The Pennsylvania State University
The Graduate School
College of Medicine
AN INVESTIGATION OF THE VACCINE GENERATED CELL MEDIATED IMMUNE
RESPONSES TO HLA-A2.1 RESTRICTED HPV16E7 EPITOPES IN VIVO USING
TWO PRECLINICAL ANIMAL MODELS
A Dissertation in
Microbiology and Immunology
by
Callie E. Bounds
© 2010 Callie E. Bounds
Submitted in Partial Fulfillment
of the Requirements
for the Degree of
Doctor of Philosophy
December 2010
The dissertation of Callie E. Bounds was reviewed and approved* by the following:
Neil D. Christensen Professor of Pathology and Microbiology and Immunology Dissertation Advisor Chair of Committee
Craig Meyers Professor of Microbiology and Immunology
David J. Spector Professor of Microbiology and Immunology
Todd D. Schell Associate Professor of Microbiology and Immunology
Laura Carrel Associate Professor of Biochemistry and Molecular Biology
Richard Courtney Professor of Microbiology and Immunology Department Chair
*Signatures are on file in the Graduate School
ii Abstract
Human papillomaviruses (HPVs) are small DNA tumor viruses and “high risk” types have been recognized as the etiological agents of cervical cancer. Two prophylactic virus-like particle (VLP) vaccines that protect against the two most common
“high risk” types, HPV16 and HPV18, are currently commercially available. However, the protection provided by each vaccine is type specific and neither vaccine can induce clearance of pre-existing HPV infections or established HPV disease. Moreover, approximately 30% of all cervical cancers are caused by other HPV types and at least 5 other cancers have been linked to HPV infection. Consequently, additional protective and therapeutic vaccine strategies are needed.
The focus of this thesis was to investigate the protective vaccine generated immunity to HLA-A2.1 restricted HPV16 E7 epitopes using two preclinical animal models.
The protective immunity generated after DNA vaccination against the well-known HLA-
A2.1 restricted HPV16 E7 82-90 epitope was first examined using the CRPV/HLA-A2.1 transgenic rabbit model. Infectious CRPV genomes were developed by embedding the epitope within the E7 gene or the L2 gene using two alternative strategies. Protective vaccination studies carried out with these two genomes indicated that this epitope was processed and presented from its position within either the E7 protein or the L2 protein, as epitope vaccinated HLA-A2.1 transgenic rabbits were protected against viral DNA challenge. These studies also revealed that the CRPV genome contains areas of plasticity within both the E7 and the L2 genes that are amenable to PCR induced modification and suggested that while an epitope expressed during a late time point of a natural papillomavirus infection could be targeted by cell mediated immunity, early expressed epitopes are more readily targeted by cellular immunity.
iii It has long been known that route of delivery can have an impact on the immune- stimulating capacity of vaccines. In head to head experiments comparing two vaccination strategies, rabbit groups were vaccinated three times at three-week intervals using the tattoo gun or gene gun followed by challenge with the wild type CRPV genome or an epitope-modified CRPV genome. These protective vaccination studies indicated that DNA vaccination through tattooing or with a gene gun yielded similar levels of protection. Thus the tattoo gun is a simple, useful, and cost-effective alternative to the gene gun and produces comparable results in the CRPV/HLA-A2.1 transgenic rabbit model.
The focus of the third data chapter was the validation of new HLA-A2.1 restricted
HPV16 E7 epitopes identified by bioinformatics. To examine the binding affinity and stability of the peptide/MHC complex, various in vitro assays were performed. The immunogenicity of these potential HPV16E7 epitopes was determined in vivo through peptide and DNA vaccination of HHD mice. HLA-A2-restricted HPV16 E7 epitopes that stimulated epitope-specific CTLs in the HHD mice after peptide vaccination were considered potential epitopes for continued testing. Of the seven candidate epitopes tested, four were immunogenic in vivo. Additional studies to examine the vaccine- induced epitope-specific protective immune responses generated to two of these epitopes were performed using the CRPV/HLA-A2.1 transgenic rabbit model. DNA vaccination was followed by challenge with modified CRPV genomes containing each epitope embedded in the E6 or E7 genes. The data collected from these studies suggested that the C-terminus region of the E7 gene has plasticity and is more amenable to PCR modification than the tested regions within the E6 gene. Additionally,
HLA-A2.1 transgenic rabbits vaccinated against a newly discovered HPV16 E7 epitope were partially protected from challenge with the epitope-modified CRPV genome containing this epitope embedded in the E7 gene.
iv Supplementary projects demonstrated that both the CRPV E6 and CRPV E7 genes are permissive for epitope-modification and that genome position, as well as epitope sequence, affect the stimulating capacity of individual epitopes. Moreover, the
CRPV/HLA-A2.1 transgenic rabbit model is a useful and versatile tool for exploring the vaccine generated immunity in a model of natural papillomavirus infection and the use of both HHD mice and HLA-A2.1 transgenic rabbits to evaluate predicted epitopes overcomes the individual limitations of each HPV preclinical animal model.
v TABLE OF CONTENTS
LIST OF FIGURES xiv
LIST OF TABLES xix
LIST OF ABBREVIATIONS xxi
ACKNOWLEDGEMENTS xxiv
CHAPTER I: Literature Review 1
A. Papillomaviruses 2
1. Introduction 2
2. Human Papillomaviruses 2
a. Types and Tissues 2
i. Cutaneous and mucosal HPVs 2
ii. HPV and cancer progression 3
iii. Infections in immunocompromised patients 6
iv. Current treatments 7
b. Genome Organization 8
c. Life Cycle and Function of Proteins 10
3. Immune Responses to HPV Infections 15
a. Cellular Immunity 15
b. Humoral Immunity 17
c. Protein Localization and Immunity 18
4. An Illustration of Immune Evasion 18
a. The Infectious Cycle 18
b. Inhibition of Host’s Innate Immunity During Infection 20
c. Rare Codon Usage 23
d. Other Mechanisms of Immune Escape 24
vi 5. Commercially available VLP vaccines 24
a. Gardasil and Cervarix 24
b. Deficiencies of First Generation VLP Vaccines 25
B. Animal Model Systems for the Study of Papillomaviruses 26
1. Models of Natural Infection 26
a. Introduction 26
b. BPV 26
c. COPV 27
d. ROPV 27
e. CRPV 28
e. CRPV/HLA-A2.1 30
2. Mouse Models 31
a. Introduction 31
b. C57Bl/6 Mice 31
c. HLA-A2.1 Transgenic Models 32
i. HHD Mice 32
C. HPV Therapeutic Vaccines 33
1. Challenges of Vaccine Development 33
2. Considerations for Therapeutic HPV Vaccine Designs 34
3. Current Therapeutic HPV Vaccine Strategies 35
a. DNA Vaccines 35
b. Peptide/protein Vaccines 36
c. Viral/bacterial Vectors 37
d. Dendritic Cell Vaccines 38
e. Combination Vaccines 39
f. Non-HPV-Specific Therapies 40
vii 4. The First Human T Cell Vaccine 41
CHAPTER II: Introduction to the thesis 42
CHAPTER III: Relocation of an HPV16 E7 HLA-A2.1 Restricted CD8+ T Cell Epitope into the Cottontail Rabbit Papillomavirus (CRPV) Genome Increases the Protective Immunity Elicited in the HLA-A2.1 Transgenic Rabbit Model 47
A. Abstract 48
B. Introduction 49
C. Materials and Methods 51
1. DNA vaccines 51
2. Viral DNA challenge constructs 51
3. Rabbit vaccination and DNA challenge 54
4. Papilloma volume determination and statistical analysis 55
D. Results 56
1. Epitope modified CRPV genomes produce papillomas 56
2. DNA vaccinated HLA-A2.1 transgenic rabbits are partially protected against challenge with a modified CRPV genome 60
3. DNA vaccinated HLA-A2.1 transgenic rabbits are completely protected against challenge with a modified CRPV genome 60
4. DNA vaccination generates epitope-specific immunity in HLA-A2.1 transgenic rabbits 65
E. Discussion 72
F. Acknowledgements 77
CHAPTER IV: DNA Vaccination by Tattooing Induces Specific Protective Immunity to HLA-A2.1 Restricted CRPV E1 and HPV16 E7 Epitopes in HLA-A2.1 Transgenic Rabbits 78
A. Abstract 79
viii B. Introduction 81
C. Materials and Methods 84
1. DNA vaccines 84
2. DNA plasmids 84
3. Rabbit vaccination and DNA challenge 85
4. Histology and immunofluorescence detection 87
5. Statistical analysis 87
D. Results 88
1. Detection of EGFP 88
2. DNA vaccination by tattooing provides complete protection against wild type CRPV challenge 88
3. Gene gun and tattoo gun DNA vaccination provide similar levels of protection 93
4. DNA vaccination by tattooing provides complete protection against a modified CRPV genome 95
E. Discussion 103
F. Acknowledgements 105
CHAPTER V: Characterizing the Immunogenicity of a “Sequence Optimized” HPV16 E7 HLA-A2.1 Restricted Epitope Using Two HLA-A2.1 Transgenic Preclinical Animal Models 106
A. Abstract 107
B. Introduction 109
C. Materials and Methods 109
1. Bioinformatics and peptide synthesis 112
2. Antibodies, tetramer synthesis, and flow cytometry 112
3. HLA-A2.1 peptide binding assay 113
4. HLA-A2.1 stability assay 113
ix 5. Animals 114
6. HLA-A2.1 transgenic mice vaccination 114
7. Cell culture 115
8. Dendritic cell isolation and culture 115
9. Tetramer staining assay 116
10. Intracellular cytokine staining assay 116
11. DNA vaccine 117
12. Viral DNA challenge constructs 117
13. Rabbit vaccination and viral DNA challenge 119
14. Papilloma volume determination and statistical analysis 119
D. Results 120
1. Sequence modification increases binding affinity of HLA-A2.1 restricted epitope 120
2. Peptide immunization of HHD mice produces epitope- specific CTLs 123
3. An epitope-modified CRPV genomes produces papillomas 130
4. Epitope DNA vaccination is partially protective against an epitope-modified CRPV genome 133
E. Discussion 138
F. Acknowledgements 141
CHAPTER VI: Identification and Characterization of the Vaccine Generated Cellular Immune Responses to Computer-Predicted and Known HPV16 E7 HLA-A2.1 Restricted Epitopes In Vivo 142
A. Abstract 143
B. Introduction 145
C. Materials and Methods 147
1. Bioinformatics and peptide synthesis 147
x 2. Antibodies, tetramer synthesis, and flow cytometry 147
3. HLA-A2.1 peptide binding assay 147
4. HLA-A2.1 stability assay 148
5. Animals 149
6. HLA-A2.1 transgenic mice vaccination 149
7. Cell culture 150
8. Dendritic cell isolation and culture 150
9. Tetramer staining assay 151
10. Intracellular cytokine staining assay 151
11. DNA vaccine 151
12. Viral DNA challenge constructs 152
13. Rabbit vaccination and viral DNA challenge 160
14. Papilloma volume determination and statistical analysis 160
D. Results 161
1. Multiple epitope prediction programs identify potential vaccine targets 161
2. Epitope affinities for the HLA-A2.1 molecule 163
3. Peptide immunization of HHD mice generates epitope- specific CTLs 169
4. Gene gun immunization of HHD mice does not provoke a measurable CTL response 184
5. Epitope insertion but not epitope substitution within E7 produces functional CRPV genomes 187
6. DNA vaccination did not protect against challenge with the CRPV/E7ins11-19 genome 194
7. Epitope insertion within E6 results in CRPV genomes with reduced viabilities 199
8. DNA vaccination offers little protection against challenge with a CRPV genome modified within E6 203
xi
E. Discussion 214
F. Acknowledgements 220
CHAPTER VII: Discussion and Future Studies 221
A. Summary of Aim 1 222
1. Future studies 225
a. How do we prevent spreading immunity in the CRPV/HLA-A2.1 transgenic rabbit model? 225
i. Hypothesis #1 225
b. Why is the HPV16E7 82-90 epitope preferentially targeted when it is embedded in CRPV E7 as compared to CRPV L2? 226
i. Hypothesis #1 226
ii. Hypothesis #2 227
iii. Hypothesis #3 228
c. Why does the CRPV/E7ins82-90 genome exhibit a reduced growth rate in the CRPV/HLA-A2.1 transgenic rabbit model? 229
i. Hypothesis #1 229
ii. Hypothesis #2 229
d. Can vaccine generated cellular immunity target the HPV16E7 82-90 epitope located in CRPV E1 and E2 genes? 230
B. Summary of Aim 2 231
1. Future studies 232
a. Why do papillomas resulting from challenge with CRPV/E7(82-90)TR quickly progress to cancer in the CRPV rabbit model? 232
i. Hypothesis #1 232
b. Is DNA vaccination by tattooing a viable therapeutic strategy in the CRPV/HLA-A2.1 transgenic rabbit model? 233
xii
c. Is peptide vaccination with the tattoo gun a viable strategy in the CRPV/HLA-A2.1 transgenic rabbit model? 234
i. Hypothesis #1 234
C. Summary of Aim 3 235
1. Future studies 237
a. What are some additional strategies for identifying HLA-A2.1 restricted HPV epitopes? 237
b. Can the tandem repeat genome strategy create viable genomes containing epitopes in multiple CRPV early genes for future vaccination studies in the CRPV/HLA-A2.1 transgenic rabbit model? 238
i. Hypothesis #1 238
c. Will a multivalent HPV16E7 epitope DNA vaccine generate a protective and/or therapeutic immune response in the CRPV/HLA-A2.1 transgenic rabbit model? 239
D. Limitations of the CRPV/HLA-A2.1 transgenic rabbit model 240
E. Concluding Remarks 241
REFERENCES 244
xiii LISTS OF FIGURES
Figure 1.1. World wide cervical cancer 4
Figure 1.2 Schematic of the HPV type 16 genome 9
Figure 1.3 Dynamic architecture of normal and HPV-infected epithelium 12
Figure 1.4 Detection of CD8+ and CD4+ T cells in canine oral mucosa by Immunohistochemistry 16
Figure 1.5 Expression patterns of viral antigens within the papilloma 19
Figure 1.6 Modulation of JAK-Stat pathway activation by HPV E6 and E7 oncogenes 21
Figure 1.7 Diagram of the ORFs of CRPV 29
Figure 3.1. Diagram of the HPV16E7/82-90 DNA epitope 52
Figure 3.2 Diagram illustrating the L2 and E7 proteins of CRPV before and after modification of the CRPV genes 57
Figure 3.3 Papilloma GMDs from New Zealand White rabbits challenged with CRPV/L2sub82-90 DNA and wild type CRPV DNA 58
Figure 3.4 Papilloma GMDs from New Zealand White rabbits challenged with CRPV/E7ins82-90 DNA and wild type CRPV DNA 59
Figure 3.5 Papilloma outgrowth in DNA vaccinated outbred HLA-A2.1 transgenic and control rabbits after challenge with CRPV/L2sub82-90 63
Figure 3.6 Papilloma outgrowth in DNA vaccinated outbred HLA-A2.1 transgenic and control rabbits after challenge with wild type CRPV DNA 64
Figure 3.7 Papilloma outgrowth in DNA vaccinated outbred HLA-A2.1 transgenic and control rabbits after challenge with CRPVE7ins82-90 68
Figure 3.8 Papilloma outgrowth in DNA vaccinated outbred HLA-A2.1 transgenic and control rabbits after challenge with wild type CRPV DNA 69
Figure 3.9 Papilloma outgrowth in DNA vaccinated outbred HLA-A2.1 transgenic rabbits after challenge with wild type CRPV DNA or CRPV/e7ins82-90 71
xiv Figure 4.1A Detection of EGFP expression in each pun biopsy 24 hours after 10ug of pCR3-EGFP was delivered using the gene gun 89
Figure 4.1B H&E ear punch biopsy after gene gun delivery of 10ug of pCR3-EGFP 89
Figure 4.2A Detection of EGFP expression in ear punch biopsy 24 hours after 10ug of pCR3-EGFP was delivered using the tattoo gun 91
Figure 4.2B H&E ear punch biopsy after tattoo gun delivery of 10ug of pCR3-EGFP 91
Figure 4.3 Papilloma outgrowth in DNA vaccinated outbred HLA-A2.1 transgenic rabbits after wild type CRPV DNA challenge 94
Figure 4.4 Papilloma outgrowth in gene gun mediated-DNA vaccinated outbred HLA-A2.1 transgenic and control rabbits after challenge with CRPV/E7ins82-90 DNA 97
Figure 4.5 Papilloma outgrowth in tattoo gun DNA vaccinated outbred HLA-A2.1 transgenic and control rabbits after challenge with CRPV/E7ins82-90 DNA 98
Figure 4.6 Papilloma GMDs from New Zealand White rabbits challenged with CRPV/E7(82-90)TR DNA and wild type CRPV DNA 99
Figure 4.7 Papilloma outgrowth in outbred HLA-A2.1 transgenic and control rabbits after epitope DNA vaccination by tattooing followed by challenge with CRPV/E7(82-90)TR DNA 102
Figure 5.1 Diagram illustrating the HPV16E7/49-57(opt) DNA vaccine 118
Figure 5.2 T2 binding assay for native and optimized HPV16E7 49-57 peptides 121
Figure 5.3 Dilution curve analysis of HPV16 E7 49-57(opt) peptide 122
Figure 5.4 Dilution curve analysis of native HPV16 E7 49-57 peptide 124
Figure 5.5 HLA-A2.1-peptide complex stability assay for HPV16 E7 49-57 and HPV16E7 49-57(opt) peptides 125
Figure 5.6 Tetramer-binding assay for cultured T lymphocytes from HHD mice vaccinated with the HPV16 E7 49-57(opt) peptide 127
Figure 5.7 IFN-g ICS for cultured T lymphocytes isolated from HHD mice vaccinated and stimulated in vitro with the HPV16 E7 49-57(opt) peptide 128
xv Figure 5.8 IFN-g ICS for cultured T lymphocytes isolated from HHD mice vaccinated with the HPV16 E7 49-57(opt) peptide and cultured with the native HPV16 E7 49-57 peptide 129
Figure 5.9 IFN-g ICS assay for cultured T lymphocytes isolated from HHD mice vaccinated with the HPV16E7/49-57(opt) DNA vaccine 131
Figure 5.10 Papilloma GMDs from New Zealand White rabbits challenged with CRPV/E7ins49-57(opt) DNA and wild type CRPV DNA 132
Figure 5.11 Papilloma outgrowth in DNA vaccinated outbred HLA-A2.1 transgenic and control rabbits after viral challenge with CRPV/E7ins49-57(opt) 136
Figure 5.12 Papilloma outgrowth in DNA vaccinated outbred HLA-A2.1 transgenic and control rabbits after challenge with wild type CRPV DNA 137
Figure 6.1 T2 binding assay for HPV16 E7 11-20, 11-20(T9V), and 11-19 peptides 164
Figure 6.2 T2 binding assay for HPV16 E7 85-93(opt) and 66-74 peptides 165
Figure 6.3 Dilution analysis curves for the native HPV16 E7 11-20 and 11-20(T9V) peptides 166
Figure 6.4 Dilution analysis curve of the HPV16E7 11-19 peptide 167
Figure 6.5 Dilution analysis curves of the HPV16 E7 85-93 and 66-74 peptides 168
Figure 6.6 HLA-A2.1/peptide stability assay for the HPV16E7 11-19, 11-20, and 11-20(T9V) peptides 170
Figure 6.7 HLA-A2.1/peptide stability assay for the HPV16E7 85-93(opt) peptide 171
Figure 6.8 IFN-g ICS staining assay for cultured T lymphocytes isolated from HHD mice vaccinated with the HPV16 E7 85-93(opt) peptide 173
Figure 6.9 IFN-g ICS staining assay for cultured T lymphocytes isolated from HHD mice vaccinated with the HPV16 E7 11-20 peptide 174
Figure 6.10 IFN-g ICS staining assay for cultured T lymphocytes isolated from HHD mice vaccinated with the HPV16 E7 11-20(T9V) peptide 175
xvi Figure 6.11 IFN-g ICS staining assay for cultured T lymphocytes isolated from HHD mice vaccinated with the HPV16 E7 11-19 peptide 176
Figure 6.12 IFN-g ICS of CTLs isolated from HHD mice vaccinated with the HPV16E7 11-19 peptide and incubated with targets presenting HPV16E7 11-20 or 11-20(T9V) peptides 178
Figure 6.13 CTLs isolated from HHD mice vaccinated with the HPV16E7 11-20 peptide recognize targets presenting HPV16E7 11-20 or 11-20(T9V) peptides 180
Figure 6.14 CTLs isolated from HHD mice vaccinated with the HPV16E7 11-20(T9V) peptide recognize targets presenting HPV16E7 11-20 or 11-20(T9V) peptides 182
Figure 6.15 CTLs isolated from DNA vaccinated HHD mice recognize targets presenting their specific peptide 185
Figure 6.16 Papilloma GMDs from New Zealand White rabbits challenged with CRPV/E7sub49-57(opt) DNA and wild type CRPV DNA 189
Figure 6.17 Papilloma GMDs from New Zealand White rabbits challenged with CRPV/E7sub85-93(opt) DNA and wild type CRPV DNA 190
Figure 6.18 Papilloma GMDs from New Zealand White rabbits challenged with CRPV/E7sub11-20 DNA and wild type CRPV DNA 191
Figure 6.19 Papilloma GMDs from New Zealand White rabbits challenged with CRPV/E7ins11-19 DNA and wild type CRPV DNA 192
Figure 6.20 Papilloma GMDs from New Zealand White rabbits challenged with CRPV/E7ins11-20 DNA and wild type CRPV DNA 193
Figure 6.21 Papilloma outgrowth in epitope DNA vaccinated outbred HLA-A2.1 transgenic rabbits and control rabbits after viral challenge with CRPV/E7ins11-19 DNA 197
Figure 6.22 Papilloma outgrowth in epitope DNA vaccinated outbred HLA-A2.1 transgenic rabbits and control rabbits after viral challenge with wild type CRPV DNA 198
Figure 6.23 Papilloma GMDs from New Zealand White rabbits challenged with CRPV/E6ins49-57(opt) DNA and wild type CRPV DNA 200
Figure 6.24 Papilloma GMDs from New Zealand White rabbits challenged with CRPV/E6-457ins49-57(opt) DNA and wild type CRPV DNA 201
Figure 6.25 Papilloma GMDs from New Zealand White rabbits challenged with CRPV/E6ins82-90 DNA and wild type CRPV DNA 202
xvii Figure 6.26 Papilloma GMDs from New Zealand White rabbits challenged with CRPV/E6-457ins82-90 DNA and wild type CRPV DNA 204
Figure 6.27 Papilloma outgrowth in epitope DNA vaccinated outbred HLA-A2.1 transgenic rabbits and control rabbits after viral challenge with CRPV/E6ins49-57(opt) DNA 207
Figure 6.28 Papilloma outgrowth in epitope DNA vaccinated outbred HLA-A2.1 transgenic rabbits and control rabbits after viral challenge with wild type CRPV DNA 208
Figure 6.29 Papilloma outgrowth in epitope DNA vaccinated outbred HLA-A2.1 transgenic rabbits and control rabbits after viral challenge with CRPV/E6-457ins49-57(opt) DNA 212
Figure 6.30 Papilloma outgrowth in epitope DNA vaccinated outbred HLA-A2.1 transgenic rabbits and control rabbits after viral challenge with wild type CRPV DNA 213
Figure 7.1 Diagram describing spreading immunity 224
xviii LISTS OF TABLES
Table 1.1 Cancers attributable to HPV infection 5
Table 1.2 Functions of HPV ORFs 11
Table 3.1 Primer sequences for substitution of the HPV16 E7 82-90 epitope into the CRPV L2 gene and for insertion into the CRPV E7 gene 53
Table 3.2. Tumor protection rates in vaccinated outbred New Zealand White rabbits challenged with CRPV/L2sub82-90 DNA 61
Table 3.3 Tumor protection rates in vaccinated outbred New Zealand White rabbits challenged with wild type CRPV DNA 62
Table 3.4. Tumor protection rates in vaccinated outbred New Zealand White rabbits challenged with CRPV/E7ins82-90 DNA 66
Table 3.5. Tumor protection rates in vaccinated outbred New Zealand White rabbits challenged with wild type CRPV DNA 67
Table 3.6. Tumor protection rates in vaccinated outbred New Zealand White rabbits challenged with CRPV/E7ins82-90 DNA or wild-type CRPV DNA 70
Table 4.1. Tumor protection rates in New Zealand White rabbits after DNA vaccination with two different devices 96
Table 4.2. Tumor protection rates in outbred New Zealand White rabbits challenged with CRPV/E7(82-90)TR DNA after DNA vaccination through tattooing 101
Table 5.1 Tumor protection rates in vaccinated outbred New Zealand White rabbits challenged with CRPV/E7ins 49-57(opt) DNA 134
Table 5.2 Tumor protection rates in vaccinated outbred New Zealand White rabbits challenged with wild type CRPV DNA 135
Table 6.1 Primer sequences used to substitute HPV16 E7 11-20 into the CRPV E7 gene 153
Table 6.2 Primer sequences used to substitute HPV16 E7 85-93 into the CRPV E7 gene 154
Table 6.3 Primer sequences used to substitute HPV16 E7 49-57(opt) into the CRPV E7 gene 155
xix Table 6.4 Primer sequences for insertion of HPV16 E7 11-20 or 11-19 into the CRPV E7 gene 157
Table 6.5 Primer sequences for insertion of HPV16 E7 82-90 or 49-57(opt) into the CRPV E6 gene 158
Table 6.6 Primer sequences for insertion of the HPV16 E7 82-90 or 49- 57(opt) into the CRPV E6 gene at base pair position 457 159
Table 6.7 Binding scores of predicted HLA-A2.1 restricted HPV16 E7 epitopes 162
Table 6.8 Percentages of CD8+ and CD8+/IFNg+ CTLs isolated from HHD mice immunized with the HPV16E7 11-19 peptide 179
Table 6.9 Percentages of CD8+ and CD8+/IFNg+ CTLs isolated from HHD mice immunized with the HPV16E7 11-20 peptide 181
Table 6.10 Percentages of CD8+ and CD8+/IFNg+ CTLs isolated from HHD mice immunized with the HPV16E7 11-20(T9V) peptide 183
Table 6.11 Percentages of CD8+ and CD8+/IFNg+ CTLs isolated from HHD mice immunized with DNA epitope vaccines 186
Table 6.12 Tumor protection in outbred New Zealand White rabbits challenged with CRPV/E7ins 11-19 DNA 195
Table 6.13 Tumor protection rates in vaccinated outbred New Zealand White rabbits challenged with wild type CRPV DNA 196
Table 6.14 Tumor protection in outbred New Zealand White rabbits challenged with CRPV/E6ins 49-57(opt) DNA 205
Table 6.15 Tumor protection rates in vaccinated outbred New Zealand White rabbits challenged with wild type CRPV DNA 206
Table 6.16 Tumor protection rates in vaccinated outbred New Zealand White rabbits challenged with CRPV/E6-457ins 49-57(opt) DNA 210
Table 6.17 Tumor protection rates in vaccinated outbred New Zealand White rabbits challenged with wild type CRPV DNA 211
xx LISTS OF ABBREVIATIONS
Abbreviation Meaning
A Alanine aa Amino Acid
AIN Anal Intraepithelial Neoplasia
APC Antigen Presenting Cell
ANN Artificial Neural Network
APL Altered Peptide Ligand
BFA Brefeldin A bp Base Pair
BPV Bovine Papillomavirus
C Celsius
CIN Cervical Intraepithelial Neoplasia
CMI Cell Mediated Immune(ity)
COPV Canine Oral Papillomavirus
CRPV Cottontail Rabbit Papillomavirus
CTL Cytotoxic T Lymphocyte
DC Dendritic Cell
DMSO Dimethyl Sulfoxide
EGFP Enhanced Green Fluorescent Protein
FITC Fluorescein Isothiocyanate Isomer
GMC-SF Granulocyte Macrophage Colony-Stimulating Factor
GMD Geometric Mean Diameter
HAART Highly Active Anti-Retroviral Therapy
H.CRPV Hershey strain Cottontail Rabbit Papillomavirus
xxi HLA Human Leukocyte Antigen
HPV Human Papillomavirus
ICS Intracellular Cytokine Staining
IFN-g Interferon Gamma i.d. Intradermal i.m. Intramuscular in Inch i.v. Intravenously kb Kilobase lb Pound
LC Langerhans Cell
LPS Lipopolysaccharide
MAb Monoclonal Antibody
MHC Major Histocompatability Complex ml Milliliter mm Millimeters
NK Natural Killer ng nanogram
OCT Optimal Cutting Temperature
(opt) Optimized
ORF Open Reading Frame pAPC Professional Antigen Presenting Cell
PBMC Peripheral Blood Mononuclear Cells
PBS Phosphate Buffered Saline
PCR Polymerase Chain Reaction
PE Phycoerythrin
xxii
PMED Particle Mediated Epidermal Delivery
PV Papillomavirus
QRT-PCR Quantitative Real Time Polymerase Chain Reaction
ROPV Rabbit Oral Papillomavirus
RRP Recurrent Respiratory Papillomatosis
TE Tris-EDTA
TR Terminal Repeat
TT Tetanus Toxoid
Ub Ubiquitin ug Microgram ul Microliter
VIN Vulvar Intraepithelial Neoplasia
VLP Virus-like Particle
Y Tyrosine
xxiii ACKNOWLEDGEMENTS
First and foremost, I would like to thank my parents, Jane and Bill. Without their unconditional love, encouragement, and support none of this would have been possible.
My thanks goes to them both for believing in me, encouraging me to set goals, and instilling in me the confidence and independence necessary to achieve my goals.
Accordingly, I dedicate my dissertation to them.
I would especially like to thank my thesis advisor, Dr Neil Christensen. The patience, wisdom, and guidance that I received from Neil as well as the independence to steer my thesis project in new directions are very much appreciated. I feel privileged to call Neil my scientific mentor, and I am forever grateful for his help in shaping me into an independent scientist.
I would also like to extend my thanks to all the members of the Christensen lab for their many contributions to the completion of my thesis project. Lynn, Nancy, Jiafen,
Sarah, Karla and Neil created a lab environment that was both welcoming and productive. I will cherish all the birthday celebrations, the good food, and great conversations that we shared as well as the incredible scientific conference locations that we visited. Each of you has my gratitude for giving me a home away from home.
Additionally, I would like to thank all the members of my thesis committee Drs
David Spector, Craig Meyers, Todd Schell, and Laura Carrel for sharing their invaluable scientific insights, demonstrating how to think like a scientist, and aiding my scientific development through challenging questions and supportive comments. I would also like to thank the members of the Jake Gittlen Research Foundation and all the students, faculty, and staff of the Department of Microbiology and Immunology for creating an atmosphere that was both friendly and rewarding throughout my graduate career.
xxiv Finally, I would like to extend a special thank-you to Terry and Penny Su for their love and support as well as all of the friends that I’ve made while at Penn State. I am eternally grateful for all of the fun that was had and the memories that were made.
Cheers!
xxv
There is one thing even more vital to science than intelligent methods; and that is, the sincere desire to find out the truth, whatever it may be.
Charles Pierce
xxvi
Chapter I
Literature Review
1 A. Papillomaviruses
1. Introduction
Papillomaviruses (PVs) are small non-enveloped tumor viruses that infect stratified epithelia found at both cutaneous and mucosal sites [360]. PVs gain access to basal keratinocytes through micro-abrasions in the skin and they are maintained at a low copy number until cellular differentiation [343]. These viruses infect a number of different species including, rabbits, canines, bovines, ovines, felines, birds, reptiles, non- human primates, and humans [1]. Currently there are more than 200 different PV types known [2] with more than 100 of these types infecting humans [3]. Human papillomavirus (HPV) types can be subdivided further into “high risk” and “low risk” types based on their association with cancer [4]. Despite the diversity found within the
Papillomaviridae family, all papillomaviruses share a common double stranded 8kb circular DNA genome that can be divided into three regions: early, late, and a long control region (LCR) [5]. Additionally, all papillomavirus types share two critical aspects of biology that is, a restricted host range and a strict tissue tropism. Consequently, HPV types only infect humans where as rabbit types only infect rabbits; and the viral life cycle can only be completed in differentiated squamous epithelium.
2. Human Papillomavirues
a. Types and Tissues
i. Cutaneous and muscosal HPVs
Papillomaviruses cause benign warts and malignant tumors. To date over 100 different human papillomaviruses have been identified that infect either mucosal or cutaneous sites. In addition to the strict host and tissue tropism exhibited by papillomaviruses, each virus typically infects only specific body locations. For example
2 HPV types 2 and 4 infect cutaneous sites and cause common hand warts, where as
HPV 1 infects cutaneous sites on the feet and causes plantar warts [6], [7], [8]. Another group of HPVs are typically found in patients suffering from epidermodysplasia verruciformis, a genetic skin disorder, with HPV type 5 the most prominent member of this group [9]. There are also sexually transmitted HPV types that preferentially infect the genital mucosa. These types can further be subdivided into “high risk” and “low risk” types. HPV 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68, and 73 are all considered “high risk” with HPV 16 and 18 causing 70% of all cervical cancers world wide (Figure 1.1)[10]. Other mucosal types that are considered “low risk” include HPV 6,
11, 32, 42, 44, 54, 55, 61, 71, 72, 74, and 83 [11] with 6 and 11 causing 90% of all benign genital lesions [12]. Additional anatomical regions which can be infected with sexually transmitted HPVs include the anus, vulva, vagina, penis, and oral cavity. It is important to note that most HPV infections remain sub-clinical with the host unaware an infection has even occurred. In some cases an HPV infection can lead to formation of benign lesions that regress on their own without serious incidence [13]. Only in very few cases do HPV infections persist and only a subset of persistent infections progress to malignancy [14].
ii. HPV and cancer progression
The link between HPV infection and cervical cancer is well characterized. “High
risk” HPVs can be detected in 99% of all cervical cancers [15] with 50% of all cervical
carcinomas linked to HPV 16 alone [4]. However, cervical cancer is not the only cancer associated with HPV infection. Approximately 90% of all anal cancer, 40% of all vaginal, vulvar, and penile cancers, 12% of all oropharyngeal, and 3% of all oral cancers are related to HPV infections (Table 1.1) [16]. Taken together, approximately 5.2% of the worldwide cancer burden is attributable to HPV infection.
3 Figure 1.1 Numbers of cervical cancer cases as well as the percentages resulting from the most frequent HPV types worldwide for women 15 years of age and older from 1989- 1992. The black portion of the graph indicates the percentage of cervical cancer cases attributable to the specific HPV type listed on the left side of the graph with the exception of HPV16 which is indicated by a white bar. (Munoz, et al [10])
4 Table 1.1. Number of cases of six different cancers and the percentages of each that are attributable to HPV infections in 2002, separating developed and developing countries (Parkin, et. al 2006 [16])
Attributable Developed countries Developing countries Site to HPV (%)
Total Attributable % all Total Attributable % all cancers to HPV cancer cancers to HPV cancer
Cervix 100 83,400 83,400 1.7 409,400 409,400 7.0
Penis 40 5200 2100 0.0 21,100 8400 0.1
Vulva, vagina 40 18,300 7300 0.1 21,700 8700 0.1
Anus 90 14,500 13,100 0.3 15,900 14,300 0.2
Mouth 3 91,200 2700 0.1 183,100 5500 0.1
Oro-pharynx 12 24,400 2900 0.1 27,700 3300 0.1
All sites 5,016,100 111,500 2.2 5,827,500 449,600 7.7
5 As mentioned earlier, most HPV infections are asymptomatic and clear without treatment. However, in rare cases where active HPV infections persist, progression to cancer is possible. There is often a lag time of decades between initial infection and development of cancer suggesting that the accumulation of numerous genetic insults over time combined with papillomavirus-mediated oncogenesis lead to malignancy [9].
Early precancerous low-grade squamous intraepithelial lesions (i.e. LSIL or cervical intraepithelial neoplasia (CIN)) resemble productive infections with respect to viral protein expression patterns. Within LSIL, structural proteins are still expressed in the upper layers of the epithelium [17] and the viral genome remains episomal [18]. On the other hand, high grade lesions are characterized by a prolonged proliferative stage and in some cases complete loss of structural protein expression [17]. The molecular basis for these changes is thought to result from deregulated oncogene expression that is associated with integration of the viral genome [19]. Integration of the viral DNA into the host cell chromosome is a critical event in the progression to invasive carcinoma and is associated loss of E1, E2, and E4 genes [20], [9]. Loss of E2, which acts as a transcriptional regulator for both oncogenes, leads to deregulation of E6 and E7 expression. These changes in viral gene expression accompanied by the accumulation of secondary genetic mutations as well as epigenetic changes leads to cancer.
iii. Infections in immunocompromised patients
It is well known that immunocompromised populations have an increased risk of
HPV-associated cancers. Numerous studies have demonstrated an increased prevalence of HPV infection, increased risk of CIN, and progression to higher grades of
CIN in HIV-positive women [21], [22], [23], [24]. HIV positive men and women also have an increased risk for anal HPV infections and HPV-associated anal cancers [25], [26].
The incidence of oropharyngeal cancers is also increased in HIV positive men and
6 women and has been associated with sexual behavior [25]. Interestingly, HAART appears to have no benefit in reducing CIN or anal intraepithelial neoplasia (AIN) [27],
[28], or improving the outcome of anal cancers [29].
Other immunosuppressed patients also demonstrate an increased risk of HPV- related cancers. Iatrogenically immunsuppressed women have an increased risk of anogenital cancers and CIN [30]. CIN is also more prevalent in women undergoing renal dialysis or immunosuppressive therapy for systemic lupas. Additionally, patients undergoing renal or liver transplantations have an increased incidence of anal HPV infections [31], [32].
iv. Current treatments
Current therapeutic strategies for HPV infections focus on treating symptoms rather than erradicating disease. Treatment options that are available depend on disease presentation. As expected, there are more treatment options available for genital warts than precancerous and cancerous lesions. Treatment options for genital warts can be divided into two categories, patient-administerted and provider- administerted. Two patient-administerted treatment options are a 0.5% podofilox or a
5% imiquimod topical cream. Podofilox is an antimitotic that works by destroying the wart tissue and has a clearance rate ranging from 45-90% while imiquimod is an immune modulator that induces secretion of proinflammatory cytokines in the localized area with a clearance rate ranging from 70-85% [33]. Provider-administered treatments tend to be more aggressive and include chemical agents and surgical modalities.
Trichloacetic acid at a concentration of 80-90% can be applied directly to the wart until it appears white [34]. This treatment essentiall burns the warts off and clearance rates around 80% are typically seen in patients undergoing several weekly treatments [35].
Cryotherapy is another treatment option and it involves direct application of liquid
7 nitrogen to the wart. Finally, surgical interventions include removal of the warts with a scalpel, electrocautery in which warts are burned off using an electric current, or laser vaporization which involves the use of a carbon dioxide laser. While all surgical methods have clearance rates greater than 70%, there is a propensity for genital warts to reappear at the treatment margins [33].
Treatment options available for precancerous and cancerous lesions are usually ablative in nature. However, choice of treatment differs for patients suffering from low- grade CIN versus high-grade CIN. Patients diagnosed with CIN 1 or CIN 1/2 are typically monitored closely for progression but no immediate treatments are required as these infections are self-limiting and will usually regress on their own. However, treatment options for patients diagnosed with CIN 2/3 or CIN3 include cryotherapy, cold- knife cone biopsy, and loop electrosurgical excision procedure (LEEP) [reviewed in [36].
These types of therapies have a high success rate but are not 100% effective at preventing disease recurrence since these treatments do not eliminate the HPV infection
[37]. Consequently, additional therapeutic strategies are still needed that target the HPV infection.
b. Genome Organization
All HPV genomes are composed of an 8kb double-stranded circular DNA genome (Figure 1.2). Only one strand contains protein coding sequences and all three open reading frames (ORFs) are utilized. All HPV genomes are conserved with respect
to organization. As mentioned earlier, their genomes can be divided into three main
sections based on function. The early region, which occupies over 50% of the viral genome, encodes six ORFs (E1, E2, E4, E5, E6, and E7). Additionally, other papillomaviruses including BPV-1 [38], HPV31 [39],[40], and CRPV [41] encode another early ORF designated E8. As suggested by their name, these proteins are expressed at
8 Figure 1.2. Schematic of the HPV type 16 genome (Fields Virology, (Fig 66-2) [1]).
9 early time points during an HPV infection and in general have regulatory functions (Table
1.2). The late region of the genome encodes two ORFs (L1 and L2), which are the structural proteins. These proteins are synthesized at late time points during an HPV infection. Finally, the LCR (Long Control Region), NCR (Non-Coding Region), or URR
(Upstream Regulatory Region) is located between L1 and E6 and contains cis regulatory elements as well as the viral origin of replication. The three regions of the HPV genome are separated by two polyadenylation sites, early (AE) and late (AL). Finally, HPV
genomes contain two major promoters, designated P97 and P670 in the case of HPV16.
The “early” promoter, P97, which is constitutively active, is responsible for driving the
expression of almost all early ORFs [42] where as the P670, a differentiation-dependent
promoter, is responsible for the expression of the late ORFs [43].
c. Life Cycle and Function of Proteins
Human Papillomaviruses are restricted to infecting stratified squamous
epithelium. Presently, it is thought that HPV particles gain access to the epithelial basal
layer of cells through micro-abrasions in the skin (Figure 1.3). The identity of the
receptor(s) used for entry is controversial. Uptake of bound particles is a slow process
[44]. Following infection, the viral genome is maintained as a stable episome in the
nucleus. The exact number of genomes is unknown but is thought to be between 50-
100 copies per cell. The expression pattern of viral genes following entry is still not
established, but it is thought that both E1 and E2 are expressed since both protein
products are necessary for genome maintenance [45] and genome segregation during
cell division [46], [47]. Both E1 and E2 bind to sequences within the URR [48], [49], [50],
as well as form a complex which is necessary for DNA replication [51], [52], [53]. E2
binds to the URR and recruits E1 to the viral origin [54], [55]. E1 in turn recruits cellular
replicating proteins including replication protein A (RPA) [56] and DNA polymerase α
10 Table 1.2. Functions of HPV ORFs.
Viral ORFs Function E6 Binds p53, directs p53 ubiquitin-mediated degradation E7 Binds pocket family proteins (pRB), promoting S phase entry E1 Helicase, ATPase, necessary for viral replication E2 Transcription factor, regulator of E6 and E7 expression E5 Genome amplification (?), cell signaling modulation (?) E4 Aids virus assembly, virus release (?) L1 Major capsid protein L2 Minor capsid protein
11 Figure 1.3. Stratified squamous epithelial layers before and after PV infection accompanied by the viral expression patterns of each viral proteins throughout the virus life cycle [57].
12 primase to form a multimeric complex [58], [59]. At this point, E2 is no longer required and dissociates from the viral origin [60]. However, E2 plays an additional role in the life cycle as a transcription regulator of the “early” promoter and thus E6 and E7 [61], [62].
E2-mediated regulation of E6 and E7 is dependent on the intracellular levels of E2 [63].
High levels of the E2 protein mediates repression of E6 and E7 genes while low levels of the E2 protein leads to promoter activation and results in E6 and E7 expression [64].
In addition to E1 and E2, E6 and E7 are required for stable maintenance of the viral genome [65]. It is necessary for cells to remain in S-phase as HPV genome replication occurs in synchrony with the host cellular DNA. This is achieved through the actions of both E6 and E7. Additionally, for high-risk HPVs, E6 and E7 work together to retard terminal differentiation through interactions with cell cycle regulators. The synergistic activities of E6 and E7 result in viral replication continuing in the suprabasal layer. It is well established that E7 associates with retinoblastoma protein (pRB) as well as other members of the pocket protein family including p107 and p130 and disrupts the interaction between pRB and E2F resulting in constitutive activation of E2F [66], [67].
The free E2F in turn activates cyclins A and E that allows S phase entry. E7 also associates with cyclin-dependent kinase inhibitors, p21 and p27 [68], [69] and histone deacetylases [70]. The primary role of E6 compliments E7 through prevention of apoptosis. The E6 proteins of mucosotropic “high-risk” and “low risk” HPV types bind p53, a well-known tumor suppressor protein [71], [72]. However, E6 mediated degradation of p53 relies on the recruitment of the cellular protein E6AP, a ubiquitin ligase [73], [74] and to date only the E6 proteins of “high risk” HPV types have been implicated in this recruitment [75]. There is also evidence that E6 binds to Bak [76] and
Bax [77], two additional pro-apoptotic factors, and has the capacity to stimulate cell proliferation independent of E7 through its C- terminal PDZ-ligand domain [78].
Experimental evidence demonstrates that the E7 protein of “low-risk” HPVs binds weakly
13 to pRB [79], though both “high-risk” and “low-risk” HPVs modulate the cell cycle of infected cells demonstrating a common mechanism of action [80].
The next phase of the life cycle involves genome amplification and packaging.
This step is characterized by activation of the differentiation-dependent promoter, which may be triggered by changes in the cellular environment and in turn leads to increased amounts of E1, E2, E4, and E5 proteins. The role of E1 and E2 in genome replication takes place as described earlier with E2 binding to the URR, recruitment of E1 to the origin, the dissociation of E2, and the formation of a multimeric complex containing E1 as well as other cellular proteins necessary for viral replication. However, the exact contributions made by E4 and E5 during amplification are not well characterized.
Studies with E5 suggest that it has a role in modulating cell-signaling events [81] and therefore may act to maintain the cellular environment necessary for genome amplification in the upper layers of the skin. However, the role of E4 remains uncertain, though loss of E4 leads to disruption of late events [82] and the E4 protein of certain
HPV types causes cell-cycle arrest in G2 [83], [84]. Late during the genome amplification stage the structural proteins L1 and L2 are produced [85], [86]. L2 is expressed first followed by L1 and their accumulation leads to assembly of infectious virions in the upper layers of the epithelium [87]. E2 is also thought to contribute to genome packaging by improving the encapsidation process [88]. L2 localizes to the nucleus where it either binds the viral DNA directly [89] or associates with promyelocytic leukemia (PML) bodies that are associated with viral genomes. Meanwhile, L1 assembles into capsomeres, and only relocates to the nucleus once L2 has bound the viral genome [87]. L2 interacts with L1 through its C terminus [90] and interaction between the L1 capsomeres takes place at the C-terminus of the L1 protein [91]. Virus maturation takes place as the cells approach the surface and virus release occurs when the cornified squame is shed. Intracellular retention of viral antigens until the cell
14 reaches the upper layers of the epithelium is thought to limit detection of HPV by the immune system.
3. Immune responses to HPV infections
a. Cellular immunity
Human papillomaviruses are successful infectious agents. They infect the host, usually causing no clinical signs or symptoms and persist as chronic infections that rarely kill the host. The host occasionally shed infectious virus that can go on to infect naïve hosts leading to further propagation of the virus. However, spontaneous regression of both cutaneous and mucosal warts suggests that PV infections do not go unnoticed. Histological examination of regressing animal papillomas reveals large infiltrates of mononuclear cells, while little or no infiltrate is observed in non-regressing papillomas [92]. Phenotypical characterization of wart infiltrating lymphocytes in animal
[93], [92], [94] as well as human [95], [96] papillomas indicates that these infiltrates are composed predominantly of CD8+ and CD4+ T cells as well as macrophages in some cases (Figure 1.4) [97]. Additionally, the local environment contains high concentrations of pro-inflammatory cytokines such as IL-12, TNF-α, and IFN−γ [98], [99] indicating a bias toward a Th1-type response. Examination of the T cell epitope specificity from patients infected with HPV indicates that circulating T cells recognize E6, E7, and L1 epitopes [100], [95],[101] and tumor infiltrating T cells recognize E7 and L1 epitopes [95],
[102]. In healthy volunteers, the occurrence of T cells specific for the E2 and E6 proteins
[103], [104], [105] as well as the L1 protein [106] suggests that these antigens induce protective immune responses. Similarly, circulating T cells specific for E1, E2, E6, and
E7 can be isolated from beagle dogs challenged with COPV [107] and T cells specific for
15 Figure 1.4. Detection of CD8+ and CD4+ T cells in canine oral mucosa by Immunohistochemistry. Normal mucosa has few CD8+ (a) or CD4+ (c) T cells while regressing lesions resulting from COPV infection have increased numbers of both CD8+ (b) and CD4+ (d) T cells. CD4+ T cells infiltrating the fronds of a regressing papilloma (e). Image obtained from Nicholls et.al [108].
