicine, Baltimore, Maryland Submitted 18 February 2020; accepted in final form 24 March 2020 Ghosh B, Park B, Bhowmik D, Nishida K, Lauver M, Putcha N, RNA sequencing to determine the correlation between ALI- Gao P, Ramanathan M Jr, Hansel N, Biswal S, Sidhaye VK. cultured epithelial cells and epithelial cells obtained from nasal Strong correlation between air-liquid interface cultures and in vivo brushing and identify differences that may arise as a result of transcriptomics of nasal brush biopsy. Am J Physiol Lung Cell Mol redifferentiation. Physiol 318: L1056–L1062, 2020. First published April 1, 2020; doi:10.1152/ajplung.00050.2020.—Air-liquid interface (ALI) cultures METHODS are ex vivo models that are used extensively to study the epithelium of patients with chronic respiratory diseases.
  • Conformational Changes in Binding of Substrates with Human Cytochrome P450 Enzymes

    Conformational Changes in Binding of Substrates with Human Cytochrome P450 Enzymes

    Book of oral abstracts 100 Conformational changes in binding of substrates with human cytochrome P450 enzymes F. Peter Guengerich, Clayton J. Wilkey, Michael J. Reddish, Sarah M. Glass, and Thanh T. N. Phan Department of Biochemistry, Vanderbilt University School of Medicine, Nashville, TN, USA Introduction. Extensive evidence now exists that P450 enzymes can exist in multiple conformations, at least in the substrate-bound forms (e.g., crystallography). This multiplicity can be the result of either an induced fit mechanism or conformational selection (selective substrate binding to one of two or more equilibrating P450 conformations). Aims. Kinetic approaches can be used to distinguish between induced fit and conformational selection models. The same energy is involved in reaching the final state, regardless of the kinetic path. Methods. Stopped-flow absorbance and fluorescence measurements were made with recombinant human P450 enzymes. Analysis utilized kinetic modeling software (KinTek Explorer®). Results. P450 17A1 binding to its steroid ligands (pregnenolone and progesterone and the 17-hydroxy derivatives) is dominated by a conformational selection process, as judged by (a) decreasing rates of substrate binding as a function of substrate concentration, (b) opposite patterns of the dependence of binding rates as a function of varying concentrations of (i) substrate and (ii) enzyme, and (c) modeling of the data in KinTek Explorer. The inhibitory drugs orteronel and abiraterone bind P450 17A1 in multi-step processes, apparently in different ways. The dye Nile Red is also a substrate for P450 17A1 and its sequential binding to the enzyme can be resolved in fluorescence and absorbance changes. P450s 2C8, 2D6, 2E1, and 4A11 have also been analyzed with regard to substrate binding and utilize primarily conformational selection models, as revealed by analysis of binding rates vs.
  • Expression of CYP2S1 in Human Hepatic Stellate Cells

    Expression of CYP2S1 in Human Hepatic Stellate Cells

    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector FEBS Letters 581 (2007) 781–786 Expression of CYP2S1 in human hepatic stellate cells Carylyn J. Mareka, Steven J. Tuckera, Matthew Korutha, Karen Wallacea,b, Matthew C. Wrighta,b,* a School of Medical Sciences, Institute of Medical Science, University of Aberdeen, Aberdeen, UK b Liver Faculty Research Group, School of Clinical and Laboratory Sciences, University of Newcastle, Newcastle, UK Received 22 November 2006; revised 16 January 2007; accepted 23 January 2007 Available online 2 February 2007 Edited by Laszlo Nagy the expression and accumulation of scarring extracellular Abstract Activated stellate cells are myofibroblast-like cells associated with the generation of fibrotic scaring in chronically fibrotic matrix protein [2]. It is currently thought an inhibition damaged liver. Gene chip analysis was performed on cultured fi- of fibrosis in liver diseases may be an effective approach to brotic stellate cells. Of the 51 human CYP genes known, 13 treating patients for which the cause is refractive to current CYP and 5 CYP reduction-related genes were detected with 4 treatments (e.g. in approx. 30% of hepatitis C infected CYPs (CYP1A1, CYP2E1, CY2S1 and CYP4F3) consistently patients) [2,3]. At present, there is no approved treatment for present in stellate cells isolated from three individuals. Quantita- fibrosis. tive RT-PCR indicated that CYP2S1 was a major expressed Inadvertent toxicity of drugs is often associated with a ‘‘met- CYP mRNA transcript. The presence of a CYP2A-related pro- abolic activation’’ by CYPs [1].
  • PDF (Supplementary Figures)

    PDF (Supplementary Figures)