16 the E2 protein can be isolated from peripheral blood during and after spontaneous regression of CRPV induced lesions [109], [110]. These studies along with the observation that there is an increased incidence and progression of HPV infections in immunocompromised individuals [111], [112], [113] illustrate the important role of cell- mediated immunity in controlling and eradicating HPV infections.
b. Humoral immunity
Animal models of PV infection facilitate study of the immunological events that take place during the entire infectious cycle from initial infection to papilloma regression or cancer progression. Natural history studies strongly suggest that HPV infections follow a pattern similar to that observed in animal models [114], [115]. In COPV infections, L1-specific neutralizing antibody is initially detected at or just after wart regression with antibody titers peaking 2-3 weeks after complete papilloma regression
[116]. However, even at peak titers antibody concentrations are low, although animals remain resistant to challenge with infectious virus. Serological studies performed with various HPV VLP types have show a significant lag between time of infection and sero- conversion, approximately 6-18 months after first detection of HPV DNA in individuals with persistent HPV infections [117],[118], [119]. Additionally, approximately half of all individuals with incident infections fail to seroconvert [120], [121], [122]. Serological studies with VLPs also demonstrate that a majority of the type specific antibody is specific for L1 [123], where as L2 specific antibody, if detected, is relatively low [124].
As a side note, antibody specific for the early protein E7 has been detected during natural infection but only after the onset of invasive cervical cancer [125].
17 c. Protein localizaton and immunity
In order to understand how cell mediated immunity can gain access to and
eliminate papillomavirus infections, the anatomy of a papilloma, and the expression
patterns of different viral proteins within the infection need to be described. The
expression patterns of the viral early and late proteins in a benign papilloma are
presented in Figure 1.5. After infection of the basal cell layer, low levels of E1 and E2
are expressed along with the two oncogene E6 and E7 [126], [127], [128], [129].
Expression of E6 and E7 continues into the suprabasal layer (intermediate) of infected
epithelium. Activation of the differentiation-dependent promoter leads to an increase in
the proteins necessary for genome amplification including E1, E2, E5, and E4 in the
suprabasal layer [17], [130]. High levels of E4 begin to accumulate in the upper layers of
the skin along with the late structural proteins L1 and L2 [86], [131]. In the case of HPV-
associated cancers, expression levels of E6 and E7 are increased upon viral DNA
integration [132]. Some evidence exists that these cancers may also retain episomal
copies of viral DNA that may lead to the expression of additional early proteins E1, E2
and E5 [133], [134]. The immune system must gain access to the papilloma via the
vascular system of the underlying dermis. Consequently, early proteins E6, E7, E1, E2,
and E5 are the best immune targets for therapeutic intervention of benign as well as
cancerous HPV-induced lesions.
4. An illustration of immune evasion
a. The infectious cycle
The infectious cycle of papillomaviruses provides a prime example of immune evasion. Papillomaviruses target basal keratinocytes; replication, virus assembly, and virus release all take place within differentiating keratinocytes that are already programmed for cell death. Therefore there are no pro-inflammatory or “danger” signals
18 Figure 1.5. Expression patterns of viral antigens within a benign papilloma. (A) E6 and E7 are expressed in the basal layer and lower layers of the papilloma. Low levels of the early proteins E1, E2, E4, and E5 are also expressed. Activation of the differentiation- dependent promotor leads to increased expression of the early proteins E1, E2, E4, and E5. L1 and L2 are expressed in the upper layers of the skin. (B) Viral-life cycle events in infected epithelium (Image obtained from Doorbar [343]).
19 to stimulate an immune response [135]. In addition, during the infectious life cycle there is no systemic virema for the immune system to encounter and PV infections are non- lytic. None of the proteins encoded by the virus are secreted. Additionally, most of the early proteins, which are primarily expressed in the nucleus, are produced at very low levels [136], [137] and the more immunogenic structural proteins are expressed in the upper layers of the skin [138], [139] where there are fewer opportunities for immune cells to encounter these proteins. Finally, E5 mediates down regulation of MHCI [140, 141] preventing presentation of HPV antigens to circulating immune cells. Consequently, the infectious life cycle of papillomaviruses hinders detection of the invading pathogen by the immune system and allows for chronic persistent infections that go unnoticed by the host.
b. Inhibition of host’s innate immune response during infection
HPV infection of basal keratinocytes should result in production of type I interferons. Interferons are soluble factors that activate and attract immune cells to the site of infection. Type I interferons, IFN-α and IFN-β, have antiviral, antiproliferative, and immunostimulatory properties that act as a bridge between the innate and adaptive immune responses through activation of immature DCs [142]. However, many DNA viruses including papillomaviruses have evolved mechanisms to prevent not only the synthesis of type I interferons but also the signaling cascades induced by these immune factors. For example, E7 binds to interferon regulatory factory 9 (IRF-9) preventing the formation of the interferon-stimulating gene factor 3 (ISGF-3) complex that binds interferon-sensitive response element (ISRE) [143], [144], and E6 binds to interferon regulatory factor 3 (IFR-3) and inhibits its function that is necessary for transcription of
IFN-β mRNA (Figure 1.6) [145]. In addition E7 also inhibits activation of the IFN-β
20 Figure 1.6. Modulation of JAK-Stat pathway activation by HPV E6 and E7 oncogenes. E6 prevents phosphorylation of tyk2, stat 1, and stat 2 while E7 binds to IRF-9 thereby preventing formation of the ISGF complex. Image obtained from [146] and modified.
X E6
X
E7 X
21 promoter by physically associating with interferon regulatory factor 1 (IRF-1) [147], and
E6 interacts with tyrosine kinase 2 (Tyk2), preventing it from associating with the IFN-α receptor and preventing Tyk2 phosphorylation as well as the phosphorylation of STAT-1 and STAT-2 (Figure 1.6). Additionally, DNA microarray studies have demonstrated that both E6 and E7 alter the expression of NF-kappaB and activator protein 1 (AP1) regulated genes [148], both of which are constitutively active during carcinogenesis [149] and may contribute to HPV-induced immortalization. From these data it can be concluded that HPV effectively evades the innate immune response through the activities of E6 and E7 that directly alter the expression of genes necessary for immune function and resistance of the host to infection as well as abrogate the type I interferon signaling pathway.
Another method used to evade innate immunity is through the modulation of skin resident dendritic cells (DCs) also known as Langerhans cells (LCs). HPVs gain access to the basal cell layer through micro-abrasions in the skin and therefore, the first professional antigen presenting cells (pAPCs) encountered by HPV virions are LCs.
Numerous independent investigations indicate that HPV-infected epithelium contains fewer LCs than uninfected neighboring tissue [150], [151]. Experimental evidence suggest that the reduction in LCs within HPV infected tissues is linked to the loss of E cadherin, a membrane bound surface molecule expressed by keratinocytes that is necessary for LC migration [152], [153]. Additionally, current reports indicate that the reduction in E-cadherin expression is mediated by E7 [154]. Therefore, these studies point toward LCs present in the HPV-infected tissue to initiate an immune response.
However, studies performed with L1 only and L1/L2 virus-like particles demonstrate that these (VLPs) do bind [155], [156], [157] and are taken up by LCs [158], [159], but incubation of human LCs with HPV 16 L1 only VLPs does not activate LCs [160]. This failure to activate LCs through exposure to L1 VLPs is due to activation of PI3K and
22 down-regulation of Akt [161] and additional data suggest that this immune escape mechanism is attributable to the L2 protein [162]. Consequently, there are fewer pAPCs available in the HPV infected tissues for the uptake and processing of HPV antigen and those LCs found in the tissues fail to mount an immune response as a result fo HPV- induced modulation.
c. Rare codon usage
Redundancy in the genetic code results in several different nucleotide triplets encoding the same amino acid. Species differ in codon choice [163]. Papillomaviruses exploit this redundancy and use codons that are rarely used by their mammalian hosts
[164]. It is theorized that this evolutionary adaptation allows the virus to escape detection by the immune system (reviewed in [165] by keeping the levels of available antigen low. Reduced expression of viral proteins reduces the amount of viral antigen available for processing and presentation to circulating immune cells. Studies in which
“viral preferred” codons were replaced for “mammalian preferred” codons resulted in a marked increase in viral gene translation [166] as well as viral protein immunogenicity
[167]. These studies suggest that production of viral proteins in mammlian cells is inhibited by the availability of the approprite tRNAs during translation and this reduction in viral protein synthesis directly affects the availability of viral antigen for presentation.
Additional studies carried out in the NZW rabbit with CRPV genomes containing
“mammalian preferred” synonymous codons substituted in the CRPV E7 gene provide in
vivo evidence that indicates that the codon bias exhibited by papillomaviruses evolved
as a means of reducing the amount of protein produced and thus the amount of viral
antigen available for presentation to the immune system [168].
23 d. Other mechanisms of immune escape
In addition to the numerous immune evasion mechanisms discussed above, papillomaviruses also use molecular mimicry, a term that refers to mimicking of the structural components or amino acid sequences of host-proteins to take advantage of self-tolerance [169]. Computer assisted analysis of the HPV16 E7 protein indicated a widespread similarity to human proteins involved in regulatory processes including the xeroderma pigmentosum group C complementing protein and the retinoblastoma binding protein 1 [170]. Thus the reduced immunogenicity of the E7 protein could also be related to the motifs shared with these “self” proteins.
5. Commercially available VLP vaccines
a. Gardasil and Cervarix
Currently, there are two commercially available prophylactic vaccines which provide protection against the development of persistent HPV infections through induction of HPV type-specific neutralizing antibodies. Both vaccines are based on VLP technology. To make VLPs the major capsid protein L1 is expressed from eukaryotic expression vectors for self-assembly into particles that are antigenically similar to native virions. Additionally, both vaccines are administered as three intramuscular shots over a
6-month period and provide protection by inducting a humoral immune response.
Gardasil, which is manufactured by Merck, consists of VLPs produced in yeast
[171]. The vaccine includes VLPs comprising the four most common mucosal HPV types: 16, 18, 6 and 11. In numerous clinical trials, this vaccine is 100% effective at preventing CIN I and >96% effective at prevention of persistent infection with the four
HPV types included in the vaccine [172]. Cervarix manufactured by GSK is comprised of VLPs produced in insect cells [173]. Included in Cervarix are VLPs from the two most common “high risk” HPV types, 16 and 18. A review of the data gathered from several
24 Cervarix clinical trials reveals that this vaccine provides 100% protection against CIN I and is 100% effective in preventing persistent infection with the two HPV types included in the vaccine [173], [172]. In addition to their demonstrated efficacy, both vaccines are considered safe with minimal side effects [174].
b. Deficiencies of 1st generation VLP vaccines
The protection provided by both Gardasil and Cervarix is unquestionable.
However, as with any vaccine there are limitations. Both vaccines target the two most common “high risk” HPV types, which are responsible for approximately 70% of all HPV infections, but the cross-protection provided to other related types is limited [175], [176].
In addition, the expense of both vaccines as well as the requirement for cold storage of the vaccines prior to their administration limits the availability of these vaccines in developing countries where 80% of new cervical cancer cases occur [177]. Another deficiency for both vaccines is the lack of available clinical trial data on their safety and efficacy in pregnant women and immunocompromised patients, the latter of which often have a higher incidence of HPV related disease [178], [179]. Finally, in clinical trials that examined if vaccination led to an increase in clearance rates of HPV 16 and 18 in women already infected with these types [180] or led to a decrease in the rate of progression of HPV 16 and 18 infections to CIN 2 [181], there were no differences between vaccine and placebo groups. These studies demonstrate that HPV VLP vaccines have no significant effect on either the rates of clearance or progression of cervical HPV infections. These studies illustrate the greatest limitation of the current HPV vaccines is that neither vaccine induces the cell mediated immune response necessary to eradicate established HPV infections and HPV-related disease. Consequently, there remains a significant need for the development of therapeutic strategies to treat HPV induced disease.
25 B. Animal Model Systems for the Study of Papillomaviruses
1. Models of natural infection
a. Introduction
Papillomaviruses (PVs) are species and tissue specific [358], and as a result
there are no animal models of human papillomavirus (HPV) infection. However, there
are animal models of natural infection and these include bovine papillomavirus (BPV),
canine oral papillomavirus (COPV), rabbit oral papillomavirus (ROPV), and cottontail
rabbit papillomavirus (CRPV). Consequently, numerous studies have been carried out
in these animal models with the information gleaned having direct application to HPV
research. For example, the VLP vaccination studies carried out in these animal models
[182], [183], [184], led the way to the development and use of both the prophylactic HPV
VLP vaccines.
b. BPV
Bovine papillomaviruses (BPVs) are some of the most widely studied animal
papillomaviruses as BPV related diseases can have serious health consequences for
the infected cattle and wide-spread agricultural and economic consequences. To date
six BPV types (1-6) have been identified and characterized. Three BPV types (1,2, and
5) infect both the epithelium and the derma giving rise to fibropapillomas and three BPV
types (3, 4, and 6) infect only the epithelium inducing “true” papillomas. Infection of the
natural host with BPV-1, or BPV-2 can lead to cancer in the urinary bladder [185], [186]
while infection with BPV-4 can progress to cancer of the upper gastrointestinal tract
[187]. However, BPV infections that progress to cancer are typically seen in animals
that are fed a diet of bracken fern, which is known to contain immunosupressants and
chemical carcinogens [188]. Thus, BPV provides an animal model of cutaneous and
26 mucosal infections for investigating the virus-host interactions as well as the role of environmental cofactors in cancer progression.
c. COPV
Canine oral papillomavirus (COPV) is a mucosatropic papillomavirus that typically causes benign lesions of the oro-pharynx in dogs. In limited cases, however, infection with COPV has progressed to squamous cell carcinomas at both cutaneous
[189] and mucosal [190] sites. COPV induced lesions usually develop within 4 weeks of inoculation and undergo a rapid regression approximately 4-8 weeks after papilloma outgrowth [191]. COPV has been used as a model system to examine the role of cellular immunity in controlling and eliminating PV infections [116], [108] as well as the role of humoral immunity in providing protection from infection [183]. However, the usefulness of this model is limited in studies assesing vaccine generated immunity as typical infections with COPV naturally regress.
d. ROPV
Rabbit oral papillomavirus (ROPV) is another mucosatropic virus [192] that naturally infects domestic rabbits and causes lesions on the tongue [193], [194], [195].
Experimental inoculation of the oral cavity, typically the ventral surface of the tongue, results in benign lesions that first appear at 2-3 weeks, continue to grow for 3-6 weeks, and regress by 6-10 weeks [196]. Regression of ROPV induced lesions is characterized by infiltration of many CD4+ T cells and to a lesser extent CD8+ T cells [197]. In addition to the oral mucosa, rabbit genital tissue is also susceptible to infection with ROPV [198].
Previous studies examining the progression of the virus life cycle in numerous animal models of papillomavirus suggest that ROPV most closely resembles that of several mucosatropic HPVs [199] thereby providing yet another model for mucosal
27 papillomavirus infection. However, the tendency of ROPV infections to remain subclinical or naturally regress limits the usefullness of this papillomavirus model in examining vaccine generated protective immunity.
e. CRPV
Cottontail rabbit papillomavirus (CRPV), first described by Dr. Richard E. Shope
[200], induces hyperproliferative lesions at cutaneous sites on cottontail, domestic, snoeshoe, and jackrabbits [201], [202]. Similar to other animal and human papillomaviruses, the CRPV genome (Figure 1.7) is approximately 8Kb and can be divided into three regions. However, two unique features of the CRPV genome are the
E8 ORF that is not typically found in HPV types and the location of the E5 ORF, which is typically located upstream, within the L2 ORF. Experimental inoculation with CRPV leads to papilloma formation at 3 weeks followed by rapid growth over the next 4 weeks.
Papillomas spontaneously regress in approximately 10-40% of inoculated rabbits and another 20-30% will experience persistence, usually of benign lesions [203]. Finally, in
60-80% of infected rabbits papillomas will progress to malignant carcinomas, which can metastasize to the lymph node and lungs [204], [205]. Additionally, latent infections can be generated in this model after innoculation with suboptimal doses of CRPV [206] .
Thus, the CRPV/ rabbit model mimicks the multiple disease manifestations that are typically seen in humans infected with different HPV types and provides an ideal model for studies of prophylactic as well as therapeutic intervention.
Another key feature of the CRPV/rabbit model is the induction of papillomas by inoculating scarified rabbit skin with purified CRPV viral DNA [207]. This method of challenge presumably bypasses protection due to neutralizing antibody, allowing assessment of the cell-mediated immune response to the CRPV infection. Since the discovery that the CRPV genome is infectious, papillomas have been induced by
28 Figure 1.7. Diagram of the ORFs of CRPV.
E1 E8 E5
E4 L1 URR E7
E6 E2 L2
7868/1 1000 2000 3000 4000 5000 6000 7000
29 infectious CRPV DNA expressed from bacterial plasmids [208], [308], [209] and delivered with a gene gun [210], [211] or through topical application of the DNA liquid to sites abraded with a scalpel [209]. This significant discovery has allowed for studies of viral genetics [212], [213], [214], [210], [208], [363], [215], as well as prophylactics and anti-tumor immunotherapeutics [216], [364], [365], [217], [218]. Additionally, numerous
CRPV mutants have been made through point mutations, deletions, insertions, [215] demonstrating that the CRPV genome is amenable to modification without loss of genome viability. Viability in this sense of the word means that the CRPV genome mutants are still able to infect rabbits and produce papillomas. Finally, this model has been used to study the immunological aspects of host-mediated regressions [219] and for testing numerous antivirals [220], [221]. As a result, the CRPV rabbit model system remains a prominent model system for study of numerous viral-host interactions, as well as the viral life cycle in a host of natural papillomavirus infection.
f. CRPV/HLA-A2.1
A second CRPV rabbit model available is the CRPV/HLA-A2.1 transgenic rabbit model [222], [223]. This model was created because studies on viral immunity to CRPV in the context of rabbit MHCI molceules provide little useful information about human epitopes. Rather, antigen-specific T cell responses to HPV epitopes need to be assessed in the context of human MHCI molceules. The human MHCI gene, HLA-A2.1, was chosen because there are a larger number of databases and computer models available for prediction of HLA-A2.1-restricted epitopes. Additionally, a large pool of reagents including, antibodies, cell lines and HLA-A2.1 transgenic mice are available that can be used for functional testing of HLA-A2.1-restricted epitopes. Studies characterizing the CRPV/HLA-A2.1 transgenic model demonstrated that these rabbits are susceptible to CRPV infection similar to normal domestic rabbits but expression of
30 the HLA-A2.1 transgene affords them slightly higher levels of natural immunity to CRPV infections. Additional studies with the CRPV/HLA-A2.1 transgenic rabbit model show the usefulness of this model in providing information about the design, induction, and testing of antigen-specific T cell responses to HPV epitopes [222]. Consequently, the
CRPV/HLA-A2.1 transgenic rabbit model is the best model for assessment of the vaccine-generated epitope-specific immune responses to HPV epitopes in a model of natural papillomavirus infection.
2. Mouse models
a. Introduction
The most well-studied and widely used animal models in HPV research are
mouse models. Mouse models used in HPV studies include C57Bl/6, Balb/c, AAD [224],
HHD [225] A2Kb [226], and K14E6E6 [227]. The two most popular mouse models will
be discussed in further detail below. These models are typically used to examine
strategies that result in HPV tumor rejection. In general, mice are injected with HPV-
transformed cell lines capable of inducing HPV tumors and then HPV therapeutic
strategies aimed at reducing or eliminating the tumor burden are tested. These mouse
models have been used to develop new therapeutic strategies against HPV-induced
disease, to examine the safety and efficacy of various anti-tumor immunotherapeutics
and to evaluate the epitope-specific immune responses generated to HPV epitopes.
b. C57Bl/6 mice
This mouse model is typically used to assess whether a therapeutic intervention
can induce an HPV specific immune response that can eradicate transplantable tumors
that are injected subcutaneously and allowed to grow for a few days to weeks. Tumor
cell lines used with this model include the C3 cell line, which express the HPV16
31 genome and an activated ras oncogene, and the TC-1 cell line, which express HPV16
E6 and E7 as well as an activated ras oncogene. Numerous studies examining and comparing different vaccine strategies [228], [229], [230], [231] as well as various vaccine modalities [232], [233], [234] demonstrate the value of this animal model for
HPV research. However, this model and others like it fail to recapitulate the real-life scenario of an HPV infection which develops over a long period of time, through progressive disease states, and usually from what was once a single normal cell.
c. HLA-A2.1 transgenic mice
i. HHD mouse
HHD mice were created after it was realized that recodnition and usage of HLA class I molecules by mouse CD8+ T cells could be encouraged if H-2-restricted responses were reduced. In these transgenic mice both the mouse beta-2-microglobulin
(β2m) and the mouse H-2Db molecule are knowcked out and the mice express a chimeric HLA-A2.1 molecule composed of the cytosolic, transmembrane, and α3 domains of H-2Db molecule and the α1 and α2 domains of the HLA-A*0201 molecule covalently linked to the human β2m light chain [225]. Transgenic mouse models have been used to evaluate both the T cell responses to HLA-A2.1-restricted HPV epitopes in vivo [235], [236], and evaluate anti-tumor responses induced to HLA-A2.1 expressing
HPV tumors following administration of immunotherapeutics [237]. Two HLA-A2.1 positive tumor cell lines used with this model include TC1/A2 cells [237], which were created by transforming the TC1 tumor cell line with the HLA-A2*0201 gene, and HLF16 cells [238], heart lung fibroblasts from an HLA-A2.1 mouse that express HPV 16 E6 and
E7 as well as H-Ras V12. These animals are excellent models for evaluating the T cell responses generated to previously unknown HLA-A2.1 HPV epitopes. However, as with
32 any mouse model, these animals cannot be infected with any known papillomavirus and injection of “humanized” tumor cells fails to recapitulate cancer development in humans.
C. HPV Therapeutics
1. Challenges of Vaccine Development
Traditionally, an empirical approach has been successful in the development of vaccines against human viral pathogens. In the late 1700s, Edward Jenner observed that milkmaids were less susceptible to smallpox infections and hypothesized that pus from blisters resulting from cowpox infections provided this protection. He tested his hypothesis by inoculating James Phipps with material from cowpox blisters followed by challenge with variolous material. No disease was observed in the Phipps boy and vaccination against human pathogens was born.
Vaccination is one of the great successes of modern day medicine and has had a significant impact on world health. Current types of vaccines in use today include inactivated microorganisms (ex. typhoid vaccine), subunit vaccines (ex. Hepatitis B vaccine), toxoids (ex. Tetanus vaccine) and to a lesser extent live attenuated virus (ex.
FluMist) vaccines [239]. However, current vaccines only protect against a small number of human pathogens and these pathogens typically exhibit low antigenic variability [240].
Furthermore, the protection provided through vaccination against these infectious agents is antibody-mediated. For a substantial number of infectious pathogens the traditional approach to vaccine design has failed. This is due in part to the high antigenic variability exhibited by these pathogens as well as the need to induce cell-mediated immunity in order to provide protection. As a result, a rational approach to vaccine design is needed.
There remain many hurdles that must be overcome before vaccines can be engineered based on established principles of immunity. The greatest of these is a
33 better understanding of the immune system and its interaction with invading pathogens.
Many of the current remaining questions that must be answered include the following: 1) will the vaccine provide protection or therapy, 2) what type of immune response is needed (antibody and/or cell mediated), 3) how should these responses be generated,
4) what anatomic locations should be the focus of the response, 5) what immunogens should be targeted, 6) is viral latency a factor, 7) what route of immunization will provide the desired outcome and at what site, 8) what vaccine dose is needed, 9) are boosters necessary and if so how many? Additionally, it must be realized that the idea of “one size fits all” is not applicable to infectious pathogens or vaccine development.
2. Considerations for Therapeutic HPV Vaccine Design
When designing, evaluating, and implementing potential HPV therapeutics, several factors must be taken into account. As discussed earlier, it is well established that induction of a cell-mediated immune response is necessary for papilloma eradication. Therefore therapeutic strategies must activate a cellular immune response.
Understanding the basic biology of HPV is also essential. Unlike other human pathogens, HPV is not cytolytic, HPV infection is not accompanied by systemic viremia, and none of the HPV proteins are secreted. Therefore, natural immunity is limited. A third issue to consider is which disease state is being targeted by the vaccine. In LSIL and genital warts resulting from infection by “low risk” HPV types, virus still undergoes normal replication, early genes E6, E7, E1, E2 and E5 which can serve as potential therapeutic antigens are still expressed, and the virus is genetically stable. Conversely, in high-grade squamous intraepithelial lesions and invasive cervical carcinoma, viral gene expression is deregulated and E6 and E7 are the predominant HPV antigens.
Additionally, the tumor microenvironment as well as T-cell anergy should be considered when targeting late stages of HPV related disease. When evaluating potential HPV
34 immunotherapeutics the following questions should be considered: Does the vaccine induce HPV-specific effector T cells and do these effector cells traffic efficiently to and target the HPV infected cells? What is the duration of the response? Is the response sufficient to clear all HPV infected cells, even those latently infected? One final consideration when designing and implementing HPV therapeutic vaccines is the cost of vaccination. Approximately 80% of all new cases of cervical cancer are reported in developing countries where routine screenings are uncommon and where costly new vaccines are rarely available.
3. Current therapeutic vaccine strategies
a. DNA Vaccines
DNA vaccines are attractive options for therapeutic intervention of HPV-related disease because they are relatively inexpensive and simple to produce, stable for long periods of time making world-wide distribution convenient, and are considered to be safe and well tolerated with few reported side affects. Additionally, DNA vaccines can be delivered to the patient by many routes including, intramuscular, intradermal, intravenous, and intranasal (reviewed in [241]). However, naked DNA is poorly immunogenic and previous clinical trials with DNA based cancer vaccines have been disappointing [242]. Nevertheless, numerous approaches increasing the immunogenicity of DNA vaccines have been explored. These include the following: linkage of the DNA vaccine to intracellular targeting molecules such as M. tuberculosis heat shock protein (HSP)70 [243] or calreticulin [244], linkage of the DNA vaccine to proteins involved in intercellular transport such as Herpes Simplex Virus (HSV) VP22
[245], and delivery in conjunction with cytokines or costimulatory molecules such as
GMC-SF [246] and IL-12 [247]. In a recent phase I clinical trial, the DNA vaccine pNGVL4a-Sig/E7(detox)/HSP70, a DNA plasmid expressing HPV16E7 mutated at aa 24
35 and 26 and linked to sequences encoding a signal sequence and HSP70, was administered i.m. to patients suffering from CIN 2/3 [248]. The vaccine is safe, induces
HPV16 E7-specific T cell responses, and produces histologic regression in 3 patients. A current ongoing phase II clinical trial is investigating the use of a plasmid DNA vaccine encoding HPV16 and HPV18 E6 and E7 fragments encapsidated in biodegradable microparticles for the treatment of CIN 2/3 [367]
b. Peptide/Protein vaccines
Peptides and full-length HPV proteins have long been examined as possible immunogens for HPV therapeutic intervention. Identification of CTL epitopes for HPV16
E7 and E6 proteins as well as advances in peptide delivery and stability led to increased use of peptides. Immunization of preclinical mouse models with HPV 16 E6 and E7 peptides provokes HPV 16-specific CTLs [235], [249] and can result in eradication of
HPV16 positive tumor cells [250]. A phase I clinical trial in which HPV16 positive HLA-
A2.1 positive patients suffering from CIN 2/3 or VIN 2/3 were vaccinated with HPV16 E7 peptides resulted in measurable immunological responses, partial clearance of virus, and regression of lesions [251]. To enhance the effectiveness of peptide vaccines, adjuvants such as ODN and IFA are often used with some success [252], [253].
Additionally, peptide vaccines have been linked to immunostimulatory carriers (ISCAR) such as the Tra T protein from E. coli to improve their potency [254].
Peptide vaccines are limited based on MHC restriction, therefore full-length
protein vaccines provide an alternative strategy for HPV immunotherapy. Protein based
vaccines allow presentation of all possible epitopes to the immune system. Protein
vaccines adjuvanted with PROVAX [255], as well as IFA [256] induce HPV E7-specific
immune responses that are protective against tumor challenge. Fusion protein vaccines
have also been evaluated as therapeutic vaccines. A phase 1 clinical trial with TA-GW
36 fusion protein, which is composed of HPV6 L2 fused to E7, induced antigen-specific T cell responses in a majority of the vaccinated patients and led to complete regression in
25% of the vaccine recipients [257]. A second fusion protein TA-CIN, which consists of
HPV16 L2 fused to E6 and E7, produced antigen-specific humoral and cellular immune responses in healthy volunteers [258]. To increase the potency, protein vaccines have been linked to heat shock proteins (HSPs) including calreticulin and Hsp 70 [259].
Phase I and phase II clinical trials with the HPV 16 E7 protein fused to the M. bovis
Hsp65 have demonstrated that this vaccine is safe, even in HIV positive patients, induces antigen-specific T cell responses in vaccinated patients and can lead to complete regression or partial regression of CIN3 and AIN2/3 lesions [260], [261], [262].
Thus peptide and protein vaccines continue to show promise as HPV immunotherapeutic agents.
c. Viral/Bacterial vectors
Viral and bacterial vectors can deliver HPV epitopes to target cells and the vectors themselves are very immunogenic. However these types of vaccines have their own limitations. Viral and bacterial genomes are relatively small and therefore the size of foreign sequences that can be accommodated by certain vectors is limited. Second, anti-vector immune responses can be generated after just one vaccination thereby preventing the use of the same vector in subsequent vaccinations.
Vaccinia virus is pne of the most common viral vectors used in HPV vaccine design. This viral vector is relatively safe as it has been used to immunize individuals against small pox and is easily genetically manipulated. Preclinical studies with vaccinia vectors expressing E6 and E7 proteins have demonstrated that these vaccines induce
HPV-specific CTL responses as well as generate anti-tumor immunity [263], [264].
Phase I clinical trials with the TA-HPV, a recombinant vaccinia virus expressing E6 and
37 E7 proteins of HPV16 and HPV18, demonstrated this vaccine induces HPV-specific cellular and humoral immune responses in women suffering from cervical cancer [265].
The success of this vaccine in phase I clinical trials led to a subsequent phase II/III clinical trial that is currently ongoing [266].
Listeria monocytogenes is a well-studied bacterial vector used in therapeutic intervention of experimental HPV induced lesions [267]. This bacterial vector system employs a fusion of an HPV antigen to a molecular adjuvant and the bacterium is then engineered to secrete the fusion protein. Preclinical studies with L monocytogenes
engineered to secrete HPV16 E7 led to regression of established tumors expressing E7
[268]. The first phase I clinical trial to use a live-attenuated L monocytogenes vaccine
expressing listeriolysin (LLO) fused to HPV16 E7 demonstrated the safety and
immunogenicity of this vector, as one patient with invasive cervical carcinoma was
classified as a partial responder and seven others had stable disease [269]. The
success of the initial clinical trials with both vaccinia and L. monocytogenes, as well as
the ongoing clinical trials, suggests that these vectors show promise as future HPV
immunotherapeutic agents.
d. Dendritic cell vaccines
Cell based vaccines for cancer immunotherapy are based on the concept of
delivery of pAPCs to the tumor environment where tumor antigens are presented, tumor-
specific T cells are activated, and cytokines and chemokines that alter the milieu are
secreted, and subsequently produce tumor clearance. This type of immunotherapy
induces the generation of large numbers of DCs ex vivo through culture of hematopoietic
progenitors with cytokines. The DC vaccines are then created either by peptide pulsing
or transducing the DCs with genes of interest. DCs pulsed with E7-specific T cell
epitopes generate E7-specific T cells [270] and serve as a potent and effective anti-
38 tumor vaccine in murine tumor models [271]. A similar anti-tumor effect is achieved with
DCs pulsed with the whole E7 protein [256]. DCs transduced with E6 and E7 genes offer an alternative cell based vaccine strategy that bypasses MHC restriction. Tumor genes can be introduced by a variety of methods including viral vectors [272] or particle- mediated transfer [273]. One such vaccine DC-E7, created by delivery of an HPV16 E7 expressing vector by electroporation into a DC line, induced the most potent E7-specific anti-tumor immunity in a mouse tumor model [274]. In addition, a phase II clinical trial, in which HLA-A2.1 positive patients suffering from cervical cancer were administered immature DCs pulsed with HPV16 E7 peptides i.v., found that those patients that demonstrated immunological responses have extended survival with stable disease
[275].
e. Combination vaccines
Another strategy that has emerged in recent years is the combinatorial prime-
boost approach in which one vaccine vehicle is used to prime the immune system and
then that same vaccine cassette carried in a second vehicle is used to boost or augment
the immune response. This approach has shown promising results in clinical trials of the
TRAP malaria vaccine [276]. Additionally, the use of a DNA vaccine to prime against
HPV16 E7 followed by viral vector delivery of the same HPV antigen provided the
greatest anti-tumor effects when compared to each individual vaccine delivered alone
[277]. A second combinatorial approach involves the use of DNA vaccines and anti-viral
or immunomodulatory compounds. DNA vaccination against CRPV genes in
combination with intralesional administration of cidofovir results in clearance of
persistent CRPV-induced lesions as well as a reduction in their reoccurrence [278].
Another possible combination approach is the use of chemotherapy or radiation
treatments in conjunction with HPV therapeutic vaccination. EGCG, a substance
39 derived from green tea, that causes apoptosis of tumor cells and augments anti-tumor T cell responses [279], is currently being tested in a phase II clinical trial as an interventional agent against precancerous lesions [280]. Additionally, a phase 1 clinical trial is being planned for the use of EGCG in combination with a calreticulin-HPV 16 E7
DNA vaccine [281]. The success of the early combinatorial approaches suggests that these methods may be useful in treating persistent HPV infections.
f. Non-HPV specific therapy
Imiquimod is a current therapy that does not specifically target HPV infections or
HPV related disease but has been proven to be a useful therapeutic strategy in clinical trials for the treatment of high-grade vulva intraepithelial neoplasia (VIN) [282], [283], as well as anal intraepithelial neoplasia (AIN) in HIV positive men [284]. Imiquimod is a toll- like receptor (TLR)-7 agonist that activates TLR7 on the surface of APCs and induces secretion of proinflammatory cytokines such as interferon-α, tumor necrosis factor-α, and interleukin 12. These cytokines inducte a Th1-biased cell mediated immune response with the generation of cytotoxic effectors [285]. Additionally, Imiquimod has pro-apoptotic activity against tumor cells that is mediated by Bcl-2 and activation of caspases [286]. Imiquimod was recently found to be safe for HIV positive patients undergoing HAART treatment and suffering from external genital and perianal warts
[287]. This same study demonstrated a 32% clearance rate of warts in patients undergoing treatment, and the HPV load decreased or became undetectable in 40% of treated individuals. Patients undergoing Imiquinod treatment have also developed HPV- specific immune responses [282]. Thus, inducing a pro-inflammatory environment in the area of HPV disease is a key facet of therapeutic intervention.
40 4. The First Human T Cell Vaccine
The development of effective T-cell based therapies against human pathogens and human cancers has long been a goal of basic and clinical research. This effort recognizes that cell mediated immunity is the key defense mechanism for elimination of virally infected or diseased tumor cells. However, to date only a single T cell based therapy has gained approval by the Food and Drug Administration (FDA) for use in humans. This slow development of vaccines that elicit protective or therapeutic CD8+ T
cell responses is due in part to many of the questions that must be answered when
taking a rational approach to vaccine design, as discussed earlier.
Provenge (Sipuleucel-T), which received approval as the first therapeutic cancer
vaccine in April of 2010, was designed to target late-stage metastatic hormone-refractory
prostate cancer [288]. To produce Provenge, patient’s peripheral blood mononuclear
cells (PBMCs) are isolated, incubated with a recombinant protein consisting of prostatic
acid phosphatases (PAP) and Granulocyte Macrophage Colony-Stimulating Factor (GM-
CSF), and transferred back into the patient [289], [290]. Provenge treatment consist of
three doses administered IV at two-week intervals. Clinical trials carried out with
Provenge demonstrated that patients receiving treatment live an average of
approximately 4 months longer than those receiving placebo and their risk of death is
reduced by 22.5% [291]. The development and approval of Provenge represents a key
advancement not only in cancer immunotherapy but also in all cellular based
immunotherapeutics.
41
Chapter II
Introduction to the thesis
42 This thesis project began with the goal of utilizing the newly established
CRPV/HLA-A2.1 transgenic rabbit model to investigate the vaccine-generated immune responses to HLA-A2.1-restricted HPV16 E7 epitopes. Previous studies with the well- known HLA-A2.1 restricted HPV16 E7 82-90 epitope substituted within the CRPV E7 gene demonstrated that DNA vaccination provokes an epitope specific immune response to this epitope that is partially protective. These results generated numerous questions including but not limited to: Were other CRPV genes amendable to epitope substitution? Was there another way to embed the epitope within the CRPV genome?
Could this epitope be correctly processed and presented from other CRPV proteins?
Which CRPV proteins provide the best targets for an epitope specific immune response?
Could this epitope provoke a therapeutic immune response in the CRPV/HLA-A2.1 transgenic rabbit model? Could other HLA-A2.1 restricted epitopes provoke a protective immune response in the CRPV/HLA-A2.1 transgenic rabbit model? How do you find new HLA-A2.1-restricted epitopes?
With these questions in mind, the focus of this thesis became to investigate the cell mediated immune responses generated after vaccination with HLA-A2.1 restricted
HPV16 E7 epitopes in vivo in two HPV preclinical animal models. The following three specific aims were set forth:
1) Assess the vaccine generated protective immunity to the known HLA-A2.1 restricted HPV16 E7 82-90 epitope embedded in both early and late genes of the
CRPV genome in vivo using the CRPV/HLA-A2.1 transgenic preclinical rabbit model.
Rationale:
Previous investigations with this epitope in the CRPV/HLA-A2.1 transgenic rabbit model demonstrated that vaccination with the epitope DNA vaccine generates an
43 epitope-specific immune response. Additionally, embedding the 82-90 epitope in to the
CRPV E7 gene via PCR-induced substitution created an infectious CRPV genome.
HLA-A2.1 transgenic rabbits that received the epitope DNA vaccine were partially protected from challenge with the epitope-modifed genome. Therefore, the objective of this aim became to determine if the HPV16 E7 82-90 epitope is recognized by vaccine- generated immunity when it is expressed from another CRPV protein, and did the manner in which the epitope was embedded in a gene affect the epitope’s presentation.
In conjunction with this objective we investigated whether the time at which this epitope is expressed during an infection affects the immune response. The information provided in these studies should help in the choice of HPV genes as sources of potential epitopes and in epitope placement within the CRPV genome for future experiments. In addition the results have clinical relevance as epitopes that are expressed at earlier time points during an HPV infection within the lower layers of the epithelium and are continuosly expressed throughout progression to HPV associated diseases should be better choices for incorporation into new therapeutic HPV vaccines.
2) Examine and compare the vaccine generated protective immunity generated to the known HLA-A2.1 restricted HPV16 E7 82-90 epitope using different DNA vaccine delivery strategies.
Rationale:
Our laboratory has long used the gene gun mediated DNA vaccination to provoke protective and therapeutic immune responses in the CRPV and CRPV/HLA-
A2.1 transgenic rabbit models with great success. However, the costs of the materials necessary for gene gun vaccination continue to increase and when the gene gun undergoes routine maintenance, no DNA vaccination experiments can be performed.
Worse yet, if the gene gun stops working and needs unscheduled repairs, whole
44 experiments are interrupted. Therefore, the objective of this aim was to find an alternative device for the delivery of DNA vaccines. The tattoo gun was investigated as an alternative strategy for delivery of DNA vaccines since the device has been used in a number of different preclinical animal models for delivery of DNA, viral vectors, and peptides. The information provided in these studies has already facilitated vaccine studies in the laboratory and could have future implications for vaccine delivery in clinical settings since tattooing is already an accepted practice in many cultures around the world.
3) Identify and characterize new HLA-A2.1-restricted CD8+ T cell targets within the
HPV16 E7 gene using the HHD mouse model and the CRPV/HLA-A2.1 transgenic
rabbit model.
Rationale:
It is well established that induction of a cell-mediated immune response is
necessary for the eradication of established HPV infections as well as HPV-related
diseases. DNA vaccination is an appealing method for generation of such a response
that is currently being explored in preclinical and clinical settings. Due to previous
successes with DNA vaccination and the development of the CRPV/HLA-A2.1
transgenic rabbit model, epitope DNA vaccination has become a primary focus in our
laboratory. However, currently only a handful of HLA-A2.1-restricted epitopes have
been identified and even fewer have been tested for their ability to prime cell-mediated
immune responses that are protective or therapeutic against PV infections. Therefore,
the main objective of this aim was to identify new HLA-A2.1-restricted epitopes as well
as characterize previously recognized HLA-A2.1-restricted epitopes, focusing on HPV16
E7 specifically as this HPV type is the most prevalent and this virus gene is the better
immunologically-characterized oncogene. The information provided in these studies set
45 forth a methodology for the identification and characterization of future potential vaccine epitope candidates. New strategies developed for epitope placement as well as genome modification will have an implact on future experiments. Finally, these experiments have implications for future vaccine design as well as target choice not only in the laboratory but also in the clinic.
46
Chapter III
Relocation of an HPV16 E7 HLA-A2.1 Restricted CD8+ T Cell Epitope Into the Cottontail Rabbit Papillomavirus (CRPV) Genome Increases the Protective Immunity Elicited in the HLA-A2.1 Transgenic Rabbit Model
47 Abstract
The newly established HLA-A2.1 transgenic rabbit model has proven useful for testing the immunogenicity of well known and computer-predicted A2-restricted epitopes.
In the current study, we compared the protective immunity induced to a preferred HPV16
E7 A2-restricted epitope that was relocated to positions within the CRPV E7 gene and the CRPV L2 gene. Epitope expression from both the E7 protein and the L2 protein increased protection against viral DNA challenge when the HLA-A2.1 transgenic rabbits were compared to control-vaccinated rabbit groups. Proteins expressed at both early and late time points during a natural papillomavirus infection were targeted by specific cellular immunity. The epitope-specific immunity to a protein expressed early provided a greater level of protection than to a protein expressed late. This study highlights the broad utility of the HLA-A2.1 transgenic rabbit model for testing immunological factors involved in vaccine generated protective immunity.
48 Introduction
Human papillomaviruses (HPVs) are small DNA tumor viruses with a genome of approximately 8kb that infect both cutaneous and mucosal epithelia [360]. Currently, more than 100 different HPV types have been identified and it is well recognized that a specific subset are the etiological agents of cervical cancer [2]. Globally, cervical cancer is the second largest cause of female cancer mortality [361]. Successful development and implementation of prophylactic virus-like particle (VLP) vaccines has resulted in protection against the two most common “high risk” HPV types, 16 and 18 [359].
However, the neutralizing antibody protection provided by VLP vaccination is type specific and non-therapeutic [362]. Induction of cell mediated immunity is necessary for eradication of established HPV disease [102], [93].
Papillomaviruses (PVs) are species and tissue specific [358] and there are currently no PV types that naturally infect laboratory strains of small rodents [348].
Rabbit, dog, and bovine models are the only preclinical animal models of natural PV infection. The cottontail rabbit papillomavirus (CRPV)/rabbit model offers several advantages for studying host immunity induced during a natural PV infection. CRPV infections mimic several characteristics of high-risk HPV infections [221] and the
CRPV/rabbit model has been used extensively to test the protective immunity elicited by
VLP-based vaccines [366], [184] as well as the cell-mediated immunity generated to viral proteins E1, E2, E6, E7, E8 and L1 [292], [347], [364], [365]. A second benefit of this model is that CRPV DNA is infectious and can initiate papillomas in the absence of genome encapsidation [293], [308] thereby bypassing induction of a humoral immune response elicited to the capsid proteins.
Recent establishment of an HLA-A2.1 transgenic rabbit model provides an added resource for the assessment of vaccine induced protective immunity to HPV epitopes during natural PV infections [223]. The HLA-A2.1 transgenic rabbit model produces
49 strong protective and therapeutic immune responses to computer-predicted HLA-A2.1- restricted epitopes from the CRPVE1 gene in vivo [303]. Additional studies with this preclinical model have verified that HLA-A2.1 transgenic rabbits generate strong CTL responses to the well known HPV16E7 82-90 epitope [312], and this in vivo immunity is protective [222].
Papillomavirus proteins are expressed from initial infection throughout progression to cancer and provide potential prophylactic and therapeutic targets for vaccination. Both the E7 gene and its protein are essential for papilloma outgrowth in rabbits [214], [213], [210] where as the L2 protein is dispensable [215]. In these studies we embedded the well known HLA-A2.1-restricted HPV16E7 82-90 epitope in either the
L2 gene or the E7 gene of CRPV using two alternative methods. Both new CRPV genomes produced papillomas confirming earlier studies [215] that there are regions of plasticity within the CRPV genome. We next examined the protective immunity elicited by the HPV16E7 82-90 epitope embedded in these two CRPV genes delivered as a
DNA vaccine. Expression of the 82-90 epitope within the L2 and E7 proteins resulted in increased protection of the epitope-vaccinated HLA-A2.1 transgenic rabbits when compared to control rabbits after DNA viral challenge. These data indicate that protective immunity can be triggered to an embedded HPV epitope expressed within both an early protein and a late protein of the CRPV genome.
50 Materials and Methods
DNA Vaccine
The HPV16E7/82-90 DNA vaccine (Figure 3.1) was designed with 5 repeats of the single epitope separated by alanine-alanine-tyrosine (AAY) spacers [312], [370]. An
N-terminus Kozak sequence, followed by a universal tetanus toxoid (TT) T-helper motif
[369], and a C-terminus ubiquitin motif were also included in the synthetic sequence as described earlier [303]. This vaccine sequence was then cloned into the mammalian expression vector, pCX, creating the HPV16E7/82-90 DNA vaccine. The control vaccine was produced by cloning the ubiquitin motif into pCX creating pCXUb. All DNA vaccines were adjusted to a plasmid concentration of 1ug/ml in 1XTE. The DNA was then precipitated onto 1.6um-diamter gold particles at a ratio of 1ug of DNA/0.5mg of gold particles as described by the manufacturer (Bio-Rad, Hercules, California).
Viral DNA Challenge Constructs
The Hershey CRPV (H.CRPV) construct cloned into a pUC19 vector at the SalI
site as previously described was used as wild type CRPV [308]. A subclone of the
CRPV E7 gene was subjected to site directed mutagenesis to insert the HPV16E7 82-90
(LLMGTLGIV) sequence in frame into the CRPV E7 gene just upstream of the E7 stop
codon. Primer sequences used for this single step mutagenesis can be found in table
3.1. A modified CRPV E7 gene containing 9 additional amino acids at the carboxy-
terminus was produced and confirmed by DNA sequence analysis. The modified CRPV
E7 gene was then cloned into the H.CRPV construct at the EcorI and ClaI sites creating
CRPV/E7ins82-90 and successful cloning was was confirmed by DNA sequencing. To
create the CRPV/L2sub82-90 genome, a subclone containing the L2 gene of CRPV
inserted in the pUC19 vector was subjected to multiple rounds of PCR mutagenesis.
51 Figure 3.1. Diagram of the HPV16E7/82-90 DNA epitope vaccine including the nucleotide coding sequence and the amino acid sequence.
1 GAATTCGCCGCCACCATGGCCCAGTACATCAAGGCCAACAGCAAGTTCATCGGCATCACCGAGCTGGCAGCCTAT 1 M A Q Y I K A N S K F I G I T E L A A Y 76 TTGCTGATGGGAACCCTGGGCATTGTCGCAGCTTATTTGTTGATGGGCACATTGGGCATCGTCGCTGCTTATCTG 26 L L M G T L G I V A A Y L L M G T L G I V A A Y L
151 CTCATGGGCACCCTGGGGATCGTCGCCGCATACCTGCTGATGGGCACTCTCGGCATTGTGGCAGCTTATCTTTTG 51 L M G T L G I V A A Y L L M G T L G I V A A Y L L
226 ATGGGAACATTGGGGATTGTGGCTGCCTACGCGGCCGCCATGCAGATTTTCGTGAAGACCCTGACAGGCAAGACC 76 M G T L G I V A A Y A A A M Q I F V K T L T G K T 301 ATCACCCTGGAGGTCGAGCCCAGTGACACCATAGAGAATGTCAAGGCAAAGATCCAGGACAAGGAGGGCATCCCC 101 I T L E V E P S D T I E N V K A K I Q D K E G I P
376 CCTGACCAGCAGAGGCTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACCCTGTCAGACTACAACATCCAG 126 P D Q Q R L I F A G K Q L E D G R T L S D Y N I Q
451 AAAGAGTCCACCCTGCACCTGGTCCTTCGCCTGAGAGGTGCAGATCAGATCTTAAGTAAGTAG 151 K E S T L H L V L R L R G A D Q I L S K *
TT Helper AAY Epitope AAY Epitope AAY Epitope
AAY Epitope AAY Epitope AAYAAA Ubiquitin
52 Table 3.1. Primer sequences for substitution of the HPV16E7 82-90 epitope into the CRPV L2 gene and for insertion of the epitope into the CRPV E7 gene. Primer sequences are listed in pairs with the forward primer first followed by the reverse compliment primer sequence. Sequences in bold represent single nucleotide changes while underlined sequences represent inserted nucleotides.
Primer Sequence L2A 5’- AGCCAGATTTCAGACCTCACAACTGGTACATTCGGCACAGTGTCCAGAACACACAT T-3’ L2B 5’- AATGTGTGTTCTGGACACTGTGCCGAATGTACCAGTTGTGAGGTCTGAAATCTGGC T-3’ L2C 5’- AGCCAGATTTCAGACCTCCCAACTGGTACACTCGGCACCGTGTCCAGAACACACAT T-3’ L2D 5’- AATGTGTGTTCTGGACACGGTGCCGAGTGTACCAGTTGGGAGGTCTGAAATCTGG CT-3’ L2E 5’- AGCCAGATTTCAGACCTGCCAATTGGTACACTCGGCATCGTGTCCAGAACACACAT T-3’ L2F 5’- AATGTGTGTTCTGGACACGATGCCGAGTGTACCAATTGGCAGGTCTGAAATCTGGC T-3’ L2G 5’- AGCCAGATTTCAGACCTGCTAATGGGTACACTCGGCATCGTGTCCAGAACACACAT T-3’ L2H 5’- AATGTGTGTTCTGGACACGATGCCGAGTGTACCCATTAGCAGGTCTGAAATCTGGC T-3’ E7A 5’- GCCCGGAGTGTTGTAACCTGCTGATGGGCACCCTGGGCATCGTGTGAAAATGGCT GAAGGTACAGACC-3’ E7B 5’- GGTCTGTACCTTCAGCCATTTTCACACGATGCCCAGGGTGCCCATCAGCAGGTTAC AACACTCCGGGC-3’
53 Primer pairs for each successive round of site-directed mutagenic PCR can be found in table 3.1. This strategy produced incremental changes in the nucleotide coding sequence between nucleotides 447 and 474 of the L2 gene. Upon confirmation of all the necessary codon changes through DNA sequenceing, the new L2 gene fragment containing the HPV16E7 82-90 epitope sequence was cloned into the H.CRPV construct at SalI and AgeI sites creating the new CRPV genome. Viral DNA plasmids were isolated and purified using the Qiagen maxiprep plasmid isolation kit and subjected to cesium chloride density gradient centrifugation. Plasmid concentration was adjusted to
200ng/ul in 1X TE.
Rabbit Vaccination and Viral DNA Challenge
HLA-A2.1 transgenic outbred rabbits were maintained in the Pennsylvania State
University College of Medicine animal facility. Non-transgenic outbred rabbits were purchased from Covance Research Products, Inc. All animal care and handling procedures were approved by the Institutional Animal Care and Use Committee.
Rabbits were divided into groups and were vaccinated three times at three-week intervals with either the HPV16E7/82-90 DNA vaccine or the control DNA vaccine. The inner ear skin of each sedated rabbit was cleaned with 70% ethanol and then barraged with DNA coated gold particles at a rate of 400lb/in2 by a helium driven gene gun [215].
Each rabbit received a vaccine dose of 20ug at each immunization. Four days following the final booster rabbit backs were shaved and scarified as described [209]. One week after the final booster vaccination, rabbits were challenged with wild type CRPV DNA,
CRPV/E7ins82-90 DNA, or CRPv/L2sub82-90 DNA at a dose of 10ug/site in a 50ul volume.
54 Papilloma Volume Determination and Statistical Analysis
Papilloma size was calculated as described previously [303]. Briefly, the product of length x width x height in millimeters of individual papillomas was calculated to determine geometric mean diameter (GMD). Measurements were gathered weekly starting 3 weeks after viral DNA challenge. Unpaired t-test comparisons were used to decide statistical significance. The protection rates were calculated as previously described [222] and statistical significance was determined by Fishers exact test.
55 Results
Two modified CRPV DNA genomes produced papillomas in New Zealand White rabbits
Our laboratory previously demonstrated that the CRPV genome undergoes PCR- induced modification without loss of functional viability [215]. We performed epitope relocation by substitution of HPV16E7 82-90 into the CRPV E7 gene [222]. Here we created two additional modified CRPV genomes, CRPV/L2sub82-90 and
CRPV/E7ins82-90, using two different methods to embed the epitope. To choose a substitution position of the epitope within the CRPV L2 gene, a protein sequence alignment was performed. Limited success with relocation of epitopes within the CRPV
E7 gene led to choice of relocating the 82-90 epitope to the carboxy-terminus of the
CRPV E7 protein through epitope insertion (Figure 3.2). Following genome alteration, each CRPV construct was assayed for its capacity to induce papillomas. Two New
Zealand White rabbits were challenged with 10ug/site of each new modified CRPV genome DNA. Papilloma formation was scored as a positive functional result.
Papillomas appeared on the backs of rabbits 3 weeks after challenge with
CRPV/L2sub82-90 DNA and these papillomas grew at a rate similar to that of papillomas induced by wild type CRPV DNA (Figure 3.3). Three weeks after challenge with
CRPV/E7ins82-90 DNA small papillomas appeared on the backs of the rabbits (Figure
3.4). These papillomas were smaller in size and exhibited a slower growth rate than papillomas resulting from wild type CRPV DNA challenge, but persisted throughout the entire viability study.
56 Figure 3.2. Modified CRPV genomes form papillomas in New Zealand White rabbits. Diagram illustrating the L2 and E7 proteins of CRPV before and after the CRPV genes underwent PCR mutagenesis to substitute or insert the HPV16E7 82-90 epitope, respectively.
L2 protein SQISDVTSGTSGTVSRTH SQISDLLMGTLGIVSRTH L2sub82-90 protein
E7 protein LLMGTLGIV E7ins82-90 protein
57 Figure 3.3. Papilloma GMDs from New Zealand White rabbits challenged with CRPV/L2sub82-90 DNA and wild type CRPV DNA.
20 CRPV/L2sub82-90 DNA 18 wild type CRPV DNA
16
14
12
10
8
6
4
2
Papilloma Size (Mean +/- SE) by GMD in mm by GMD in SE) (Mean +/- Size Papilloma 0
Wk3 Wk4 Wk5 Wk6 Wk7 Wk8 Wk9
Weeks after challenge with DNA
58 Figure 3.4. Papilloma GMDs from New Zealand White rabbits challenged with CRPV/E7ins82-90 DNA and wild type CRPV DNA.
20 CRPV/E7ins82-90 DNA 18 wild type CRPV DNA
16
14
12
10
8
6
4
2
Papilloma Size (Mean +/- SE) by GMD in mm 0
Wk3 Wk4 Wk5 Wk6 Wk7 Wk8 Wk9
Weeks after challenge with DNA
59 HLA-A2.1 transgenic rabbits receiving DNA vaccine are partially protected from challenge with the modified CRPV genome containing the HPV16E7 82-90 epitope substituted in the L2 gene
Specific immunity to the HLA-A2.1-restricted HPV16E7 82-90 epitope expressed in the CRPV E7 protein is stimulated in the HLA-A2.1 transgenic rabbit model upon DNA vaccination [222]. We performed the following experiment to determine if the same epitope can be targeted when it is expressed in the CRPV L2 protein. HLA-A2.1 transgenic (N = 4) and control (N = 3) rabbits received three immunizations with the
HPV16E7/82-90 epitope DNA vaccine or vector vaccine at three-week intervals. One week following the final booster vaccination, each rabbit was challenged with wild-type
CRPV DNA at two sites and CRPV/L2sub82-90 DNA at eight sites. No statistically significant difference was observed in protection rates between the HLA-A2.1 transgenic rabbits and control rabbits immunized with the HPV16E7/82-90 epitope vaccine or vector vaccine, respectively (Table 3.2 and 3.3). However, reduction in papilloma size was observed in HLA-A2.1 transgenic rabbits vaccinated with the epitope DNA vaccine followed by challenge with the modified CRPV genome (Figure 3.5). As expected there was no difference in mean papilloma size in HLA-A2.1 transgenic or control rabbits receiving the HPV16E7/82-90 epitope vaccine that were subsequently challenged with wild type CRPV DNA (Figure 3.6).
DNA vaccination imparts complete protection against infection with the modified CRPV genome containing the HPV16E7 82-90 epitope inserted in the E7 gene
The protection induced by the HPV16E7/82-90 epitope vaccine against the modified CRPV genome containing the 82-90 epitope expressed at the end of the E7 protein was further investigated. HLA-A2.1 transgenic and control rabbits were vaccinated three times with the HPV16E7/82-90 epitope vaccine or vector vaccine
60 Table 3.2. Tumor protection in outbred New Zealand White rabbits challenged with CRPV DNA containing the HPV16E7 82-90 epitope substituted in the L2 gene after three immunizations with either the HPV16E7/82-90 epitope vaccine or the control DNA vaccine.
Rabbits Vaccine Challenged Sites Protection Ratea (%) 1 HLA-A2.1 (N = 4) E7 Epitope 24 4/24 (17%)b,c,d 2 Control (N = 3) E7 Epitope 18 0/18 (0%) 3 HLA-A2.1 (N = 4) Vector 24 2/24 (8%) 4 Control (N = 3) Vector 18 0/18 (0%) a Protection rate, papilloma-free sites/challenge sites (six sites/each construct/each rabbit); bp = 0.14, cp = 0.67, dp = 0.14 vs group 2, group 3, and group 4, respectively, Fisher’s exact test.
61 Table 3.3. Tumor protection in outbred New Zealand White rabbits challenged with wild type CRPV DNA after three immunizations with either the HPV16E7/82-90 epitope vaccine or the control DNA vaccine.
Rabbits Vaccine Challenged Sites Protection Ratea (%) 1 HLA-A2.1 (N = 4) E7 Epitope 8 0/8 (0%)b,c,d 2 Control (N = 3) E7 Epitope 6 0/6 (0%) 3 HLA-A2.1 (N = 4) Vector 8 3/8 (38%) 4 Control (N = 3) Vector 6 0/6 (0%) a Protection rate, papilloma-free sites/challenge sites (two sites/each construct/each rabbit); bp = 1, cp = 0.23, dp = 1 vs group 2, group 3, and group 4, respectively, Fisher’s exact test.
62 Figure 3.5. Papilloma outgrowth in epitope DNA vaccinated outbred HLA-A2.1 transgenic and control rabbits after viral DNA challenge. HLA-A2.1 transgenic and control rabbits immunized three times with the HPV16E7/82-90 epitope DNA vaccine were challenged with CRPV/L2sub82-90 DNA. Significantly smaller papillomas were found on HLA-A2.1 transgenic rabbits immunized with the E7 epitope vaccine and challenged with the epitope-modified CRPV DNA construct (p< 0.05, unpaired student’s t-test).
20 HLA-A2.1 + HPV16E7/82-90 epitope vaccine 18 Control + HPV16E7/82-90 epitope vaccine
16 *
14
12 * *
+/- SE) by GMD in mm 10
8
6
4
2
Papilloma Size (Mean 0
WK3 WK4 WK5 WK6 WK7 Wk9
Weeks after challenge with CRPV/L2sub82 DNA
63 Figure 3.6. Papilloma outgrowth in epitope DNA vaccinated outbred HLA-A2.1 transgenic and control rabbits after viral DNA challenge. HLA-A2.1 transgenic and control rabbits immunized three times with the HPV16E7/82-90 epitope DNA vaccine were challenged with wild type CRPV DNA.
20 HLA-A2.1 + HPV16E7/82-90 epitope vaccine 18 Control + HPV16E7/82-90 epitope vaccine
16
14
12
10
8
6
4
2
Papilloma Size (Mean +/- SE) by GMD in mm 0
WK3 WK4 WK5 WK6 WK7 Wk9
Weeks after challenge with wild type CRPV DNA
64 as described above. The animals were challenged at two sites with wild type CRPV
DNA and at six sites with CRPV/E7ins82-90 DNA one week later. HLA-A2.1 transgenic
rabbits immunized with the epitope vaccine were completely protected against challenge
with the modified CRPV genome (Table 3.4) and unexpectedly showed partial protection
from challenge with wild type CRPV DNA (Table 3.5). In contrast, little to no protection
was observed in control rabbits receiving either vaccine followed by challenge with wild type CRPV DNA or CRPV/E7ins 82-90 DNA (Table 3.4 and 3.5). Additionally, for both
CRPV DNA genomes, the mean papilloma size on the control rabbits was significantly larger than that of the HLA-A2.1 transgenic rabbits (Figure 3.7 and 3.8).
Specific protective immunity induced in HLA-A2.1 transgenic rabbits following DNA
vaccination with the HPV16E7/82-90 epitope vaccine
In the above experiment, rabbits were simultaneously challenged with wild type
CRPV DNA and the modified CRPV/E7ins82-90 DNA. To demonstrate that the
protective immunity stimulated in the HLA-A2.1 transgenic rabbits immunized with the
HPV16E7/82-90 epitope vaccine was specific for the epitope expressed at the end of the
E7 protein in the context of the full CRPV genome, an additional experiment was
conducted. Two groups of HLA-A2.1 transgenic rabbits were vaccinated three times at
three-week intervals with the HPV16E7/82-90 epitope vaccine. One week after the final
immunization, the animals were challenged with either CRPVE7ins82-90 DNA (N = 3)
only or wild type CRPV DNA (N = 2) only. Near complete protection was observed in
HLA-A2.1 transgenic rabbits challenged with the CRPV/E7ins82-90 DNA (Table 3.6).
The mean size of the papillomas that did appear was significantly smaller in these HLA-
A2.1 transgenic rabbits (Figure 3.9).
65 Table 3.4. Tumor protection in outbred New Zealand White rabbits challenged with CRPV DNA containing the HPV16E7 82-90 epitope inserted in the E7 gene after three immunizations with either the HPV16E7/82-90 epitope vaccine or the control DNA vaccine.
Rabbits Vaccine Challenged Sites Protection Ratea (%) 1 HLA-A2.1 (N = 3) E7 Epitope 18 18/18 (100%)b,c,d 2 Control (N = 3) E7 Epitope 18 1/18 (6%) 3 HLA-A2.1 (N = 4) Vector 24 7/24 (26%) 4 Control (N = 3) Vector 18 5/18 (28%) a Protection rate, papilloma-free sites/challenge sites (six sites/each construct/each rabbit); bp = 0.0009, cp = 0.025, dp = 0.054 vs group 2, group 3, and group 4, respectively, Fisher’s exact test.
66 Table 3.5. Tumor protection in outbred New Zealand White rabbits challenged with wild type CRPV DNA after three immunizations with the HPV16E7/82-90 epitope vaccine or the control DNA vaccine.
Rabbits Vaccine Challenged Sites Protection Ratea (%) 1 HLA-A2.1 (N = 3) E7 Epitope 6 5/6 (83%)b,c,d 2 Control (N = 3) E7 Epitope 6 0/6 (0%) 3 HLA-A2.1 (N = 4) Vector 8 0/8 (0%) 4 Control (N = 3) Vector 6 0/6 (0%) a Protection rate, papilloma-free sites/challenge sites (two sites/each construct/each rabbit); bp = 0.10, cp = 0.04, dp = 0.10 vs group 2, group 3, and group 4, respectively, Fisher’s exact test.
67 Figure 3.7. Papilloma outgrowth in epitope DNA vaccinated outbred HLA-A2.1 transgenic and control rabbits after viral DNA challenge. HLA-A2.1 transgenic and control rabbits immunized three times with the HPV16E7/82-90 epitope vaccine were challenged with CRPV/E7ins82-90 DNA. Significantly smaller papillomas were found on all HLA-A2.1 transgenic rabbits immunized with the E7 epitope vaccine (p< 0.05, unpaired student’s t-test).
20 HLA-A2.1 + HPV16E7/82-90 epitope vaccine 18 Control + HPV16E7/82-90 epitope vaccine
16
14
12
+/- SE) by GMD in mm 10 *
8 * 6 * 4 * * * 2
Papilloma Size (Mean 0
WK3 WK4 WK5 WK6 WK7 Wk9
Weeks after challenge with CRPV/E7ins82-90 DNA
68 Figure 3.8. Papilloma outgrowth in epitope DNA vaccinated outbred HLA-A2.1 transgenic and control rabbits after viral DNA challenge. HLA-A2.1 transgenic and control rabbits immunized three times with the HPV16E7/82-90 epitope vaccine were challenged with wild type CRPV DNA. Significantly smaller papillomas were found on all HLA-A2.1 transgenic rabbits immunized with the E7 epitope vaccine (p< 0.05, unpaired student’s t-test).
20 HLA-A2.1 + HPV16E7/82-90 epitope vaccine 18 Control + HPV16E7/82-90 epitope vaccine *
16
14 *
12 *
+/- SE) by GMD in mm 10 *
8 * 6
4
2
Papilloma Size (Mean 0
WK3 WK4 WK5 WK6 WK7 Wk9
Weeks after challenge with wild type CRPV DNA
69 Table 3.6. Tumor protection in outbred New Zealand White rabbits challenged with CRPV DNA containing the HPV16E7 82-90 epitope inserted in the E7 gene or wild-type CRPV DNA after three immunizations with the HPV16E7/82-90 epitope DNA vaccine.
Rabbits DNA Challenged Sites Protection Ratea (%) 1 HLA-A2.1 (N = 2) WT CRPV 16 0/16 (0%)b 2 HLA-A2.1 (N = 3) E7 Ins 82 24 19/24 (79%) a Protection rate, papilloma-free sites/challenge sites (eight sites/each construct/each b rabbit); p = 0.001 vs group 2, Fisher’s exact test.
70 Figure 3.9. Papilloma outgrowth in epitope DNA vaccinated outbred HLA-A2.1 transgenic rabbits after viral DNA challenge. HLA-A2.1 transgenic rabbits immunized three times with the HPV16E7/82-90 epitope vaccine were challenged with CRPV/E7ins82-90 DNA or wild type CRPV DNA. Significantly smaller papillomas were found on HLA-A2.1 transgenic rabbits immunized with the E7 epitope vaccine and challenged with the epitope-modified CRPV DNA construct (p< 0.05, unpaired student’s t-test).
20 HLA-A2.1 + HPV16E7/82-90 epitope vaccine + CRPV/E7ins82-90 18 HLA-A2.1 + HPV16E7/82-90 epitope vaccine + wild type CRPV
16
14
12 * 10 * *
8 * 6 *
4
2
Papilloma Size (Mean +/- SE) by GMD in mm +/- SE) by Size (Mean Papilloma 0
Wk3Wk4Wk5Wk6Wk7
Weeks after challenge with DNA
71 Discussion
In this report we used the novel HLA-A2.1 transgenic rabbit model to study the vaccine induced, protective immunity generated against the HLA-A2.1-restricted
HPV16E7 82-90 epitope after challenge with modified CRPV DNA genomes containing this same epitope expressed from the L2 protein or the E7 protein. The HPV16E7/82-90 epitope vaccine elicited protective immunity that effectively targeted the 82-90 epitope substituted into the CRPVL2 gene or inserted into the CRPV E7 gene. This successful vaccine strategy resulted in a mean papilloma size in HLA-A2.1 transgenic rabbits receiving the HPV16E7/82-90 epitope vaccine that was reduced compared to vaccinated control rabbits. Moreover, HLA-A2.1 transgenic rabbits challenged with the
CRPV/E7ins82-90 DNA construct following vaccination with the HPV16E7/82-90 epitope vaccine were almost completely protected. These data indicate that both early and late proteins of papillomaviruses can be targeted by epitope-specific immunity and that the
E7 protein is a superior target. Our laboratory reported that HLA-A2.1 transgenic rabbits receiving the HPV16E7/82-90 epitope vaccine mount a protective epitope- specific CTL response against a CRPV viral DNA genome with the 82-90 epitope substituted into the E7 gene [222]. The HLA-A2.1 transgenic rabbit model can be used to screen the immunogenicity of computer-predicted HLA-A2.1-restricted epitopes and test their protective and therapeutic immunity in vivo [303]. Collectively, these data
highlight the versatility of the HLA-A2.1 transgenic rabbit model system for testing
various immunological aspects of vaccine-generated protective immunity.
CRPV DNA is infectious and induces papillomas in the CRPV rabbit model
system [207], [210], [308]. This infection method presumably bypasses induction of
humoral immunity to the major and minor capsid proteins, L1 and L2, respectively.
Additionally, the CRPV genome is amenable to a number of different mutations including
point mutations, deletions and insertions while retaining the ability to produce papillomas
72 on the backs of challenged rabbits [215]. Our laboratory has also reported that domestic
rabbits are permissive for CRPV and can be used to study the entire virus life cycle in vivo [368]. These features allowed us to examine the vaccine-induced epitope-specific
protective immunity generated against the HLA-A2.1-restricted HPV16E7 82-90 epitope
when the epitope is expressed in either a late protein or at the end of an early protein of
CRPV.
The L2 protein of CRPV is not necessary for papilloma formation in rabbits, [208]
and as expected, substitution of the 82-90 epitope into the CRPV L2 gene did not
compromise the ability of the modified genome to form papillomas in rabbits.
Furthermore, the protective immune response generated after DNA vaccination to an
epitope expressed within the L2 protein had yet to be examined in vivo. For these
reasons we investigated whether epitope-specific protective immunity induced by DNA
vaccination with the HPV16E7/82-90 DNA epitope vaccine could target this epitope
expressed in the CRPV L2 protein. The results of this study suggest that epitopes
embedded in the L2 gene and expressed at late time points during a natural
papillomavirus infection are viable targets for cell-mediated immunity. Experimental
vaccination with L2 peptides [371] and L2 fusion proteins [372] induce L2 specific
antibodies that neutralize divergent PV types. Further studies to determine if HPV L2
proteins contain any cross-protective T cell epitopes could prove useful for additional
immunity generated by broadly-protective prophylactic HPV L2-based vaccines.
The E7 gene of CRPV and its protein product are essential for papilloma formation in rabbits [213]. Attempts to create new genomes with a variety of other HLA-
A2.1-restricted HPV16E7 epitopes embedded in the CRPV E7 gene using the substitution method were unsuccessful (unpublished data). This mutagenesis method relies on sequence similarity between the epitope and protein target of choice. To overcome these challenges we chose to employ an insertion method for embedding
73 epitopes within the CRPV E7 gene, essentially creating an epitope tag. Insertion of the
HPV16E7 82-90 epitope within the E7 gene just upstream of the stop codon resulted in a
viable genome. This site is permissive for insertion of other HLA-A2.1-restricted HPV16
E7 epitopes as well (unpublished data). Gene gun mediated DNA vaccination with the
HPV16E7/82-90 epitope vaccine generated powerful protective immunity in the HLA-
A2.1 transgenic rabbits. This initial protective DNA vaccination study performed with the
CRPV/E7ins82-90 genome suggested that the protective immunity induced by the DNA
vaccine was not exclusively epitope specific since papillomas resulting from challenge
with both the mutant and wild type CRPV were affected. However, a limitation of the first
study was the fact that rabbits were challenged with both epitope-modified and wild type
CRPV genomes simultaneously. To overcome the limitation of the first study and to
ensure that the vaccine-generated immune response was specific for the HPV16E7 82-
90 epitope, the second study was performed. The results of the second study with the
CRPV/E7ins82-90 genome clearly demonstrate that the protective immunity induced in
the HLA-A2.1 transgenic rabbits after DNA epitope vaccination is epitope specific.
The unexpected results obtained in the initial E7 protection experiment in which
papillomas induced on the same HLA-A2.1 transgenic rabbits by the CRPV/E7ins82-90
genome or the wild type CRPV genome were reduced may be due to a phenomenon
known as bystander T cell activation. Bystander T cells may become activated in vivo by viruses and oligonucleotides containing CpG motifs thereby up-regulating certain surface markers on the cells and inducing proliferation [373], [374]. Additionally, LPS, type I interferons secreted by dendritic cells, and interferon-gamma secreted by NK cells induce activation of bystander T cells in vitro [378]. DNA vaccines produced in bacteria contain CpG motifs with immunostimulatory effects in vivo [379]. Furthermore, we
showed previously that the HLA-A2.1 transgenic rabbit model has a low level of natural
immunity to CRPV infections that is higher than that in non-transgenic rabbits [223].
74 Finally, the early proteins E6, E7, E1 and E2 are expressed in the infected basal layer of
epithelial cells providing T cells greater access to naturally occurring as well as vaccine specific epitopes at the base of the papilloma [343]. Consequently, the initial vaccination event with a DNA vaccine containing CpG motifs followed by challenge with the CRPV viral DNA, and continuous access of epitope specific as well as heterologous T cells to foreign antigens may have created a multi-epitoped-targeted immune storm. We contend that the initial immunity induced by the HPV16E7/82-90 DNA vaccine was specific for the epitope. This epitope-specific activation was followed by bystander activation of heterologous T cells leading to spreading immunity to other naturally occurring epitopes that are HLA-A2.1-restricted and shared by both CRPV genomes. In support of this hypothesis, our laboratory has demonstrated that powerful protective and therapeutic immunity to native HLA-A2.1-restricted CRPV E1 epitopes can be generated
[303] and that these CRPV E1 epitopes may have been additional targets for the spreading immunity. However, such spreading immunity was only seen in rabbits challenged with the CRPV/E7ins82-90 genome. This observation could result from the fact that the L2 protein is not expressed until later in the viral life cycle and is typically expressed in the upper layers of the epithelium [343]. Thus, there would be less time and less exposure of the epitope specific T cells for their specific antigen and the immune environment would not be as conducive for bystander T cell activation.
Our experiments have demonstrated that the CRPV genome contains areas of plasticity that are amenable to modification without loss of genome viability. Additionally, we have shown that an HPV16 E7 epitope embedded in the L2 gene or the E7 gene of
CRPV can be targeted by DNA vaccine induced immunity. However, the E7 protein provides a superior target over the L2 protein as the HLA-A2.1 transgenic rabbits receiving the epitope vaccine were protected against challenge with the CRPV/E7ins82-
90 genome much better than rabbits challenged with the CRPV/L2sub82-90 genome.
75 Together these data demonstrate that the CRPV/HLA-A2.1 transgenic rabbit model is a
useful and versatile tool to explore various facets of vaccine generated immunity in a model of natural papillomavirus infection.
76 Acknowledgements
This work was supported by the Public Health Service, National Cancer Institute Grant
R01 CA47622 from the National Institutes of Health and by the Jake Gittlen Memorial
Golf Tournament.
77
Chapter IV
DNA Vaccination by Tattooing Induces Specific Protective Immunity to HLA-A2.1 Restricted CRPV E1 and HPV16 E7 Epitopes in HLA-A2.1 Transgenic Rabbits
78 Abstract
The CRPV/HLA-A2.1 transgenic rabbit model system has been employed to test the cell-mediated immunity generated to computer-predicted HLA-A2-restricted cottontail rabbit papillomavirus (CRPV) E1 epitopes and a well-known HPV16 E7 epitope with
DNA vaccines delivered intracutaneously by gene gun. Gene gun delivery of these DNA epitope vaccines induces specific protective immunity in the CRPV/HLA-A2.1 transgenic rabbit model. However, gene gun vaccine components are expensive and the required maintenance and repairs for the gene gun upkeep are costly. Furthermore, component composition can differ among manufacturers. Consequently, we assessed alternative, more cost-effective methods of DNA vaccination. DNA vaccination by tattooing has been used successfully in several animal model systems. This novel technique allows for direct application of the DNA vaccine to the skin thus reducing the overall cost of
DNA vaccine delivery. Therefore we chose to perform experiments comparing the two vaccination strategies.
Two vaccines were used for this comparison. One was a CRPV E1 multivalent epitope DNA vaccine that provides complete protection against challenge with wild type
CRPV DNA in HLA-A2.1 transgenic rabbits. The second is a well known HPV16E7/82-
90 epitope vaccine that provides partial protection in HLA-A2.1 transgenic rabbits against modified CRPV genomes containing this epitope embedded in either early or late CRPV genes. Vaccination of HLA-A2.1 transgenic rabbits with the CRPV E1 multi- epitope vaccine through DNA tattooing induced epitope-specific cellular immunity and this immunity was completely protective; in contrast, papillomas that cleared by week 7 formed in gene gun-vaccinated animals. Additionally, DNA vaccination of HLA-A2.1 transgenic rabbits by either method with the HPV16E7/82-90 vaccine yielded similar levels of protection against an epitope-modified CRPV DNA genome. These data indicate that DNA vaccine delivery by tattooing in the CRPV/HLA-A2.1 transgenic rabbit
79 model is a simple, useful, and cost-effective alternative to the gene gun and produces comparable results.
80 Introduction
DNA vaccines show promise as prophylactic and therapeutic strategies against chronic viral infections [375], [376], [377] and antigen-specific tumors [385], [386], [387].
DNA vaccines induce both humoral and cellular immune responses and spontaneously transfected cellular targets continue to express vaccine antigens, which may aid the induction of immunologic memory [241], [388], [389]. Additionally, DNA vaccines are relatively stable and their production can be easily scaled up. One hindrance to DNA vaccination is that traditional delivery methods, such as intramuscular (i.m.) and intradermal (i.d.) injection, are inefficient at generating a strong immune response even at high DNA vaccine concentrations [390], [391]. Consequently, other methods of DNA vaccination, such as particle mediated epidermal delivery (PMED) and tattooing, have been developed to improve the immunogenicty of DNA vaccines.
PMED, also known as gene gun immunization, uses gold particles as a carrier for
DNA molecules. The DNA-coated gold particles are driven into the epidermal layers of the skin at high pressure, delivering the DNA to keratinocytes and skin-resident dendritic cells (DCs) [392], [393]. Gene gun mediated DNA vaccination invokes a stronger immunological response than traditional delivery methods in a number of animal models including mice [228], [231], rabbits [347], and non-human primates [384], [383]. PMED also generates both humoral and cellular immune responses in human clinical trials
[377], [380], [381]. DNA vaccination through tattooing uses a vibrating solid needle to directly deliver the DNA vaccine to the epidermal layers of the skin through multiple tiny puncture wounds. This method transfects cells in the epidermal layers of the skin and promotes T cell activation [230]. DNA tattooing induces a stronger immune response in both mice and non-human primates than traditional intramuscular (i.m.) vaccination
[230], [382]. When compared side by side both gene gun mediated DNA vaccination
81 and DNA tattooing were equally effective in generating strong antigen-specific T cell
responses against an HPV16E7 epitope in vaccinated mice [229].
HPVs induce hyperproliferative lesions at both cutaneous and mucosal sites, and
it is well recognized that “high risk” HPV types are the etiological agents of cervical
cancer. The current commercially available prophylactic virus-like particle (VLP)
vaccines induce protective humoral immune responses [359], [362] but alternative vaccines and vaccination strategies that induce cell-mediated immune responses are necessary for therapeutic intervention of established HPV disease [102], [93]. Our laboratory uses the cottontail rabbit papillomavirus (CRPV)/rabbit model to study the host immunity induced during a natural PV infection. Previously our laboratory demonstrated that cell-mediated immunity to viral proteins E1, E2, E6, E7, E8 and L1
[216], [347], [365], [364] is generated in the CRPV rabbit model by gene gun mediated
DNA vaccination. Additionally, gene gun mediated DNA vaccination of the newly established HLA-A2.1/CRPV transgenic rabbit model provokes strong protective immune responses to the well known HPV16E7 82-90 epitope [312] and computer-predicted
HLA-A2.1-restricted epitopes from the CRPVE1 gene in vivo [303], [222]. However, the expenses incurred from the components necessary for gene gun mediated DNA vaccination and gene gun repair, as well as the time loss during said repairs, prompted our laboratory to search for an alternative DNA vaccination method.
In these studies, we compared the protective immunity induced in HLA-A2.1 transgenic rabbits using two different DNA delivery methods. Initially, we established that a GFP-expressing plasmid could be introduced successfully to the inner ear skin of rabbits using a gene gun or a tattoo gun. We next compared the protective immunity generated in HLA-A2.1 transgenic rabbit groups vaccinated with a CRPV E1 multi- epitope DNA vaccine using either a gene gun or a tattoo gun followed by challenge with wild type CRPV DNA. In our second comparison study, HLA-A2.1 transgenic and
82 control rabbit groups were vaccinated against the HLA-A2.1-restricted HPV16E7 82-90
epitope followed by challenge with modified CRPV DNA genomes containing this same
epitope embedded in the E7 gene. Both studies indicate that the tattoo gun is just as
effective as the gene gun in generating protective cell-mediated immune responses in
the HLA-A2.1/CRPV rabbit model. Consequently, DNA vaccination by tattooing is an attractive alternative vaccination strategy to gene gun mediated particle delivery in the
HLA-A2.1/CRPV rabbit model.
83 Materials and Methods
DNA Vaccines
The HPV16E7/82-90 DNA vaccine (Figure 3.1) was designed with 5 repeats of the single epitope separated by alanine-alanine-tyrosine (AAY) spacers [303], [215]. A universal tetanus toxoid (TT) T-helper motif [370] followed an N-terminus Kozak sequence, and a ubiquitin motif at the C-terminus were also included in the synthetic sequence as described earlier [223]. The complete vaccine sequence was then cloned into the expression vector pCX (Invitrogen). The finished vaccine product was designated HPV16E7/82-90 DNA epitope vaccine. The CRPVE1ep1-5 DNA vaccine was designed as previously described [303]. DNA vaccines were isolated and purified using the Qiagen maxiprep plasmid isolation kit. The DNA vaccines delivered using the gene gun were adjusted to a plasmid concentration of 1ug/ml in 1XTE. The DNA was then precipitated onto 1.6um-diamter gold particles at a ratio of 1ug of DNA/0.5mg of gold particles as described by the manufacturer (Bio-Rad, Hercules, California). The
DNA vaccines delivered using the tattoo gun were subjected to Cesium chloride density gradient centrifugation after maxiprep isolation and their concentrations were adjusted to
500ng/ul in 1X TE.
DNA Plasmids
The enhanced green fluorescent protein (EGFP) cloned into the mammalian
expression vector pCR3 (Invitrogen) was used to detect DNA delivery. H.CRPV
construct cloned into a pUC19 vector using the SalI site found in the L2 gene of CRPV at base pair position 4572 was used as wild type CRPV for cloning purposes [308]. A ClaI site was added to H. CRPV at base pair position 1382, just downstream of the E7 stop codon [215]. A subclone of the CRPV E7 gene cloned into a pUC19 vector between the
EcoRI and ClaI sites underwent a single round of site directed mutagenesis to insert the
84 HPV16 E7 82-90 (LLMGTLGIV) sequence in frame into the CRPV E7 gene just
upstream of the E7 stop codon. This procedure produced a CRPV E7 gene containing
nine additional amino acids at the C-terminus, which was confirmed by DNA sequencing.
After cloning the modified CRPV E7 gene into the H.CRPV construct using the EcoRI and ClaI sites, the sequence of the new genome, CRPV/E7ins82-90, was confirmed by
DNA sequencing. To create the tandem repeat genome, the CRPVE7ins82-90 genome was digested with SalI, liberating the viral DNA from the pUC19 vector. A second construct containing nucleotides 1063 to 4575 of wild type CRPV cloned into pUC19 between the SalI and EcoRI sites was digested with SalI. The two DNA restriction
products were then ligated creating a new modified CRPV genome clone that contains
the entire CRPV/E7ins82-90 genome plus an additional 3523bp piece of CRPV that
includes the wild type CRPV E7 gene as well as wild type CRPV E1, E2, E4 and parts of
the E5 and L2 genes. The CRPV/E7(82-90)TR genome sequence was confirmed by
DNA sequencing and orientation was established by digests with restriction enzymes
SphI, Aat2, and HindIII.
DNA plasmids were isolated and purified according to the Qiagen maxiprep plasmid isolation kit protocol. The concentration of the pCR3-EGFP plasmid that was delivered using the gene gun was adjusted to 1ug/ul. Viral DNA plasmids and the pCR3-EGFP plasmid that were applied using the tattoo machine were subjected to an additional purification step through cesium chloride density gradient centrifugation. The concentrations of viral DNA plasmids were adjusted to 200ng/ul in 1X TE and the concentration of pCR3-EGFP was adjusted to 500ng/ul in 1X TE.
Rabbit Vaccination and DNA Challenge
Outbred HLA-A2.1 transgenic rabbits were maintained in the Pennsylvania State
University College of Medicine animal facility. Outbred non-transgenic New Zealand
85 White rabbits were purchased from Covance Research Products, Inc. The Institutional
Animal Care and Use Committee approved all animal care and handling procedures used in all animal studies. Rabbits were divided into groups and were vaccinated three times at three-week intervals with either the CRPVE1ep1-5 DNA vaccine or the
HPV16E7/82-90 DNA vaccine. Prior to DNA vaccination by either strategy, the inner ear skin of each rabbit was cleaned with 70% ethanol. For gene gun mediated particle delivery, the ear skin was barraged with DNA coated gold particles at a rate of 400lb/in2 from a helium driven gene gun [209]. Each rabbit received a vaccine dose of 20 shots
(theoretically 20ug) at each immunization. For DNA vaccination by tattooing, vaccines were delivered to the inner ear skin of each rabbit with a 14-bundle linear tattoo needle and a commercially available rotary tattoo machine (NMT-2 NeoTat Linear Series tattoo machine, taptatdaddio.com). The DNA was delivered to a depth of 1-2 mm as described
[230]. A template of 2cm x 1cm was used as a surface area guide to ensure consistency between animals. Each area was tattooed 30-times at 2 second intervals at a voltage of
15 V (NPS-15 DC power supply, taptatdaddio.com). This voltage setting corresponds to approximately 144 hits per second. Therefore, each rabbit ear received a total number of 120,960 needle punctures at every immunization. A 10ug dose was delivered to each ear for a total dose of 20ug per vaccination per rabbit. Minor mechanical trauma, swelling and oozing of serous fluid was observed after tattooing. Four days following the final booster rabbit backs were shaved and scarified as described [209]. One week after the final booster rabbits were challenged with wild type CRPV DNA at a dose of 5ug/site in a 50ul volume in the initial CRPVE1ep1-5 comparison study, or with CRPV/E7ins82-
90 and CRPV/E7(82-90)TR at a dose of 10ug/site in a 50ul volume and wild type CRPV
DNA as described above. Rabbits receiving the pCR3-EGFP DNA plasmid were immunized in the ears with 10ug of plasmid DNA using the gene gun or the tattoo gun.
86 Ear punch biopsies were taken 24 hours later and subjected to histological analysis as
described elsewhere.
Histology and immunofluorescence detection
Fresh tissue 3 mm punch biopsies were snap frozen in liquid nitrogen and embedded in optimal cutting temperature (OCT) medium (Sakura Finetek, Torrance,
CA). Sequential cryostat sections of 6-7 um were mounted on silane coated glass slides and stored at -20C. The first section was subjected to fluorescence microscopy using a
Nikon Eclipse E600 microscope for detection of GFP. The next section was stained for
DNA with Hoechst 33342 (Molecular Probes) and visualized using the same Nikon
Eclipse E600 microscope. The third sequential section was fixed, stained with
hematoxylin and eosin, and subjected to bright field microscopy. All images were
photographed and digitally prepared using Adobe Photoshop in an identical manner.
Statistical Analysis
Papilloma size was determined as described [223]. Briefly, the cubic root of the
product of length, width, and height in millimeters of individual papillomas was calculated
to determine the geometric mean diameter (GMD). Measurements were gathered
weekly starting 3 weeks after viral DNA challenge. The data are represented as the
means (+/- standard errors) of the geometric mean diameters for each rabbit group.
Unpaired t-test comparisons were used to assign statistical significance (p <0.05 was
considered statistically significant). The protection rates were calculated as previously
described [303] and Fishers exact test was used to determine statistical significance.
87 Results
Detection of EGFP gene expression after DNA plasmid delivery to the inner ear skin of
New Zealand White rabbits by a gene gun or a tattoo gun.
Our laboratory used gene gun mediated vaccination to deliver DNA plasmid
vaccines to NWZ white rabbits with great success [216], [347], [365], [364], [303]. To
confirm that a DNA plasmid could be effectively delivered using a tattoo gun, an EGFP-
expression plasmid was employed. The EGFP-expression plasmid was administered to
the inner ear skin of sedated rabbits using a gene gun or a tattoo gun to compare the
two DNA delivery strategies. One day later, ear punch biopsies were collected and cryo-
preserved tissue samples were subjected to fluorescence and bright field microscopy.
Due to the fragile nature of the tissue sections from the tattoo gun experiment and the
fact that all manipulations of these unfixed sections compromised the integrity of the
tissue, these samples were not stained with Hoechst. GFP expression in the epidermis,
dermis, and subcutaneous layers of skin was detected in tissue samples from rabbits
receiving the DNA plasmid by either route (Figure 4.1A and 4.2A). H&E photographs
indicate tissue orientation (Figures 4.1B and 4.2B).
HLA-A2.1 transgenic rabbits receiving the CRPVE1 multivalent epitope DNA vaccine
through tattooing were completely protected from challenge with the wild type CRPV
genome.
Powerful protective immunity to native HLA-A2.1-restricted CRPV E1 epitopes is generated in HLA-A2.1 transgenic rabbits by gene gun mediated intracutaenous DNA vaccination with the multi-epitope CRPV E1 vaccine [303]. To compare routes of DNA vaccination, HLA-A2.1 transgenic rabbits were vaccinated three times at three week
88 Figure 4.1. Detection of EGFP expression in ear punch biopsy 24 hours after 10ug of pCR3-EGFP was delivered using the gene gun (A). Ear punch biopsies were collected and cryo-preserved in OTC medium. Prepared slide was visualized using fluorescence microscopy to determine successful plasmid delivery. The tip of the white arrow indicates the area of detected GFP expression. Image magnification is 20X. H&E ear punch biopsy after gene gun delivery of 10ug of pCR3-EGFP (B). 24 hours later, ear punch biopsies were collected, acetone fixed, and stained with hematoxylin and eosin. Prepared slides were visualized using bright field microscopy to demonstrate tissue orientation. Tisse layers are designated and the black arrow indicates the general area of the GFP expression. Image magnification is 10X.
89 25um
Sebaceous gland surrounding a hair folicle
Dermis
Perchondrium
Cartilage
90 Figure 4.2. Detection of EGFP expression in ear punch biopsy after 10ug of pCR3- EGFP was delivered using the tattoo gun (A). Ear punch biopsies were collected ~24 hours later and cryo-preserved in OTC medium. Prepared slide was visualized using fluorescence microscopy. The tip of the white arrow indicates the area of detected GFP expression. Image magnification is 20X. H&E ear punch biopsy after tattoo gun delivery of 10ug of pCR3-EGFP (B). 24 hours later, ear punch biopsies were collected, acetone fixed, and stained with hematoxylin and eosin. Prepared slide was visualized using bright field microscopy to demonstrate tissue orientation. Tisse layers are designated and the black arrow indicates the general area of the GFP expression. Image magnification is 10X.
91
25um
Cartilage Perichondrium
Dermis
Epidermis
92 intervals with the CRPVE1ep1-5 epitope vaccine using the gene gun (N = 4) or the
tattoo gun (N = 4). One week following the final vaccination, each rabbit was challenged
with wild type CRPV DNA at eight back sites. All rabbits vaccinated by tattooing were completely protected against CRPV infection during the entire study (Figure 4.3). Gene gun vaccinated rabbits grew small papillomas at some of the challenge sites, all of which regressed by week 7 (Figure 4.3). The outcome of the gene gun vaccination in this protection study failed to recapitulate the results obtained by Hu et al [303].
Gene gun mediated DNA vaccination requires a number of steps to achieve the final vaccine delivery product. Poor coating and unevenness in the coating of the tubing by the DNA coated gold particles has been observed (unpublished observation).
Therefore, the amount of CRPVE1ep1-5 DNA delivered on a per bullet basis was investigated. To determine the amount delivered, the plasmid vaccine DNA was eluted
from the gene gun bullets by soaking the bullets in 500uls of water. The amount of DNA eluted from the bullet was quantified using a Nano Drop ND-1000 spectrophotometer.
The results of this analysis indicated that the rabbits vaccinated using the gene gun received only half doses of the CRPVE1ep1-5 DNA vaccine during each immunization.
These data help explain the initial appearance of small papillomas on the HLA-A2.1 transgenic rabbits that were immunized with the CRPVE1ep1-5 DNA vaccine using the gene gun.
Gene gun and tattoo gun mediated vaccinations provided similar levels of protection
against challenge with a modified CRPV genome containing the HPV16E7 82-90 epitope
inserted in the E7 gene.
To ensure that the previous results were not limited to vaccines that generate powerful immunity in the CRPV/HLA-A2.1 transgenic rabbit model system and to gain supplementary comparative data, a second comparison study was carried out with the
93 Figure 4.3. Papilloma outgrowth in epitope DNA vaccinated outbred HLA-A2.1 transgenic rabbits after wild type CRPV DNA challenge. HLA-A2.1 transgenic rabbits immunized three times with the CRPVE1ep1-5 epitope vaccine using the tattoo gun or gene gun were challenged with wild type CRPV DNA. No papillomas were found on all the HLA-A2.1 transgenic rabbits immunized with the tattoo gun while HLA-A2.1 transgenic rabbits vaccinated with the gene gun grew small papillomas that completely regressed by week 7 (p< 0.05, unpaired student’s t-test).
18 HLA-A2.1 + Gene Gun + CRPVE1ep1-5 Vaccine HLA-A2.1 + Tattoo Gun + CRPVE1ep1-5 Vaccine
n mm 16 i s 14 GMD
y 12 b
SE) 10 - / 8 ean +
(M 6 ze ze
Si 4 * * *
oma 2
ill * ap
P 0
Wk3 Wk4 Wk5 Wk6 Wk7
Weeks after challenge with wild type CRPV DNA
94 partially protective HPV16E7/82-90 epitope vaccine [222]. HLA-A2.1 transgenic and non
transgenic control rabbits were vaccinated three times with the HPV16E7/82-90 epitope
vaccine at three week intervals using the gene gun or the tattoo gun. Animals
vaccinated with the gene gun were challenged at six sites with CRPV/E7ins82-90 DNA
one week later, and rabbits receiving the epitope vaccine by tattooing were challenged
at three sites with the same DNA genome. HLA-A2.1 transgenic rabbits immunized by
either method had similar levels of protection against challenge with the modified CRPV
genome (Table 4.1). In contrast, little to no protection was observed in non transgenic control rabbits receiving the epitope vaccine by either delivery route (Table 4.1).
Additionally, using either method, the mean papilloma size on the non-transgenic control
rabbits was significantly larger than that of the immunized HLA-A2.1 transgenic rabbits
(Figure 4.4 and 4.5).
DNA vaccination by tattooing imparted complete protection against infection with a
CRPV tandem repeat (CRPV/E7(82-90)TR) genome containing a modified CRPV E7
gene.
The modified genome, CRPV/E7ins82-90, produces smaller and slower growing papillomas than the wild type CRPV genome (unpublished observation). In an attempt to return the growth rate of the modified CRPV/E7ins82-90 genome to wild type levels, we created a tandem repeat genome containing a modified and a wild type CRPV E7 gene. The growth rate of papillomas produced by this tandem repeat genome was similar to wild type CRPV (Figure 4.6). To ensure that the protection observed when an epitope DNA vaccine is delivered using the tattoo gun is not due to a combination of natural immunity overwhelming an infection with a modified CRPV genome exhibiting a reduced growth rate, we performed an additional experiment with the CRPV/E7(82-
90)TR genome. In the second comparison study between the gene gun and the tattoo
95 Table 4.1. Tumor protection rates in New Zealand White rabbits after DNA vaccination with two different devices. Transgenic and non-transgenic rabbits challenged with CRPV/E7ins82-90 DNA containing the HPV16E7 82-90 epitope inserted in the E7 gene after three immunizations with the HPV16E7/82-90 epitope vaccine delivered using a gene gun or a tattoo gun.