    Supplementary Information Insights into an Efficient Light-driven Hybrid P450 BM3 Enzyme from Crystallographic, Spectroscopic and Biochemical Studies Jessica Spradlin,1 Diana Lee,1 Sruthi Mahadevan,1 Mavish Mahomed,2 Lawrence Tang,1 Quan Lam,1 Alexander Colbert,1 Oliver S. Shafaat,3 David Goodin,2 Marco Kloos,4 Mallory Kato,1 Lionel E. Cheruzel1* 1 San José State University, Department of Chemistry, One Washington Square, San José, CA 2 Department of Chemistry, One Shields Ave., University of California Davis, Davis, CA. 3 Division of Chemistry and Chemical Engineering, California Institute of Technology, Pasadena, CA. 4 Department of Biomolecular Mechanisms, Max Planck Institute for Medical Research, Heidelberg, Germany. Table of Contents: Figure S1. Graphical representations of C-H---pi interactions with P382..……………………………p.S-2 Figure S2. Transient absorption traces for the various hybrid enzymes …………….………………...p.S-3 Figure S3. UV vis spectra for the substrate-free, NPG bound and reduced hybrid enzymes..….……..p.S-4 Figure S4. Michaelis-Menten saturation curves with 16-pNCA substrate………….…………...……..p.S-4 Figure S5. Partial sequence alignment of 40 human cytochrome P450 heme domains….……...……..p.S-5 S-1 Fig. S1. Graphical representations of C-H---π interactions between the photosensitizer and the P382 residue preserved during the motion of the 310 helix by 2.1 Å in the two molecules present in the asymmetric unit of the DMSO bound structure. S-2 Fig. S2. Transient absorption traces for the dF393A-1, dF393W-1 and sL407C-1 hybrid enzymes and the corresponding difference spectra for the substrate free (SF) and substrate bound (SB) forms (bottom panels).
  • CYTOCHROME P450: Structure-Function

    CYTOCHROME P450: Structure-Function

    MEDCH 527 AER Jan. 4-6, 2017 CYTOCHROME P450: Structure-Function 1. General P450 Characteristics anD Taxonomy 2. Human P450s – Substrate anD Inhibitor Selectivities 3. Structure-Function Aspects of LiganD BinDing, P450 ReDuction anD Oxygen Activation References P450 Homepage -http:// http://drnelson.uthsc.edu/CytochromeP450.html Nelson DR et al., Pharmacogenetics. 1996 6(1):1-42: Nelson DR et al., Pharmacogenetics. 2004 14(1):1-18. Testa, B. The Biochemistry of Drug Metabolism: A 6 Part Series in Chem. BioDivers. (2006-2008). Sligar, SG. Glimpsing the critical intermediate in cytochrome P450 oxidations. Science. 2010 Nov 12;330(6006):924-5. Johnson EF, et al. Correlating structure and function of drug metabolizing enzymes:Progress and ongoing challenges. Drug Metab. Dispos. 42:9-22 (2014). Zientek MA and Youdim K, Reaction Phenotyping:Advances in experimental strategies used to characterize the contribution of drug metabolizing enzymes. Drug Metab. Dispos. 43:163-181 (2015). Almazroo et al., Drug Metabolism in the Liver. Clin. Liver Dis. 21:1-20 (2017). Absorption, Distribution, Metabolism and Excretion (ADME) of Orally Administered Drugs To reach their sites of action in the body, orally administered drugs must be absorbed from the small intestine, survive first pass metabolism - typically in the liver - before eventually being excreted, usually as drug metabolites in the bile and kidney. Therefore, clinically useful drugs must be able to cross an array of cell membranes, which are composed of a lipid bilayer. Drugs must exhibit an adequate degree of lipophilicity (logP of ~2-4) in order to able to dissolve into this lipoidal environment. Many drug metabolism processes render lipophilic drugs more water-soluble so as to facilitate excretion via the kidneys and bile.
  • Pharmacogenetics of Cytochrome P450 and Its Application and Value in Drug Therapy – the Past, Present and Future

    Pharmacogenetics of Cytochrome P450 and Its Application and Value in Drug Therapy – the Past, Present and Future

    Pharmacogenetics of cytochrome P450 and its application and value in drug therapy – the past, present and future Magnus Ingelman-Sundberg Karolinska Institutet, Stockholm, Sweden The human genome x 3,120,000,000 nucleotides x 23,000 genes x >100 000 transcripts (!) x up to 100,000 aa differences between two proteomes x 10,000,000 SNPs in databases today The majority of the human genome is transcribed and has an unknown function RIKEN consortium Science 7 Sep 2005 Interindividual variability in drug action Ingelman-Sundberg, M., J Int Med 250: 186-200, 2001, CYP dependent metabolism of drugs (80 % of all phase I metabolism of drugs) Tolbutamide Beta blokers Warfarin Antidepressants Phenytoin CYP2C9* Diazepam Antipsychotics NSAID Citalopram Dextromethorphan CYP2D6* CYP2C19* Anti ulcer drugs Codeine CYP2E1 Clozapine Debrisoquine CYP1A2 Ropivacaine CYP2B6* Efavirenz Cyclophosphamide CYP3A4/5/7 Cyclosporin Taxol Tamoxifen Tacrolimus 40 % of the phase I Amprenavir Amiodarone metabolism is Cerivastatin carried out by Erythromycin polymorphic P450s Methadone Quinine (enzymes in Italics) Phenotypes and mutations PM, poor metabolizers; IM, intermediate met; EM, efficient met; UM, ultrarapid met Frequency Population Homozygous based dosing for • Stop codons • Heterozygous Two funct deleterious • Deletions alleles SNPs • Deleterious • Gene missense • Unstable duplication SNPs protein • Induction • Splice defects EM PM IM UM Enzyme activity/clearance The Home Page of the Human Cytochrome P450 (CYP) Allele Nomenclature Committee http://www.imm.ki.se/CYPalleles/ Webmaster: Sarah C Sim Editors: Magnus Ingelman-Sundberg, Ann K. Daly, Daniel W. Nebert Advisory Board: Jürgen Brockmöller, Michel Eichelbaum, Seymour Garte, Joyce A. Goldstein, Frank J. Gonzalez, Fred F. Kadlubar, Tetsuya Kamataki, Urs A.