Rabbits Vaccine DNA Delivery Challenged Protection Ratea (%) Sites 1 HLA-A2.1 (N = 3) E7 Gene Gun 18 18/18 (100%)b,c,d Epitope 2 Control (N = 3) E7 Gene Gun 18 1/18 (6%) Epitope 3 HLA-A2.1 (N = 4) E7 Tattoo Gun 12 11/12 (92%)e,f Epitope 4 Control (N = 3) E7 Tattoo Gun 9 0/9 (0%) Epitope a Protection rate, papilloma-free sites/challenge sites; bp = 0.0009, cp = 1 , dp = 0.007 vs group 2, group 3, and group 4, respectively; ep = 0.005 , fp = 0.01 vs group 2 and group 4, respectively, Fisher’s exact test.
96 Figure 4.4. Papilloma outgrowth in gene gun mediated-DNA vaccinated outbred HLA- A2.1 transgenic and control rabbits after viral DNA challenge. HLA-A2.1 transgenic and control rabbits immunized three times with the HPV16E7/82-90 epitope vaccine using the gene gun were challenged with CRPV/E7ins82-90 DNA. Significantly smaller papillomas were found on all HLA-A2.1 transgenic rabbits immunized with the E7 epitope vaccine (p< 0.05, unpaired student’s t-test).
18 HLA-A2.1 + HPV16E7/82-90 epitope vaccine 16 Control + HPV16E7/82-90 epitope vaccine
14
12
10 * +/- SE) by GMDs in mm by SE) +/- 8 * 6 * 4 * * * 2
Papilloma Size (Mean Size Papilloma 0
WK3 WK4 WK5 WK6 WK7 Wk9
Weeks after challenge with CRPV/E7ins82-90 DNA
97 Figure 4.5 Papilloma outgrowth in tattoo gun DNA vaccinated outbred HLA-A2.1 transgenic and control rabbits after challenge with viral DNA. HLA-A2.1 transgenic and control rabbits immunized three times with the HPV16E7/82-90 epitope vaccine using the tattoo gun were challenged with CRPV/E7ins82-90 DNA. Significantly smaller papillomas were found on all HLA-A2.1 transgenic rabbits immunized with the E7 epitope vaccine (p< 0.05, unpaired student’s t-test).
18 HLA-A2.1 + HPV16E7/82-90 epitope vaccine 16 Control + HPV16E7/82-90 epitope vaccine
14
12
10 - SE) by GMDs in mm
8 * 6 * * * 4
2
Papilloma Size (Mean +/ Size Papilloma 0
Wk 3 Wk 4 Wk 5 Wk 6 Wk 7 Wk 8
Weeks after challenge with CRPV/E7ins82-90 DNA
98 Figure 4.6. Modified CRPV genome forms papillomas in New Zealand White rabbits. Papilloma GMDs from New Zealand White rabbits challenged with CRPV/E7(82-90)TR DNA and wild type CRPV DNA.
18 CRPV/E7(82-90)TR 16 wild type CRPV
14
12
10
8
6
4
2
Papilloma Size (Mean +/-SE) by GMDs in mm +/-SE) (Mean Size Papilloma 0
Wk 3Wk 4Wk 5Wk 6Wk 7Wk 8Wk 9
Weeks after challenge with DNA
99 gun in which rabbits were vaccinated with the HPV16E7/82-90 vaccine, the rabbits vaccinated by tattooing were challenged with CRPV/E7(82-90)TR genome at three sites per rabbit. Compared to control rabbits, vaccinated HLA-A2.1 transgenic rabbits were completely protected against challenge with the CRPV/E7(82-90)TR genome (Table
4.2). Furthermore, the mean papilloma size of the papillomas that did grow in the early weeks after challenge was significantly smaller in these HLA-A2.1 transgenic rabbits
(Figure 4.7).
100 Table 4.2. Tumor protection rates in outbred New Zealand White rabbits. Transgenic and non-transgenic rabbits challenged with CRPV/E7(82-90)TR DNA containing the HPV16E7 82-90 epitope inserted into the modified E7 gene after three immunizations by tattooing with the HPV16E7/82-90 epitope vaccine.
Rabbits Vaccine DNA Challenged Protection Ratea Delivery Sites (%) 1 HLA-A2.1 (N = 4) E7 Tattoo Gun 12 12/12 (100%)b Epitope 2 Control (N = 3) E7 Tattoo Gun 9 0/9 (0%) Epitope a Protection rate, papilloma-free sites/challenge sites (three sites/each rabbit); bp = 0.01 vs group 2, Fisher’s exact test.
101 Figure 4.7. Papilloma outgrowth in outbred HLA-A2.1 transgenic and control rabbits after epitope DNA vaccination through tattooing followed by viral DNA challenge. HLA- A2.1 transgenic and control rabbits immunized three times with the HPV16E7/82-90 epitope vaccine were challenged with CRPV/E7(82-90)TR DNA. Significantly smaller papillomas were found on all HLA-A2.1 transgenic rabbits immunized with the E7 epitope vaccine (p< 0.05, unpaired student’s t-test).
18 HLA-A2.1 + HPV16E7/82-90 epitope vaccine 16 Control + HPV16E7/82-90 epitope vaccine
14
12 * 10 * 8 * * 6 * 4
2
Papilloma Size (Mean +/-SE) by GMDs in mm by GMDs in (Mean +/-SE) Size Papilloma 0
Wk 3 Wk 4 Wk 5 Wk 6 Wk 7 Wk 8
Weeks after challenge with CRPV/E7(82-90)TR DNA
102 Discussion
In this study, the CRPV/HLA-A2.1 transgenic rabbit model was used to assess the protective immunity generated by DNA vaccines delivered using the gene gun or the tattoo gun. The focus was to determine if the tattoo gun was a useful DNA vaccination alternative to the gene gun. We first compared the ability of each device to deliver a
DNA plasmid to the inner ear skin of rabbits, since this same immunization site was used in our earlier studies [303], [222]. The next parameter set was the DNA vaccine dose.
Previous publications using a tattoo gun to deliver a DNA vaccine delivered doses as high as 100ug/immunization to mice [229], [230] and 650ug/immunization to non-human primates [382]. However, to perform an appropriate comparison study between the two
DNA delivery devices we followed the vaccination strategy established in our gene gun protection studies described earlier.
The preliminary experiment compared the delivery of an EFGP-expression plasmid to the inner ear skin of rabbits using either the gene gun or the tattoo gun.
Tissue biopsies analyzed using fluorescence microscopy showed that both devices delivered the DNA plasmid as green fluorescence was observed. However, only a few sites could be found within the tissues when the plasmid DNA was delivered by either device. This observation raises a number of possibilities. The cells in the tissue where the DNA was delivered did not take-up the DNA efficiently. Second, the DNA plasmid was not efficiently expressed by the cells that took up the DNA. Lastly, DNA delivered using either device was dispersed over a much larger region than the ear punch biopsy collected. Despite the small amounts of EGFP expression observed, both devices did effectively deliver DNA to the upper layers of the skin.
Our next study set up a head to head comparison of the protective immunity elicited by delivery of the CRPVE1ep1-5 DNA vaccine by either device. The gene gun or the tattoo gun was used to deliver the epitope DNA vaccine to to HLA-A2.1 transgenic
103 rabbits which were later challenged with wild type CRPV DNA. The lack of initial
complete protection observed in the rabbits receiving the CRPVE1ep1-5 DNA vaccine
using the gene gun was unexpected. An investigation into the amount of DNA-gold
coating an individual bullet revealed that only half-doses of the DNA vaccine were being
retained within the individual bullets. This observation raises a number of possibilities.
The DNA-gold mixture is not attaching to the tubing correctly and therefore less of the
DNA-gold mixture is being retained in the bullets. Second, the DNA is not sticking to the
gold and therefore, there is smaller DNA:gold ratio than expected. Lastly, the DNA-gold
mixture is not coating the tubing uniformly which results in uneven DNA delivery. Thus, direct application of a set amount of DNA vaccine to the skin that is used with the tattoo gun vaccination strategy allows a more reproducible dosing of the DNA vaccine.
In the second study comparing the gene gun and the tattoo gun, the
HPV16E7/82-90 DNA epitope vaccine was delivered by either device followed by challenge with the CRPV/E7ins82-90 genome. Similar levels of protection were achieved by tattoo gun vaccination or gene gun vaccination in this study. However, a third study with the tattoo gun only was carried out to reconfirm that tattoo gun vaccination elicited a protective immune response in the HLA-A2.1 transgenic rabbits.
The HPV16E7/82-90 DNA epitope vaccine was delivered using the tattoo gun followed by challenge with the CRPV/E7(82-90)TR genome. The results from this final study demonstrated that tattoo gun vaccination was protective in the CRPV/HLA-A2.1 transgenic model. Collectively, these studies demonstrate that the tattoo gun is a convenient and cost-effective alternative to the gene gun for DNA vaccination.
104 Acknowledgments
This work was supported by the Public Health Service, National Cancer Institute Grant
R01 CA47622 from the National Institutes of Health and by the Jake Gittlen Memorial
Golf Tournament.
105
Chapter V
Characterizing the Immunogenicity of a “Sequence Optimized” HPV16 E7 HLA-A2.1 Restricted Epitope Using Two HLA-A2.1 Transgenic Preclinical Animal Models
106 Abstract
HPVs are among the few identified infectious agents that cause cancer.
Currently two prophylactic VLP vaccines are commercially available. Neither vaccine induces clearance of pre-existing HPV infections or established HPV disease, and there is potential for vaccine escape mutants as HPV16 variants have been identified.
Consequently, additional protective and therapeutic vaccine strategies are needed. Our laboratory utilizes the HLA-A2.1 transgenic mouse model (HHD) and the CRPV/HLA-
A2.1 transgenic rabbit model to examine the CD8+ T cell responses to HLA-A2.1
restricted epitopes. HHD mice provide a quick and easy model to test the
immunogenicty of HLA-A2.1 restricted epitopes in vivo while the HLA-A2.1 transgenic
rabbits are used to determine if these immunogenic HLA-A2.1 restricted epitopes can
elicit protective cell-mediated immune responses in a model of natural papillomavirus
infection. Our laboratory reported previously that the two models complement each
other for the identification of HLA-A2.1 restricted epitopes in the CRPV genome. In the
present study, the dual model approach was used to characterize an HLA-A2.1-
restricted HPV16E7 epitope predicted by bioinformatics as a proof of concept.
An algorithm that uses multiple multilayer artificial neural networks (ANNs) was
utilized to predict epitopes that bind weakly to HLA-A2.1 molecules and are therefore
missed by other programs that only predict strong binders. The HPV16E7 49-57 epitope
along with a sequence variant that contained leucines at anchor residues 2 and 9 were
chosen for evaluation in our two model system. Peptide vaccination of HHD mice with
the native HPV16E7 49-57 epitope did not generate CD8+ cytotoxic T lymphocytes
(CTLs) while vaccination with the sequence variant did induce CTLs that were epitope specific and functional against targets presenting this same epitope. The protective immune response elicited in epitope-vaccinated HLA-A2.1 transgenic rabbits challenged with a CRPV DNA genome containing the HPV16E7 49-57(opt) epitope inserted into the
107 E7 gene was examined as well. HLA-A2.1 transgenic rabbits vaccinated with the
epitope DNA vaccine were partially protected from challenge with the CRPV/E7ins49-
57(opt) genome while the control rabbits were not protected. These data demonstrate
that there is agreement between both HLA-A2.1 transgenic preclinical animal models
with respect to epitope recognition and CTL generation. Thus, the use of both HLA-A2.1
transgenic models for the characterization of potential CD8+ T cell targets within the
HPV16E7 gene is a practical approach.
108 Introduction
HPVs are small double-stranded DNA viruses that infect both cutaneous and
mucosal tissues composed of stratified squamous epithelium. A subset of these HPVs
infect the genital tract and can further be subdivided into “low risk” types that cause
benign anogenital warts and “high risk” types that are responsible for virtually all cases
of cervical cancer [4], [15], At present two vaccines are commercially available and both
protect against the two most common “high risk” types through induction of neutralizing
antibody. However, neither vaccine has any effect on established HPV disease, as
generation of a cell mediated immune response is required for eradication of pre-existing
HPV infections and HPV related diseases [362], [102], [93]. Additionally, known HPV16-
variants differ in nucleotide sequence and vary in geographic distribution as well as
potential oncogenicity [294], [295], [296], [297] and possible immunogenicity.
Consequently, the need for protective and therapeutic strategies against HPV-related
disease and the cancer-associated complications remains.
Papillomavirus oncogenes E6 and E7 are potential targets for antigen-specific
immunotherapies as they are expressed from the time of initial infection through
progression to cancer and are required for maintenance of the malignant phenotype
[298] [299] [9]. E6 and E7 are immunogenic and E6 and E7 specific T cells are detected
in the peripheral blood of patients with cervical cancer [300] [301]. Also, tumor infiltrating
lymphocytes that recognize E6 and E7 antigens can be isolated from cervical cancer
tissue [102] [302]. In this study, we focused on identifying potential HLA-A2.1 restricted
HPV16 E7 CD8+ T cell targets, because the E7 gene sequence is more conserved than that of E6, E7 is expressed more abundantly, and E7 is better characterized immunologically [303].
PVs are highly species and tissue tropic [358]. Non-human primate, rabbit, dog, and bovine models are the only preclinical animal models of natural PV infection
109 currently available. Our laboratory has extensively used the CRPV rabbit model to study
the vaccine induced cell-mediated immunity generated to numerous CRPV viral proteins
[292], [347], [365], [364]. Recent establishment of an HLA-A2.1 transgenic rabbit model provides another resource for the assessment of vaccine induced protective and therapeutic immunity to HLA-A2-restricted epitopes during natural PV infections [222],
[303]. However, diagnostic immunological reagents available for use with the
CRPV/HLA-A2.1 rabbit model are lacking, generation of new HLA-A2.1 transgenic rabbits requires months of preparation, and this resource is too costly to be used as an epitope-screening tool for potential HPV16 E7 targets. On the other hand, a wide variety of reagents are available for the HHD mouse model. Moreover, this animal model has been used previously to characterize the immune response to potential HPV16 epitopes
[235]. However, there are no mouse models of natural infection as there are no PV types that infect laboratory strains of small rodents [348]. Consequently, our laboratory has chosen a dual model approach to overcome some of the inherent limitations of each individual HPV preclinical animal model.
In these studies, we used a bioinformatics approach to predict a new HPV16E7 epitope that bound weakly to the HLA-A2.1 molecules along with a sequence variant
(optimized) of this epitope containing hydrophobic leucine residues at the HLA-A2.1 anchor positions of 2 and 9. A more stable peptide/HLA-A2.1 complex was formed using the optimized epitope as compared to the native sequence epitope. Peptide
immunization of HHD mice with the sequence-optimized epitope produced CTLs that were epitope-specific and functional against targets presenting this same epitope.
However, CTLs specific for the “sequence optimized” epitope did not target HLA-A2.1
molecules presenting the native epitope. To test the immunogenicity of the optimized
epitope in vivo under conditions of a natural infection, the epitope was inserted into the
CRPV E7 gene producing a viable new CRPV genome that produced papillomas on the
110 backs of challenged rabbits. Gene gun vaccination with this epitope vaccine elicited a protective immune response in the HLA-A2.1 transgenic rabbits and this immunity was epitope-specific, as vaccinated non-transgenic control rabbits were not protected from challenge with the CRPV genome containing the epitope in the E7 gene. These data demonstrate that the C-terminus of the CRPV E7 gene is amenable to insertion of sequence-modified epitopes, and HLA-A2 restricted epitopes can be processed and presented from this location in the CRPV genome.
111 Materials and Methods
Bioinformatics and Peptide Synthesis
A predictive algorithm that uses multiple multilayer artificial neural networks
(ANNs) [304] was utilized to predict HLA-A2.1-restricted HPV16E7 epitopes that bound weakly to HLA-A2.1 molecules and are therefore missed by other algorithms that are designed to predict peptides that bind strongly to HLA molecules. This peptide as well as a variant that contained canonical leucines at HLA-A2.1 anchor positions 2 and 9 were produced through 9-fluroenylmethoxycarbonyl chemistry using an automated peptide synthesizer (9050 MilliGen PepSynthesizer) in the macromolecular synthesis core at the Penn State University College of Medicine. Peptides were verified for correct sequence by mass spectroscopy and stored at -20C as lyophilized powder. Prior to use, peptides were solubilized in DMSO and diluted to the appropriate concentration in sterile
1X PBS for use in vaccination of HHD mice or in RPMI 1640 complete media for use in cell culture.
Antibodies, Tetramer Synthesis, and Flow Cytometry
Antibodies directed against mouse CD8 and IFN-gamma (IFN-g) were FITC- and
PE-conjugated, respectively (Biolegend, San Diego, CA). A specific anti-HLA-A2.1
monoclonal antibody, BB7.2 (ATCC), and a PE-conjugated goat anti mouse IgG
(Jackson ImmunoResearch Laboratories, Inc., West Grove, PA) were also used. A PE-
conjugated HLA-A2.1 tetramer was synthesized at the NIH tetramer core facility. All
stained cells were analyzed on a FACSCalibur (Becton Dickinson) or a FACScan
(Becton Dickinson) flow cytometer and the data analyzed using CellQuest software.
112 HLA-A2.1-peptide Binding Assay
The HLA-A2.1-peptide binding assay was conducted using T2 (a human HLA-
A2.1 positive TAP deficient cell line) cells as described by [305] with a few modifications.
Briefly, all naturally bound peptides were chemically stripped from the HLA-A2.1 molecules of the T2 cells by incubating the cells for 60s in ice-cold citric acid buffer, pH
3.1 (1:1 mixture of 0.263M citric acid buffer and 0.123M Na2HPO4). Cells were immediately buffered in complete DMEM (containing 10% heat inactivated fetal bovine serum (FBS), sodium bicarbonate, HEPES, non-essential amino acids, L-glutamine
(2mM), sodium pyruvate (1mM), penicillin (100U/ml) and streptomycin (100ug/ml)) medium followed by two additional washes with this media. Cells were re-suspended in complete DMEM containing 2ug/ml human beta2-microglobulin (Sigma-Aldrich) and
1ug/ml brefeldin A (BFA) (Sigma-Aldrich). The T2 cells were mixed with each individual peptide at a concentration of 20ug/ml and plated in triplicate at a concentration of 3 x 104 cells/well in 96-well U-bottomed plates. Plates were incubated at 37°C for 3.5 hours.
Cells were washed two times in PBS containing 2% FBS and incubated for 1 hour with the BB7.2 antibody. Two washes were performed and the cells were then stained with the PE-conjugated goat anti mouse IgG (1:50) for 30 minutes. After washing two times, cells were fixed in PBS containing 2% paraformaldehyde and subjected to flow cytometric analysis.
HLA-A2.1 Stability Assay
T2 stability assay was performed as described [306] with some modifications. T2
cells were chemically stripped of naturally bound peptides as described above. T2 cells
were re-suspended in serum free RPMI 1640 (Gibco) (10mM HEPES, 2mM L-glutamine,
1mM sodium pyruvate, 100U/ml penicillin, 100ug/ml streptomycin and 50uM 2-ME)
medium containing 2ug/ml beta2-microglobulin. T2 cells were mixed with individual
113 peptides at a concentration of 20ug/ml, seeded at a density of 3 x 105 cells/well in 96- well U-bottomed plates in triplicate and incubated overnight at 37°C. Cultured cells were washed one time with PBS containing 2% FBS and incubated for 1 hour at 37°C in RPMI
1640 complete media (containing 10% FBS) and 10ug/ml BFA to block the egress of new MHCI molecules. Cells were subsequently incubated at 37°C in RPMI 1640 complete media containing 0.5ug/ml BFA to maintain the MHCI block. At indicated time points cells were washed three times and incubated with BB7.2 for 45 minutes followed by staining with PE-conjugated goat anti mouse IgG (1:100) for 45 minutes. All antibodies and wash medium contained 0.5ug/ml BFA. Cells were fixed in PBS containing 2% paraformaldehyde and subjected to flow cytometric analysis.
Animals
HHD mice are a double knockout for mouse beta-2-microglobulin and the mouse
H-2Db molecule. These mice express a chimeric HLA-A2.1 molecule composed of the cytosolic, transmembrane and α3 domains of H-2Db molecule and the α1 and α2
domains of the HLA-A*0201 molecule covalently linked to the human β2m light chain
[225]. The HHD mice and the HLA-A2.1 transgenic outbred rabbits were bred and maintained in the Pennsylvania State University College of Medicine animal facility.
Non-transgenic outbred rabbits were purchased from Covance Research Products, Inc.
All animal studies, care, and handling procedures were performed under protocols approved by the Institutional Animal Care and Use Committee.
HLA-A2.1 transgenic mice vaccination
Six to eight week old HHD mice were vaccinated two times at one week intervals subcutaneously at the base of the tail with peptide emulsions. These emulsions were composed of 100ug of the specified peptide, 160ug of the HBV core helper peptide (AA
114 128-140) and 100ul of incomplete Freund’s adjuvant as described by [307]. One week
following the booster, immunized mice were sacrificed and their spleens harvested. For
gene gun mediated DNA vaccination, the shaved abdominal regions of sedated HHD
mice were barraged with DNA-coated gold particles at a rate of 400lb/in2 by a helium
driven gene gun [228]. Each mouse received a vaccine dose of 5ug at each
immunization. Gene gun vaccination followed the same schedule as peptide
vaccinations.
Cell Culture
Single cell suspensions of harvested splenocytes were co-cultured with syngeneic bone marrow-derived DCs. DCs were pulsed with peptide (20ng/ml) for 1 hour at 37°C, irradiated with 10Krads using a 60Co-source GammaCell irradiator (MDS
Nordion), washed 2X times with 1X PBS, and re-suspended in complete RPMI 1640
media. Recombinant human IL-2 (R&D Systems, Minneapolis, MN) was added to the
splenocyte co-cultures at a dose of 20U/ml during the first stimulation. One week later
the T lymphocyte cultures were stimulated again with peptide pulsed DCs as described
above and 10units/ml of rh-IL2 was added to each culture.
Dendritic Cell Isolation and Culture
DC’s were isolated from the bone marrow and maintained in culture with GM-
CSF-containing supernatant from X-63GM.1 cells [308] as described by [309]. Briefly, femurs of HHDII mice were removed and bone marrow was isolated by flushing with
RPMI 1640 media. The bone marrow derived cells were seeded at a density of 4 x 106
cells/dish in 100mm Petri dishes containing 10 milliliters (mls) of complete RPMI 1640
medium supplemented with 10% X-63GM.1 supernatant. On day 3, 10 mls of this same
media was added to the cultures. On days 6 and 8, 10 mls of supernatant was removed
115 from each Petri dish, cells pelleted by centrifugation, and re-suspended in 10 mls of
fresh media that was added back to the original dish. On day 11, the cells were
harvested, frozen in CTL freezing media composed of 90% FBS and 10% dimethyl
sulfoxide (DMSO), and stored at −80°C until use.
Tetramer Staining Assay
Four days after the second stimulation, cultured T lymphocytes were tested for epitope specificity using the tetramer binding assay. T lymphocytes were stained with
FITC labeled anti mouse CD8 (1:50) for 1 hour on ice followed by two washes with 1X
PBS containing 2% FBS. Cells were then stained with PE labeled HLA-A2.1 tetramers at the indicated dilutions for one hour on ice. Two-color flow cytometry was performed and dual labeled cells represented the effector CTL population.
Intracellular Cytokine Staining Assay
Four days following the second stimulation, the cultured T lymphocytes were tested for IFN-g production by intracellular cytokine staining (ICS). T lymphocytes were stimulated with 20ng/ml of the indicated peptides or an unrelated HLA-A2.1-binding peptide in the presence of BFA (1ug/ml) for 4 hours at 37°C. Cells were stained with
FITC conjugated anti mouse CD8 (1:50) for 30 minutes and PE-conjugated anti mouse
IFN-g (1:50) for 30 minutes using the Cytofix/Cytoperm kit (BD Biosciences) as described by the manufacturer. Cells were fixed with PBS containing 2% paraformaldehyde and subjected to flow cytometry. Two-color-labeled cells represented the effector CTL population with the potential to eliminate infected cells.
116 DNA Vaccine
The HPV16E7/49-57(opt) DNA vaccine was designed with five repeats of the single epitope as illustrated in figure 5.1. The control vaccine used was pCXUb as described in
Chapter III. The plasmid concentration of the DNA vaccine was adjusted to 1ug/ml in
1XTE followed by DNA precipitation onto 1.6um-diamter gold particles at a ratio of 1ug of DNA/0.5mg of gold particles as described by the manufacturer (Bio-Rad, Hercules,
California)
Viral DNA Challenge Constructs
H.CRPV cloned into the pUC19 vector at the SalI site was used as wild type
CRPV [310]. The CRPV E7 gene cloned into the pUC19 vector as described [215] was modified using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) as described by the manufacturer to insert the HPV16E7 49-57(opt) (RLHYNIVTL) sequence in frame into the CRPV E7 gene just upstream of the E7 stop codon. Primer sequences used for this single step mutagenesis were 5’-GCC-CGG-AGT-GTT-GTA-
ACC-GCC-TGC-ACT-ACA-ACA-TCG-TGA-CCC-TGT-GAA-AAT-GGC-TGA-AGG-TAC-
AGA-CC-3’ and 5’-GGT-CTG-TAC-CTT-CAG-CCA-TTT-TCA-CAG-GGT-CAC-GAT-
GTT-GTA-GTG-CAG-GCG-GTT-ACA-ACA-CTC-CGG-GC-3’ with the underlined portion
indicating the inserted nucleotide sequences. The sequence of the modified CRPV E7
gene containing the inserted epitope sequence at the carboxy-terminus was confirmed
and the gene was cloned into the H.CRPV genome between the EcorI and ClaI sites creating CRPV/E7ins49-57(opt). This new CRPV genome sequence was confirmed by
DNA sequencing. Viral DNA plasmids were isolated and purified using maxiprep plasmid isolation kit (Qiagen Valencia, CA) by following the manufacturer’s instructions and subjected to cesium chloride density gradient centrifugation as a second purification step. Plasmid concentration was adjusted to 200ng/ul in 1X TE
117 Figure 5.1. Diagram illustrating the HPV16E7/49-57(opt) DNA vaccine components. The HPV16E7/49-57(opt) DNA vaccine was designed with each repeat of the single epitope separated by alanine-alanine-tyrosine (AAY) spacers. An N-terminus Kozak sequence, followed by a universal tetanus toxoid (TT) T-helper motif and a C-terminus Ubiquitin motif were also included in the synthetic sequence and the entire vaccine sequence was then cloned into the pCX expression vector.
TT Helper AAY RLHYNIVTL AAY RLHYNIVTL AAY RLHYNIVTL
AAY RLHYNIVTL AAY RLHYNIVTL AAYAAA Ubiquitin
118 Rabbit Vaccination and Viral DNA challenge
HLA-A2.1 transgenic rabbits (N = 4) rabbits and control rabbits (N = 3) were
divided into groups and vaccinated with the HPV16E7/49-57(opt) epitope DNA vaccine
or the vector only vaccine using a helium driven gene gun 3 times at 3-week intervals as
previously described [215]. One week after the final vaccination, rabbits were
challenged with a dose of 10ug/site in a 50ul volume of wild type CRPV DNA and
CRPV/E7ins49-57(opt) DNA as described by [209].
Papilloma Volume Determination and Statistical Analysis
Papilloma size was calculated as described previously [364]. Unpaired t-test comparisons were used to evaluate statistical significance.
119 Results
Sequence modification of an HPV16E7 epitope increases its HLA-A2.1 binding affinity
A predictive algorithm that uses multiple multilayer artificial neural networks
(ANNs) [304] was utilized to predict HLA-A2.1-restricted HPV16E7 epitopes that bound weakly to HLA-A2.1 molecules. These epitopes are missed by other algorithms that are designed to predict peptides that bind strongly to HLA molecules and that conform to the
HLA allele-specific epitope motifs. The HPV16E7 49-57 (RAHYNIVTF) native epitope that is a known binder of the H2-Db molecule [249] was predicted to bind weakly to HLA-
A2.1 molecules. This epitope as well as the sequence variant RLHYNIVTL, HPV16E7
49-57 (opt), that contained canonical leucines at the HLA-A2.1 anchor positions 2 and 9
[311] were investigated further. To determine the actual binding affinities of these two epitopes to HLA-A2.1 molecules, the peptides were synthesized and T2 binding experiments were performed. T2 cells were pulsed with each individual peptide
(20ug/ml) for a period of 4 hours and then stained for A2 surface expression. The amount of A2 expression correlates with the number of peptide-bound A2 molecules on the surface of the cells. T2 cells with medium only was included as a negative control and T2 cells pulsed with HPV16E7 82-90 [312] peptide were used as a positive control.
The geometric mean fluorescence (Geo Mean) value was used to assess the binding affinity of each individual peptide.
Both HPV16E7 82-90 and HPV16E7 49-57(opt) peptides bound the HLA-A2.1 molecules with a statistically significant greater affinity than the medium only control while the native HPV16E7 49-57 peptide did not bind to the HLA-A2.1 molecule above the medium control (Figure 5.2). Additionally, a decrease in the concentration of the
HPV16E7 49-57(opt) peptide reduced the amount of peptide bound A2 molecules
(Figure 5.3), demonstrating that the optimized peptide binds the A2 molecules in a dose-
120 Figure 5.2. T2 binding assay for native and optimized HPV16E7 49-57 peptides. T2 cells were pulsed with the native HPV16E7 49-57 peptide, the HPV16E7 49-57(opt), HPV16E7 82-90 (positive control) or media (negative control) at a peptide concentration of 20ug/ml and the geometric means of A2 expression were detected by flow cytometry.
60 * *
50
40
30
Geo Mean +/- SE 20
10
0 0 t 7 a -9 Op -5 di 82 57 49 Me 7 9- 7 6E 4 6E PV1 6E7 PV1 H V1 H HP Peptides
121 Figure 5.3. Dilution curve analysis of HPV16E7 49-57(opt) peptide. T2 cells were pulsed with various peptides over a range of peptide concentrations and the geometric means of A2 expression were detected by flow cytometry. HPV16 82-90 represents a positive control while media only is a negative control (p< 0.05, unpaired student’s t- test).
100 HPV16E7 82-90 peptide HPV16E7 49-57(opt) peptide ** Media only 80 **
60 **
40 ** Geo Mean +/- SE *
20
0 20ug/ml 2ug/ml 200ng/ml 20ng/ml 2ng/ml 0.2ng/ml
Peptide Concentration
122 dependent manner. However, for the native HPV16E7 49-57 peptide there was no
change in the number of bound A2 molecules over a wide range of concentrations
(Figure 5.4) indicating that the native HPV16E7 49-57 epitope indeed bound poorly to
HLA-A2.1 molecules.
There is a well-established positive correlation between the immunogenicity of an epitope and its ability to form a stabile MHCI/peptide complex [313]. Therefore, the halflives of the peptide/HLA-A2.1 complexes were determined by T2 complex stability assays. T2 cells were co-cultured with each peptide (20ug/ml) overnight and the A2 expression levels were determined at the indicated time points after peptide removal.
BFA was added to the media prior to peptide removal to ensure that the number of stable complexes could not be due to peptide reloading on egressing HLA-A2.1 molecules. The HPV16E7 82-90 peptide was included as a positive control. The results demonstrate that the HPV16E7 49-57(opt) peptide/HLA-A2.1 complexes and the
HPV16E7 82-90 peptide/HLA-A2.1 complexes have similar half-lives of approximately
4.5 hours while the native HPV16E7 49-57 peptide has a half-life of less then 2 hours
(Figure 5.5). Consequently, the native HPV16E7 49-57 epitope was not investigated further for immunogenicity in vivo. However, these results demonstrate that changing the amino acids found at the anchor positions of an epitope to hydrophobic leucines significantly increases the stability of the peptide/HLA-A2.1 complex.
Immunization of HHD mice with the HPV16E7 49-57(opt) peptide but not the DNA
epitope vaccine induced epitope-specific CTLs that were functional against epitope-
presenting targets in vitro.
After showing that the HPV16E7 49-57(opt) peptide bound to the HLA-A2.1
molecule and formed a stable complex, the immunogenicity of this potential epitope was
determined using HHD mice. HHD mice were immunized subcutaneously with a peptide
123 Figure 5.4. Dilution curve analysis of native HPV16E7 49-57 peptide. T2 cells were pulsed with various peptides over a range of peptide concentrations and the geometric means of A2 expression were detected by flow cytometry. HPV16 11-20 represents a positive control while media only is a negative control (p< 0.05, unpaired student’s t- test).
210 * HPV16E7 49-57 peptide HPV16E7 11-20 peptide 180 Media only
150 *
120
90
Geo Mean +/- SE * 60
30
0 20ug/ml 2ug/ml 200ng/ml 20ng/ml 2ng/ml 0.2ng/ml
Peptide Concentration
124 Figure 5.5. HLA-A2.1-peptide complex stability assay for HPV16E7 49-57 and HPV16E7 49-57(opt) peptides. The HPV16E7 82-90 peptide was included as a positive control. T2 cells were pulsed with individual peptides (20ug/ml) overnight. Recycling of HLA-A2.1 molecules was blocked with the addition of BFA for 1 hour. After 1 hour HLA- A2.1 egress was maintained by a lower concentration of BFA. At the indicated time points after initial washes, the HLA-A2.1/peptide complexes were labeled with BB7.2 through indirect immunofluorescence. Mean fluorescence was detected by flow cytometry
100 HPV16E7 82-90 HPV16E7 49-57(opt) HPV16E7 49-57
80
60
40
% of still complexes remaining 20
0 0123456
Time (hrs)
125 emulsion composed of the HPV16E7 49-57(opt) peptide, an HBV core helper peptide
included to augment the immune response by increased the helper T-cell response, and
incomplete Freund’s adjuvant. Mice were immunized two times at one-week intervals.
One week after the final booster, splenocytes were harvested and co-cultured with syngeneic dendritic cells (DCs) pulsed with the HPV16E7 49-57(opt) peptide. After two stimulations, the frequency of tetramer-positive CD8-positive T cells was determined. T
lymphocytes staining positive for CD8 and the HPV16E7 49-57(opt) tetramer were
observed in the stimulated cultures from the HHD mice immunized with this same
peptide and only background levels of staining were observed for the control tetramer
(Figure 5.6). However, tetramer staining does not measure T cell function. Therefore,
interferon-gamma (IFN-g) intracellular cytokine staining (ICS) experiments were
performed to determine if these tetramer-positive CTLs were active against targets
presenting the optimized sequence peptide or the native sequence peptide. Targets
presenting the native epitope sequence were included in this study since this is the
sequence that would be naturally found in the HPV16 E7 protein and therefore would be
presented by HPV16 infected cells. Bulk CTLs were co-cultured with the HPV16E7 49-
57(opt) peptide, the native HPV16E7 49-57 peptide, or an irrelevant peptide for 4 hours
and subsequently stained for CD8 surface expression and IFN-g production. The CTLs
from the HHD mice immunized with the HPV16E7 49-57(opt) peptide and co-cultured
with this same peptide produced IFN-g in response to targets presenting this peptide but
only background levels of IFN-g were observed for the CTLs co-cultured with the
negative control peptide (Figure 5.7). However, no detectable level of IFN-g was
produced over background levels in response to targets presenting the native HPV16E7
49-57 peptide (Figure 5.8). These data demonstrate that immunization with the
sequence optimized peptide stimulates CTLs that can recognize the optimized but not
the native epitope in the context of the HLA-A2.1 molecule.
126 Figure 5.6. Tetramer-binding assay for cultured T lymphocytes from HHD mice vaccinated with the HPV16E7 49-57(opt) peptide. Splenocytes were isolated from peptide vaccinated mice, stimulated 2 times in vitro, and stained with FITC conjugated anti mouse CD8 and PE conjugated HLA-A2.1/HPV16E7 49-57(opt) tetramer. The percentage of the cultured T-lymphocytes that were dually labeled is indicated in the top right-hand corner of the graphs.
HPV16E7 49-57(opt) tetramer Control tetramer
3.23% 0.39%
Tetramer-PE Tetramer-PE
CD8-FITC
127 Figure 5.7. IFN-g ICS assay for cultured T lymphocytes isolated from HHD mice vaccinated with the HPV16E7 49-57(opt) peptide. Harvested splenocytes from mice vaccinated with HPV16E7 49-57(opt) peptide stimulated 2 times in vitro with this same peptide, and stimulated for 4 hours at 37°C with HPV16E7 49-57(opt) peptide or control peptides. All cultures were stained with FITC conjugated anti mouse CD8 and PE conjugated anti mouse IFN-g. The percentage of cells labeled with both antibodies is indicated in the top right-hand corner of the graphs.
HPV16E7 49-57(opt) peptide Control peptide
8.99% 2.42%
IFN-gamma-PE
CD8-FITC
128 Figure 5.8. IFN-g ICS assay for cultured T lymphocytes isolated from HHD mice vaccinated with the HPV16E7 49-57(opt) peptide. Harvested splenocytes from mice vaccinated with HPV16E7 49-57(opt) peptide stimulated 2 times in vitro with this same peptide, and stimulated for 4 hours at 37°C with the native HPV16E7 49-57 peptide or control peptide. All cultures were stained with FITC conjugated anti mouse CD8 and PE conjugated anti mouse IFN-g. The percentage of cells labeled with both antibodies is indicated in the top right-hand corner of the graphs.
HPV16E7 49-57 native peptide Control peptide
0.41% 0.27% IFN-g-PE
CD8-Fitc
129 DNA vaccines delivered by gene gun mediated intracutaneous DNA vaccination stimulate a potent immune response in the mouse [228], and protective cell-mediated immune responses in both the CRPV rabbit model and the CRPV/HLA-A2.1 transgenic rabbit models [314], [216], [223], [305]. Consequently, the cell mediated immune response generated by the epitope vaccine HPV16E7/49-57(opt) was examined in HHD mice. Mice were immunized using the same schedule for peptide immunizations. One week following the booster, spleens were harvested and co-cultured with syngeneic dendritic cells (DCs) pulsed with the HPV16E7 49-57(opt) peptide. Following two stimulations with the HPV16E7 49-57(opt) peptide, an IFN-g ICS was performed to examine CTL functionality. However, no detectable level of IFN-g over background was produced by CTLs incubated with the HPV16E7 49-57(opt) peptide or a negative control peptide (Figure 5.9).
A modified CRPV DNA genome produced papillomas in New Zealand White rabbits
Our laboratory has performed numerous PCR based site-directed modifications on the CRPV genome without loss of functional viability [215]. To create the
CRPV/E7ins49-57(opt) genome in which the HPV16E7 49-57(opt) epitope was inserted into the E7 gene, site-directed PCR mutagenesis was employed. Following genome alteration, the new CRPV construct was assayed for its ability to produce papillomas.
Two New Zealand White rabbits were challenged with 10ug/site of wild type CRPV DNA or the new modified CRPV genome DNA and growth of papillomas was measured in the following weeks. Papilloma formation was considered a positive functional readout for the viability of the new CRPV/E7ins49-57(opt) genome. Papillomas appeared on the backs of rabbits 3 weeks after challenge with CRPV/E7ins49-57(opt) genome and these papillomas grew at a rate similar to that papillomas induced by wild type CRPV DNA
(Figure 5.10).
130 Figure 5.9. IFN-g ICS assay for cultured T lymphocytes isolated from HHD mice vaccinated with the HPV16E7/49-57(opt) DNA vaccine. Harvested splenocytes from mice vaccinated with HPV16E7/49-57(opt) DNA vaccine, stimulated 2 times in vitro with the HPV16E7 49-57(opt) peptide, and cultured for 4 hours at 37°C with the same peptide or control peptide were subjected to an IFN-g ICS assay. All cultures were stained with FITC conjugated anti mouse CD8 and PE conjugated anti mouse IFN-g. The percentage of cells labeled with both antibodies is indicated in the top right-hand corner of the graphs.
HPV16E7 49-57(opt) peptide Control peptide 0.30% 0.30% IFN-gamma-PE
CD8-Fitic
131 Figure 5.10. A modified CRPV genome forms papillomas on the backs of New Zealand White rabbits. Papilloma GMDs from New Zealand White rabbits challenged with CRPV/E7ins49-57(opt) DNA and wild type CRPV DNA.
14 CRPV/E7ins49-57(opt) wild type CRPV 12
10
8 - SE) GMDs by in mm
6
4
2
0 Papilloma Size (Mean +/ Size Papilloma
Wk3 Wk4 Wk5 Wk6 Wk7 Wk8 Wk9
Weeks after challenge with DNA
132 DNA vaccination provided eptope-specific partial protection against challenge with the modified CRPV genome containing the HPV16E7 49-57(opt) epitope inserted in the E7 gene
To evaluate the protective immunity generated to the HPV16E7 49-57(opt) epitope, HLA-A2.1 transgenic (N = 4) and non-transgenic control (N = 3) rabbits were vaccinated three times with the HPV16E7/49-57(opt) epitope vaccine or control vaccine three times at three-week intervals. The animals were subsequently challenged at two sites with wild type CRPV DNA and at six sites with CRPV/E7ins49-57(opt) DNA one week following the final booster. No statistically significant difference was observed in protection rates between the HLA-A2.1 transgenic rabbits and control rabbits immunized with the HPV16E7/49-57 (opt) epitope vaccine or control vaccine, respectively (Tables
5.1 and 5.2). However, a statistically significant reduction in the mean papilloma size on the HLA-A2.1 transgenic rabbits receiving the epitope vaccine and challenged with the modified CRPV genome was observed (Figure 5.11). The mean papilloma size of the epitope vaccinated HLA-A2.1 transgenic rabbits challenged with wild type CRPV declined starting at week 5, however there was no statistically significant difference between the two rabbit groups until week 9 (Figure 5.12).
133 Table 5.1 Tumor protection in outbred New Zealand White rabbits challenged with CRPV DNA containing the HPV16E7 49-57(opt) epitope inserted in the E7 gene after three immunizations with either the HPV16E7/49-57(opt) epitope vaccine or the control DNA vaccine.
Rabbits Vaccine Challenged Sites Protection Ratea (%) 1 HLA-A2.1 (N = 4) E7 Epitope 24 16/24 (67%)b,c,d 2 Control (N = 3) E7 Epitope 18 0/18 (0%) 3 HLA-A2.1 (N = 3) Vector 18 11/18 (61%) 4 Control (N = 3) Vector 18 8/18 (44%) a Protection rate, papilloma-free sites/challenge sites (six sites/each construct/each rabbit); bp = 0.001, cp = 1, dp = 0.60 vs group 2, group 3, and group 4, respectively, Fisher’s exact test.
134 Table 5.2. Tumor protection in outbred New Zealand White rabbits challenged with wild type CRPV DNA after three immunizations with either the HPV16E7/49-57(opt) epitope vaccine or the control DNA vaccine.
Rabbits Vaccine Challenged Sites Protection Ratea (%) 1 HLA-A2.1 (N = 4) E7 Epitope 8 4/8 (50%)b,c,d 2 Control (N = 3) E7 Epitope 6 0/6 (0%) 3 HLA-A2.1 (N = 3) Vector 6 2/6 (33%) 4 Control (N = 3) Vector 6 2/6 (33%) a Protection rate, papilloma-free sites/challenge sites (six sites/each construct/each rabbit); bp = 0.25, cp = 1, dp = 0.1 vs group 2, group 3, and group 4, respectively, Fisher’s exact test.
135 Figure 5.11. Papilloma outgrowth in epitope DNA vaccinated outbred HLA-A2.1 transgenic rabbits and control rabbits after viral DNA challenge. HLA-A2.1 transgenic rabbits immunized three times with the HPV16E7/49-57(opt) epitope vaccine were challenged with CRPV/E7ins49-57(opt) DNA. Significantly smaller papillomas were found on HLA-A2.1 transgenic rabbits immunized with the E7 epitope vaccine and challenged with the epitope-modified CRPV DNA construct (p< 0.05, unpaired student’s t-test).
14 HLA-A2.1 + HPV16E7/49-57(opt) epitope vaccine Control + HPV16E7/49-57(opt) epitope vaccine 12
10 * 8 * * * 6 *
4
2
Papilloma Size (Mean +/-SE) by GMDs in mm 0
Wk3 Wk4 Wk5 Wk6 Wk7 Wk8 Wk9
Weeks after challenge with CRPV/E7ins49-57(opt) DNA
136 Figure 5.12. Papilloma outgrowth in epitope DNA vaccinated outbred HLA-A2.1 transgenic rabbits and control rabbits after viral DNA challenge. HLA-A2.1 transgenic rabbits immunized three times with the HPV16E7/49-57(opt) epitope vaccine were challenged with wild type CRPV DNA. No statistically significant difference was seen between the two rabbit groups until the final week of the experiment (p< 0.05, unpaired student’s t-test).
14 HLA-A2.1 + HPV16E7/49-57(opt) epitope vaccine Control + HPV16E7/49-57(opt) epitope vaccine 12 *
10
8
6
4
2
0 Papilloma Size (Mean +/- SE) by GMDs in mm by GMDs in SE) (Mean +/- Size Papilloma
Wk3 Wk4 Wk5 Wk6 Wk7 Wk8 Wk9
Weeks after challenge with wild type CRPV DNA
137 Discussion
The focus of this study was to use epitope prediction software to identify new
HLA-A2.1 restricted HPV16E7 epitopes and characterize the immunogenicity and the
protective immunity generated to the epitopes in vivo using multiple HPV preclinical animal models as a proof of concept. Our collaborators used a predictive algorithm that identifies epitopes that bind weakly to HLA-A2.1 molecules and are therefore typically missed by algorithms that predict strong binders of the HLA-A2.1 molecule. The predictive algorithm computes the HLA-A2.1 binding properties of peptides based on the interdependence of all the amino acid within the peptide sequence [304]. From the epitopes identified we chose to investigate the HPV16E7 49-57 epitope as well as the epitope variant HPV16E7 49-57(opt) that contained leucines at anchor positions 2 and 9, based on the predicted scores of each epitope. In vitro experiments were carried out to
determine if the epitopes bound to the HLA-A2.1 molecules and formed stable
complexes. We next used the HHD mouse model to examine the immunogenicity of the
new epitope while the CRPV/HLA-A2.1 transgenic rabbit model was utilized to determine
the vaccine induced epitope-specific protective immunity generated to the epitope in the
context of a natural PV infection.
The initial in vitro binding experiments carried out with the HPV16E7 49-57 peptide and the HPV16E7 49-57(opt) peptide confirmed that the native sequence epitope bound weakly to the HLA-A2.1 molecule and did not form a stable complex with the HLA-A2.1 molecule while the optimized sequence epitope was a strong binder and did form a stable complex with the HLA-A2.1 molecules. The immunogencity of both epitopes was evaluated in HHD mice. HHD mice serve as a screening tool for HLA-A2.1 restricted epitopes as the entire CD8+ T cell repertoire can only respond to HLA-A2.1
presentation of antigen [225]. Additionally, previous studies have utilized this model to
identify HLA-A2.1-restricted HPV16 E6 and E7 epitopes [235]. Another benefit of this
138 model is that there are a large number of diganostic reagents that are available for qualitative and quantitative readouts of CTL responses. Peptide vaccination of HHD mice with the native HPV16 E7 49-57 epitope did not provoke a measurable CTL
response as a CD8+ T cell population did not expand in culture during multiple rounds of
in vitro expansion (unpublished data). This result was not surprising due to the short half-life of the HPV16E7 49-57/HLA-A2.1 complex, and the strong correlation between a peptide’s binding affinity for MHC I molecules and its immunogenicity [315]. Previous studies report that immunization with sequence variant peptides can provoke and improve CTL responses to the native sequence epitope [304], [236]. Experiments were carried out to determine if CTLs induced by immunization of HHD mice with the
HPV16E7 49-57(opt) peptide could recognize targets presenting the native sequence.
However, there was no measurable cross-recognition.
The HHD mouse studies clearly demonstrate that CTLs specific for the HPV16E7
49-57 (opt) epitope do not recognize targets presenting the native epitope. Therefore, the optimized epitope would not be included in an HPV vaccine. However, to evaluate the symmetry between in vitro induction versus in vivo protection, protective vaccination studies were carried out. HHD mice serve as a great screening tool for HLA-A2.1 restricted epitopes, but there are no known papillomaviruses that infect these small laboratory rodents. Therefore, a second animal model that is a natural host for papillomavirus infection was used. The CRPV/HLA-A2.1 transgenic rabbit model, which expresses an HLA-A2.1 transgene, was used to test the protection provided through vaccination with the HPV16E7 49-57(opt) epitope [222], [223].
Previous studies have demonstrated that gene gun mediated DNA vaccination of
HLA-A2.1 transgenic rabbits induces cell-mediated immune responses that are protective against CRPV DNA challenge [222], [305]. Additionally, the CRPV genome has an area of plasticity located at the end of the E7 gene that is amenable to PCR-
139 based modification without loss of genome viability (Chapter III). Therefore, protective
DNA vaccination studies were carried out in the HLA-A2.1 transgenic rabbits followed by
challenge with an epitope modifed CRPV genome that contained the HPV16E7 49-
57(opt) epitope inserted at the end of the E7 gene. The HLA-A2.1 transgenic rabits
receiving the HPV16E7 49-57(opt) epitope vaccine were partially protected against challenge with the CRPV/E7ins 49-57(opt) genome. These studies show that there is a positive correlation between in vitro induction and in vivo protection. However, the
magnitude of the in vitro response is not necessarily an accurate predictor of complete protection. Consequently, there remains a need for animal models in which protective and therapeutic vaccines can be assessed.
In summary, we used bioinformatics to identify a new HPV16 E7 epitope that bound weakly to the HLA-A2.1 molecule and subsequently identified sequence optimizations that could increase the epitope’s binding affinity for the HLA-A2.1 molecule. In vitro binding experiments demonstrated that the native HPV16E7 49-57 bound weakly to the HLA-A2.1 molecule and did not form a stable peptide/MHCI complex with this HLA allele. In contrast, the sequence-optimized version formed a stable complex with the HLA-A2.1 molecule. The immunogenicity of both epitopes was assesed in the HHD mouse model revealing that the HPV16E7 49-57(opt) epitope was immunogenic but did not recognize targets presenting the native epitope. However, to compare the responses induced in vitro to the protection provided in vivo with the
HPV16E7 49-57(opt) epitope, protective DNA vaccination studies were carried out in the
CRPV/HLA-A2.1 transgenic rabbit model. Collectively, these data demonstrate that a combinatorial approach to identify and characterize new HLA-A2.1-restricted HPV16 E7 epitopes using multiple preclinical animal models is a fast and efficient approach.
140 Acknowledgments
This work was supported by the Public Health Service, National Cancer Institute Grant
R01 CA47622 from the National Institutes of Health and by the Jake Gittlen Memorial
Golf Tournament.
141
Chapter VI
Identification and Characterization of the Vaccine Generated Cellular Immune Responses to Computer-Predicted and Known HPV16E7 HLA-A2.1 Restricted Epitopes In Vivo
142 Abstract
Our laboratory is interested in identifying and characterizing CD8+ T cells responses induced by HLA-A2.1 restricted epitopes against HPV infections and HPV- related diseases. These epitopes could serve as potential vaccine candidates in second generation protective vaccines and therapeutic vaccines. We used multiple resources including two epitope prediction programs, BIMAS and SYFPEITHI, as well as literature searches to identify new HLA-A2.1 restricted HPV16 E7 epitopes for testing. Six new epitopes and two epitopes used in previous studies were chosen for further evaluation.
In vitro experiments were carried out to confirm that each potential vaccine epitope
bound HLA-A2.1 molecules and formed a stable complex. Five new epitopes bound the
HLA-A2.1 molecule strongly and formed stable complexes while one epitope was a
weak binder. We next immunized HLA-A2.1 transgenic mice (HHD) with peptides or
DNA to determine the in vivo immunogenicity of the five strong binders. Four of the new
HLA-A2-restricted HPV16 E7 epitopes stimulated epitope-specific CTLs in the HHD mice
after peptide vaccination and were considered potential epitopes for continued testing.
The vaccine-induced epitope-specific protective immune responses generated to these
epitopes in a model of natural papillomavirus infection were evaluated using the
CRPV/HLA-A2.1 transgenic rabbit model. HLA-A2.1transgenic rabbits were gene gun
vaccinated with individual DNA epitope vaccines followed by challenge with epitope-
modified CRPV genomes containing potential epitopes embedded in the E6 or E7
genes. Two methods, substitution and insertion, were employed to embed the epitope
targets within the E7 or E6 genes of the CRPV genome. Modified CRPV genomes
capabale of inducing papillomas of the back of challenged rabbits were then used in
protection studies to examine the vaccine generated epitope-specific immune responses
to each vaccine candidate. However, all protective studies carried out did not deliver
143 definitive results about epitope-specific immunity. Therefore, additional strategies and new locations must be identified for embedding epitopes within the CRPV genome.
144 Introduction
Human Papillomaviruses (HPVs) are tumor-causing viruses that infect mucosal and cutaneous epithelia. Currently over 100 different HPV types have been identified
[2]. Those HPV types that infect mucosal sites are further subdivided into “high risk” and
“low risk” types based on their tendency to progress to cervical cancer [4].
Epidemiological data [316] as well as functional in vitro studies of papillomavirus
oncogenes [298] have established that persistent HPV infections with “high risk” types
are the cause of over 99% of all cervical cancer cases [15]. In addition, infection with
“low risk” types can result in benign genital warts. Treatment options for control and/or
eradication of established HPV infections are limited, not always effective in eliminating
the infection, and do not prevent recurrence [317], [318], [319]. Moreover, although VLP
based vaccines do offer protection against some of the most common “high” and “low
risk” types, these vaccines offer no therapy against established HPV disease [362].
Consequently, new therapies and additional treatment options remain a high priority.
Numerous studies in animal models of natural infection show that a cell-mediated
immune response is necessary for eradication of established PV disease [102], [93].
Therapeutic DNA vaccination with COPV early genes significantly reduced wart number
and size in COPV challenged beagles demonstrating that a CMI response is crucial for
wart regression. Additionally, vaccine-induced CMI responses to the E7 gene of CRPV
have been implicated in delaying the development of cancer in CRPV challenged rabbits
[218], further inplicating a CMI response in controlling PV-induced disease. DNA
vaccination of the CRPV rabbit model induces CMI responses to CRPV proteins E1, E2,
E6, E7, E8 and L1 [292], [347], [364], [365] and these responses protect against CRPV
disease.
Recent establishment of the CRPV/HLA-A2.1 transgenic rabbit model provided
an additional resource to study the protective CMI responses generated to a well-known
145 HPV16E7 epitope [222] and computer-predicted HLA-A2.1 restricted epitopes [303].
Both studies demonstrated that the vaccine-induced CMI response is protective in vivo.
However, their remains a need for additional targets that induce CMI responses that can
be protective and/or therapeutic against HPV disease. Our laboratory demonstrated that
the use of bioinformatics to identify new HLA-A2.1 restricted targets is fast and effective
[303]. Additionally, the use of both the HHD mouse model and the CRPV/HLA-A2.1
transgenic rabbit model to characterize the in vivo immunogenicity as well as the
protective CMI responses induced during a natural PV infection, respectively, overcomes
some of the inherent limitations of each individual animal model.
In the following studies, we used bioinformatics as well as a review of the
literature to discover potential HLA-A2.1 restricted HPV16E7 epitopes. In vitro assays
examined the epitope binding to and the stability of the epitope/HLA-A2.1 complex.
Epitopes that bound the HLA-A2.1 molecule and formed a stable complex were further
examined for their immunogenicity in vivo. HHD mice were immunized with potential epitopes and interferon-gamma intracellular cytokine staining assays were performed.
Epitopes that were immunogenic were then embedded in the CRPV E7 or the CRPV E6 gene using two different epitope-relocation strategies. Viable epitope-modified CRPV constructs were then used in protection studies to examine the epitope-specific immunity generated in a natural PV infection. These studies provide additional information about epitope relocation within the CRPV genome and identify a potential epitope candidate for inclusion in protective and/or therapeutic vaccines.
146 Materials and Methods
Bioinformatics and Peptide Synthesis
Two open access epitope prediction programs were used to identify potential
HPV16 E7 HLA-A2.1 restricted epitopes. Briefly, the full amino acid sequence of HPV16
E7 was scanned for HLA-A2.1 restricted 9mers and 10mers. The Parker [320] and
Rammensee [321] peptide binding scores were used to identify potential epitope candidates. All peptides were produced through 9-fluroenylmethoxycarbonyl chemistry using an automated peptide synthesizer (9050 MilliGen PepSynthesizer) in the macromolecular synthesis core at the Penn State University College of Medicine.
Peptides were verified for correct sequence by mass spectroscopy and stored at -20C as lyophilized powder. Prior to use, peptides were solubilized in DMSO and diluted to the appropriate concentration in sterile 1X PBS for use in vaccination of HHD mice or in
1640 RPMI complete media for use in cell culture.
Antibodies, Tetramer Synthesis, and Flow Cytometry
Antibodies directed against mouse CD8 were FITC-conjugated while antibodies
against mouse IFN-g were PE-conjugated (Biolegend, San Diego, CA). A specific anti-
HLA-A2.1 monoclonal antibody, BB7.2 (ATCC), and a PE-conjugated goat anti mouse
IgG (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA) were also used.
PE-conjugated HLA-A2.1 tetramers were synthesized at the NIH tetramer core facility.
All stained cells were analyzed on a FACSCalibur (Becton Dickinson) or a FACScan
(Becton Dickinson) flow cytometer and analyzed using CellQuest software.
HLA-A2.1-peptide Binding Assay
The HLA-A2.1-peptide binding assay was conducted using T2 (a human HLA-
A2.1 positive TAP deficient cell line) cells as described by [305] with a few
147 modifications. Briefly, all naturally bound peptides were chemically stripped from the
HLA-A2.1 molecules of the T2 cells by incubating the cells for 60s in ice-cold citric acid buffer, pH 3.1 (1:1 mixture of 0.263M citric acid buffer and 0.123M Na2HPO4). Cells were immediately buffered in complete DMEM (containing 10% heat inactivated fetal bovine serum (FBS), sodium bicarbonate, HEPES, non-essential amino acids, L-glutamine (2mM), sodium pyruvate (1mM), penicillin (100U/ml) and streptomycin (100ug/ml)) medium followed by two additional washes with this media.
Cells were re-suspended in complete DMEM containing 2ug/ml beta-2-microglobulin
(Sigma-Aldrich) and 1ug/ml brefeldin A (BFA) (Sigma-Aldrich). The T2 cells were mixed with each individual peptide at a concentration of 20ug/ml and plated in triplicate at a concentration of 3 x 104 cells/well in 96-well U-bottomed plates. Plates were incubated
at 37°C for 3.5 hours. Cells were washed two times in PBS containing 2% FBS. Cells
were incubated for 1 hour with the BB7.2 antibody followed by two washes. Cells were
then stained with the PE-conjugated goat anti mouse IgG (1:50) for 30 minutes. After
washing two times, cells were fixed in PBS containing 2% paraformaldehyde and
subjected to flow cytometric analysis.
HLA-A2.1 Stability Assay
T2 stability assay was performed as described [306] with some modifications. T2 cells were chemically stripped of naturally bound peptides as described above. T2 cells were re-suspended in serum free RPMI 1640 (Gibco) (10mM HEPES, 2mM L-glutamine,
1mM sodium pyruvate, 100U/ml penicillin, 100ug/ml streptomycin and 50uM 2-ME) medium containing 2ug/ml beta2-microglobulin. T2 cells were mixed with individual peptides at a concentration of 20ug/ml, seeded at a density of 3 x 105 cells/well in 96- well U-bottomed plates in triplicate and incubated overnight at 37°C. Cultured cells were washed one time with PBS containing 2% FBS and incubated for 1 hour at 37°C in RPMI
148 1640 complete media (containing 10% FBS) and 10ug/ml BFA to block the egress of
new MHCI molecules. Cells were subsequently incubated at 37°C in RPMI 1640
complete media containing 0.5ug/ml BFA to maintain the MHCI block. At indicated time
points cells were washed three times and incubated with BB7.2 for 45 minutes followed
by staining with PE-conjugated goat anti mouse IgG (1:100) for 45 minutes. All antibodies and wash medium contained 0.5ug/ml BFA. Cells were fixed in PBS containing 2% paraformaldehyde and subjected to flow cytometric analysis.
Animals
HHD mice are a double knockout for mouse beta-2-microglobulin and the mouse
H-2Db molecule. These mice express a chimeric HLA-A2.1 molecule composed of the cytosolic, transmembrane and α3 domains of H-2Db molecule and the α1 and α2
domains of the HLA-A*0201 molecule covalently linked to the human β2m light chain
[225]. These HHD mice and the HLA-A2.1 transgenic outbred rabbits were bred and maintained in the Pennsylvania State University College of Medicine animal facility.
Non-transgenic outbred rabbits were purchased from Covance Research Products, Inc.
All animal studies, care, and handling procedures were performed under protocols approved by the Institutional Animal Care and Use Committee.
HLA-A2.1 transgenic mice vaccination
Six to eight week old HHD mice were vaccinated two times at one week intervals subcutaneously at the base of the tail with peptide emulsions. These emulsions were composed of 100ug of the specified peptide, 160ug of the HBV core helper peptide (aa
128-140) and 100ul of incomplete Freund’s adjuvant as described by [307]. One week following the booster, immunized mice were sacrificed and their spleens harvested. For gene gun mediated DNA vaccination, the shaved abdominal regions of sedated HHD
149 mice were barraged with DNA-coated gold particles at a rate of 400lb/in2 by a helium driven gene gun [228]. Each mouse received a vaccine dose of 5ug at each immunization. Gene gun vaccination followed the same schedule as peptide vaccinations.
Cell Culture
Single cell suspensions of harvested splenocytes were co-cultured with syngeneic bone marrow-derived DCs. DCs were pulsed with peptide (20ng/ml) for 1 hour at 37°C, irradiated with 10Krads using a 60Co-source GammaCell irradiator (MDS
Nordion), washed 2X times with 1X PBS, and re-suspended in complete RPMI 1640 media. Recombinant human IL-2 (R&D Systems, Minneapolis, MN) was added to the splenocyte co-cultures at a dose of 20U/ml during the first stimulation. One week later the T lymphocyte cultures were stimulated again with peptide pulsed DCs as described above and 10U/ml of rh-IL2 was added to each culture.
Dendritic Cell Isolation and Culture
DC’s were isolated from the bone marrow and maintained in culture with GM-
CSF-containing supernatant from X-63GM.1 cells [308] as described by [309]. Briefly, femurs of HHDII mice were removed and bone marrow was isolated with RPMI 1640 media. The bone marrow derived cells were seeded at a density of 4 x 106 cells/dish in
100mm Petri dishes containing 10 milliliters (mls) of complete RPMI 1640 medium supplemented with 10% X-63GM.1 supernatant. On day 3, 10 mls of this same media was added to the cultures. On days 6 and 8, 10 mls of supernatant was removed from each Petri dish, cells pelleted by centrifugation, and re-suspended in 10 mls of fresh media which was added back to the original dish. On day 11, the cells were harvested,
150 frozen in CTL freezing media composed of 90% FBS and 10% dimethyl sulfoxide
(DMSO), and stored at −80°C until use.
Tetramer Staining Assay
Four days after the second stimulation, cultured T lymphocytes were tested for
epitope specificity using the tetramer-binding assay. T lymphocytes were stained with
FITC labeled anti mouse CD8 (1:50) for 1 hour followed by two washes with 1X PBS
containing 2% FBS. Cells were then stained with PE labeled HLA-A2.1 tetramers
loaded with the specified peptide or an unrelated control peptide. Two-color flow
cytometry was performed and dual labeled cells represented the effector CTL
population.
Intracellular Cytokine Staining Assay
Four days following the second stimulation, the cultured T lymphocytes were tested for IFN-g production by intracellular cytokine staining (ICS). T lymphocytes were stimulated with 20ng/ml of the indicated peptides or an unrelated HLA-A2.1-binding peptide in the presence of BFA (1ug/ml) for 4 hours at 37°C. Cells were stained with
FITC conjugated anti mouse CD8 (1:50) for 30 minutes and PE-conjugated anti mouse
IFN-g (1:50) for 30 minutes using the Cytofix/Cytoperm kit (BD Biosciences) as described by the manufacturer. Cells were fixed with PBS containing 2% paraformaldehyde and subjected to flow cytometry. Two-color-labeled cells represented the effector CTL population with the potential to eliminate infected cells.
DNA Vaccines
The HPV16E7/82-90 DNA vaccine was designed as described by [303]. The
HPV16E7/49-57(opt) DNA vaccine design is illustrated in figure 5.1. The HPV16E7/11-
151 19 epitope DNA vaccine was designed with 5 repeats of the single epitope separated by
alanine-alanine-tyrosine (AAY) spacers [312], [370]. A Kozak sequence was included at
the N-terminus, followed by a universal tetanus toxoid (TT) T-helper motif [369], and a
ubiquitin motif at the C-terminus. The control vaccines was designated pCXUb and was
made as described in Chapter III. The plasmid concentration of the DNA vaccines was
adjusted to 1ug/ml in 1X TE followed by DNA precipitation onto 1.6um-diamter gold
particles at a ratio of 1ug of DNA/0.5mg of gold particles as described by the
manufacturer (Bio-Rad, Hercules, California)
Viral DNA Challenge Constructs
H.CRPV cloned into the pUC19 vector at the SalI site was used as wild type
CRPV [310]. Using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla,
CA) according to the manufacturer, the CRPV E7 gene cloned into the pUC19 vector as
described by [215] was modified to create all modified CRPV E7 genes by substitution or
insertion. Numerous epitopes including HPV16E7 11-20, 85-93(opt), and 49-57(opt)
were substituted into the CRPV E7 gene. The CRPV E7 subclone was subjected to
multiple rounds of mutagenic PCR to create each new CRPV E7 gene. Primer pairs for
each successive site-directed mutagenic PCR the position of the substitution can be
found in tables 6.1, 6.2, and 6.3, respectively. This method allowed for incremental
changes of the CRPV E7 gene. Each modified CRPV E7 gene was confirmed by DNA
sequencing and then cloned into the H.CRPV genome between the EcorI and ClaI sites creating the CRPV/E7sub11-20, CRPV/E7sub85-93(opt), and CRPV/E7sub49-57(opt) genomes. The new CRPV genomes were confirmed by DNA sequencing. To create the
CRPV/E7ins11-19 genome and the CRPV/E7ins11-20 genome, the CRPV E7 subclone was subjected to a single round of site-directed mutagenesis PCR to insert the
152 Table 6.1. Primer sequences used to substitute the HPV16E7 11-20 epitope into the CRPV E7 gene between nucleotides 33 and 60 of the CRPV E7 gene. Primer sequences are listed in pairs with the forward primer first followed by the reverse compliment primer sequence. Sequences in bold represent single nucleotide changes.
Primer Sequence E7A-11 5’-GTG-AGC-TGG-TTC-TAG-ATG-AAA-ATG-CTG-AAG-CGC-TTA-GTC-TGC-3’ E7B-11 5’-GCA-GAC-TAA-GCG-CTT-CAG-CAT-TTT-CAT-CTA-GAA-CCA-GCT-CAC-3’ E7C-11 5’-GTG-AGC-TGG-TTC-TAG-ATC-AAC-ATG-CTG-AAG-CGC-TTA-GTC-TGC-3’ E7D-11 5’-GCA-GAC-TAA-GCG-CTT-CAG-CAT-GTT-GAT-CTA-GAA-CCA-GCT-CAC-3’ E7E-11 5’-GTG-AGC-TGG-TTC-TAG-ATC-TAC-AAG-CTG-AAG-CGC-TTA-GTC-TGC-3’ E7F-11 5’-GCA-GAC-TAA-GCG-CTT-CAG-CTT-GTA-GAT-CTA-GAA-CCA-GCT-CAC-3’ E7G-11 5’-GTG-AGC-TGG-TTC-TAG-ATC-TGC-AAC-CTG-AAG-CGC-TTA-GTC-TGC-3’ E7H-11 5’-GCA-GAC-TAA-GCG-CTT-CAG-GTT-GCA-GAT-CTA-GAA-CCA-GCT-CAC-3’ E7I-11 5’-CTA-AGC-TTA-GTG-AGT-TGA-TTC-TAG-ATC-TGC-AAC-CTG-AAG-CCC-TTA- GTC-TGC-ATT-GCG-AC-3’ E7J-11 5’-GTC-GCA-ATG-CAG-ACT-AAG-GGC-TTC-AGG-TTG-CAG-ATC-TAG-AAT-CAA- CTC-ACT-AAG-CTT-AG-3’ E7K-11 5’-CTA-AGC-TTA-GTG-AGT-TCA-TGC-TAG-ATC-TGC-AAC-CTG-AAG-CCA-TTA- GTC-TGC-ATT-GCG-AC-3’ E7L-11 5’-GTC-GCA-ATG-CAG-ACT-AAT-GGC-TTC-AGG-TTG-CAG-ATC-TAG-CAT-GAA- CTC-ACT-AAG-CTT-AG-3’ E7M-11 5’-CTA-AGC-TTA-GTG-AGT-ACA-TGC-TAG-ATC-TGC-AAC-CTG-AAA-CCA-CTA- GTC-TGC-ATT-GCG-AC-3’ E7N-11 5’-GTC-GCA-ATG-CAG-ACT-AGT-GGT-TTC-AGG-TTG-CAG-ATC-TAG-CAT-GTA- CTC-ACT-AAG-CTT-AG-3’
153 Table 6.2. Primer sequences used to substitute the HPV16E7 85-93(opt) epitope into the CRPV E7 gene between nucleotides 247 and 273 of the CRPV E7 gene. Primer sequences are listed in pairs with the forward primer first followed by the reverse compliment primer sequence. Sequences in bold represent single nucleotide changes.
Primer Sequence E7A-85 5’-TTG-AAT-CGA-CTG-CTA-TCC-GGA-TCG-CTT-TGC-CTC-GTG-TGC-CCG- (opt) GAG-TGT-TGT-AAC-3’ E7B-85 5’-GTT-ACA-ACA-CTC-CGG-GCA-CAC-GAG-GCA-AAG-CGA-TCC-GGA-TAG- (opt) CAG-GCG-ATT-CAA-3’ E7C-85 5’-TTG-AAT-CGA-CTG-CTA-TCC-GGA-TTG-CTT-TGC-ATC-GTG-TGC-CCG- (opt) GAG-TGT-TGT-AAC-3’ E7D-85 5’-GTT-ACA-ACA-CTC-CGG-GCA-CAC-GAT-GCA-AAG-CAA-TCC-GGA-TAG- (opt) CAG-TCG-ATT-CAA-3’ E7E-85 5’-TTG-AAT-CGA-CTG-CTA-TCC-GGA-TTG-CTT-GGC-ATC-GTG-TGC-CCG- (opt) GTG-TGT-TGT-AAC -3’ E7F-85 5’-GTT-ACA-ACA-CAC-CGG-GCA-CAC-GAT-GCC-AAG-CAA-TCC-GGA-TAG- (opt) CAG-TCG-ATT-CAA-3’
154 Table 6.3. Primer sequences used to substitute the HPV16E7 49-57(opt) epitope into the CRPV E7 gene between nucleotides 235 and 261 of the CRPV E7 gene. Primer sequences are listed in pairs with the forward primer first followed by the reverse compliment primer sequence. Sequences in bold represent single nucleotide changes.
Primer Sequence E7A-49 5’-ATA-AGA-ACC-TTG-AAT-CGA-CTG-CAA-TCC-ACA-TTG-CTT-TCC-CTG-TCC- (opt) CTG-GTG-TGC-CCG-3” E7B-49 5’-CGG-GCA-CAC-CAG-GGA-CAG-GGA-AAG-CAA-TGT-GGA-TTG-CAG-TCG-ATT- (opt) CAA-GGT-TCT-TAT-3’ E7C-49 5’-ATA-AGA-ACC-TTG-AAT-CGA-CTG-CAA-TCC-AAA-TTC-CTT-TTC-CTG-TCC- (opt) CTG-GTG-TGC-CCG-3’ E7D-49 5’-CGG-GCA-CAC-CAG-GGA-CAG-GAA-AAG-GAA-TTT-GGA-TTG-CAG-TCG-ATT- (opt) CAA-GGT-TCT-TAT-3’ E7E-49 5’-ATA-AGA-ACC-TTG-AAT-CGA-CTG-CAC-TCC-AAA-ATC-CTT-CTC-CTG-GTG- (opt) TGC-CCG-GAG-TGT-3’ E7F-49 5’-ACA-CTC-CGG-GCA-CAC-CAG-GAG-AAG-GAT-TTT-GGA-GTG-CAG-TCG-ATT- (opt) CAA-GGT-TCT-TAT-3’ E7G-49 5’-ATA-AGA-ACC-TTG-AAT-CGA-CTG-CAC-TAC-AAC-ATC-GTT-CTC-CTG-GTG- (opt) TGC-CCG-GAG-TGT-3’ E7H-49 5’-ACA-CTC-CGG-GCA-CAC-CAG-GAG-AAC-GAT-GTT-GTA-GTG-CAG-TCG-ATT- (opt) CAA-GGT-TCT-TAT-3’
155 HPV16E7 11-19 (YMLDLQPET) epitope or the HPV16E7 11-20 (YMLDLQPETT) epitope in frame into the CRPV E7 gene just upstream of the E7 stop codon. Primer sequences used for these single step mutagenesis can be found in table 6.4. Modified
CRPV E7 genes containing 9 additional amino acids at the carboxy-terminus were produced and confirmed by DNA sequencing. The modified CRPV E7 genes were then cloned into the H.CRPV construct between the EcoRI and ClaI sites creating the
CRPV/E7ins11-19 and CRPV/E7ins11-20 genomes.
Site directed mutagenesis PCR was also used to modify the CRPV E6 gene sequence. A subclone of the CRPV E6 gene was subjected to a single round of PCR mutagenesis to insert the HPV16E7 49-57(opt) epitope or the HPV16E7 82-90 epitope into the CRPV E6 gene in frame just upstream of the E6 stop codon. These two
HPV16E7 epitopes were also inserted into the CRPV E6 gene at base pair position 457.
Primer sequences used to create each new CRPV E6 gene can be found in tables 6.5 and 6.6, respectively. The sequence alterations of each modified CRPV E6 gene product were confirmed by DNA sequencing. The modified CRPV E6 genes were then cloned into the H.CRPV construct between the EcoRI and SacII restriction sites creating
4 new modified CRPV genomes. These new genomes included CRPV/E6ins49-57(opt),
CRPV/E6457ins-49-57(opt), CRPV/E6ins82-90, and CRPV/E6457ins-82-90. Each new genome was confirmed by DNA sequencing. Viral DNA plasmids were isolated and purified using maxiprep plasmid isolation kit (Qiagen Valencia, CA) by following the manufacturer’s instructions and subjected to cesium chloride density gradient centrifugation as a second purification step. Plasmid concentration was adjusted to
200ng/ul in 1X TE.
156 Table 6.4. Primer sequences for insertion of HPV16E7 11-20 or 11-19 into the CRPV E7 gene. Primer sequences are listed in pairs with the forward primer first followed by the reverse compliment primer sequence. Underlined sequences represent inserted nucleotides.
Primer Sequence E7A-20 5’-CTT-TCC-CTG-GTG-TGC-CCG-GAG-TGT-TGT-AAC-TAT-ATG-TTG-GAT-CTG- CAG-CCA-GAG-ACA-ACC-TGA-AAA-TGG-CTG-AAG-GTA-CAG-ACC-CTA-TCG-3’ E7B-20 5’-CGA-TAG-GGT-CTG-TAC-CTT-CAG-CCA-TTT-TCA-GGT-TGT-CTC-TGG-CTG- CAG-ATC-CAA-CAT-ATA-GTT-ACA-ACA-CTC-CGG-GCA-CAC-CAG-GGA-AAG-3’ E7A-19 5’-GCC-CGG-AGT-GTT-GTA-ACT-ACA-TGC-TGG-ACC-TGC-AGC-CCG-AGA-CCT- GAA-AAT-GGC-TGA-AGG-TAC-AGA-CC-3’ E7B-19 5’-GGT-CTG-TAC-CTT-CAG-CCA-TTT-TCA-GGT-CTC-GGG-CTG-CAG-GTC-CAG- CAT-GTA-GTT-ACA-ACA-CTC-CGG-GC-3’
157 Table 6.5. Primer sequences for insertion of HPV16E7 49-57(opt) or 82-90 epitopes into the CRPV E6 gene. Primer sequences are listed in pairs with the forward primer first followed by the reverse compliment primer sequence. Underlined sequences represent inserted nucleotides.
Primer Sequence E6A- 5’-CTT-CAC-AGA-ATT-TAG-ACG-CCT-GCA-CTA-CAA-CAT-CGT-GAC-CCT-GTG- 49(opt) ATA-GTG-TTT-CTG-CTA-TCC-TG-3’ E6B- 5’-CAG-GAT-AGC-AGA-AAC-ACT-ATC-ACA-GGG-TCA-CGA-TGT-TGT-AGT-GCA- 49(opt) GGC-GTC-TAA-ATT-CTG-TGA-AG-3’ E6A-82 5’-CTT-CAC-AGA-ATT-TAG-ACT-GCT-GAT-GGG-CAA-CCT-GGG-CAT-CGT-GTG- ATA-GTG-TTT-CTG-CTA-TCC-TG-3’ E6B-82 5’-CAG-GAT-AGC-AGA-AAC-ACT-ATC-ACA-CGA-TGC-CCA-GGT-TGC-CCA-TCA- GCA-GTC-TAA-ATT-CTG-TGA-AG-3’
158 Table 6.6. Primer sequences for insertion of HPV16E7 49-57(opt) or 82-90 epitopes into the CRPV E6 gene at base pair position 457. Primer sequences are listed in pairs with the forward primer first followed by the reverse compliment primer sequence. Underlined sequences represent inserted nucleotides.
Primer Sequence E6A-457- 5’-GGT-GAT-TTG-GGG-GGC-TAT-CCC-CGC-CTG-CAC-TAC-AAC-ATC-GTG-ACC- 49(opt) CTG-CCG-AGT-CCC-GGC-AGT-C-3’ E6B-457- 5’-GAC-TGC-CGG-GAC-TCG-GCA-GGG-TCA-CGA-TGT-TGT-AGT-GCA-GGC- 49(opt) GGG-GAT-AGC-CCC-CCA-AAT-CAC-C-3’ E6A-457- GGT-GAT-TTG-GGG-GGC-TAT-CCC-CTG-CTG-ATG-GGC-AAC-CTG-GGC-ATC- 82 GTG-CCG-AGT-CCC-GGC-AGT-C E6B-457- GAC-TGC-CGG-GAC-TCG-GCA-CGA-TGC-CCA-GGT-TGC-CCA-TCA-GCA-GGG- 82 GAT-AGC-CCC-CCA-AAT-CAC-C
159 Rabbit Vaccination and Viral DNA challenge
HLA-A2.1 transgenic rabbits and control rabbits were divided into groups and vaccinated with the specified epitope DNA vaccine or the vector vaccine using a helium- driven gene gun 3 times at 3-week intervals. The inner ear skin of each sedated rabbit was cleaned with 70% ethanol and then barraged with DNA coated gold particles at a rate of 400lb/in2 by a helium driven gene gun [209]. Each rabbit received a vaccine dose of 20 shots (theoretically 20ug) at each immunization. Four days following the final booster rabbit backs were shaved and scarified as described by [209]. One week after the final booster vaccination, rabbits were challenged with a dose of 10ug/site in a 50ul volume with wild type CRPV DNA and the specified modified CRPV genome DNA as described by [209].
Papilloma Volume Determination and Statistical Analysis
Papilloma size was calculated as described previously [364]. Unpaired t-test comparisons were used to evaluate statistical significance.
160 Results
Multiple epitope prediction programs identify potential HPV16 E7 HLA-A2.1 restricted
epitopes
To identify potential vaccine cadidate epitopes that bind strongly to the HLA-A2.1
molecule, the full length amino acid sequence of HPV16 E7 was scanned using BIMAS
and SYFPEITHI. Both programs use algorithms that are trained with the frequencies of
the different amino acids at the different sequence positions of an epitope or with binding
data of known epitopes. For example, HLA-A*0201 molecules bind preferentially
nonapeptides with the aliphatic amino acids leucine, isoleucine, valine, or methionine at positions 2 and 9. Six new potential HLA-A2.1 restricted epitopes were identified as well as two epitopes used in previous studies (Chapters III and IV). Those selected for these studies can be found in table 6.7. The HPV16E7 82-90 was included in the table to the demonstrate scores of a peptide known to bind the HLA-A2.1 molecule. In addition, both the native HPV16E7 49-57 epitope and the sequence variant from earlier studies
(Chapter V) were included to show how changes in the amino acid sequence of an epitope can affect the predicted score of the epitope. The HPV16 E7 11-20 epitope was predicted by both programs and this epitope has been previously identified as an immunogenic HLA-A2.1 restricted epitope [235], [300], [102], [100]. In addition, a sequence variant (optimized) with an amino acid residue change at position 9 of threonine (T) to valine (V) was investigated. This change was made to improve the potential immunogenicity of the epitope since previous studies with the alternate peptide ligand (APL), 11-20(T10V), [236] demonstrated that changes to the epitope sequence could improve its immunogenicity in vivo. Earlier studies with HPV16E7 85-93
determined that this epitope does bind to the HLA-A2.1 molecule [322]. However, based
on the poor prediction scores of this epitope, we chose to work with the sequence
varitant (optimized) containing amino acid changes at anchor positions 2 and 9 that
161 Table 6.7. Binding scores of predicted HLA-A2.1-restricted HPV16E7 epitopes. Bold letters indicate amino acid residues that are not found in the native sequence of the epitope. Underlined epitope sequences identify epitopes that were selected for further studies.
Epitope Position Epitope Sequencea BIMAS Scoreb Syfpeithi Scorec 1 82-90 L L M G T L G I V 53.6 29 2 49-57 R A H Y N I V T F 0.0 11 3 49-57(opt) R L H Y N I V T L 49.1 27 4 11-20 Y M L D L Q P E T T 184.0 19 5 11-20(T9V) Y M L D L Q P E V T 75.5 17 6 11-19 Y M L D L Q P E T 375.6 21 7 85-93 G T L G I V C P I 1.2 21 8 85-93(opt) G L L G I V C P V 591.9 29 9 66-74 R L C V Q S T H V 69.6 20 a Single letter abbreviations for amino acids. Bold face letters indicate alterations in the original epitope sequence. b Determined at http://www-bimas.cit.nih.gov/molbio/hla_bind/ c Determined at http://www.syfpeithi.de/Scripts/MHCServer.dll/EpitopePrediction.htm
162 included a threoine (T) to leucine (L) and an isoleucine (I) to valine (V), respectively.
HPV16 E7 66-74 and 11-19 were also chosen for evaluation based on their predicted
scores.
Affinity of predicted HPV16 E7 HLA-A2.1 restricted epitopes
To determine actual binding affinity of each epitope to HLA-A2.1 molecules, peptides were synthesized and T2 binding experiments were performed. T2 cells were pulsed with each individual peptide (20ug/ml) for a period of 4 hours and then stained for
A2 surface expression. The amount of detected A2 expression correlates with the number of peptide-bound A2 molecules on the surface of the cells. T2 cells with medium only was included as a negative control while T2 cells pulsed with HPV16E7 82-
90 [312] peptide was used as a positive control. The geometric mean fluorescence (Geo
Mean) value was used to assess the binding affinity of each peptide. As expected the native HPV16 E7 11-20 peptide bound to the HLA-A2.1 molecules (Figure 6.1). In addition, both the HPV16 E7 11-19 and HPV 16 E7 11-20(T9V) bound the HLA-A2.1 molecules (Figure 6.1). All binding was statistically significant as compared to the medium only control. A second T2 binding experiment demonstrated that the HPV16 E7
85-93(opt) peptide bound strongly to HLA-A2.1 molecules while the HPV16 E7 66-74 peptide was an intermediate binder (Figure 6.2). Subsequent studies measuring epitope binding at different peptide concentrations were carried out. These experiments demonstrated that HPV16E7 11-20, 11-20(T9V) (Figure 6.3) 11-19 (Figure 6.4) and 85-
93(opt) (Figure 6.5) peptides bound to HLA-A2.1 molecules in a dose dependent manner. Conversely, there was little change in the amount of HPV16E7 66-74 peptide bound A2 molecules over a wide range of concentrations suggesting that this peptide is a weak binder (Figure 6.5).
163 Figure 6.1. T2 binding assay for HPV16E7 11-20, 11-20(T9V), and 11-19 peptides. T2 cells were pulsed with the HPV16E7 11-20, 11-20(T9V), 11-19, 82-90 (positive control) or media (negative control) at a peptide concentration of 20ng/ml and the geometric means of A2 expression were detected by flow cytometry (p< 0.05, unpaired student’s t- test).
100
80
* * * 60 *
40 Geo Mean +/- SE
20
0 90 19 20 ** ia 2- 1- 1- 20 ed 8 1 1 1- M 7 1 6E 6E7 6E7 7 1 6E PV PV1 PV1 H H H PV1 H
164 Figure 6.2. T2 binding assay for HPV16E7 85-93(opt) and 66-74 peptides. T2 cells were pulsed with the HPV16E7 85-93(opt), 66-74, 82-90 (positive control) or media (negative control) at a peptide concentration of 20ug/ml and the geometric means of A2 expression were detected by flow cytometry (p< 0.05, unpaired student’s t-test).
400
*
* 300
200 Geo Mean +/- SE * 100
0
4 3 0 ia -7 -9 -9 ed 66 85 2 M 7 7 7 8 6E 6E 6E V1 V1 V1 HP HP HP
165 Figure 6.3. Dilution curve analysis of HPV16E7 11-20 and 11-20(T9V) peptides. T2 cells were pulsed with various peptides over a range of peptide concentrations and the geometric means of A2 expression were detected by flow cytometry (p< 0.05, unpaired student’s t-test).
300 HPV16E7 11-20 HPV16E7 11-20(T9V) 250 Media
** 200 ** 150
Geo Mean +/- SE 100 **
50 *
0 20ug/ml 2ug/ml 200ng/ml 20ng/ml 2ng/ml 0.2ng/ml
Peptide Concentration
166 Figure 6.4. Dilution curve analysis of the HPV16E7 11-19 peptide. T2 cells were pulsed with the HPV16E7 11-19 peptide over a range of peptide concentrations and the geometric means of A2 expression were detected by flow cytometry (p< 0.05, unpaired student’s t-test).
300 HPV16 E7 11-19 Media 250
200
150
* Geo Mean +/- SE 100 * * * 50
0 20ug/ml 2ug/ml 200ng/ml 20ng/ml 2ng/ml 0.2ng/ml
Peptide Concentration
167 Figure 6.5. Dilution curve analysis of the HPV16E7 85-93(opt) and 66-74 peptides. T2 cells were pulsed with the HPV16E7 85-93(opt) and 66-74 peptides over a range of peptide concentrations and the geometric means of A2 expression were detected by flow cytometry (p< 0.05, unpaired student’s t-test).
300 HPV16 E7 85-93(opt) * HPV16 E7 66-74 250 Media *
200
150 *
Geo Mean +/- SE 100
50
0 20ug/ml 2ug/ml 200ng/ml 20ng/ml 2ng/ml 0.2ng/ml
Peptide Concentration
168 Previous studies have indicated that there is a positive relationship between the ability of an epitope to form a stable MHCI/peptide complex and the immunogenicity of an epitope [323]. Studies with APLs that are modified at their anchor residues and demonstrate increased peptide/MHCI complex stability and increased epitope immunogenicity [324], [325] confirm this finding. The half-lives of the peptide/HLA-A2.1 complexes were investigated using the T2 complex stability assay. T2 cells were co- cultured with each peptide (20ug/ml) overnight. BFA was added to the media prior to peptide removal to ensure that the number of stable complexes could not be due to peptide reloading on egressing HLA-A2.1 molecules. The results show that the
HPV16E711-19 peptide/HLA-A2.1 complexes and HPV16E7 11-20(T9V) peptide/HLA-
A2.1 complexes have similar half-lives greater than 6 hours (Figure 6.6) while the half- life of the HPV16E7 11-20 peptide/HLA-A2.1 complexes is only 3.5 hours (Figure 6.6).
The half-life of the HPV16E7 85-93(opt) peptide/HLA-A2.1 complexes was greater than
5.5 hours (Figure 6.7). These results confirm that changes made at the anchor residues of peptides can influence the interaction between the peptide and MHCI molecules.
Secondly, we would predict that the HPV16E7 11-20 epitope would evoke the weakest immune response in vaccinated HLA-A2.1 transgenic animals as it formed the least stable peptide/HLA-A2.1 complex.
Peptide immunization of HHD mice induces CTLs that are functional in vitro.
To determine the immunogenicity of each epitope, HHD mice were immunized with peptide emulsions composed of an individual peptide, an HBV core helper peptide, and Freund’s incomplete adjuvant. Mice were immunized subcutaneously 2 times at one-week intervals. One week following the final booster, splenocytes were harvested and co-cultured with syngeneic dendritic cells (DCs) pulsed with HPV16E7 11-20
169 Figure 6.6. HLA-A2.1/peptide stability assay for the HPV16E7 11-19, 11-20, and 11- 20(T9V) peptides. T2 cells were pulsed with individual peptides (20ug/ml) overnight. Recycling of HLA-A2.1 molecules was blocked with the addition of BFA for 1 hour. After 1 hour HLA-A2.1 egress was maintained by a lower concentration of BFA. At the indicated time points after initial washes, the HLA-A2.1/peptide complexes were labeled with BB7.2 through indirect immunofluorescence. Mean fluorescence was detected by flow cytometry.
100 HPV16E7 11-19 HPV16E7 11-20 HPV16E7 11-20(T9V)
80
60
40 % of complexes remaining 20
0 0123456
Time (hrs)
170 Figure 6.7. HLA-A2.1/peptide stability assay for the HPV16E7 85-93(opt) peptide. T2 cells were pulsed with the peptide (20ug/ml) overnight. Recycling of HLA-A2.1 molecules was blocked with the addition of BFA for 1 hour. After 1 hour HLA-A2.1 egress was maintained by a lower concentration of BFA. At the indicated time points after initial washes, the HLA-A2.1/peptide complexes were labeled with BB7.2 through indirect immunofluorescence. Mean fluorescence was detected by flow cytometry.
100 HPV16E7 85-93(opt)
80
60
40 % of remaining % of complexes 20
0 0123456
Time (hrs)
171 peptide, HPV16E7 11-19 peptide, HPV16E7 11-20(T9V) peptide, or HPV16E7 85-
93(opt) peptide. After two stimulations, IFN-g ICS experiments were performed to
determine if these CTLs were functional against targets presenting each peptide.
Cultured CTLs from mice immunized with the HPV16E7 85-93(opt) peptide were co-
cultured with this same peptide or a negative control peptide for 4 hours and stained for
surface CD8 and IFN-g production. A CD8+ T cell population was detected, but no IFN-g production was detected (Figure 6.8). These results indicate that the HPV16E7 85-
93(opt) epitope is not immunogenic in the HHD mouse model.
Additional ICS experiments with cultured CTLs from mice immunized with the 11-
20, 11-20(T9V) or 11-19 peptides were performed. A small population of the CTLs from mice immunized with the HPV16E7 11-20 peptide and co-cultured with this same peptide stained positive for CD8 surface expression and IFN-g production (Figure 6.9).
Additionally, cells staining positive for CD8 and IFN-g were detected in cultured CTLs from mice immunized with the HPV16E7 11-20(T9V) (Figure 6.10) and the HPV16E7 11-
19 peptides (Figure 6.11), respectively. Collectively, these data illustrate that the
HPV16E7 11-20, 11-20(T9V) and 11-19 epitopes are all immunogenic in vivo.
Furthermore, the results of the ICS experiments indicate that the HPV16E7 11-20(T9V)
epitope is more immunogenic than the native HPV16E711-20 epitope in vivo.
Due to the similarity in sequence shared between the HPV16E7 11-19, 11-20,
and 11-20(T9V) epitopes, the ability of one peptide to substitute for another during in
vitro stimulation and the ability of CTLs from mice immunized with one peptide to recgonize targets presenting another was examined. Splenocytes isolated from mice immunized with the HPV16E7 11-19 peptide were stimulated with syngeneic dendritic cells (DCs) pulsed with HPV16E7 11-19, HPV16E7 11-20 or 11-20(T9V) peptides.
Following two stimulations IFN-g ICS experiments were performed to determine if these cultured bulk CTLs could recognize targets presenting the HPV16E7 11-19, 11-20, or
172 Figure 6.8. ICS staining assay for cultured T lymphocytes isolated from HHD mice vaccinated with the HPV16E7 85-93(opt) peptide. Harvested splenocytes from mice vaccinated with HPV16E7 85-93(opt) peptide stimulated 2 times in vitro with this same peptide, and stimulated for 4 hours at 37°C with HPV16E7 85-93(opt) peptide or a control peptide. All cultures were stained with FITC conjugated anti mouse CD8 and PE conjugated anti mouse IFN-g. The percentage of cells labeled with both antibodies is indicated in the top right-hand corner of the graphs.
HPV16E7 85-93 peptide Control peptide 0.18% 0.12% IFN-gamma-PE
CD8-Fitic
173 Figure 6.9. ICS staining assay for cultured T lymphocytes isolated from HHD mice vaccinated with the HPV16E7 11-20 peptide. Harvested splenocytes from mice vaccinated with HPV16E7 11-20 peptide stimulated 2 times in vitro with this same peptide, and stimulated for 4 hours at 37°C with HPV16E7 11-20 peptide or a control peptide. All cultures were stained with FITC conjugated anti mouse CD8 and PE conjugated anti mouse IFN-g. The percentage of cells labeled with both antibodies is indicated in the top right-hand corner of the graphs.
HPV16 E7 11-20 peptide Control peptide
0.17% 0.12%
IFN-gamma-PE
CD8-Fitc
174 Figure 6.10. ICS staining assay for cultured T lymphocytes isolated from HHD mice vaccinated with the HPV16E7 11-20(T9V) peptide. Harvested splenocytes from mice vaccinated with HPV16E7 11-20(T9V) peptide stimulated 2 times in vitro with this same peptide, and stimulated for 4 hours at 37°C with HPV16E7 11-20(T9V) peptide or a control peptide. All cultures were stained with FITC conjugated anti mouse CD8 and PE conjugated anti mouse IFN-g. The percentage of cells labeled with both antibodies is indicated in the top right-hand corner of the graphs.
Control peptide HPV16E7 11-20(T9V) peptide
2.30% 0.33%
IFN-gamma-PE
CD8-Fitc
175 Figure 6.11. ICS staining assay for cultured T lymphocytes isolated from HHD mice vaccinated with the HPV16E7 11-19 peptide. Harvested splenocytes from mice vaccinated with HPV16E7 11-19 peptide stimulated 2 times in vitro with this same peptide, and stimulated for 4 hours at 37°C with HPV16E7 11-19 peptide or a control peptide. All cultures were stained with FITC conjugated anti mouse CD8 and PE conjugated anti mouse IFN-g. The percentage of cells labeled with both antibodies is indicated in the top right-hand corner of the graphs.
HPV16 E7 11-19 peptide Control peptide
6.83% 0.70%
IFN-gamma-PE
CD8-Fitc
176 11-20(T9V) peptides (Figure 6.12). Percentages of CD8+ T cells and cells staning
positive for CD8 and IFN-g can be found in table 6.8. These results demonstrate that
immunization of HHD mice with the HPV16E7 11-19 peptide stimulates CTLs that
arespecific for targets presenting the 11-19 peptide only. Similar ICS experiments were
carried out with splenocytes isolated from HHD mice immunized with the HPV16E7 11-
20 peptide or the HPV16E7 11-20(T9V) peptide. HHD mice vaccinated with the
HPV16E7 11-20 peptide, followed by two rounds of in vitro stimulation with this same peptide, produced a small population of CD8+ CTLs that recognized targets presenting
the 11-20 peptide and the 11-20(T9V) peptide (Figure 6.13 and Table 6.9). Stimulation
with the 11-20(T9V) peptide produced CD8+ CTLs that recognized target presenting the
native 11-20 or the 11-20(T9V) peptides as well (Figure 6.13 and Table 6.9). These
data indicate that altering the epitope sequence at position 9 does not prevent TCR
recognition of the peptide/HLA-A2.1 complex. HHD mice immunized with HPV16E7 11-
20(T9V) peptide, followed by two rounds of in vitro stimulation with this same peptide produced a larger population of CD8+ CTLs that recognized targets presenting the native
11-20 peptide and the 11-20(T9V) peptide (Figure 6.14 and Table 6.10). Additionally, splenocytes isolated from HHD mice vaccinated with the HPV16E7 11-20(T9V) peptide, stimulated with the native HPV16E7 11-20 peptide also recognize targets presenting the
11-20 or the 11-20(T9V) peptides. These data indicate that priming with the HPV16E7
11-20(T9V) peptide produces a greater CMI response in the HHD mice compared to the
11-20 peptide.
177 Figure 6.12. CTLs isolated from HHD mice vaccinated with the HPV16E7 11-19 peptide do not recognize targets presenting HPV16E7 11-20 or 11-20(T9V) peptides. ICS staining assays were performed with cultured CTLs isolated from HHD mice vaccinated with the HPV16E7 11-19 peptide. Harvested splenocytes were stimulated 2 times in vitro with the HPV16E7 11-19, 11-20 or 11-20(T9V) peptides. These stimulated CTLs were then cultured for 4 hours at 37°C with the HPV16E7 11-19, 11-20 or 11-20(T9V) peptides or a control peptide. All cultures were stained with FITC conjugated anti mouse CD8 and PE conjugated anti mouse IFN-g. Green dots appearing in R2 represent the CD8+ population while blue dots located in R3 represent cells staining positive for CD8 and IFN-g.
A B K L IFNg-PE
CD8-Fitc C D M N
E F O P
G H Q R
I J
178 Table 6.8. Percentages of CD8+ and CD8+/IFNg+ CTLs isolated from HHD mice immunized with the HPV16E7 11-19 peptide. Letters found in the first column correspond to the letters found on the graphs in figure 6.12. The peptides used to expand the CTLs in vitro and the petides used to pulse the targets are listed in the table as well as the percentages of each labeled population.
Vaccination Stimulation Culture CD8+ % CD8+/IFNg+ % A 11-19 11-19 11-19 5.90 5.20 B 11-19 11-19 control 15.91 0.00 C 11-19 11-19 11-20 8.84 0.05 D 11-19 11-19 control 9.13 0.04 E 11-19 11-19 11-20(T9V) 6.51 0.05 F 11-19 11-19 control 6.54 0.03 G 11-19 11-20 11-19 4.59 0.08 H 11-19 11-20 control 4.50 0.01 I 11-19 11-20 11-20 5.80 0.02 J 11-19 11-20 control 4.50 0.01 K 11-19 11-20 11-20(T9V) 7.21 0.02 L 11-19 11-20 control 7.75 0.03 M 11-19 11-20(T9V) 11-19 6.19 0.06 N 11-19 11-20(T9V) control 5.44 0.05 O 11-19 11-20(T9V) 11-20 6.20 0.04 P 11-19 11-20(T9V) control 5.44 0.05 Q 11-19 11-20(T9V) 11-20(T9V) 5.43 0.05 R 11-19 11-20(T9V) control 5.44 0.05
179 Figure 6.13. CTLs isolated from HHD mice vaccinated with the HPV16E7 11-20 peptide recognize targets presenting HPV16E7 11-20 or 11-20(T9V) peptides. ICS staining assays were performed with cultured CTLs isolated from HHD mice vaccinated with the HPV16E7 11-20 peptide. Harvested splenocytes were stimulated 2 times in vitro with the HPV16E7 11-19, 11-20 or 11-20(T9V) peptides. These stimulated CTLs were then cultured for 4 hours at 37°C with the HPV16E7 11-19, 11-20 or 11-20(T9V) peptides or a control peptide. All cultures were stained with FITC conjugated anti mouse CD8 and PE conjugated anti mouse IFN-g. Green dots appearing in R2 represent the CD8+ population while blue dots located in R3 represent cells staining positive for CD8 and IFN-g.
A B K L IFNg-PE
CD8-Fitc
C D M N
E F O P
G H Q R
I J
180 Table 6.9. Percentages of CD8+ and CD8+/IFNg+ CTLs isolated from HHD mice immunized with the HPV16E7 11-20 peptide. Letters found in the first column correspond to the letters found on the graphs in figure 6.13. The peptides used to expand the CTLs in vitro and the petides used to pulse the targets are listed in the table as well as the percentages of each labeled population.
Vaccination Stimulation Culture CD8+ %IFN-g+/CD8+ % A 11-20 11-19 11-19 6.47 0.02 B 11-20 11-19 control 6.63 0.10 C 11-20 11-19 11-20 7.26 0.02 D 11-20 11-19 control 6.63 0.10 E 11-20 11-19 11-20(T9V) 10.57 0.07 F 11-20 11-19 control 11.25 0.06 G 11-20 11-20 11-19 7.80 0.02 H 11-20 11-20 control 7.35 0.02 I 11-20 11-20 11-20 6.93 0.17 J 11-20 11-20 control 7.35 0.02 K 11-20 11-20 11-20(T9V) 6.03 0.06 L 11-20 11-20 control 6.12 0.02 M 11-20 11-20(T9V) 11-19 5.88 0.0 N 11-20 11-20(T9V) control 5.54 0.0 O 11-20 11-20(T9V) 11-20 10.54 0.10 P 11-20 11-20(T9V) control 10.65 0.02 Q 11-20 11-20(T9V) 11-20(T9V) 10.24 0.15 R 11-20 11-20(T9V) control 10.65 0.02
181 Figure 6.14. CTLs isolated from HHD mice vaccinated with the HPV16E7 11-20(T9V) peptide recognize targets presenting HPV16E7 11-20 or 11-20(T9V) peptides. ICS staining assays were performed with cultured CTLs isolated from HHD mice vaccinated with the HPV16E7 11-20(T9V) peptide. Harvested splenocytes were stimulated 2 times in vitro with the HPV16E7 11-19, 11-20 or 11-20(T9V) peptides. These stimulated CTLs were then cultured for 4 hours at 37°C with the HPV16E7 11-19, 11-20 or 11-20(T9V) peptides or a control peptide. All cultures were stained with FITC conjugated anti mouse CD8 and PE conjugated anti mouse IFN-g. Green dots appearing in R2 represent the CD8+ population while blue dots located in R3 represent cells staining positive for CD8 and IFN-g.
A B K L IFNg-PE
CD8-Fitc
C D M N
E F O P
G H Q R
I J
182 Table 6.10. Percentages of CD8+ and CD8+/IFNg+ CTLs isolated from HHD mice immunized with the HPV16E7 11-20(T9V) peptide. Letters found in the first column correspond to the letters found on the graphs in figure 6.14. The peptides used to expand the CTLs in vitro and the petides used to pulse the targets are listed in the table as well as the percentages of each labeled population.
Vaccination Stimulation Culture CD8+ %IFNg+/CD8+ % A 11-20(T9V) 11-19 11-19 5.59 0.08 B 11-20(T9V) 11-19 control 5.77 0.02 C 11-20(T9V) 11-19 11-20 5.86 0.08 D 11-20(T9V) 11-19 control 5.77 0.02 E 11-20(T9V) 11-19 11-20(T9V) 6.08 0.06 F 11-20(T9V) 11-19 control 5.77 0.02 G 11-20(T9V) 11-20 11-19 10.41 0.03 H 11-20(T9V) 11-20 control 9.97 0.01 I 11-20(T9V) 11-20 11-20 9.35 0.70 J 11-20(T9V) 11-20 control 9.97 0.01 K 11-20(T9V) 11-20 11-20(T9V) 9.57 0.53 L 11-20(T9V) 11-20 control 9.97 0.01 M 11-20(T9V) 11-20(T9V) 11-19 8.68 0.15 N 11-20(T9V) 11-20(T9V) control 8.06 0.10 O 11-20(T9V) 11-20(T9V) 11-20 6.58 0.92 P 11-20(T9V) 11-20(T9V) control 8.06 0.10 Q 11-20(T9V) 11-20(T9V) 11-20(T9V) 7.11 1.25 R 11-20(T9V) 11-20(T9V) control 8.06 0.10
183 Gene gun immunization of HHD mice with numerous individual epitope-DNA vaccines
stimulated no detectable epitope-specific functional CTLs
DNA vaccines delivered by gene gun mediated intracutaneous DNA vaccination stimulate a potent immune response in the mouse [228]. Our laboratory reports that
DNA vaccines delivered using the gene gun generate protective cell mediated immune responses in the CRPV rabbit model [314], [216] as well as the CRPV/HLA-A2.1 transgenic rabbit model [223], [305]. Moreover, gene gun DNA vaccination is the primary immunization method used in the rabbit protection studies. Therefore, the CMI responses generated through DNA vaccination were examined in the HHD mouse model. HHD mice were immunized 2 times at 1-week intervals with the HPV16E7/82-
90, HPV16E7/11-19, or HPV16E7/11-20 DNA epitope vaccines. One week following the booster, spleens were harvested and co-cultured with syngeneic DCs pulsed with the peptides listed in table 6.11. Following two stimulations, IFN-g ICS assays were performed to examine CTL functionality. HHD mice vaccinated with the the
HPV16E7/82-90 or the HPV16E7/11-19 DNA epitope vaccines produced a CD8+ T cell
population that did not recognize targets presenting their respective peptides (Figure
6.15 and Table 6.11). However, a small population of cells positive for CD8 surface
expression and IFN-g were detected in cultured CTLs isolated from the HPV16E7/11-20
DNA vaccinated mice, stimulated 2X with the HPV16E7 11-20 peptide. In addition,
stimulation with the HPV16E7 11-20(T9V) peptide expanded a larger population of CD8+
CTLs that recognized the 11-20(T9V) peptide when pesented in complex with HLA-A2.1
(Figure 6.15 and Table 6.11). These data show that peptide vaccination and epitope
DNA vaccination do not always stimulate parallel CMI responses in the HHD mouse
model.
184 Figure 6.15. CTLs isolated from DNA vaccinated HHD mice recognize targets presenting their specific peptide. ICS assays were performed with cultured CTLs isolated from DNA vaccinated HHD mice. Harvested splenocytes were stimulated 2 times in vitro with the HPV16E7 82-90, 11-19, 11-20 or 11-20(T9V) peptides. These stimulated CTLs were then cultured for 4 hours at 37°C with the HPV16E7 82-90, 11-19, 11-20, 11-20(T9V), or a control peptide. All cultures were stained with FITC conjugated anti mouse CD8 and PE conjugated anti mouse IFN-g. Green dots appearing in R2 represent the CD8+ population while blue dots located in R3 represent cells staining positive for CD8 and IFN-g.
A B IFNg-PE
CD8-Fitc
C D
E F
G H
185 Table 6.11. Percentages of CD8+ and CD8+/IFNg+ CTLs isolated from DNA vaccinated HHD mice Letters found in the first column correspond to the letters found on the graphs in figure 6.15. The peptides used to expand the CTLs in vitro and the petides used to pulse the targets are listed in the table as well as the percentages of each labeled population.
Vaccination Stimulation Culture CD8+ %IFNg+/CD8+ % A pCX82Ub 82-90p 82-90p 8.22 0.04 B pCX82Ub 82-90p control 8.03 0.01 C pCX11-19Ub 11-19p 11-19p 2.35 0.04 D pCX11-19Ub 11-19p control 2.59 0.01 E pCX11-20Ub 11-20p 11-20p 1.25 0.15 F pCX11-20Ub 11-20p control 1.47 0.01 G pCX11-20Ub 11-20(T9V)p 11-20(T9V)p 2.23 1.05 H pCX11-20Ub 11-20(T9V)p control 2.98 0.02
186 Modified CRPV DNA genomes created by epitope insertion but not epitope substitution
produced papillomas in New Zealand White rabbits
In order to test the vaccine-generated CMI responses to potential vaccine epitopes in a model of natural papillomavirus infection, epitopes must be embedded in the CRPV genome. Currently, there are no known papillomaviruses that naturally infect laboratory strains of mice. However, CRPV infects and completes its life cycle in domestic laboratory rabbits [368]. Additionally, our laboratory has shown that the CRPV genome can be modified by PCR mutagenesis without loss of functional viability [215].
The E7 gene of CRPV was chosen as the target because E7 is expressed from initial infection to cancer and the substitution method was used since viable genomes that produced papillomas on the backs of challenged New Zealand rabbits were created using this method [222], Chapter III. To determine substitution positions of the epitopes within the CRPV E7 gene, protein sequence alignments were performed. The initial epitopes chosen for substitution included HPV16E7 49-57(opt), HPV16E7 11-20, and
HPV16E7 85-93. The HPV16E7 49-57(opt) epitope was chosen because previous studies indicated that this epitope could be embedded in the CRPV E7 gene without a significant reduction in genome growth rate (Chapter V). The HPV16E7 11-20 epitope was chosen because it is a naturally occuring epitope in HPV16 and previous studies have indicated that a detectable CMI response is generated to this epitope in people infected with HPV16 [102], [100]. Finally, the HPV16E7 85-93(opt epitope was chosen because new data indicate there is not always a direct relationship between epitope immunogenicity in the HHD mouse model and the CRPV/HLA-A2.1 transgenic rabbit model (unpublished observation). Thus, the following three new CRPV genomes were produced: CRPV/E7sub49-57(opt), CRPV/E7sub11-20, and CRPV/E7sub85-93(opt).
Each new CRPV construct was assayed for its capacity to induce papillomas. Two New
Zealand White rabbits were challenged with DNA a dose of 10ug/site with each genome.
187 Challenge with wild type CRPV DNA was included to control for challenge technique.
Rabbits were examined weekly for papillomas and papilloma formation was considered a positive result. No papillomas were detected on the backs of the rabbits challenged with the CRPV/E7sub49-57(opt) (Figure 6.16) or CRPV/E7sub85-93(opt) (Figure 6.17) indicating these substitutions were lethal. Very small papillomas developed on the backs of rabbits challenged with the CRPV/E7sub11-20 (Figure 6.18). However, due to the significant reduction in the growth rate of this genome compared to wild type CRPV, no further studies were performed with the CRPV/E7sub11-20 genome or the two non- viable genomes.
The insertion method described in Chapter III was used in subsequent attempts to create epitope-modified CRPV genomes. We initially chose two epitopes for insertion in to the CRPV E7 gene. These included the HPV16E7 11-19 and the HPV16E7 11-20 epitopes because both naturally occur in the HVP16 genome and HHD mice immunized with the 11-19 peptide produced a detectable CMI response while peptide of DNA vacciantion with the 11-20 epitope produced a CMI response in HHD mice. The new
CRPV constructs, CRPV/E7ins 11-19 and CRPV/E7ins 11-20, were tested for function by challenge of New Zealand White rabbits. Growth of papillomas was measured in the following weeks, and papilloma formation was considered a positive functional result.
Small papillomas appeared on the backs of the rabbits challenged with the
CRPV/E7ins11-19 genome (Figure 6.19) or the CRPV/E7ins11-20 genome (Figure
6.20). The small papillomas resulting from challenge with the CRPV/E7ins 11-19 genome persisted while the papillomas formed from challenge with the CRPV/E7ins 11-
20 genome began to regress by week 7. These results indicate that the length of the epitope inserted at the C-terminus of the CRPV E7 gene has a significant effect on the function of the E7 protein in vivo.
188 Figure 6.16. A modified CRPV genome does not form papillomas on the backs of New Zealand White rabbits. Papilloma GMDs from New Zealand White rabbits challenged with CRPV/E7sub49-57(opt) DNA and wild type CRPV DNA.
14 Wild Type CRPV CRPV/E7sub49-57(opt) 12
10
8
6
4
2
0 Papilloma Size (Mean +/- SE) by GMDs mm +/- in (Mean Size Papilloma
Wk3 Wk4 Wk5 Wk6 Wk7 Wk8
Weeks after challenge with DNA
189 Figure 6.17. A modified CRPV genome does not form papillomas on the backs of New Zealand White rabbits. Papilloma GMDs from New Zealand White rabbits challenged with CRPV/E7sub85-93(opt) DNA and wild type CRPV DNA.
14 Wild Type CRPV CRPV/E7sub85-93(opt) 12
10
8
6
4
2
0 Papilloma Size (Mean +/- SE) by GMDs mm +/- in (Mean Size Papilloma
Wk3 Wk4 Wk5 Wk6 Wk7 Wk8
Weeks after challenge with DNA
190 Figure 6.18. A modified CRPV genome forms small papillomas on the backs of New Zealand White rabbits. Papilloma GMDs from New Zealand White rabbits challenged with CRPV/E7sub11-20 DNA and wild type CRPV DNA.
14 Wild Type CRPV CRPV/E7sub11-20 12
10
8
6
4
2
0 Papilloma Size (Mean +/- SE) by GMDs mm +/- in (Mean Size Papilloma
Wk3 Wk4 Wk5 Wk6 Wk7 Wk8 Wk9 Wk1- Wk11 Wk12 Wk14
Weeks after challenge with DNA
191 Figure 6.19. Papilloma GMDs from New Zealand White rabbits challenged with CRPV/E7ins11-19 DNA and wild type CRPV DNA.
14 CRPV/E7ins11-19 Wild Type CRPV 12
10
8 - SE) GMDs by in mm
6
4
2
0 Papilloma Size (Mean +/ Size Papilloma
Wk3 Wk4 Wk5 Wk6 Wk7 Wk8
Weeks after challenge with DNA
192 Figure 6.20. Papilloma GMDs from New Zealand White rabbits challenged with CRPV/E7ins11-20 DNA and wild type CRPV DNA.
14 Wild Type CRPV CRPV/E7ins11-20 12
10
8 - SE) GMDs by in mm
6
4
2
0 Papilloma Size (Mean +/ Size Papilloma
Wk 3 Wk4 Wk5 Wk6 Wk7
Weeks after challenge with DNA
193
Vaccination with the HPV16E7/11-19 DNA epitope vaccine provided no detectable
epitope-spcific protection against challenge with the CRPV/E7ins11-19 genome
The small but persistent papillomas resulting from challenge with the
CRPV/E7ins11-19 genome reflect the disease condition caused by HPV16 infections
early on. We were interested in examining the protection provided by DNA epitope
vaccination targeting the HPV16E7 11-19 epitope when it is expressed at the end of the
CRPV E7 protein. Additionally, previous studies demonstrated that a different HPV16E7
epitope could be specifically targeted by vaccine generated immunity when expressed at
this same position (Chapter III). HLA-A2.1 transgenic rabbits (N = 4) and non-transgenic
control rabbits (N = 3) were vaccinated three times at three-week intervals with the
HPV16E7/11-19 DNA vaccine or the control vaccine. One week following the final
booster rabbits were challenged at 4 sites with CRPV/E7ins 11-19 DNA or with wild type
CRPV DNA at 2 sites. A total of six sites were challenged on the rabbits due to the
smaller size of the young HLA-A2.1 transgenic rabbits used in the study. No statistically
significant difference in protection rates was observed between the HLA-A2.1 transgenic
rabbits and control rabbits immunized with the HPV16E7/11-19 epitope vaccine or
control vaccine, respectively (Tables 6.12 and 6.13). A statistically significant reduction
in mean papilloma size between the transgenic and control rabbits that received the
HPV16E7/11-19 DNA vaccine followed by challenge with the CRPV/E7ins11-19 DNA
was observed beginning at week 6 (Figure 6.21). However, a reduction in mean
papilloma size of the sites resulting from challenge with wild type CRPV dna was also
observed between the two rabbits groups starting at week 6 (Figure 6.22). Thus the
epitope-specificity of the protection provided by the HPV16E7/11-19 DNA vaccine can
not be determined. A second protection study in which rabbits are challenged at a larger
number of sites/rabbit and challenged with only one genome/group is necessary.
194 Table 6.12. Tumor protection in outbred New Zealand White rabbits challenged with CRPV/E7ins 11-19 DNA after three immunizations with the HPV16E7/11-19 epitope vaccine or the control DNA vaccine.
Rabbits Vaccine Challenged Sites Protection Ratea (%) 1 HLA-A2.1 (N = 4) E7 Epitope 16 15/16 (94%)b,c,d 2 Control (N = 3) E7 Epitope 12 5/12 (42%) 3 HLA-A2.1 (N = 4) Vector 16 14/16 (88%) 4 Control (N = 2) Vector 8 0/8 (0%) a Protection rate, papilloma-free sites/challenge sites (six sites/each construct/each rabbit); bp = 0.24, cp = 1, dp = 0.01 vs group 2, group 3, and group 4, respectively, Fisher’s exact test.
195 Table 6.13. Tumor protection in outbred New Zealand White rabbits challenged with wild type CRPV DNA after three immunizations with the HPV16E7/11-19 epitope vaccine or the control DNA vaccine.
Rabbits Vaccine Challenged Sites Protection Ratea (%) 1 HLA-A2.1 (N = 4) E7 Epitope 8 4/8 (50%)b,c,d 2 Control (N = 3) E7 Epitope 6 0/6 (0%) 3 HLA-A2.1 (N = 4) Vector 8 5/8 (63%) 4 Control (N = 2) Vector 4 0/4 (0%) a Protection rate, papilloma-free sites/challenge sites (six sites/each construct/each rabbit); bp = 0.25, cp = 0.1, dp = 0.52 vs group 2, group 3, and group 4, respectively, Fisher’s exact test.
196 Figure 6.21. Papilloma outgrowth in epitope DNA vaccinated outbred HLA-A2.1 transgenic rabbits and control rabbits after viral DNA challenge. HLA-A2.1 transgenic rabbits immunized three times with the HPV16E7/11-19 epitope vaccine were challenged with CRPV/E7ins11-19 DNA (p< 0.05, unpaired student’s t-test).
14 HLA-A2.1 + HPV16E7/11-19 epitope vaccine Control + HPV16E7/11-19 epitope vaccine 12
10
8
6
4 * * * 2
Papilloma Size (Mean +/-SE) by GMDs in mm by GMDs in (Mean +/-SE) Size Papilloma 0
Wk3 Wk4 Wk5 Wk6 Wk7 Wk8
Weeks after challenge with CRPV/E7ins11-19 DNA
197 Figure 6.22. Papilloma outgrowth in epitope DNA vaccinated outbred HLA-A2.1 transgenic rabbits and control rabbits after viral DNA challenge. HLA-A2.1 transgenic rabbits immunized three times with the HPV16E7/11-19 epitope vaccine,were challenged with wild type CRPV DNA (p< 0.05, unpaired student’s t-test).
14 HLA-A2.1 + HPV16E7/11-19 epitope vaccine Control + HPV16E7/11-19 epitope vaccine 12
10 * * 8 *
6
4
2
0 Papilloma Size (Mean +/- SE) by GMDs in mm by GMDs in SE) (Mean +/- Size Papilloma
Wk3 Wk4 Wk5 Wk6 Wk7 Wk8
Weeks after challenge with wild type CRPV
198 Inserting HPV16E7 epitopes within the CRPV E6 gene
It is well established that retention and expression of both the HPV E6 and E7 genes is required for progression and maintenance of the malignant phenotype associated with cervical cancer [326], [327]. Additionally, our laboratory reported that
CRPV E6 can be targeted by vaccine generated immunity [292]. Therefore, we chose to embed epitopes within the CRPV E6 gene. Previous successes with epitope insertion at the end of the CRPV E7 gene made the carboxy-terminus of the E6 gene a potential target. Sequence divergence between two naturally occurring CRPV strains that occurs at base pair position 457 within the H. CRPV strain [328] provided a second potential spot for epitope insertion. CRPVb (a.k.a. H. CRPVa), which is a naturally occuring regressing variant of the prototypical CRPV, has an 18-nucleotide duplication [329] starting at base pair position 457. This data suggest that this region of CRPV could accommodate an insertion of a 29 nucleotide epitope sequence. Due to our previous success in creating epitope-modified CRPV genomes containing the HPV16E7 82-90 epitope or the HPV16E7 49-57(opt) epitope, both epitopes were inserted into the
CRPVE6 gene through site-directed PCR mutagenesis. Four new genomes were created and included CRPV/E6ins49-57(opt), CRPV/E6-457ins49-57(opt),
CRPV/E6ins82-90, and CRPV/E6-457ins82-90. New Zealand White rabbits were challenged with 10ug/site of each new construct along with wild type CRPV DNA.
Papillomas resulting from challenge with the CRPV/E6ins 49-57(opt) genome were smaller and this construct had a reduced growth rate when compared to wild type CRPV
(Figure 6.23). However, insertion of the HPV16E7 49-57(opt) into the CRPV E6 gene at base pair 457 created a construct that displayed similar growth kinetics to wild type
CRPV (Figure 6.24). CRPV genomes containing the HPV16E7 82-90 epitope inserted at the carboxy-terminus or at base pair position 457 of the CRPV E6 gene produced tiny papillomas and had reduced growth rates compared to wild type CRPV (Figures 6.25
199 Figure 6.23. Papilloma GMDs from New Zealand White rabbits challenged with CRPV/E6ins49-57(opt) DNA and wild type CRPV DNA.
14 CRPV/E6ins49-57(opt) Wild Type CRPV 12
10
8 - SE) GMDs by in mm
6
4
2
0 Papilloma Size (Mean +/ Size Papilloma
Wk3 Wk4 Wk5 Wk6 Wk7 Wk8 Wk9
Weeks after challenge with DNA
200 Figure 6.24. Papilloma GMDs from New Zealand White rabbits challenged with CRPV/E6-457ins49-57(opt) DNA and wild type CRPV DNA.
14 CRPV/E6-457ins49-57(opt) wild type CRPV 12 n mm i s
10 GMD
SE)
- 8 /
ean + 6 (M
ze ze 4 Si
oma 2 ill ap P 0
Wk3 Wk4 Wk5 Wk6 Wk7 Wk8 Wk9 Weeks after Challenge with DNA
201 Figure 6.25. Papilloma GMDs from New Zealand White rabbits challenged with CRPV/E6ins82-90 DNA and wild type CRPV DNA.
14 Wild type CRPV CRPV/E6ins82-90 n mm i 12 s
GMD 10 y b
8 SE) - /
6 ean + (M 4 ze ze Si
2 oma ill
ap 0 P
Wk3 Wk4 Wk5 Wk6
Weeks after challenge with DNA
202 and 6.26). These data demonstrate that the CRPV E6 gene contains two areas of
plasticity that are amenable to epitope insertion. However, position of the epitope
insertion and amino acid sequence of the epitope affects the in vivo function of the E6
protein differently.
Epitope DNA vaccination provides no epitope-specific protection against challenge with
modified CRPV genomes containing an HPV16E7 epitope inserted in the E6 gene
Since both CRPV genomes that contained the 49-57(opt) epitope inserted into the E6 gene produced papillomas on challenged rabbits, protective DNA vaccination studies were carried out with these two genomes in HLA-A2.1 transgenic rabbits. HLA-
A2.1 transgenic (N = 2) and control (N = 3) rabbits received three immunizations with the
HPV16E7/49-57(opt) epitope DNA vaccine or vector vaccine at three-week intervals followed by challenge with both wild type CRPV DNA and CRPV/E6ins49-57 DNA one week later. The number of HLA-A2.1 transgenic rabbits challenged in this study is reduced due to the fact that no papillomas grew on two of the HLA-A2.1 transgenic rabbits. Therefore, these two rabbits were excluded when calculating the protection rate or the mean papilloma size. Each rabbit was challenged with wild-type CRPV DNA at two sites and CRPV/E6ins49-57(opt) at six sites. No statistically significant difference in protection rates was observed between the HLA-A2.1 transgenic rabbits and control rabbits immunized with the HPV16E7/49-57(opt) epitope vaccine or vector vaccine, respectively (Tables 6.14 and 6.15). There was a reduction in mean papilloma size between the HLA-A2.1 transgenic and control rabbits receiving the epitope DNA vaccine followed by challenge with the modified CRPV genome at weeks 8 and 9 (Figure 6.27).
However, a similar reduction in mean papilloma size for the wild type sites was observed in the two groups starting at week 5 (Figure 6.28). However, this reduction was not statistically significant.
203 Figure 6.26. Papilloma GMDs from New Zealand White rabbits challenged with CRPV/E6-457ins82-90 DNA and wild type CRPV DNA.
14 Wild type CRPV CRPV/E6-457ins82-90 n mm i 12 s
GMD 10 y b
8 SE) - /
6 ean + (M 4 ze ze Si
2 oma ill
ap 0 P
Wk3 Wk4 Wk5 Wk6
Weeks after challenge with DNA
204 Table 6.14. Tumor protection in outbred New Zealand White rabbits challenged with CRPV/E6ins 49-57(opt) DNA after three immunizations with the HPV16E7/49-57(opt) epitope vaccine or the control DNA vaccine.
Rabbits Vaccine Challenged Sites Protection Ratea (%) 1 HLA-A2.1 (N = 2) E7 Epitope 12 12/12 (100%)b,c,d 2 Control (N = 3) E7 Epitope 18 10/18 (56%) 3 HLA-A2.1 (N = 2) Vector 12 7/12 (58%) 4 Control (N = 3) Vector 18 8/18 (44%) a Protection rate, papilloma-free sites/challenge sites (six sites/each construct/each rabbit); bp = 0.4, cp = 0.54, dp = 0.25 vs group 2, group 3, and group 4, respectively, Fisher’s exact test.
205 Table 6.15. Tumor protection in outbred New Zealand White rabbits challenged with wild type CRPV DNA after three immunizations with the HPV16E7/49-57(opt) epitope vaccine or the control DNA vaccine.
Rabbits Vaccine Challenged Sites Protection Ratea (%) 1 HLA-A2.1 (N = 2) E7 Epitope 4 2/4 (50%)b,c,d 2 Control (N = 3) E7 Epitope 6 2/6 (33%) 3 HLA-A2.1 (N = 2) Vector 4 2/4 (50%) 4 Control (N = 3) Vector 6 2/6 (33%) a Protection rate, papilloma-free sites/challenge sites (six sites/each construct/each rabbit); bp = 1, cp = 1, dp = 1 vs group 2, group 3, and group 4, respectively, Fisher’s exact test.
206 Figure 6.27. Papilloma outgrowth in epitope DNA vaccinated outbred HLA-A2.1 transgenic rabbits and control rabbits after viral DNA challenge. HLA-A2.1 transgenic rabbits immunized three times with the HPV16E7/49-57(opt) epitope vaccine were challenged with CRPV/E6ins49-57(opt) DNA (p< 0.05, unpaired student’s t-test).
14 HLA-A2.1 + HPV16E7/49-57(opt) epitope vaccine Control + HPV16E7/49-57(opt) epitope vaccine n mm i 12 s
GMD 10 y b
8 SE) - /
6 ean + (M 4 ze ze Si
2 * * oma ill
ap 0 P
Wk3 Wk4 Wk5 Wk6 Wk7 Wk8 Wk9
Weeks after challenge with CRPV/E6ins49-57(opt) DNA
207 Figure 6.28. Papilloma outgrowth in epitope DNA vaccinated outbred HLA-A2.1 transgenic rabbits and control rabbits after viral DNA challenge. HLA-A2.1 transgenic rabbits immunized three times with the HPV16E7/49-57(opt) epitope vaccine were challenged with wild type CRPV DNA (p< 0.05, unpaired student’s t-test).
14 HLA-A2.1 + HPV16E7/49-57(opt) epitope vaccine Control + HPV16E7/49-57(opt) epitope vaccine 12
10
8
6
4
2
Papilloma (Mean +/- SE) GMDs mm Size in Papilloma 0
Wk3Wk4Wk5Wk6Wk7Wk8Wk9
Weeks after challenge with wild type CRPV DNA
208 A second vaccine protection experiment was carried out with the CRPV/E6-
457ins49-57(opt) genome. HLA-A2.1 transgenic (N = 4) and control (N = 3) rabbits received three immunizations with the HPV16E7/49-57(opt) epitope DNA vaccine or vector vaccine at three-week intervals. One week after the final booster, each rabbit was challenged with wild-type CRPV DNA at two sites and CRPV/E6-457ins49-57(opt) at six sites. No papillomas grew on all four HLA-A2.1 transgenic rabbits vaccinated with the vector vaccine. Therefore, these rabbits were not included in calculations determing the protection rate or the mean papilloma size. No statistically significant difference was observed in protection rates between the HLA-A2.1 transgenic rabbits and control rabbits immunized with the HPV16E7/49-57(opt) epitope vaccine or vector vaccine, respectively (Tables 6.16 and 6.17). Unpredictably the control rabbits receiving the epitope DNA vaccine followed by challenge with both the modified CRPV genome
(Figure 6.29) and wild type CRPV (Figure 6.30) had mean papilloma sizes that were significantly reduced as compared to the HLA-A2.1 transgenic rabbits. However, due to the loss of an entire control group, no conclusions could be drawn from this experiment.
209 Table 6.16. Tumor protection in outbred New Zealand White rabbits challenged with CRPV/E6-457ins 49-57(opt) DNA after three immunizations with the HPV16E7/49- 57(opt) epitope vaccine or the control DNA vaccine.
Rabbits Vaccine Challenged Sites Protection Ratea (%) 1 HLA-A2.1 (N = 4) E7 Epitope 24 7/24 (29%)b,c,d 2 Control (N = 3) E7 Epitope 18 9/18 (50%) 3 HLA-A2.1 (N = 0) Vector 0 0 4 Control (N = 3) Vector 18 5/18 (28%) a Protection rate, papilloma-free sites/challenge sites (six sites/each construct/each rabbit); bp = 0.39, cp = 1, dp = 1 vs group 2, group 3, and group 4, respectively, Fisher’s exact test.
210 Table 6.17. Tumor protection in outbred New Zealand White rabbits challenged with wild type CRPV DNA after three immunizations with the HPV16E7/49-57(opt) epitope vaccine or the control DNA vaccine.
Rabbits Vaccine Challenged Sites Protection Ratea (%) 1 HLA-A2.1 (N = 4) E7 Epitope 8 2/8 (25%)b,c,d 2 Control (N = 3) E7 Epitope 6 3/6 (50%) 3 HLA-A2.1 (N = 0) Vector 0 0 4 Control (N = 3) Vector 6 0/6 (0%) a Protection rate, papilloma-free sites/challenge sites (six sites/each construct/each rabbit); bp = 1, cp = 1, dp = 0.5 vs group 2, group 3, and group 4, respectively, Fisher’s exact test.
211 Figure 6.29. Papilloma outgrowth in epitope DNA vaccinated outbred HLA-A2.1 transgenic rabbits and control rabbits after viral DNA challenge. HLA-A2.1 transgenic rabbits immunized three times with the HPV16E7/49-57(opt) epitope vaccine were challenged with CRPV/E6-457ins49-57(opt) DNA.
14 HLA-A2.1 + HPV16E7/49-57(opt) epitope vaccine Control + HPV16E7/49-57(opt) epitope vaccine 12
10
8 - SE) GMDs by in mm
6
4
2
0 Papilloma Size (Mean +/ Size Papilloma
Wk3 Wk4 Wk5 Wk6 Wk7 Wk8 Wk9
Weeks after challenge with CRPV/E6-457ins49-57(opt) DNA
212 Figure 6.30. Papilloma outgrowth in epitope DNA vaccinated outbred HLA-A2.1 transgenic rabbits and control rabbits after viral DNA challenge. HLA-A2.1 transgenic rabbits immunized three times with the HPV16E7/49-57(opt) epitope vaccine were challenged with wild type CRPV DNA.
14 HLA-A2.1 + HPV16E7/49-57(opt) epitope vaccine Control + HPV16E7/49-57(opt) epitope vaccine 12
10
8 - SE) GMDs by in mm
6
4
2
0 Papilloma Size (Mean +/ Size Papilloma
Wk3 Wk4 Wk5 Wk6 Wk7 Wk8 Wk9
Weeks after challenge with wild type CRPV DNA
213 Discussion
In silico prediction strategies have been used to identify potential T cell epitopes for a number of human pathogens including influenza virus [330], dengue virus [331],
Francisella tularensis [332], and Plasmodium falciparum [333]. Many free epitope prediction tools are available online and predictions are made using sequence based, structure based, or profile based methods [334]. Both BIMAS and SYFPEITHI use a profile based method that examines the frequencies of different amino acids at the different sequence positions of epitopes known to bind to a specific MHCI molecule to
predict epitopes that should bind strongly to that same allele. A total of four predicted
epitopes were chosen along with two epitopes that represented sequence variants
containing amino acid changes at HLA-A2.1 anchor positions 2 and/or 9 for additional
studies. In vitro experiments confirmed that peptide/HLA-A2.1 stability could be
improved by changing the amino acid residues found at the HLA-A2.1 anchor positions.
However, the presence of preferential amino acids at anchor positions 2 and 9 does not
guarantee stronger interactions between the peptide and HLA-A2.1 molecules, as seen
with the HPV16E7 66-74 epitope.
Five of the six epitopes formed stable complexes with HLA-A2.1 molecules.
However, peptide binding to MHC I molecules and the formation of stable peptide/MHCI
complexes is required but does not guarantee epitope immunogenicity [335]. Therefore,
the HHD mouse model was used to examine the immunogenicity of each new potential
vaccine candidate in vivo. Four of the five epitopes induced an epitope-specific CTL response when delivered via peptide immunization. However, gene gun mediated DNA vaccination of HHD mice did not produce these same results. Interestingly, HLA-A2.1 transgenic mice immunized subcutaneously (s.c.) with the HPV16E7 82-90 peptide produced CTLs that exhibited epitope-specific killing [235] while DNA vaccination of these same mice with the HPV16E7/82-90 epitope vaccine did not generate a detectable
214 immune response. Conversely, i.m. or s.c. injection of peptides in HLA-A2.1 transgenic
rabbits does not generate a CTL response (unpublished observation) while a CD8+ T cell
response is generated in HLA-A2.1 transgenic rabbits after vaccination with the
HPV16E7/82-90 DNA epitope vaccine [222]. Collectively, these data indicate that there
are unique differences in epitope processing and presentation between HHD mice and
HLA-A2.1 transgenic rabbits, and vaccine modality and method of delivery are key
components for consideration when determining vaccination strategies.
T cell receptors cross-react with different peptide/MHC I complexes [336], [337].
Three of the four epitopes that were immunogenic in HHD mice, HPV16 E7 11-19, 11-
20, and 11-20(T9V), differ in sequence by only one or two amino acids. Therefore, IFN-
g ICS studies were performed to determine if there was any cross-recognition between
these three epitopes. The results from these studies demonstrated that the HPV16 E7
11-19 and the HPV16 E7 11-20 epitopes are two distinct sequences and CTLs
recognizing the 11-19/HLA-A2.1 complex do not cross-react with the 11-20/HLA-A2.1
complex and vise versa. Conversely, CTLs primed with the HPV16 E7 11-20 peptide
could recognize targets presenting the sequence variant HPV16 E7 11-20(T9V) and vice
versa. In addition, both the HPV16 E7 11-20 and 11-20(T9V) peptides were
interchangeable during in vitro expansion of CTLs. Further studies to examine if the
vaccine generated immunity to the APL 11-20(T9V) is protective and/or therapeutic
against targets presenting the native HPV16 E7 11-20 sequence is needed since
preclinical and clinical evidence suggests that the HPV16 E7 11-20 epitope is naturally
processed and presented [235], [300], [102], [100].
The HHD mouse model serves as a fast and efficient toll for examining the
immunogencity of potential vaccine candidate epitopes in vivo. The cell culture system for primary mouse splenocytes is well known, primary mouse DCs are readily available, and there are a large number of diagnostic reagents for examining immune responses to
215 foreign antigens in vitro and in vivo. However, to date there are no known
papillomaviruses that infect laboratory strains of mice. Consequently, a second model is
needed to examine the vaccine-generated immune responses to HPV epitopes during a
papillomavirus infection in vivo. The HLA-A2.1 transgenic rabbit was created for this purpose since domestic rabbits are susceptible to infection with cottontail rabbit papillomavirus [201], [202]. Additionally, CRPV DNA is infectious and can undergo
PCR-induced modification without loss of functional viability [210], [308], [338], [339],
[215]. These features allowed us to create CRPV genomes containing HPV16 E7 epitopes embedded within the E6 and E7 genes of CRPV. As a result, the protection provided by each predicted epitope after DNA vaccination could be tested in vivo, under contitions of a natural papillomavirus infection in an animal model with an intact immune system.
The substitution method [222], (Chapter III) and the insertion method (Chapters
III and IV) have been successfully used to embed epitopes within the CRPV genome.
However, initial attempts at substitution of the HPV16 E7 49-57(opt), 85-95 (opt), and
11-20 epitopes within the CRPV E7 gene produced non-viable genomes and this method was abandoned. As a result, the insertion method was used to create the remainder of the epitope modified constructs. Insertion of the HPV16 E7 11-19 epitope or the HPV16 E7 11-20 epitope at the end of the CRPV E7 gene produced viable CRPV genomes with reduced growth rates compared to wild type CRPV. However, while papillomas resulting from challenge with the CRPV/E7ins 11-19 genome persisted, those resulting from challenge with the CRPV/E7ins 11-20 genome regressed. These data reaffirm that the end of the CRPV E7 gene is an area of sequence flexibility.
However, in addition to the amino acid composition of the epitope, the length of epitope sequence affects the function of the CRPV E7 protein in vivo.
216 Production of viable epitope-modified CRPV genomes allows the epitope-specific protective vaccine generated immunity to HLA-A2.1 restricted HPV16 E7 epitopes during a natural papillomavirus infection to be examined [222]. Studies were carried out ot determine if the epitope-specific immunity induced through DNA vaccination with the
HPV16E7/11-19 epitope vaccine could target this epitope when it is expressed at the end of the CRPV E7 protein. HLA-A2.1 transgenic rabbits vaccinated with the epitope vaccine or the control vaccine exhibited similar rates of protection. Thus the protection afforded to the HLA-A2.1 transgenic rabbits by DNA vaccination with the HPV16E7/11-
19 vaccine was not epitope-specific. These results suggest a number of possibilities.
First, this epitope is not immunogenic in the CRPV/HLA-A2.1 transgenic rabbit model.
Second, the HPV16 E7 11-19 epitope can not be correctly processed and presented from the end of the CRPV E7 gene. Third, the number of challenge sites/ rabbit were too few for vaccine induced epitope specificity to be discerned. Each of these possibilities can be tested through additional experiments. Epitope immunogenicity in the HLA-A2.1 rabbits can be tested through tetramer staining assays of rabbit CTLs isolated from transgenic rabbits vaccinated with the HPV16E7/11-19 epitope vaccine.
Epitope processing and presentation from the end of the CRPV E7 gene could be tested if a CTL reporter cell line was created that was specific for the HPV16E7 11-19 epitpe presented by HLA-A2.1 molecules. The technology is available for creation of such a cell line as demonstrated by [340]. Finally, setting up a second protection experiment in which rabbits are challenged at a greater number of sites/rabbit with the CRPV/E7ins11-
19 genome only could be carried out to ensure that epitope spreading (Chapter III) is not the cause of the non-specific protection.
The CRPV E6 gene and its protein product is essential for papilloma formation
[214], [213]. Consequently, this gene was examined as a potential target for epitope insertion as well. Due to the success of epitope insertion at the C-terminus of the CRPV
217 E7 gene, the end of the E6 gene was also examined for plasticity. A second area with known plasticity starting at base pair position 457 within the H. CRPV strain [328], [329] was also examined. Two HLA-A2.1 restricted HPV16 E7 epitopes, 82-90 and 49-57(opt) were inserted at the C-terminus and at base pair position 457 within the CRPV E6 gene.
These two epitopes were chosen since previous studies demonstrated that they were correctly processed and presented from the end of the CRPV E7 gene and that these epitopes could be targeted by vaccine generated immunity (Chapters III and V).
Embedding the HPV16E7 82-90 epitope within the CRPV E6 gene at both positions produced genomes with significantly reduced growth rates when compared to wild type
CRPV. While the CRPV/E6ins49-57(opt) genome had a slightly reduced growth rate and the CRPV/E6-457ins49-57(opt) genome had a growth rate similar to wild type CRPV.
These results suggest that these areas within the CRPV E6 gene are more sensitive to
PCR-induced modifications and indicate that epitope position and epitope sequence affect the function of the CRPV E6 protein in vivo.
Due to the reduced growth rates of both the CRPV/E6ins82-90 and the
CRPV/E6-457ins82-90 genomes, no vacciantion studies were carried out. However, protective vaccines studies were performed with both the CRPV/E6ins49-57(opt) and
CRPV/E6-457ins49-57(opt) genomes. The results of the vaccine protection study with the CRPV/E6ins 49-57(opt) genome were inconclusive with respect to epitope- specificity. Additionally, the protection studies with the CRPV/E6-457ins49-57(opt) genome were compromised due to the removal of two HLA-A2.1 rabbits in the epitope vaccine group and the removal of all HLA-A2.1 rabbits in the control vaccine group from analysis due to no papilloma growth of any kind. Interestingly, examination of the mean papilloma size of the HPV16E7/49-57(opt) vaccinated HLA-A2.1 transgenic and control rabbits challenged with the CRPV/E6-457ins49-57(opt) genome demonstrated that the control rabbits were had smaller papillomas than the HLA-A2.1 transgenic rabbits. This
218 same phenomenon held true at the wild type challenge sites too for both rabbit groups.
These two data sets suggest that the non-specific protection that was afforded the
epitope-vaccinated control rabbits against both genomes was due to differences between the rabbit types and not the two genomes. One possible area of difference is the rabbit MHCI molecules expressed within each group. While the current number of rabbit MHC I genes remains unknown, data from other species suggest that there is more than one rabbit MHCI gene and these genes are polymorphic. Neither the control nor the HLA-A2.1 transgenic rabbits are inbred populations, thus it is likely that there are allelic differences in the rabbit MHC I genes not only between the rabbit groups but within the rabbit groups. Thus, a single rabbit MHC I allele shared by the control rabbits but not found in the HLA-A2.1 transgenic rabbits could have presented a rabbit MHC I- restricted epitope found within both genomes to CTLs resulting in papilloma regression.
In summary, the data presented here provides a method for the identification and characterization of HLA-A2.1 restricted HPV16 E7 epitopes through the use of epitope prediction models as well as two preclinical animal models. Additionally, a new sequence variant of the HPV16E7 11-20 epitope was tested in vitro and in vivo and the
outcome of these experiments indicate that further testing of this epitope as a vaccine
candidate in vivo is warranted. The E6 gene of CRPV can be modified through PCR, and similarly to modified CRPV E7, these modifications affect the function of the CRPV
E6 protein in vivo. Finally, while these studies provide information about the CRPV genome with respect to sequence mutations by epitope substitution and epitope insertion, additional strategies and new locations for embedding epitopes within the
CRPV genome are still needed.
219 Acknowledgments
This work was supported by the Public Health Service, National Cancer Institute Grant
R01 CA47622 from the National Institutes of Health and by the Jake Gittlen Memorial
Golf Tournament.
220
Chapter VII
Discussion and Future Studies
221 The purpose of this thesis was to answer several of the remaining questions
surrounding the vaccine generated immune responses to papillomavirus infection of a
natural host with an intact immune system. Specifically, we chose to investigate the cell
mediated immune responses that are generated to HLA-A2.1 restricted HPV16E7
epitopes using the HHD mouse model and the CRPV/HLA-A2.1 transgenic rabbit model.
Three specific aims were set forth and shall be discussed individually. In addition, future experiments will be proposed to answer some of the questions raised by the findings of this thesis.
Aim 1. Assess the vaccine generated protective immunity to the known
HLA-A2.1 restricted HPV16 E7 82-90 epitope embedded in both early and
late genes of the CRPV genome in vivo using the CRPV/HLA-A2.1
transgenic preclinical rabbit model.
One of the many unanswered questions surrounding HPV vaccination concerns immune targeting. That is, which genes serve as the best targets for a vaccine generated immune response? This question leads to another set of questions concerning protection versus therapy and which HPV disease state is being targeted by the vaccine induced immune response. We chose to focus the studies presented in aim
1 on prevention of papillomavirus infection, ie vaccine protection. In this first aim we examined the immune responses to a specific epitope target when it is expressed within an early protein versus a late protein. We chose the established HPV16E7 HLA-A2.1 restricted 82-90 epitope [312] as our specific target since previous studies in mice [235] and HLA-A2.1 transgenic rabbits [222] clearly demonstrated that this epitope could be targeted by vaccine generated cellular immunity. Two different strategies were used to embed the epitope within the two chosen CRPV genes resulting in two new epitope-
222 modified CRPV genomes. In fact, the insertion strategy developed in this first aim
revealed that the carboxy-terminus of the CRPV E7 gene was amenable to PCR induced
modification. As a result, this same epitope insertion strategy was later used to embed a
number of different HPV16E7 HLA-A2.1 restricted epitopes discussed in aim 3.
The vaccination experiments carried out with the HPV16E7/82-90 DNA epitope
vaccine followed by challenge with either the CRPV/L2sub82-90 genome or the
CRPV/E7ins82-90 genome demonstrated that the 82-90 epitope could be correctly
processed and presented from its location within either protein. This indirect finding is
based on the detectable levels of epitope-specific protection generated against both
genomes. In addition, the results of both vaccine protection studies indicated that the
vaccine generated immunity was specific for the 82-90 epitope. However, the initial
vaccine protection study performed with the CRPV/E7ins82-90 genome also revealed a
phenomenon coined spreading immunity (Figure 7.1). It is thought that the initial
vaccine generated immunity is epitope-specific but due to bystander T cell activation T
cells in the area of the infection that are specific for epitopes other than the vaccine
epitope become activated. Bystander T cell activation leads to the specificity of the cellular immune response effectively spreading to other epitopes that may be shared by both genomes, ultimately resulting in reduction of all papillomas remaining on the
challenged rabbits. The spreading immunity phenomenon was not specific for the 82-90
epitope. This same trend occurred in rabbits challenged with the CRPV/E7ins49-57(opt)
genome. As a result, possible methods to curb spreading immunity will be discussed in
future studies below.
Comparison of the protection rates between the CRPV/L2sub82-90 study and the
CRPV/E7ins82-90 study revealed that the CRPV E7 protein was a superior target for the
vaccine generated immunity. Clinical implication for future HPV vaccine designs can be gleaned from the results presented here. These data provide clear evidence that
223 Figure 7.1. Diagram describing spreading immunity. DNA vaccination leads to epitope specific immunity. Upon initial challenge with both an epitope-modified CRPV genome (blue solid line), where the modification is to an early gene, and wild type CRPV DNA (purple solid line) both genomes overcome the low level natural immunity already present in the HLA-A2.1 transgenic rabbits and this results in expression of epitope modified and native CRPV proteins. These early proteins are then continuously expressed throughout the infection in the infected basal layer at the base of the papilloma. However in addition to the epitope-specific T cells that were activated through vaccination, the combination of vaccination with a DNA vaccine followed by challenge with DNA also results in activation of bystander T cells that are specific for epitopes other than the vaccine epitope. This results in the epitope-specific immunity essentially spreading to epitopes shared by both infections. This results in the reduction and in some cases complete elimination of all papillomas.
Spreading immunity to shared epitopes
Antigen- specific immune response
Vaccination Natural immunity
Time after infection
Infection
224 epitopes located within the early genes of HPV types, specifically epitopes within the E7
gene, should be examined as potential targets for vaccine generated immunity. The
results in this aim also raised the following additional questions: How is spreading
immunity curbed in the CRPV/HLA-A2.1 transgenic model? Why is the 82-90 epitope
preferentially targeted by vaccine generated immunity when it is expressed from the
CRPV E7 protein as compared to the CRPV L2 protein? Could vaccine generated
epitope-specific immunity target the 82-90 epitope when it is located within E6, E1, or
E2?
Future studies
How is spreading immunity reduced in the CRPV/HLA-A2.1 transgenic rabbit
model?
Hypothesis #1
In two protection studies presented in this thesis, the phenomenon of spreading immunity was observed. The first example was exhibited when the HPV16E7 82-90 epitope was inserted at the C-terminus of the CRPV E7 gene while the second instance was when the optimized HPV16E7 49-57(opt) epitope was inserted at that same position. We hypothesized that in both cases the spreading immunity was the result of activation of bystander T cells specific for rabbit MHC-restricted or HLA-A2.1 restricted epitopes that were shared by the genomes used to challenge the rabbits. It has been well documented that the CRPV E1 gene contains powerful HLA-A2.1 restricted epitopes that provoke strong cellular immune responses in the HLA-A2.1 transgenic rabbits [341], [342], Chapter IV). We hypothesize that it is the five HLA-A2.1 restricted epitopes within the CRPV E1 gene that are targeted when immune response spreads to additional epitopes shared by both epitope-modified CRPV genomes and wild type
CRPV. Therefore, we propose to create a CRPV genome in which those five CRPV E1
225 epitopes have been mutated through PCR-induced mutagenesis so that they no longer
bind to the HLA-A2.1 molecule. Previous studies have demonstrated that a single amino
acid change of an M to a P at position 303 of the CRPV E1 303-311 epitope can
decrease the peptide’s binding affinity for the HLA-A2.1 molecule to background levels
(unpublished observation). Additional amino acid changes to the other four CRPV E1 epitopes could have this same effect. However, all introduced changes into the CRPV genome would have to be tested on rabbits to ensure that these changes did not result in a nonviable genome. Use of this new CRPV E1 mutant genome in future vaccine studies with epitope-modified CRPV genomes could result in reduction and possible prevention of spreading immunity thus reducing the need for additional protection studies to demonstrate epitope-specificity.
Why is the HPV16E7 82-90 epitope preferentially targeted by vaccine generated
immunity when it is embedded in CRPV E7 as compared to CRPV L2?
Hypothesis #1
Studies performed examining the expression of papillomavirus proteins during
the viral life cycle have demonstrated that E7 is expressed upon initial infection and this
protein product is required throughout the infection while L2 is not expressed until after
genome amplification has been completed [343]. As a result we hypothesize that the
82-90 epitope is preferentially targeted when it is expressed in the CRPV E7 protein
because CRPV E7 is more abundantly expressed during a papillomavirus infection. To
test this hypothesis, the amounts of each protein would need to be quantified. However,
quantification of proteins during a natural infection poses serious obstacles including
proteins must be isolated from infected tissue and the levels of each protein may be
below a detectable threshold at any given time point during a papillomavirus infection.
One quantitative method for measuring relative amounts of protein is through Western
226 blot. However, this is dependent on isolation without degradation of the proteins of interests from the infected tissues at detectable levels. A second method is the use of
QRT-PCR to detect the relative levels of mRNA transcripts of each gene. However, there is not always a direct correlation between mRNA abundances and protein levels
[344]. Therefore, both techniques could be employed simultaneously to determine the levels of CRPV E7 protein and CRPV L2 protein at selected time points after infection of rabbits with CRPV DNA. In-house generated mouse anti-rabbit monoclonal antibodies to CRPV E7 and CRPV L2, SE7.1 and CL2ax.3B4, respectively could be used to detect the levels of each protein found within the infected tissue. Detection of CRPV E7 and
CRPV L2 protein levels would require extraction of the proteins from the infected tissue, followed by SDS-PAGE and Western blotting. In addition, QRT-PCR experiments to quantify the levels of E7 mRNA and L2 as described by [345], [168] could be carried out on the infected tissue samples at each time point. The results from these experiments would provide data about the relative amounts of two CRPV proteins during a natural infection and lend support or challenge the notion that differences in protein abundances is the basis for why the 82-90 epitope is preferentially targeted by the vaccine generated immunity when it is expressed within the CRPV E7 protein.
Hypothesis #2
From initial infection, early papillomavirus proteins are expressed in the infected basal layer while late papillomavirus proteins are expressed during later time points of the viral life cycle and usually in the upper layers of the skin [11]. Thus activated epitope-specific T cells likely have earlier access to their specific epitopes when they are embedded in an early protein and greater access as the epitopes found in early proteins are expressed in the basal layer. Therefore, we hypothesize that the 82-90 epitope is preferentially targeted when it is expressed in the CRPV E7 as compared to the CRPV
227 L2 protein because the epitope is expressed at earlier time points during a natural papillomavirus infection in the CRPV E7 protein. A comparison of the reported protection rates obtained with a different epitope-modified CRPV genome,
CRPV/E7sub82-90 [222], support this hypothesis. While the protection rates obtained against this substitution modified genome were not as high as those demonstrated for the CRPV/E7ins82-90 genome, they were higher than those obtained for the
CRPV/L2sub82-90 genome. A vaccine protection study where vaccinated rabbits are challenged with all three genomes simultaneously to compare the protection rates obtained with each genome could provide data to support this hypothesis.
Hypothesis #3
Finally, we hypothesize that the 82-90 epitope is preferentially targeted by the vaccine generated immunity when it is expressed from the CRPV E7 protein because the 82-90 epitope is more efficiently processed and presented from this location as compared to its location within the CRPV L2 protein. To test this hypothesis, the levels of antigen processing and presentation of the 82-90 epitope from its location within each protein would need to be quantified. Quantification could be achieved through generation of an epitope specific CTL clone that would provide a quantitative readout upon TCR engagement of the HLA-A2.1 molecule in complex with the 82-90 epitope similarly to the T cell hybridoma BB7 which recognizes a mycobacterial antigen 85B epitope [346]. An alternative strategy would be an epitope specific CTL clone that would provide a quantitative readout upon T cell activation, similarly to the LacZ-inducible T cell hyridomas created by [340]. In addition, an immortalized HLA-A2.1 positive cell line which could be transfected with the following four expression vectors would be necessary: pCR3/E7, pCR3/E7ins82-90, pCR3/L2 and pCR3/L2sub82-90. Caski cells would serve as a positive control for the 82-90 CTL clone. With these reagents, in vitro
228 assays could be carried out to quantify the amounts of epitope that were processed and
presented from the two different gene targets and provide insights as to why the epitope
is preferentially targeted when it is expressed in the CRPV E7 protein.
Why does the CRPV/E7ins82-90 genome exhibit a reduced growth rate in the
CRPV/HLA-A2.1 transgenic rabbit model?
Hypothesis #1
We hypothesize that the reduction in genome viability exhibited by the
CRPV/E7ins82-90 genome results from the location of the epitope. One method to test this hypothesis would be to compare the growth rates of the CRPV/E7ins82-90 genome with that of a second genome containing the same epitope in the CRPV E7 gene. There is another epitope modified genome containing the same epitope substituted into the
CRPV genome, CRPV/E7sub82-90, which has been used in previous vaccine protection studies [222]. In order to test this hypothesis, side by side comparisons of the papilloma
GMDs resulting from challenge with the CRPV/E7ins 82-90 genome or the
CRPV/E7sub82-90 genome would be carried to determine the growth rate of each.
From previous studies, we suspect that it is the C-terminal location of the epitope as well
as the added length of the CRPV E7 gene that is mostly responsible for the reduction in
growth rate.
Hypothesis #2
An initial study demonstrating that CRPV DNA was infectious was performed with
CRPV DNA in which the intervening plasmid sequences were removed and the CRPV fragment was ligated together [293]. This same study demonstrated that the presence of the plasmid sequences resulted in a reduction in papilloma formation. Consequently, we hypothesize that the reduced growth rate exhibited by the CRPV/E7ins82-90 genome
229 is due to the interrupting plasmid sequences located within the L2 gene. In order to test this hypothesis, side by side comparisons of the papilloma GMDs resulting from challenge with the CRPV/E7ins 82-90 genome and the same genomes with the pUC19 sequences removed would be carried out. We suspect that removal of the intervening plasmid sequences would improve the growth rate of the CRPV/E7ins82-90 genome though it is unlikely to restore it to wild type levels.
Can vaccine generated cellular immunity target the HPV16E7 82-90 epitope located in CRPV E1 and E2 genes?
Previous studies from our laboratory have demonstrated that intramuscular DNA vaccination with the E1 and E2 genes induces a cell mediated response in domestic rabbits [292] and gene gun mediated vaccination of domestic rabbits with the E1 and E2 genes [347] or specific E1 epitopes [305] induces a protective cell mediated immune response. Taken together these data clearly demonstrate that both E1 and E2 protein products can be seen by the cellular arm of an immune response during a natural infection and as a result, both CRPV genes are potential targets for epitope modification.
However, determining the location in which to embed the epitope as well as the method for epitope relocation is no easy task. Nonetheless, the CRPV genome tandem repeat technology which was discussed in Chapter IV and was previously described by [339] could make the task of epitope relocation less problematic. This technology allows for modification of the chosen gene with the knowledge that a second wild type copy of the gene will be present incase any modifications are lethal. All genomes made with the
HPV16E7/82-90 epitope relocated within the E1 or E2 genes would then have to be tested for viability through challenge studies in domestic rabbits. Only after genomes were demonstrated to be functional in vivo could vaccine protection studies be performed. Initial protection studies would be set up in the same manner as the initial
230 studies carried out with the CRPV/E7ins82-90 genome. The results of the primary vaccination studies would dictate if further vaccination studies would be carried out.
Aim 2. Examine and compare the vaccine generated protective immunity generated to the known HLA-A2.1 restricted HPV16 E7 82-90 epitope using different DNA vaccine delivery strategies.
The main goal of any vaccination strategy is to prevent disease. This is achieved through exposure of the host’s immune system to the pathogen’s antigenic determinants thus priming an initial immune response that can result in a swift secondary immune response should the host encounter the same pathogen again. Our laboratory has long used DNA vaccines, be them whole gene [347] or specific epitopes [303], delivered using a gene gun to protect against CRPV infections [216] and to delay the progression to cancer [218]. However, as with any vaccination method, there are disadvantages to particle mediated epidermal delivery. Cost of materials and loss of the vaccination device due to maintenance or repairs are the two principal shortcomings of gene gun mediated vaccination. Thus, the second aim of this thesis was to compare two vaccination strategies for the delivery of DNA epitope vaccines with the desire of discovering an effective alternative to the gene gun.
The delivery of an EGFP-expression plasmid using a gene gun or a tattoo gun demonstrated that both strategies were effective methods for the delivery of a DNA plasmid. The initial vaccination experiment in which the multivalent CRPVE1ep1-5 DNA vaccine was delivered using a tattoo gun or a gene gun followed by challenge of HLA-
A2.1 transgenic rabbits with CRPV DNA suggested that the tattoo gun was an effective and practical alternative to the gene gun. This experiment also revealed one of the inconsistencies that can arise with gene gun vaccination and that is bullet making.
231 Though both vaccination strategies resulted in complete protection, examination of the
bullets used with the gene gun revealed that only half the amount of the DNA vaccine
was being delivered during each immunization. Therefore, a second head to head
comparison of the two vaccine delivery devices was performed. In the second study,
HLA-A2.1 transgenic rabbits were vaccinated using the gene gun or tattoo gun with the
HPV16E7/82-90 DNA vaccine and challenged with the CRPV/E7ins82-90 genome or a more vigorous CRPV/E7(82-90)TR genome. In both studies, similar levels of protection were provided by the gene gun or tattoo gun against the CRPV/E7ins82-90 genome and
DNA vaccination by tattooing provided near complete protection against challenge with the CRPV/E7(82-90)TR genome. The data presented here provide clear evidence that the tattoo gun is a practical and effective alternative to the gene gun and could be a useful vaccine delivery strategy in a clinical setting.
In addition to the above finding, one other outcome was observed concerning the
CRPV/E7(82-90)TR genome. Some papillomas resulting from challenge with the
CRPV/E7(82-90)TR genome progressed to cancer within 4 months. This time line from challenge to cancer is greatly reduced when compared to onset of cancer at sites challenged with wild type CRPV DNA, which is usually 12-16 months [348]. This led to some additional questions that will be addressed in the future studies portion.
Future Studies
Why do papillomas resulting from challenge with the CRPV/E7(82-90)TR
genome progress quickly to cancer in the CRPV rabbit model?
Hypothesis #1
Previous studies have demonstrated that CRPV infections can progress to malignancy [349]. It is well established that E7 is one of three oncogenes found in the viral genome of CRPV [214], and in vitro studies have demonstrated that expression of
232 E7 alone from “high risk” HPV types is sufficient to immortalize primary cells [350], [299],
[351]. Therefore, we hypothesize that the increased rate of progression to cancer by the
CRPV/E7(82-90)TR genome is due to expression of a second copy of the CRPV E7
gene. To test this hypothesis the following additional tandem repeat genomes would
need to be made: wild type CRPV(TR) containing two E7 genes and wild type
CRPV(TR) with only one E7 gene. Individual rabbit groups would be infected with one of
each of the TR genomes and then a control group with wild type CRPV DNA.
Papillomas would be measured and examined for physical signs suggesting progression
to cancer. Additionally, papillomas could be harvested at selected time points and
subjected to histological examination. We suspect that papillomas resulting from the
wild type CRPV(TR) with the additional CRPV E7 gene would progress to cancer the
fastest.
Is DNA vaccination through tattooing a viable therapeutic strategy in the
CRPV/HLA-A2.1 transgenic rabbit model?
As demonstrated in this thesis, epitope DNA vaccines delivered using the tattoo gun induce strong protective immune responses in the CRPV/HLA-A2.1 transgenic rabbit model. Previous studies in both mice [230] and non-human primates [382] have demonstrated that DNA vaccines delivered by tattooing induce strong cellular immune responses and these immune responses are antigen-specific [229]. Collectively, these data indicate that DNA vaccines delivered using a tattoo gun can induce cellular immune responses in a wide variety of animal models against several different pathogens. While these reports demonstrate protection, there are currently no published studies in any animal model demonstrating that vaccines delivered using a tattoo gun induce therapeutic immune responses. Previous studies from our laboratory have demonstrated that the multivalent CRPV E1 DNA vaccine delivered using a gene gun
233 can provoke partial and in some cases complete regression of CRPV induced
papillomas [305]. Therefore, it is likely that this same vaccine delivered using the tattoo
gun could also induce a therapeutic response in the CRPV/HLA-A2.1 transgenic model.
We propose a head to head comparison of the therapeutic vaccine generated immunity
provided by the multivalent CRPV E1 DNA vaccine when it is delivered using the tattoo
gun or the gene gun. The results of this study would present the first evidence of
therapeutic immunity generated through tattooing and provide a foundation for
therapeutic intervention against HPV induced disease using a tattoo gun.
Is peptide vaccination by tattooing a viable vaccine delivery strategy in the
CRPV/HLA-A2.1 transgenic rabbit model?
Hypothesis #1
Previous studies have shown that adenoviral vectors [352], DNA plasmids [230],
and peptides [353] delivered using the tattoo gun induce strong humoral and cellular
responses in mice. These data demonstrate that different vaccine modalities delivered using the tattoo gun are immunogenic. Additionally, peptides delivered through two mucosal routes, intranasal and ocular, induced strong immune responses in HLA-A2.1 transgenic rabbits [342]. When peptide vaccination was combined with a single DNA vaccine dose delivered using the gene gun, complete protection was achieved [342].
Therefore, we hypothesize that vaccination of HLA-A2.1 transgenic rabbits with a combination of peptides delivered mucosally and peptides delivered using a tattoo gun could induce protective immune responses against CRPV DNA challenge. In the initial vaccine study, HLA-A2.1 transgenic rabbits would be vaccinated three times at 3-week intervals with the CRPV E1 303-311 peptide by the two mucosal routes as described by
[342]. In addition, these rabbits would also receive the same peptide vaccine at the
100ug dose delivered using the tattoo gun. An unrelated peptide delivered through all
234 three routes would serve as the negative control. In addition, mucosal delivery of the
peptide vaccine followed by a single DNA vaccine immunization would serve as the
positive control. One week following the final booster, rabbits would be challenged with
wild type CRPV DNA and papilloma GMDs would serve as the indicator of protection.
The data gleaned from these experiments could reveal if peptide immunization only is a
viable vaccination strategy and if the tattoo gun is a practical peptide delivery method in the CRPV/HLA-A2.1 transgenic rabbit model.
Aim 3. Identify and characterize HLA-A2.1 restricted CD8+ T cell targets
within the HPV16 E7 gene using the HHD mouse model and the CRPV/HLA-
A2.1 transgenic rabbit model.
At present, there remains only a handful of known HPV16 epitopes that can be
targeted by the immune system. In addition to this significant deficiency, there remains
insufficient knowledge about the types of immune responses generated to these
epitopes and whether or not these epitopes could serve as targets in protective or
therapeutic vaccines. Therefore, the focus of aim 3 was to identify new HLA-A2.1
restricted CD8+ T cell targets within the HPV16E7 gene and characterize these epitopes using two preclinical animal models.
Potential vaccine candidates were identified through literature searches and epitope prediction software. Based on previous studies as well as program scores, 7 potential candidates were chosen (Table 6.8). Four native sequenced epitopes and three sequence optimized epitopes were included for additional study. Initial in vitro
HLA-A2.1 binding studies, stability studies, and in vivo immunogenicity studies with HHD
mice further narrowed the vaccine candidates down to 5. The first potential vaccine
candidate examined was the sequence optimized HPV16 E7 49-57(opt) epitope.
235 Peptide vaccination of HHD mice with this epitope produced epitope specific functional
CTLs that recognized not only the optimized version but also the native sequence as well. Conversely, vaccination of HHD mice with the HPV16E7/49-57(opt) epitope DNA vaccine did not stimulate any detectable CTLs. Insertion of this epitope into CRPV E7
and CRPV E6 produced viable epitope-modified CRPV genomes. Protective vaccine studies carried out with the HPV16E7/49-57(opt) epitope DNA vaccine followed by challenge with the CRPV/E7ins49-57(opt) genome, CRPV/E6ins49-57(opt) genome, or the CRPV/E6-457ins49-57(opt) genome demonstrated that the 49-57(opt) epitope could be correctly processed and presented from the C-terminus of the CRPV E7 protein and suggested that this epitope was correctly processed and presented from the C-terminus of the CRPV E6 protein. Furthermore, these vaccination studies revealed that the
HPV16E7/49-57(opt) DNA vaccine generated immunity was partially protective in HLA-
A2.1 transgenic rabbits. However, as discussed in aim 1, spreading immunity was observed in the HLA-A2.1 transgenic rabbits challenged with the CRPV/E7ins49-57(opt) genome and an additional study to confirm that the vaccine generated immunity is epitope-specific remains necessary.
The success achieved with insertion of the 49-57(opt) epitope into the CRPV E6 gene was not duplicated upon insertion of the 82-90 epitope into the same two positions.
As a result not additional studies were carried out with the 82-90 epitope. The next three potential vaccine candidates examined were HPV16E7 11-19, 11-20, and 11-20(T9V).
In vivo immunogenicity studies carried out in the HHD mice indicated that both 11-19
and 11-20(T9V) were very immunogenic while 11-20 was marginally immunogenic. Due
to the sequence similarities between the three epitopes, additional immunogenicity
studies were carried out to determine if one epitope could substitute for another. These
studies revealed that 11-19 could not substitute for 11-20 or 11-20(T9V). However, 11-
20(T9V) was a more immunogenic epitope than the 11-20 epitope and CTLs recognizing
236 one epitope could recognize and respond to the other epitope. Insertion of HPV16E7
11-19 and 11-20 at the C-terminus of the CRPV E7 gene produced genomes with
compromised growth rates. However, a vaccine protection study was carried out with
the CRPV/E7ins 11-19 genome. This study revealed vaccination with the HPV16/E711-
19 epitope DNA vaccine followed by challenge with the CRPV/E7ins11-19 genome did
not demonstrate epitope-specific protection.
The data presented in Chapters V and VI not only provide evidence of a newly
identified HLA-A2.1 restricted HPV16E7 epitope but also present information about the
plasticity of the CRPV genome with respect to the CRPV E7 and the CRPV E6 genes.
These finding have implications for future vaccine studies using the CRPV/HLA-A2.1
transgenic rabbit model, with respect to methods used to embed epitopes, as well as
epitope placement. Additionally, the studies carried out in HHD mice suggest that the
HPV16E7 11-20(T9V) epitope would be a good vaccine candidate as CTLs primed
against this epitope can recognize the naturally processed and presented native 11-20
epitope. A future protective vaccine study with the 11-20(T9V) epitope should be carried
out once a suitable CRPV genome is made. Finally, while the correlation between the in vitro response versus the in vivo protection is imperfect this aim provides a solid
methodology for the identification and characterization of HLA-A2.1 restricted HPV
epitopes.
Future Studies
What are some additional strategies that can be employed to identify HLA-A2.1
restricted HPV epitopes?
Traditionally, HLA-A2.1 restricted HPV epitopes have been identified through the use of overlapping peptides containing HPV sequences in conjunction with T cell proliferation assays, ICS assays, and ELISPOT assays. However, this method is time
237 consuming and reagent intensive. Epitope prediction programs have been previously
used with great success in our laboratory [305] and were used to identify potential HLA-
A2.1 restricted HPV16 E7 epitopes for the studies carried out in Chapters V and VI.
However, with advancements in technology come new methods for epitope
identification. Two methods that have been used to successfully identify HLA-A2.1
restricted epitopes include MHCI-peptide and costimulatory microarrays [354] and caged
MHC class I tetramers [355]. The first method mentioned relies on microarrays
consisting of immobilized MHCI-peptide complexes, costimulatory molecules, and
cytokine capture antibodies that collectively act as synthetic APCs. Functional
information that results from interaction between synthetic APCs presenting a huge array
of potential epitopes and the T cells of interest can be examined with this method. The
second method is dependent on the production of caged MHC tetramers [356]. This
method allows for production of an assortment of MHC tetramers with defined specificity
that can be rapidly generated for screening of CD8+ T cell epitopes. With caged
tetramers, T cells of interest could be scanned with a huge collection of tetramers and
the specific T cell epitopes identified through flow cytometric analysis. Both methods
could potentially be used with primary PBMCs isolated from HPV infected human
patients as well as in conjunction with whole gene vaccination of HHD mice to produce
epitope specific CTLs for screening.
Can the tandem repeat genome strategy create viable genomes containing
epitopes in multiple CRPV early genes for future vaccination studies in the CRPV/HLA-
A2.1 transgenic rabbit model?
Hypothesis #1
In Chapter IV the tandem repeat genome strategy was successfully used to restore the growth rate of the CRPV genome containing the HPV16 E7 82-90 epitope
238 within the CRPV E7 gene to wild type levels. This same strategy has been used
previously to restore the viability of a nonviable genome [339]. We hypothesize that the
use of the tandem repeat genome strategy would allow for the creation of viable CRPV
genomes that contained epitope modifications in additional early genes including E6, E1
and E2. Previous studies with CRPV genomes containing the HPV16E7 49-57(opt)
epitope inserted at the C terminus and at bp position 457 of the E6 gene have resulted in
viable genomes (Chapter VI). In addition vaccine protection studies with the
CRPV/E6ins49-57(opt) suggested that this epitope could be targeted by epitope-specific immunity from this position (Chapter VI). Moreover, all the vaccination studies with the multivalent CRPV E1 epitope vaccine provide evidence that epitopes expressed within
the E1 protein are targeted by vaccine generated immunity [305] , (Chapter IV).
Consequently, we propose that the creation of tandem repeat genomes with epitopes
inserted at the two previously identified positions within the E6 gene as well as an
epitope at the C-terminus of the E7 gene and additional targets in currently unknown
positions of E1 and E2 would create additional reagents for future studies of the vaccine
generated immune responses to HLA-A2.1 restricted HPV epitopes.
Will a multivalent HPV epitope DNA vaccine generate a protective and/or
therapeutic immune response in the CRPV/HLA-A2.1 transgenic rabbit model?
Previous studies for out laboratory have demonstrated that a multivalent epitope
DNA vaccine is protective and can provide therapeutic intervention of CRPV induced disease [305]. Additionally, studies presented in Chapter III and described elsewhere
[222] demonstrate that the HPV16E7/82-90 epitope DNA vaccine can produce a cell- mediated immune response that is protective in vivo. Also studies discussed in Chapter
V demonstrate that the HPV16E7/49-57(opt) epitope DNA vaccine is partially protective
in vivo. Collectively, these data suggest that production of a multivalent HPV16E7
239 epitope DNA vaccine that can generate epitope-specific immune responses to targets of
choice is possible. However, one downside to an HPV16E7 multivalent epitope vaccine is the possibility of immunodominance, in which the vaccinated host’s immune system responds to only one or a few of the foreign epitopes presented in the synthetic vaccine protein. One method that has been described to overcome this potential problem is a vaccine cocktail in which each epitope is expressed from a separate DNA plasmid [357].
Therefore, a multivalent epitope DNA vaccine that includes HPV16E7 82-90, 49-57(opt), and potentially 11-20(T9V) as well as currently unidentified HPV18 E7 epitopes could offer broader epitope-specific protection and provide an additional reagent for future vaccination studies in the CRPV/HLA-A2.1 transgenic rabbit model.
Limitations of the CRPV/HLA-A2.1 transgenic rabbit model system
With every animal model there are certain limitations, and the CRPV/HLA-A2.1
transgenic rabbit model is no exception. Undoubtably there is a shortage of diagnostic
immunological reagents available for this model. For example, there is no antibody
available for the detection of rabbit IFN-g, making IFN-g ICS experiments impossible.
Secondly, there is a single supplier of these transgenic rabbits and experiments with
HLA-A2.1 transgenic rabbits requires months of preparation, as a minimum of 4 months
is necessary for generation of new usuable animals. Additionally, the CRPV/HLA-A2.1
transgenic rabbits are typically outbred which contributes to the variability in response
that is seen in vaccine experiments as well as other antiviral treatments. Papillomas
produced by wild type CRPV DNA are typically much larger than those seen in a clinical
seting although mutant genomes that produce smaller but persistent papillomas which
are more clinically relevant are available. Additionally, the papillomas produced in the
CRPV model are cutaneous and restricted to hair-bearing skin while mucosal HPVs are
240 associated with the highest morbidity in patients. However, this animal model is one of the few natural hosts available for study of the complete PV life cycle including progression to cancer and the CRPV/HLA-A2.1 transgenic rabbit model is the only available model in which the immune response to specific HPV epitopes can be studied in a host with an intact immune system during infection with a natural pathogen.
Concluding Remarks
In summary, this thesis demonstrates that the CRPV/HLA-A2.1 transgenic rabbit model is a unique and versatile tool for the exploration of multiple facets of vaccine generated protective immunity in a model of natural papillomavirus infection. The findings in the opening data chapter demonstrate for the first time that the CRPV L2 protein can be targeted by epitope-specific vaccine generated immunity in domestic rabbits naturally infected with CRPV. In this same chapter, studies describe epitope insertion via PCR-induced modification and demonstrate that this method of epitope relocation is a practical strategy. Lastly, studies in the first data chapter illustrate that the
C-terminus of the CRPV E7 gene contains plasticity and is amenable to modification through PCR. Collectively, the first chapter provides information about epitope-targeting in early and late genes that will impact future studies with respect to genome location of potential targets and methods for introducing epitopes into the CRPV genome.
The second data chapter provides comparative information about a second intradermal DNA vaccination strategy. The data in this chapter clearly demonstrate that the tattoo gun is a useful alternative to the gene gun. Additionally, the creation of a viable tandem repeat CRPV genome containing two E7 genes was described and used in protective vaccine studies. As a result, the Christiansen laboratory now has a second
DNA vaccination device that can be used as the primary vaccine delivery device or as a secondary back-up when the gene gun is being repaired. Secondly, a strategy that
241 allows epitopes to be relocated within the oncogenes of CRPV without reducing the
growthrate of the modified CRPV genome is an additional tool for future protective and
therapeutic studies.
The third data chapter confirms that the C-terminus of the CRPV E7 gene is
amenable to PCR modification and demonstrates that modification in this region is not
restricted to a single epitope sequence. Secondly, these studies demonstrate that
sequence modification of an epitope at the MHCI anchor residues can increase binding
affinity and MHCI/peptide complex stability, but these alterations may not allow
peptide/MHCI complex recognition of the native epitope sequence. Lastly, these studies
examine the relationship between in vitro induction versus in vivo protection and indicate that additional studies are necessary to define the threshhold by which in vitro outcomes predict complete protection in vivo.
The data in chapter 6 also provides in vitro induction information about a potential vaccine candidate, HPV16 E7 11-20(T9V). However, additional in vivo protection studies are still needed to determine if the immune response gnerated to this epitope provides protection from papillomavirus challenge. Secondly, data presented in this chapter also suggest that CRPV E6 is amenable to PCR-induced modification but epitope sequence has a greater effect on genome viability than modifications that were made to the E7 gene. Laslty, this chapter provides a step-by-step process for the identification and evaluation of HPV16E7 HLA-A2.1 restricted epitopes using epitope prediction programs and two HLA-A2.1 preclinicl animal models. However, this process is not restricted to HPV epitopes nor is it restricted to the HLA-A2.1 molecule. The two epitope prediction program used in these studies can predict epitopes that bind to a number of different class I and II HLA alleles as well as mouse class I and class II molecules. In addition, epitope predictions can be performed on any protein sequence that is available. The greatest limiting factor of this step-by-step process is the
242 availability of a suitable animal model for in vivo studies. Thus, the information gleaned from the studies carried out in chapter 6 have wide application in the hunt for epitopes against human pathogens.
243 References
[1] Howley PM and Knipe DM, editors.Field's Virology. 4th ed. Philadelphia: Lippincott- Raven; 2001.
[2] de Villiers EM, Fauquet C, Broker TR, Bernard HU, zur Hausen H. Classification of papillomaviruses. Virology 2004;324(1):17-27.
[3] Bernard HU. The clinical importance of the nomenclature, evolution and taxonomy of human papillomaviruses. Journal of Clinical Virology 2005;32:S1-S6
[4] Munoz N, Bosch FX, de Sanjose S, et al. Epidemiologic classification of human papillomavirus types associated with cervical cancer. New England Journal of Medicine 2003;348(6):518-27.
[5] Zheng ZM, Baker CC. Papillomavirus genome structure, expression, and post- transcriptional regulation. Frontiers in Bioscience 2006;11:2286-302.
[6] Gissmann L, Pfister H, Zurhausen H. Human Papilloma Viruses (Hpv) - Characterization of 4 Different Isolates. Virology 1977;76(2):569-80.
[7] Orth G, Favre M, Croissant O. Characterization of A New Type of Human Papillomavirus That Causes Skin Warts. Journal of Virology 1977;24(1):108-20.
[8] Favre M, Orth G, Croissant O, Yaniv M. Human Papillomavirus Dna - Physical Map. Proceedings of the National Academy of Sciences of the United States of America 1975;72(12):4810-4.
[9] zur Hausen H. Papillomavirus infections--a major cause of human cancers. Biochimica et Biophysica Acta 1996;1288(2):F55-78.
[10] Munoz N, Bosch FX, Castellsague X, et al. Against which human papillomavirus types shall we vaccinate and screen? The international perspective. International Journal of Cancer 2004;111(2):278-85.
[11] Doorbar J. Molecular biology of human papillomavirus infection and cervical cancer. Clinical Science 2006;110(5):525-41.
[12] Schiffman M, Castle PE, Jeronimo J, Rodriguez AC, Wacholder S. Human papillomavirus and cervical cancer. Lancet 2007;370(9590):890-907.
[13] Schlecht NF, Platt RW, Duarte-Franco E, et al. Human papillomavirus infection and time to progression and regression of cervical intraepithelial neoplasia. Journal of the National Cancer Institute 2003;95(17):1336-43.
[14] Goldie SJ, Grima D, Kohli M, Wright TC, Weinstein M, Franco E. A comprehensive natural history model of HPV infection and cervical cancer to estimate the clinical impact of a prophylactic HPV-16/18 vaccine. International Journal of Cancer 2003;106(6):896- 904.
244 [15] Walboomers JMM, Jacobs MV, Manos MM, et al. Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. Journal of Pathology 1999;189(1):12-9.
[16] Parkin DM, Bray F. The burden of HPV-related cancers. Vaccine 2006;24:11-25.
[17] Middleton K, Peh W, Southern S, et al. Organization of human papillomavirus productive cycle during neoplastic progression provides a basis for selection of diagnostic markers. Journal of Virology 2003;77(19):10186-201.
[18] Cullen AP, Reid R, Campion M, Lorincz AT. Analysis of the Physical State of Different Human Papillomavirus Dnas in Intraepithelial and Invasive Cervical Neoplasm. Journal of Virology 1991;65(2):606-12.
[19] Wentzensen N, Vinokurova S, Doeberitz MV. Systematic review of genomic integration sites of human papillomavirus genomes in epithelial dysplasia and invasive cancer of the female lower genital tract. Cancer Research 2004;64(11):3878-84.
[20] Schwarz E, Freese UK, Gissmann L, et al. Structure and Transcription of Human Papillomavirus Sequences in Cervical-Carcinoma Cells. Nature 1985;314(6006):111-4.
[21] Wright TC, Ellerbrock TV, Chiasson MA, et al. Cervical Intraepithelial Neoplasia in Women Infected with Human-Immunodeficiency-Virus - Prevalence, Risk-Factors, and Validity of Papanicolaou Smears. Obstetrics and Gynecology 1994;84(4):591-7.
[22] Byrne MA, Taylorrobinson D, Munday PE, Harris JRW. The Common Occurrence of Human Papillomavirus Infection and Intraepithelial Neoplasia in Women Infected by Hiv. Aids 1989;3(6):379-82.
[23] Henry MJ, Stanley MW, Cruikshank S, Carson L. Association of Human Immunodeficiency Virus-Induced Immunosuppression with Human Papillomavirus Infection and Cervical Intraepithelial Neoplasia. American Journal of Obstetrics and Gynecology 1989;160(2):352-3.
[24] Maiman M, Fruchter RG, Serur E, Levine PA, Arrastia CD, Sedlis A. Recurrent Cervical Intraepithelial Neoplasia in Human Immunodeficiency Virus-Seropositive Women. Obstetrics and Gynecology 1993;82(2):170-4.
[25] Frisch M, Biggar IJ, Goedert JJ. Human papillomavirus-associated cancers in patients with human immunodeficiency virus infection and acquired immunodeficiency syndrome. Journal of the National Cancer Institute 2000;92(18):1500-10.
[26] Palefsky JM, Holly EA, Ralston ML, Jay N. Prevalence and risk factors for human papillomavirus infection of the anal canal in human immunodeficiency virus (HIV)- positive and HIV-negative homosexual men. Journal of Infectious Diseases 1998;177(2):361-7.
[27] Heard I, Palefsky JM, Kazatchkine MD. The impact of HIV antiviral therapy on human papillomavirus (HPV) infections and HPV-related diseases. Antiviral Therapy 2004;9(1):13-22.
245 [28] Palefsky JM, Holly EA, Efirdc JT, et al. Anal intraepithelial neoplasia in the highly active antiretroviral therapy era among HIV-positive men who have sex with men. Aids 2005;19(13):1407-14.
[29] Bower M, Powles T, Newsom-Davis T, Thirwell C, Stebbing J, Mandalia S. HIV- Associated Anal Cancer: Has Highly Active Antiretroviral Therapy Reduced the Incidence or Improved the Outcome? Journal of Acquired Immunodeficiency Syndrome 2004;37(5):1563-5.
[30] Adami J, Gabel H, Lindelof B, et al. Cancer risk following organ transplantation: a nationwide cohort study in Sweden. British Journal of Cancer 2003;89(7):1221-7.
[31] Roka S, Rasoul-Rockenschaub S, Roka J, Kirnbauer R, Muhlbacher F, Salat A. Prevalence of anal HPV infection in solid-organ transplant patients prior to immunosuppression. Transplant International 2004;17(7):366-9.
[32] Patel HS, Silver AR, Northover JM. Anal cancer in renal transplant patients. International Journal of Colorectal Disease 2007;22(1):1-5.
[33] Gunter J. Genital and perianal warts: New treatment opportunities for human papillomavirus infection. American Journal of Obstetrics and Gynecology 2003;189(3):S3-S11
[34] Centers for Disease Control and Prevention. Sexually transmitted diseases, treatment guidelines. Morbidity and Mortality Weekly Report. Atlanta: 2002; 51
[35] Maw RD. Treatment of anogenital warts. Dermatologic Clinics 1998;16(4):829-34.
[36] Singer A and Monoghan JM, editors.Lower genital tract precancer. Colposcopy, pathology and treatment. 2nd ed. Oxford, U.K.: Blackwell Science; 2000.
[37] Soutter WP, Lopes AD, Fletcher A, et al. Invasive cervical cancer after conservative therapy for cervical intraepithelial neoplasia. Lancet 1997;349(9057):978-80.
[38] Lambert PF, Spalholz BA, Howley PM. A Transcriptional Repressor Encoded by Bpv-1 Shares A Common Carboxy-Terminal Domain with the E2 Transactivator. Cell 1987;50(1):69-78.
[39] Stubenrauch F, Zobel T, Iftner T. The E8 domain confers a novel long-distance transcriptional repression activity on the E8-over-cap-E2C protein of high-risk human papillomavirus type 31. Journal of Virology 2001;75(9):4139-49.
[40] Stubenrauch F, Hummel M, Iftner T, Laimins LA. The E8 - E2C protein, a negative regulator of viral transcription and replication, is required for extrachromosomal maintenance of human papillomavirus type 31 in keratinocytes. Journal of Virology 2000;74(3):1178-86.
[41] Harry JB, Wettstein FO. Transforming properties of the cottontail rabbit papillomavirus oncoproteins LE6 and SE6 and of the E8 protein. Journal of Virology 1996;70(6):3355-62.
246 [42] Smotkin D, Wettstein FO. Transcription of Human Papillomavirus Type-16 Early Genes in A Cervical-Cancer and A Cancer-Derived Cell-Line and Identification of the E7- Protein. Proceedings of the National Academy of Sciences of the United States of America 1986;83(13):4680-4.
[43] Grassmann K, Rapp B, Maschek H, Petry KU, Iftner T. Identification of a differentiation-inducible promoter in the E7 open reading frame of human papillomavirus type 16 (HPV-16) in raft cultures of a new cell line containing high copy numbers of episomal HPV-16 DNA. Journal of Virology 1996;70(4):2339-49.
[44] Culp TD, Christensen ND. Kinetics of in vitro adsorption and entry of papillomavirus virions. Virology 2004;319(1):152-61.
[45] Wilson VG, West M, Woytek K, Rangasamy D. Papillomavirus E1 proteins: Form, function, and features. Virus Genes 2002;24(3):275-90.
[46] You J, Croyle JL, Nishimura A, Ozato K, Howley PM. Interaction of the bovine papillomavirus E2 protein with Brd4 tethers the viral DNA to host mitotic chromosomes. Cell 2004;117(3):349-60.
[47] McPhillips MG, Ozato K, McBride AA. Interaction of bovine papillomavirus E2 protein with Brd4 stabilizes its association with chromatin. Journal of Virology 2005;79(14):8920-32.
[48] Androphy EJ, Lowy DR, Schiller JT. Bovine Papillomavirus E2 Trans-Activating Gene-Product Binds to Specific Sites in Papillomavirus Dna. Nature 1987;325(6099):70-3.
[49] Ustav M, Ustav E, Szymanski P, Stenlund A. Identification of the Origin of Replication of Bovine Papillomavirus and Characterization of the Viral Origin Recognition Factor-E1. Embo Journal 1991;10(13):4321-9.
[50] Dell G, Wilkinson KW, Tranter R, Parish J, Brady L, Gaston K. Comparison of the structure and DNA-binding properties of the E2 proteins from an oncogenic and a non- oncogenic human papillomavirus. Journal of Molecular Biology 2003;334(5):979-91.
[51] Mohr IJ, Clark R, Sun S, Androphy EJ, Macpherson P, Botchan MR. Targeting the E1 Replication Protein to the Papillomavirus Origin of Replication by Complex-Formation with the E2 Transactivator. Science 1990;250(4988):1694-9.
[52] Blitz IL, Laimins LA. The 68-Kilodalton E1 Protein of Bovine Papillomavirus Is A Dna-Binding Phosphoprotein Which Associates with the E2 Transcriptional Activator Invitro. Journal of Virology 1991;65(2):649-56.
[53] Sedman J, Stenlund A. Co-operative interaction between the initiator E1 and the transcriptional activator E2 is required for replicator specific DNA replication of bovine papillomavirus in vivo and in vitro. Embo Journal 1995;14(24):6218-28.
[54] Seo YS, Muller F, Lusky M, et al. Bovine Papilloma-Virus (Bpv)-Encoded E2 Protein Enhances Binding of E1 Protein to the Bpv Replication Origin. Proceedings of the National Academy of Sciences of the United States of America 1993;90(7):2865-9.
247 [55] Loo YM, Melendy T. Recruitment of replication protein A by the papillomavirus E1 protein and modulation by single-stranded DNA. Journal of Virology 2004;78(4):1605- 15.
[56] Han YF, Loo YM, Militello KT, Melendy T. Interactions of the papovavirus DNA replication initiator proteins, bovine papillomavirus type 1 E1 and simian virus 40 large T antigen, with human replication protein A. Journal of Virology 1999;73(6):4899-907.
[57] Frazer IH. Prevention of cervical cancer through papillomavirus vaccination. Nature Reviews Immunology 2004;4(1):46-55.
[58] Masterson PJ, Stanley MA, Lewis AP, Romanos MA. A C-terminal helicase domain of the human papillomavirus el protein binds E2 and the DNA polymerase alpha-primase p68 subunit. Journal of Virology 1998;72(9):7407-19.
[59] Conger KL, Liu JS, Kuo SR, Chow LT, Wang TSF. Human papillomavirus DNA replication - Interactions between the viral E1 protein and two subunits of human DNA polymerase alpha/primase. Journal of Biological Chemistry 1999;274(5):2696-705.
[60] Titolo S, Pelletier A, Sauve F, et al. Role of the ATP-binding domain of the human papillomavirus type 11 E1 helicase in E2-dependent binding to the origin. Journal of Virology 1999;73(7):5282-93.
[61] Thierry F, Yaniv M. The Bpv1-E2 Trans-Acting Protein Can be Either An Activator Or A Repressor of the Hpv18 Regulatory Region. Embo Journal 1987;6(11):3391-7.
[62] Cripe TP, Haugen TH, Turk JP, et al. Transcriptional Regulation of the Human Papillomavirus-16 E6-E7 Promoter by A Keratinocyte-Dependent Enhancer, and by Viral E2 Transactivator and Repressor Gene-Products - Implications for Cervical Carcinogenesis. Embo Journal 1987;6(12):3745-53.
[63] Rapp B, Pawellek A, Kraetzer F, et al. Cell-type-specific separate regulation of the E6 and E7 promoters of human papillomavirus type 6a by the viral transcription factor E2. Journal of Virology 1997;71(9):6956-66.
[64] Steger G, Corbach S. Dose-dependent regulation of the early promoter of human papillomavirus type 18 by the viral E2 protein. Journal of Virology 1997;71(1):50-8.
[65] Thomas JT, Hubert WG, Ruesch MN, Laimins LA. Human papillomavirus type 31 oncoproteins E6 and E7 are required for the maintenance of episomes during the viral life cycle in normal human keratinocytes. Proceedings of the National Academy of Sciences of the United States of America 1999;96(15):8449-54.
[66] Dyson N, Howley PM, Munger K, Harlow E. The Human Papilloma Virus-16 E7- Oncoprotein Is Able to Bind to the Retinoblastoma Gene-Product. Science 1989;243(4893):934-7.
248 [67] Chellappan S, Kraus VB, Kroger B, et al. Adenovirus-E1A, Simian Virus-40 Tumor- Antigen, and Human Papillomavirus-E7 Protein Share the Capacity to Disrupt the Interaction Between Transcription Factor-E2F and the Retinoblastoma Gene-Product. Proceedings of the National Academy of Sciences of the United States of America 1992;89(10):4549-53.
[68] Funk JO, Waga S, Harry JB, Espling E, Stillman B, Galloway DA. Inhibition of CDK activity and PCNA-dependent DNA replication by p21 is blocked by interaction with the HPV-16 E7 oncoprotein. Genes & Development 1997;11(16):2090-100.
[69] ZerfassThome K, Zwerschke W, Mannhardt B, Tindle R, Botz JW, JansenDurr P. Inactivation of the cdk inhibitor p27(KIP1) by the human papillomavirus type 16 E7 oncoprotein. Oncogene 1996;13(11):2323-30.
[70] Longworth MS, Laimins LA. The binding of histone deacetylases and the integrity of zinc finger-like motifs of the E7 protein are essential for the life cycle of human papillomavirus type 31. Journal of Virology 2004;78(7):3533-41.
[71] Crook T, Tidy JA, Vousden KH. Degradation of P53 Can be Targeted by Hpv E6 Sequences Distinct from Those Required for P53 Binding and Transactivation. Cell 1991;67(3):547-56.
[72] Elbel M, Carl S, Spaderna S, Iftner T. A comparative analysis of the interactions of the E6 proteins from cutaneous and genital papillomaviruses with p53 and E6AP in correlation to their transforming potential. Virology 1997;239(1):132-49.
[73] Huibregtse JM, Scheffner M, Howley PM. Localization of the E6-Ap Regions That Direct Human Papillomavirus E6 Binding, Association with P53, and Ubiquitination of Associated Proteins. Molecular and Cellular Biology 1993;13(8):4918-27.
[74] Huibregtse JM, Scheffner M, Howley PM. Cloning and Expression of the Cdna for E6-Ap, A Protein That Mediates the Interaction of the Human Papillomavirus E6 Oncoprotein with P53. Molecular and Cellular Biology 1993;13(2):775-84.
[75] Scheffner M, Werness BA, Huibregtse JM, Levine AJ, Howley PM. The E6 Oncoprotein Encoded by Human Papillomavirus Type-16 and Type-18 Promotes the Degradation of P53. Cell 1990;63(6):1129-36.
[76] Thomas M, Banks L. Inhibition of Bak-induced apoptosis by HPV-18 E6. Oncogene 1998;17(23):2943-54.
[77] Li BY, Dou QP. Bax degradation by the ubiquitin/proteasome-dependent pathway: involvement in tumor survival and progression. Proceedings of the National Academy of Sciences of the United States of America 2000;97(8):3850-5.
[78] Nguyen ML, Nguyen MM, Lee D, Griep AE, Lambert PF. The PDZ ligand domain of the human papillomavirus type 16 E6 protein is required for E6's induction of epithelial hyperplasia in vivo. Journal of Virology 2003;77(12):6957-64.
249 [79] Gage JR, Meyers C, Wettstein FO. The E7 Proteins of the Nononcogenic Human Papillomavirus Type-6B (Hpv-6B) and of the Oncogenic Hpv-16 Differ in Retinoblastoma Protein-Binding and Other Properties. Journal of Virology 1990;64(2):723-30.
[80] Halbert CL, Demers GW, Galloway DA. The E6-Gene and E7-Gene of Human Papillomavirus Type-6 Have Weak Immortalizing Activity in Human Epithelial-Cells. Journal of Virology 1992;66(4):2125-34.
[81] Crusius K, Rodriguez I, Alonso A. The human papillomavirus type 16 E5 protein modulates ERK1/2 and p38 MAP kinase activation by an EGFR-Independent process in stressed human keratinocytes. Virus Genes 2000;20(1):65-9.
[82] Peh WL, Brandsma JL, Christensen ND, Cladel NM, Wu X, Doorbar J. The viral E4 protein is required for the completion of the cottontail rabbit papillomavirus productive cycle in vivo. Journal of Virology 2004;78(4):2142-51.
[83] Davy CE, Jackson DJ, Raj K, et al. Human papillornavirus type 16 E1and E4- induced G(2) arrest is associated with cytoplasmic retention of active Cdk1/Cyclin B1 complexese. Journal of Virology 2005;79(7):3998-4011.
[84] Nakahara T, Nishimura A, Tanaka M, Ueno T, Ishimoto A, Sakai H. Modulation of the cell division cycle by human papillomavirus type 18 E4. Journal of Virology 2002;76(21):10914-20.
[85] Doorbar J, Gallimore PH. Identification of Proteins Encoded by the L1 and L2 Open Reading Frames of Human Papillomavirus-1A. Journal of Virology 1987;61(9):2793-9.
[86] Doorbar J, Foo C, Coleman N, et al. Characterization of events during the late stages of HPV16 infection in vivo using high-affinity synthetic Fabs to E4. Virology 1997;238(1):40-52.
[87] Florin L, Sapp C, Streeck RE, Sapp M. Assembly and translocation of papillomavirus capsid proteins. Journal of Virology 2002;76(19):10009-14.
[88] Day PM, Roden RBS, Lowy DR, Schiller JT. The papillomavirus minor capsid protein, L2, induces localization of the major capsid protein, L1, and the viral transcription/replication protein, E2, to PML oncogenic domains. Journal of Virology 1998;72(1):142-50.
[89] Fay A, Yutzy WH, Roden RBS, Moroianu J. The positively charged termini of L2 minor capsid protein required for bovine papillomavirus infection function separately in nuclear import and DNA binding. Journal of Virology 2004;78(24):13447-54.
[90] Finnen RL, Erickson KD, Chen XJS, Garcea RL. Interactions between papillomavirus L1 and L2 capsid proteins. Journal of Virology 2003;77(8):4818-26.
[91] Modis Y, Trus BL, Harrison SC. Atomic model of the papillomavirus capsid. Embo Journal 2002;21(18):4754-62.
[92] Knowles G, Oneil BW, Campo MS. Phenotypical characterization of lymphocytes infiltrating regressing papillomas. Journal of Virology 1996;70(12):8451-8.
250 [93] Selvakumar R, Schmitt A, Iftner T, Ahmed R, Wettstein FO. Regression of papillomas induced by cottontail rabbit papillomavirus is associated with infiltration of CD8+ cells and persistence of viral DNA after regression. Journal of Virology 1997;71(7):5540-8.
[94] Okabayashi M, Angell MG, Christensen ND, Kreider JW. Morphometric Analysis and Identification of Infiltrating Leukocytes in Regressing and Progressing Shope Rabbit Papillomas. International Journal of Cancer 1991;49(6):919-23.
[95] Hong K, Greer CE, Ketter N, VanNest G, Paliard X. Isolation and characterization of human papillomavirus type 6-specific T cells infiltrating genital warts. Journal of Virology 1997;71(9):6427-32.
[96] Iwatsuki K, Tagami H, Takigawa M, Yamada M. Plane Warts Under Spontaneous Regression - Immunopathologic Study on Cellular-Constituents Leading to the Inflammatory Reaction. Archives of Dermatology 1986;122(6):655-9.
[97] Coleman N, Birley HDL, Renton AM, et al. Immunological Events in Regressing Genital Warts. American Journal of Clinical Pathology 1994;102(6):768-74.
[98] Hagari Y, Budgeon L, Pickel M, Kreider J. Association of tumor necrosis factor- alpha gene expression and apoptotic cell death with regression of Shope papillomas. Journal of Investigative Dermatology 1995;104(4):526-9.
[99] Stanley MA. Immunobiology of papillomavirus infections. Journal of Reproductive Immunology 2001;52(1-2):45-59.
[100] Hoffmann TK, Arsov C, Schirlau K, et al. T cells specific for HPV16 E7 epitopes in patients with squamous cell carcinoma of the oropharynx. International Journal of Cancer 2006;118(8):1984-91.
[101] Nakagawa M, Stites DP, Palefsky JM, Kneass Z, Moscicki AB. CD4-positive and CD8-positive cytotoxic T lymphocytes contribute to human papillomavirus type 16 E6 and E7 responses. Clinical and Diagnostic Laboratory Immunology 1999;6(4):494-8.
[102] Evans EML, Man S, Evans AS, Borysiewicz LK. Infiltration of cervical cancer tissue with human papillomavirus-specific cytotoxic T-lymphocytes. Cancer Research 1997;57(14):2943-50.
[103] de Jong A, van der Burg SH, Kwappenberg KMC, et al. Frequent detection of human papillomavirus 16 E2-specific T-helper immunity in healthy subjects. Cancer Research 2002;62(2):472-9.
[104] de Jong A, van Poelgeest MIE, van der Hulst JM, et al. Human papillomavirus type 16-positive cervical cancer is associated with impaired CD4+T-cell immunity against early antigens E2 and E6. Cancer Research 2004;64(15):5449-55.
[105] Welters MJP, de Jong A, van den Eeden SJF, et al. Frequent display of human papillomavirus type 16 E6-specific memory T-helper cells in the healthy population as witness of previous viral encounter. Cancer Research 2003;63(3):636-41.
251 [106] Williams OM, Hart KW, Wang ECY, Gelder CM. Analysis of CD4(+) T-cell responses to human papillomavirus (HPV) type 11 L1 in healthy adults reveals a high degree of responsiveness and cross-reactivity with other HPV types. Journal of Virology 2002;76(15):7418-29.
[107] Jain S, Moore RA, Anderson DM, Gough GW, Stanley MA. Cell-mediated immune responses to COPV early proteins. Virology 2006;356(1-2):23-34.
[108] Nicholls PK, Moore PF, Anderson DM, et al. Regression of canine oral papillomas is associated with infiltration of CD4+and CD8+lymphocytes. Virology 2001;283(1):31-9.
[109] Selvakumar R, Ahmed R, Wettstein FO. Tumor-Regression Is Associated with A Specific Immune-Response to the E2 Protein of Cottontail Rabbit Papillomavirus. Virology 1995;208(1):298-302.
[110] Selvakumar R, Borenstein LA, Lin YL, Ahmed R, Wettstein FO. T-Cell Response to Cottontail Rabbit Papillomavirus Structural Proteins in Infected-Rabbits. Journal of Virology 1994;68(6):4043-8.
[111] Palefsky JM, Gillison ML, Strickler HD. HPV vaccines in immunocompromised women and men. Vaccine 2006;24:140-6.
[112] Laga M, Icenogle JP, Marsella R, et al. Genital Papillomavirus Infection and Cervical Dysplasia - Opportunistic Complications of Hiv-Infection. International Journal of Cancer 1992;50(1):45-8.
[113] Dejongtieben LM, Berkhout RJM, Smits HL, et al. High-Frequency of Detection of Epidermodysplasia Verruciformis-Associated Human Papillomavirus Dna in Biopsies from Malignant and Premalignant Skin-Lesions from Renal-Transplant Recipients. Journal of Investigative Dermatology 1995;105(3):367-71.
[114] Ho GYF, Bierman R, Beardsley L, Chang CJ, Burk RD. Natural history of cervicovaginal papillomavirus infection in young women. New England Journal of Medicine 1998;338(7):423-8.
[115] Moscicki A, Schiffman M, Kjaer S, Villa L. Chapter 5: Updating the natural history of HPV and anogenital cancer. Vaccine 2006;24 (Supplement 3):42-51.
[116] Nicholls PK, Klaunberg BA, Moore RA, et al. Naturally occurring, nonregressing canine oral papillomavirus infection: Host immunity, virus characterization, and experimental infection. Virology 1999;265(2):365-74.
[117] Wideroff L, Schiffman MH, Nonnenmacher B, et al. Evaluation of Seroreactivity to Human Papillomavirus Type-16 Virus-Like Particles in An Incident Case-Control Study of Cervical Neoplasia. Journal of Infectious Diseases 1995;172(6):1425-30.
[118] Carter JJ, Wipf GC, Hagensee ME, et al. Use of Human Papillomavirus Type-6 Capsids to Detect Antibodies in People with Genital Warts. Journal of Infectious Diseases 1995;172(1):11-8.
252 [119] Carter JJ, Koutsky LA, Wipf GC, et al. The natural history of human papillomavirus type 16 capsid antibodies among a cohort of university women. Journal of Infectious Diseases 1996;174(5):927-36.
[120] Carter JJ, Koutsky LA, Hughes JP, et al. Comparison of human papillomavirus types 16, 18, and 6 capsid antibody responses following incident infection. Journal of Infectious Diseases 2000;181(6):1911-9.
[121] Kirnbauer R, Hubbert NL, Wheeler CM, Becker TM, Lowy DR, Schiller JT. A Virus- Like Particle Enzyme-Linked-Immunosorbent-Assay Detects Serum Antibodies in A Majority of Women Infected with Human Papillomavirus Type-16. Journal of the National Cancer Institute 1994;86(7):494-9.
[122] Le Cann P, Touze A, Enogat N, et al. Detection of antibodies against human papillomavirus (HPV) type 16 virions by enzyme-linked immunosorbent assay using recombinant HPV 16 L1 capsids produced by recombinant baculovirus. Journal of Clinical Microbiology 1995;33(5):1380-2.
[123] Dillner J. The serological response to papillomaviruses. Seminars in Cancer Biology 1999;9(6):423-30.
[124] Kanda T, Teshima H, Katase K, et al. Occurrence of the antibody against human papillomavirus type 16 virion protein L2 in patients with cervical cancer and dysplasia. Intervirology 1995;38(3-4):187-91.
[125] Jochmus-Kudielka I, Schneider A, Braun R, et al. Antibodies against the human papillomavirus type 16 early proteins in human sera: correlation of anti-E7 reactivity with cervical cancer. Journal of the National Cancer Institute 1989;81(22):1698-704.
[126] Degeest K, Turyk ME, Hosken MI, Hudson JB, Laimins LA, Wilbanks GD. Growth and Differentiation of Human Papillomavirus Type-31B Positive Human Cervical Cell- Lines. Gynecologic Oncology 1993;49(3):303-10.
[127] Stanley MA, Browne HM, Appleby M, Minson AC. Properties of A Non-Tumorigenic Human Cervical Keratinocyte Cell-Line. International Journal of Cancer 1989;43(4):672-6.
[128] Stubenrauch F, Lim HB, Laimins LA. Differential requirements for conserved E2 binding sites in the life cycle of oncogenic human papillomavirus type 31. Journal of Virology 1998;72(2):1071-7.
[129] Frattini MG, Lim HB, Laimins LA. In vitro synthesis of oncogenic human papillomaviruses requires episomal genomes for differentiation-dependent late expression. Proceedings of the National Academy of Sciences of the United States of America 1996;93(7):3062-7.
[130] Genther SM, Sterling S, Duensing S, Munger K, Sattler C, Lambert PF. Quantitative role of the human papillomavirus type 16 E5 gene during the productive stage of the viral life cycle. Journal of Virology 2003;77(5):2832-42.
253 [131] Ozbun MA, Meyers C. Temporal usage of multiple promoters during the life cycle of human papillomavirus type 31b. Journal of Virology 1998;72(4):2715-22.
[132] Jeon S, Lambert PF. Integration of Human Papillomavirus Type-16 Dna Into the Human Genome Leads to Increased Stability of E6 and E7 Messenger-Rnas - Implications for Cervical Carcinogenesis. Proceedings of the National Academy of Sciences of the United States of America 1995;92(5):1654-8.
[133] Kristiansen E, Jenkins A, Holm R. Coexistence of Episomal and Integrated Hpv16 Dna in Squamous-Cell Carcinoma of the Cervix. Journal of Clinical Pathology 1994;47(3):253-6.
[134] Park JS, Hwang ES, Park SN, et al. Physical status and expression of HPV genes in cervical cancers. Gynecologic Oncology 1997;65(1):121-9.
[135] Kupper TS, Fuhlbrigge RC. Immune surveillance in the skin: Mechanisms and clinical consequences. Nature Reviews Immunology 2004;4(3):211-22.
[136] Greenfield I, Nickerson J, Penman S, Stanley M. Human Papillomavirus-16 E7- Protein Is Associated with the Nuclear Matrix. Proceedings of the National Academy of Sciences of the United States of America 1991;88(24):11217-21.
[137] Stoler MH, Rhodes CR, Whitbeck A, Wolinsky SM, Chow LT, Broker TR. Human Papillomavirus Type-16 and Type-18 Gene-Expression in Cervical Neoplasias. Human Pathology 1992;23(2):117-28.
[138] Cason J, Patel D, Naylor J, et al. Identification of Immunogenic Regions of the Major Coat Protein of Human Papillomavirus Type-16 That Contain Type-Restricted Epitopes. Journal of General Virology 1989;70:2973-87.
[139] Rudolf MP, Nieland JD, DaSilva DM, et al. Induction of HPV16 capsid protein- specific human T cell responses by virus-like particles. Biological Chemistry 1999;380(3):335-40.
[140] Ashrafi GH, Haghshenas MR, Marchetti B, O'Brien PM, Campo MS. E5 protein of human papillomavirus type 16 selectively downregulates surface HLA class I. International Journal of Cancer 2005;113(2):276-83.
[141] Marchetti B, Ashrafi GH, Tsirimonaki E, O'Brien PM, Campo MS. The bovine papillomavirus oncoprotein E5 retains MHC class I molecules in the Golgi apparatus and prevents their transport to the cell surface. Oncogene 2002;21(51):7808-16.
[142] Le Bon A, Tough DF. Links between innate and adaptive immunity via type I interferon. Current Opinion in Immunology 2002;14(4):432-6.
[143] Barnard P, McMillan NAJ. The human papillomavirus E7 oncoprotein abrogates signaling mediated by interferon-alpha. Virology 1999;259(2):305-13.
[144] Barnard P, Payne E, McMillan NAJ. The human papillomavirus E7 protein is able to inhibit the antiviral and anti-growth functions of interferon-alpha. Virology 2000;277(2):411-9.
254 [145] Ronco LV, Karpova AY, Vidal M, Howley PM. Human papillomavirus 16 E6 oncoprotein binds to interferon regulatory factor-3 and inhibits its transcriptional activity. Genes & Development 1998;12(13):2061-72.
[146] Platanias LC. Mechanisms of type-I- and type-II-interferon-mediated signalling. Nature Reviews Immunology 2005;5(5):375-86.
[147] Park JS, Kim EJ, Kwon HJ, Hwang ES, Namkoong SE, Um SJ. Inactivation of interferon regulatory factor-1 tumor suppressor protein by HPV E7 oncoprotein - Implication for the E7-mediated immune evasion mechanism in cervical carcinogenesis. Journal of Biological Chemistry 2000;275(10):6764-9.
[148] Nees M, Geoghegan JM, Hyman T, Frank S, Miller L, Woodworth CD. Papillomavirus type 16 oncogenes downregulate expression of interferon-responsive genes and upregulate proliferation-associated and NF-kappa B-responsive genes in cervical keratinocytes. Journal of Virology 2001;75(9):4283-96.
[149] Budunova IV, Perez P, Vaden VR, Spiegelman VS, Slaga TJ, Jorcano JL. Increased expression of p50-NF-kappa B and constitutive activation of NF-kappa B transcription factors during mouse skin carcinogenesis. Oncogene 1999;18(52):7423- 31.
[150] Hubert P, Calberg JH, Gilles C, et al. E-cadherin-dependent adhesion of dendritic and Langerhans cells to keratinocytes is defective in cervical human papillomavirus- associated (pre)neoplastic lesions. Journal of Pathology 2005;206(3):346-55.
[151] Mcardle JP, Muller HK. Quantitative Assessment of Langerhans Cells in Human Cervical Intraepithelial Neoplasia and Wart Virus-Infection. American Journal of Obstetrics and Gynecology 1986;154(3):509-15.
[152] Tang AM, Amagai M, Granger LG, Stanley JR, Udey MC. Adhesion of Epidermal Langerhans Cells to Keratinocytes Mediated by E-Cadherin. Nature 1993;361(6407):82-5.
[153] Jakob T, Udey MC. Regulation of E-cadherin-mediated adhesion in Langerhans cell-like dendritic cells by inflammatory mediators that mobilize Langerhans cells in vivo. Journal of Immunology 1998;160(8):4067-73.
[154] Laurson J, Khan S, Chung R, Cross K, Raj K. Epigenetic repression of E-cadherin by human papillomavirus 16 E7 protein. Carcinogenesis 2010;31(5):918-26.
[155] Lenz P, Day PM, Pang YYS, et al. Papillomavirus-like particles induce acute activation of dendritic cells. Journal of Immunology 2001;166(9):5346-55.
[156] Rudolf MP, Fausch SC, Da Silva DM, Kast WM. Human dendritic cells are activated by chimeric human papillomavirus type-16 virus-like particles and induce epitope-specific human T cell responses in vitro. Journal of Immunology 2001;166(10):5917-24.
255 [157] De Witte L, Zoughlami Y, Aengeneyndt B, et al. Binding of human papilloma virus L1 virus-like particles to dendritic cells is mediated through heparan sulfates and induces immune activation. Immunobiology 2007;212(9-10):679-91.
[158] Bousarghin L, Hubert P, Franzen E, Jacobs N, Boniver J, Delvenne P. Human papillomavirus 16 virus-like particles use heparan sulfates to bind dendritic cells and colocalize with langerin in Langerhans cells. Journal of General Virology 2005;86:1297- 305.
[159] Fausch SC, Da Silva DM, Kast WM. Differential uptake and cross-presentation of human papillomavirus virus-like particles by dendritic cells and Langerhans cells. Cancer Research 2003;63(13):3478-82.
[160] Fausch SC, Da Silva DM, Rudolf MP, Kast WM. Human papillomavirus virus-like particles do not activate langerhans cells: A possible immune escape mechanism used by human papillomaviruses. Journal of Immunology 2002;169(6):3242-9.
[161] Fausch SC, Fahey LM, Da Silva DM, Kast WM. Human papillomavirus can escape immune recognition through Langerhans cell phosphoinositide 3-kinase activation. Journal of Immunology 2005;174(11):7172-8.
[162] Fahey LM, Raff AB, Da Silva DM, Kast WM. Reversal of Human Papillomavirus- Specific T Cell Immune Suppression through TLR Agonist Treatment of Langerhans Cells Exposed to Human Papillomavirus Type 16. Journal of Immunology 2009;182(5):2919-28.
[163] Grantham R, Gautier C, Gouy M. Codon Frequencies in 119 Individual Genes Confirm Consistent Choices of Degenerate Bases According to Genome Type. Nucleic Acids Research 1980;8(9):1893-912.
[164] Shackelton LA, Parrish CR, Holmes EC. Evolutionary basis of codon usage and nucleotide composition bias in vertebrate DNA viruses. Journal of Molecular Evolution 2006;62(5):551-63.
[165] Trindle RW. Immune evasion in human papillomavirus-associated cervical cancer. Nature Reviews Cancer 2002;2(1):59-65.
[166] Zhou J, Liu WJ, Peng SW, Sun XY, Frazer I. Papillomavirus capsid protein expression level depends on the match between codon usage and tRNA availability. Journal of Virology 1999;73(6):4972-82.
[167] Liu WJ, Gao FG, Zhao KN, et al. Codon modified human papillomavirus type 16 E7 DNA vaccine enhances cytotoxic T-lymphocyte induction and anti-tumour activity. Virology 2002;301(1):43-52.
[168] Cladel NM, Hu JF, Balogh KK, Christensen ND. CRPV Genomes with Synonymous Codon Optimizations in the CRPV E7 Gene Show Phenotypic Differences in Growth and Altered Immunity upon E7 Vaccination. Plos One 2008;3(8)
[169] Oldstone MBA. Molecular mimicry and immune-mediated diseases. Faseb Journal 1998;12(13):1255-65.
256 [170] Natale C, Giannini T, Lucchese A, Kanduc D. Computer-assisted analysis of molecular mimicry between human papillomavirus 16 E7 oncoprotein and human protein sequences. Immunology and Cell Biology 2000;78(6):580-5.
[171] Villa L, Costa R, Petta C, et al. Prophylactic quadrivalent human papillomavirus (types 6, 11, 16, and 18) L1 virus-like particle vaccine in young women: a randomised double-blind placebo-controlled multicentre phase II efficacy trial. Lancet Oncology 2005;6(5):271-8.
[172] Schiller JT, Castellsague X, Villa LL, Hildesheim A. An update of prophylactic human papillomavirus L1 virus-like particle vaccine clinical trial results. Vaccine 2008;26:K53-K61
[173] Harper DM, Franco EL, Wheeler C, et al. Efficacy of a bivalent L1 virus-like particle vaccine in prevention of infection with human papillomavirus types 16 and 18 in young women: a randomised controlled trial. Lancet 2004;364(9447):1757-65.
[174] Reiter PL, Brewer NT, Gottlieb SL, Mcree AL, Smith JS. How much will it hurt? HPV vaccine side effects and influence on completion of the three-dose regimen. Vaccine 2009;27(49):6840-4.
[175] Harper DM, Franco EL, Wheeler CM, et al. Sustained efficacy up to 4-5 years of a bivalent L1 virus-like particle vaccine against human papillomavirus types 16 and 18: follow-up from a randomised control trial. Lancet 2006;367(9518):1247-55.
[176] Paavonen J, Jenkins D, Bosch FX, et al. Efficacy of a prophylactic adjuvanted bivalent L1 virus-like-particle vaccine against infection with human papillomavirus types 16 and 18 in young women: an interim analysis of a phase III double-blind, randomised controlled trial. Lancet 2007;369(9580):2161-70.
[177] Parkin D, Muir C, Whelan S. Cancer incidents in five continents. Comperability and quality of data. IARC Science Publications 1992;45:45-173.
[178] Ellerbrock TV, Chiasson MA, Bush TJ, et al. Incidence of cervical squamous intraepithelial lesions in HIV-infected women. Jama-Journal of the American Medical Association 2000;283(8):1031-7.
[179] Palefsky JM, Minkoff H, Kalish LA, et al. Cervicovaginal human papillomavirus infection in human immunodeficiency virus-1 (HIV)-positive and high-risk HIV-negative women. Journal of the National Cancer Institute 1999;91(3):226-36.
[180] Hildesheim A, Herrero R, Wacholder S, et al. Effect of human papillomavirus 16/18 L1 viruslike particle vaccine among young women with preexisting infection - A randomized trial. Jama-Journal of the American Medical Association 2007;298(7):743- 53.
[181] Villa LL, Perez G, Kjaer SK, et al. Quadrivalent vaccine against human papillomavirus to prevent high-grade cervical lesions. New England Journal of Medicine 2007;356(19):1915-27.
257 [182] Kirnbauer R, Chandrachud LM, Oneil BW, et al. Virus-like particles of bovine papillomavirus type 4 in prophylactic and therapeutic immunization. Virology 1996;219(1):37-44.
[183] Suzich JA, Ghim SJ, Palmerhill FJ, et al. Systemic Immunization with Papillomavirus L1 Protein Completely Prevents the Development of Viral Mucosal Papillomas. Proceedings of the National Academy of Sciences of the United States of America 1995;92(25):11553-7.
[184] Christensen ND, Reed CA, Cladel NM, Han R, Kreider JW. Immunization with viruslike particles induces long-term protection of rabbits against challenge with cottontail rabbit papillomavirus. Journal of Virology 1996;70(2):960-5.
[185] Olson C, Pamukcu AM, Brobst DF, Kowalczyk T, Satter EJ, Price JM. Urinary Bladder Tumor Induced by A Bovine Cutaneous Papilloma Agent. Cancer Research 1959;19(7):779-&
[186] Olson C, Pamukcu AM, Brobst DF. Papilloma-Like Virus from Bovine Urinary Bladder Tumors. Cancer Research 1965;25(6P1):840-&
[187] Jarrett WFH, Mcneil PE, Grimshaw WTR, Selman IE, Mcintyre WIM. High Incidence Area of Cattle Cancer with A Possible Interaction Between An Environmental Carcinogen and A Papilloma-Virus. Nature 1978;274(5668):215-7.
[188] Campo MS. Bovine papillomavirus and cancer. Veterinary Journal 1997;154(3):175-88.
[189] Bregman C, Hirth R, Sundberg J, Christensen E. Cutaneous Neoplasms in Dogs Associated with Canine Oral Papillomavirus Vaccine. Veterinary Pathology 1987;24(6):477-87.
[190] Teifke JP, Lohr CV, Shirasawa H. Detection of canine oral papillomavirus-DNA in canine oral squamous cell carcinomas and p53 overexpressing skin papillomas of the dog using the polymerase chain reaction and non-radioactive in situ hybridization. Veterinary Microbiology 1998;60(2-4):119-30.
[191] Chambers V, Evans C. Canine Oral Papillomatosis I. Virus Assay and Observations on the Various Stages of the Experimental Infection. Cancer Research 1959;19:1188-95.
[192] Christensen ND, Cladel NM, Reed CA, Han RC. Rabbit oral papillomavirus complete genome sequence and immunity following genital infection. Virology 2000;269(2):451-61.
[193] Parsons R, Kidd J. Oral papillomatosis of rabbits: A virus disease. Journal of Experimental Medicine 1942;77:233-50.
[194] Dominguez JA, Corella EL, Auro A. Oral Papillomatosis in 2 Laboratory Rabbits in Mexico. Laboratory Animal Science 1981;31(1):71-3.
258 [195] Sundberg JP, Junge RE, Elshazly MO. Oral Papillomatosis in New-Zealand White- Rabbits. American Journal of Veterinary Research 1985;46(3):664-8.
[196] Christensen ND, Cladel NM, Reed CA, et al. Laboratory production of infectious stocks of rabbit oral papillomavirus. Journal of General Virology 1996;77:1793-8.
[197] Wilgenburg BJ, Budgeon LR, Lang CM, Griffith JW, Christensen ND. Characterization of immune responses during regression of rabbit oral papillomavirus infections. Comparative Medicine 2005;55(5):431-9.
[198] Harvey SB, Cladel NM, Budgeon LR, et al. Rabbit genital tissue is susceptible to infection by rabbit oral papillomavirus: an animal model for a genital tissue-targeting papillomavirus. Journal of Virology 1998;72(6):5239-44.
[199] Peh WL, Middleton K, Christensen N, et al. Life cycle heterogeneity in animal models of human papillomavirus-associated disease. Journal of Virology 2002;76(20):10401-16.
[200] Shope RE. A transmissible tumor-like condition in rabbits. Journal of Experimental Medicine 1932;56(6):793-U5.
[201] Beard JW, Rous P. Effectiveness of the Shope papilloma virus in various American rabbits. Proceedings of the Society for Experimental Biology and Medicine 1935;33(1):191-3.
[202] Kidd JG, Rous P. Effect of the papilloma virus (Shope) upon the tar warts of rabbits. Proceedings of the Society for Experimental Biology and Medicine 1937;37(3):518-20.
[203] Christensen N, Han R, Kreider J. Ahmed R, Chen I, editors.Persistent Viral Infections. Chichester: Wiley; 1999;Cottontail Rabbit Papillomavirus. p. 485-502.
[204] Syverton JT, Dascomb HE, Wells EB, Koomen J, Berry GP. The Virus-Induced Rabbit Papilloma-To-Carcinoma Sequence .2. Carcinomas in the Natural Host, the Cottontail Rabbit. Cancer Research 1950;10(7):440-4.
[205] Syverton JT, Dascomb HE, Koomen J, Wells EB, Berry GP. The Virus-Induced Papilloma-To-Carcinoma Sequence .1. the Growth Pattern in Natural and Experimental Infections. Cancer Research 1950;10(6):379-84.
[206] Amella CA, Lofgren LA, Ronn AM, Nouri M, Shikowitz MJ, Steinberg BM. Latent Infection-Induced with Cottontail Rabbit Papillomavirus - A Model for Human Papillomavirus Latency. American Journal of Pathology 1994;144(6):1167-71.
[207] Ito Y, Evans CA. Induction of Tumors in Domestic Rabbits with Nucleic Acid Preparations from Partially Purified Shope Papilloma Virus and from Extracts of Papillomas of Domestic and Cottontail Rabbits. Journal of Experimental Medicine 1961;114(4):485
259 [208] Nasseri M, Meyers C, Wettstein FO. Genetic-Analysis of Crpv Pathogenesis - the L1 Open Reading Frame Is Dispensable for Cellular-Transformation But Is Required for Papilloma Formation. Virology 1989;170(1):321-5.
[209] Cladel NM, Hu J, Balogh K, Mejia A, Christensen ND. Wounding prior to challenge substantially improves infectivity of cottontail rabbit papillomavirus and allows for standardization of infection. Journal of Virological Methods 2008;148(1-2):34-9.
[210] Brandsma JL, Yang ZH, Barthold SW, Johnson EA. Use of A Rapid, Efficient Inoculation Method to Induce Papillomas by Cottontail Rabbit Papillomavirus Dna Shows That the E7 Gene Is Required. Proceedings of the National Academy of Sciences of the United States of America 1991;88(11):4816-20.
[211] Jeckel S, Loetzsch E, Huber E, Stubenrauch F, Iftner T. Identification of the E9 and E2C cDNA and functional characterization of the gene product reveal a new repressor of transcription and replication in cottontail rabbit papillomavirus. Journal of Virology 2003;77(16):8736-44.
[212] Brandsma JL, Yang ZH, Dimaio D, Barthold SW, Johnson E, Xiao W. The Putative-E5 Open Reading Frame of Cottontail Rabbit Papillomavirus Is Dispensable for Papilloma Formation in Domestic Rabbits. Journal of Virology 1992;66(10):6204-7.
[213] Wu X, Xiao W, Brandsma JL. Papilloma Formation by Cottontail Rabbit Papillomavirus Requires E1 and E2 Regulatory Genes in Addition to E6 and E7 Transforming Genes. Journal of Virology 1994;68(9):6097-102.
[214] Meyers C, Harry J, Lin YL, Wettstein FO. Identification of 3 Transforming Proteins Encoded by Cottontail Rabbit Papillomavirus. Journal of Virology 1992;66(3):1655-64.
[215] Hu JF, Cladel NM, Balogh K, Budgeon L, Christensen ND. Impact of genetic changes to the CRPV genome and their application to the study of pathogenesis in vivo. Virology 2007;358(2):384-90.
[216] Han RC, Cladel NM, Reed CA, Peng XW, Christensen ND. Protection of rabbits from viral challenge by gene gun-based intracutaneous vaccination with a combination of cottontail rabbit papillomavirus E1, E2, E6, and E7 genes. Journal of Virology 1999;73(8):7039-43.
[217] Han RC, Cladel NM, Reed CA, et al. DNA vaccination prevents and/or delays carcinoma development of papillomavirus-induced skin papillomas on rabbits. Cancer Gene Therapy 2000;7(12):S25
[218] Han R, Peng XW, Reed CA, et al. Gene gun-mediated intracutaneous vaccination with papillomavirus E7 gene delays cancer development of papillomavirus-induced skin papillomas on rabbits. Cancer Detection and Prevention 2002;26(6):458-67.
[219] Kreider JW. Studies on Mechanism Responsible for Spontaneous Regression of Shope Rabbit Papilloma. Cancer Research 1963;23(9):1593
260 [220] Stanley MA, Masterson PJ, Nicholls PK. In vitro and animal models for antiviral therapy in papillomavirus infections. Antiviral Chemistry & Chemotherapy 1997;8(5):381-400.
[221] Christensen ND, Pickel MD, Budgeon LR, Kreider JW. In vivo anti-papillomavirus activity of nucleoside analogues including cidofovir on CRPV-induced rabbit papillomas. Antiviral Research 2000;48(2):131-42.
[222] Hu JF, Peng XW, Schell TD, Budgeon LR, Cladel NM, Christensen ND. An HLA- A2.1-transgenic rabbit model to study immunity to papillomavirus infection. Journal of Immunology 2006;177(11):8037-45.
[223] Hu JF, Peng XW, Budgeon LR, Cladel NM, Balogh KK, Christensen ND. Establishment of a cottontail rabbit papillomavirus/HLA-A2.1 transgenic rabbit model. Journal of Virology 2007;81(13):7171-7.
[224] Newberg MH, Smith DH, Haertel SB, Vining DR, Lacy E, Engelhard VH. Importance of MHC class I alpha 2 and alpha 3 domains in the recognition of self and non-self MHC molecules. Journal of Immunology 1996;156(7):2473-80.
[225] Pascolo S, Bervas N, Ure JM, Smith AG, Lemonnier FA, Perarnau B. HLA-A2.1- restricted education and cytolytic activity of CD8(+) T lymphocytes from beta 2 microglobulin (beta 2m) HLA-A2.1 monochain transgenic H-2D(b) beta 2m double knockout mice. Journal of Experimental Medicine 1997;185(12):2043-51.
[226] Vitiello A, Marchesini D, Furze J, Sherman LA, Chesnut RW. Analysis of the Hla- Restricted Influenza-Specific Cytotoxic Lymphocyte-T Response in Transgenic Mice Carrying A Chimeric Human-Mouse Class-I Major Histocompatibility Complex. Journal of Experimental Medicine 1991;173(4):1007-15.
[227] Melero I, Singhal MC, McGowan P, et al. Immunological ignorance of an E7- encoded cytolytic T-lymphocyte epitope in transgenic mice expressing the E7 and E6 oncogenes of human papillomavirus type 16. Journal of Virology 1997;71(5):3998- 4004.
[228] Trimble C, Lin CT, Hung CF, et al. Comparison of the CD8+ T cell responses and antitumor effects generated by DNA vaccine administered through gene gun, biojector, and syringe. Vaccine 2003;21(25-26):4036-42.
[229] Bins AD, Jorritsma A, Wolkers MC, et al. A rapid and potent DNA vaccination strategy defined by in vivo monitoring of antigen expression. Nature Medicine 2005;11(8):899-904.
[230] Pokorna D, Rubio I, Muller M. DNA-vaccination via tattooing induces stronger humoral and cellular immune responses than intramuscular delivery supported by molecular adjuvants. Genetic Vaccines and Therapy 2008;6:4
[231] Best SR, Peng SW, Juang CM, et al. Administration of HPV DNA vaccine via electroporation elicits the strongest CD8+T cell immune responses compared to intramuscular injection and intradermal gene gun delivery. Vaccine 2009;27(40):5450-9.
261 [232] Daftarian P, Mansour M, Benoit AC, et al. Eradication of established HPV 16- expressing tumors by a single administration of a vaccine composed of a liposome- encapsulated CTL-T helper fusion peptide in a water-in-oil emulsion. Vaccine 2006;24(24):5235-44.
[233] Manuri PR, Nehete B, Nehete PN, et al. Intranasal immunization with synthetic peptides corresponding to the E6 and E7 oncoproteins of human papillomavirus type 16 induces systemic and mucosal cellular immune responses and tumor protection. Vaccine 2007;25(17):3302-10.
[234] Peng S, Trimble C, Alvarez RD, et al. Cluster intradermal DNA vaccination rapidly induces E7-specific CD8(+) T-cell immune responses leading to therapeutic antitumor effects. Gene Therapy 2008;15(16):1156-66.
[235] Ressing ME, Sette A, Brandt RMP, et al. Human Ctl Epitopes Encoded by Human Papillomavirus Type-16 E6 and E7 Identified Through In-Vivo and In-Vitro Immunogenicity Studies of Hla-A-Asterisk-0201-Binding Peptides. Journal of Immunology 1995;154(11):5934-43.
[236] Schreurs MWJ, Kueter EWM, Scholten KBJ, Lemonnier FA, Meijer CJLM, Hooijberg E. A single amino acid substitution improves the in vivo immunogenicity of the HPV16 oncoprotein E7(11-20) cytotoxic T lymphocyte epitope. Vaccine 2005;23(31):4005-10.
[237] Peng S, Tomson TT, Trimble C, He L, Hung CF, Wu TC. A combination of DNA vaccines targeting human papillomavirus type 16 E6 and E7 generates potent antitumor effects. Gene Therapy 2006;13(3):257-65.
[238] Eiben GL, Velders MP, Schreiber H, et al. Establishment of an HLA-A*0201 human papillomavirus type 16 tumor model to determine the efficacy of vaccination strategies in HLA-A*0201 transgenic mice. Cancer Research 2002;62(20):5792-9.
[239] Ingolotti M, Kawalekar O, Shedlock DJ, Muthumani K, Weiner DB. DNA vaccines for targeting bacterial infections. Expert Review of Vaccines 2010;9(7):747-63.
[240] Rinaudo CD, Telford JL, Rappuoli R, Seib KL. Vaccinology in the genome era. Journal of Clinical Investigation 2009;119(9):2515-25.
[241] Donnelly JJ, Ulmer JB, Shiver JW, Liu MA. DNA vaccines. Annual Review of Immunology 1997;15:617-48.
[242] Rosenberg SA, Yang JC, Sherry RM, et al. Inability to immunize patients with metastatic melanoma using plasmid DNA encoding the gp100 melanoma-melanocyte antigen. Human Gene Therapy 2003;14(8):709-14.
[243] Chen CH, Wang TL, Hung CF, et al. Enhancement of DNA vaccine potency by linkage of antigen gene to an HSP70 gene. Cancer Research 2000;60(4):1035-42.
[244] Cheng WF, Hung CF, Chai CY, et al. Tumor-specific immunity and antiangiogenesis generated by a DNA vaccine encoding calreticulin linked to a tumor antigen. Journal of Clinical Investigation 2001;108(5):669-78.
262 [245] Hung CF, Cheng WF, Chai CY, et al. Improving vaccine potency through intercellular spreading and enhanced MHC class I presentation of antigen. Journal of Immunology 2001;166(9):5733-40.
[246] Leachman SA, Tigelaar RE, Shlyankevich M, et al. Granulocyte-macrophage colony-stimulating factor priming plus papillomavirus E6 DNA vaccination: Effects on papilloma formation and regression in the cottontail rabbit papillomavirus-rabbit model. Journal of Virology 2000;74(18):8700-8.
[247] Tan J, Yang NS, Turner JG, et al. Interleukin-12 cDNA skin transfection potentiates human papillomavirus E6 DNA vaccine-induced antitumor immune response. Cancer Gene Therapy 1999;6(4):331-9.
[248] Trimble CL, Peng S, Kos F, et al. A Phase I Trial of a Human Papillomavirus DNA Vaccine for HPV16+ Cervical Intraepithelial Neoplasia 2/3. Clinical Cancer Research 2009;15(1):361-7.
[249] Feltkamp MCW, Smits HL, Vierboom MPM, et al. Vaccination with Cytotoxic T- Lymphocyte Epitope-Containing Peptide Protects Against A Tumor-Induced by Human Papillomavirus Type-16-Transformed Cells. European Journal of Immunology 1993;23(9):2242-9.
[250] Zwaveling S, Mota SCF, Nouta J, et al. Established human papillomavirus type 16-expressing tumors are effectively eradicated following vaccination with long peptides. Journal of Immunology 2002;169(1):350-8.
[251] Muderspach L, Wilczynski S, Roman L, et al. A phase I trial of a human papillomavirus (HPV) peptide vaccine for women with high-grade cervical and vulvar intraepithelial neoplasia who are HPV 16 positive. Clinical Cancer Research 2000;6(9):3406-16.
[252] Chen YF, Lin CW, Tsao YP, Chen SL. Cytotoxic-T-lymphocyte human papillomavirus type 16 E5 peptide with CpG-oligodeoxynucleotide can eliminate tumor growth in C57BL/6 mice. Journal of Virology 2004;78(3):1333-43.
[253] van Driel WJ, Ressing ME, Kenter GG, et al. Vaccination with HPV16 peptides of patients with advanced cervical carcinoma: Clinical evaluation of a phase I-II trial. European Journal of Cancer 1999;35(6):946-52.
[254] Tindle RW, Croft S, Herd K, et al. A Vaccine Conjugate of Iscar Immunocarrier and Peptide Epitopes of the E7 Cervical Cancer-Associated Protein of Human Papillomavirus Type-16 Elicits Specific Th1-Type and Th2-Type Responses in Immunized Mice in the Absence of Oil-Based Adjuvants. Clinical and Experimental Immunology 1995;101(2):265-71.
[255] Hariharan K, Braslawsky G, Barnett RS, et al. Tumor regression in mice following vaccination with human papillomavirus E7 recombinant protein in PROVAX(TM). International Journal of Oncology 1998;12(6):1229-35.
263 [256] De Bruijn MLH, Schuurhuis DH, Vierboom MPM, et al. Immunization with human papillomavirus type 16 (HPV16) oncoprotein-loaded dendritic cells as well as protein in adjuvant induces MHC class I-restricted protection to HPV16-induced tumor cells. Cancer Research 1998;58(4):724-31.
[257] Lacey CJN, Thompson HSG, Monteiro EF, et al. Phase IIa safety and immunogenicity of a therapeutic vaccine, TA-GW, in persons with genital warts. Journal of Infectious Diseases 1999;179(3):612-8.
[258] de Jong A, O'Neill T, Khan AY, et al. Enhancement of human papillomavirus (HPV) type 16 E6 and E7-specific T-cell immunity in healthy volunteers through vaccination with TA-CIN, an HPV16 L2E7E6 fusion protein vaccine. Vaccine 2002;20(29-30):3456-64.
[259] Liu B, Ye DX, Song XX, et al. A novel therapeutic fusion protein vaccine by two different families of heat shock proteins linked with HPV16 E7 generates potent antitumor immunity and antiangiogenesis. Vaccine 2008;26(10):1387-96.
[260] Roman LD, Wilczynski S, Muderspach LI, et al. A phase II study of Hsp-7 (SGN- 00101) in women with high-grade cervical intraepithelial neoplasia. Gynecologic Oncology 2007;106(3):558-66.
[261] Einstein MH, Kadish AS, Burk RD, et al. Heat shock fusion protein-based immunotherapy for treatment of cervical intraepithelial neoplasia III. Gynecologic Oncology 2007;106(3):453-60.
[262] Palefsky JM, Berry JM, Jay N, et al. A trial of SGN-00101 (HspE7) to treat high- grade anal intraepithelial neoplasia in HIV-positive individuals. Aids 2006;20(8):1151-5.
[263] Boursnell MEG, Rutherford E, Hickling JK, et al. Construction and characterisation of a recombinant vaccinia was expressing human papillomavirus proteins for immunotherapy of cervical cancer. Vaccine 1996;14(16):1485-94.
[264] Meneguzzi G, Cerni C, Kieny MP, Lathe R. Immunization Against Human Papillomavirus Type-16 Tumor-Cells with Recombinant Vaccinia Viruses Expressing E6 and E7. Virology 1991;181(1):62-9.
[265] Kaufmann AM, Stern PL, Sommer H, et al. Safety and immunogenicity of TA-HPV, a recombinant vaccinia virus expressing modified human papillomavirus (HPV)-16 and HPV-18 E6 and E7 genes, in women with progressive cervical cancer. Clinical Cancer Research 2002;8(12):3676-85.
[266] A Phase II Trial in Patients With Early Cervical Cancer to Study The Safety and The Immunological Effects of Vaccination With TA-HPV, A Live Recombinant Vaccinia Virus Expressing The Human Papilloma Virus 16 and 18 E6 and E7 Proteins. Available at www.clinicaltrials.gov , (Identfier NCT00002916). 2009. (GENERIC) Ref Type: Generic
[267] Hussain SF, Paterson Y. What is needed for effective antitumor immunotherapy? Lessons learned using Listeria monocytogenes as a live vector for HPV-associated tumors. Cancer Immunology Immunotherapy 2005;54(6):577-86.
264 [268] Gunn GR, Zubair A, Peters C, Pan ZK, Wu TC, Paterson Y. Two Listeria monocytogenes vaccine vectors that express different molecular forms of human papilloma virus-16 (HPV-16) E7 induce qualitatively different T cell immunity that correlates with their ability to induce regression of established tumors immortalized by HPV-16. Journal of Immunology 2001;167(11):6471-9.
[269] Maciag PC, Radulovic S, Rothman J. The first clinical use of a live-attenuated Listeria monocytogenes vaccine: A Phase I safety study of Lm-LLO-E7 in patients with advanced carcinoma of the cervix. Vaccine 2009;27(30):3975-83.
[270] Ossevoort MA, Feltkamp MCW, Vanveen KJH, Melief CJM, Kast WM. Dendritic Cells As Carriers for A Cytotoxic T-Lymphocyte Epitope-Based Peptide Vaccine in Protection Against A Human Papillomavirus Type 16-Induced Tumor. Journal of Immunotherapy 1995;18(2):86-94.
[271] Mayordomo JI, Zorina T, Storkus WJ, et al. Bone-Marrow-Derived Dendritic Cells Pulsed with Synthetic Tumor Peptides Elicit Protective and Therapeutic Antitumor Immunity. Nature Medicine 1995;1(12):1297-302.
[272] Liu Y, Chiriva-Internati M, Grizzi F, et al. Rapid induction of cytotoxic T-cell response against cervical cancer cells by human papillomavirus type 16 E6 antigen gene delivery into human dendritic cells by an adeno-associated virus vector. Cancer Gene Therapy 2001;8(12):948-57.
[273] Tuting T, Deleo AB, Lotze MT, Storkus WJ. Genetically modified bone marrow- derived dendritic cells expressing tumor-associated viral or ''self'' antigens induce antitumor immunity in vivo. European Journal of Immunology 1997;27(10):2702-7.
[274] Wang TL, Ling M, Shih IM, et al. Intramuscular administration of E7-transfected dendritic cells generates the most potent E7-specific anti-tumor immunity. Gene Therapy 2000;7(9):726-33.
[275] Achtar MS, Ibrahim R, Herrin VE, et al. Pre-immature dendritic cells pulsed with human papillomavirus 16 E7 peptide vaccine in advanced cervical cancer. Journal of Clinical Oncology 2005;23(16):171S
[276] Hill AVS, Reyes-Sandoval A, O'Hara G, et al. Prime-boost vectored malaria vaccines Progress and prospects. Human Vaccines 2010;6(1):78-83.
[277] Chen CH, Wang TL, Hung CF, Pardoll DM, Wu TC. Boosting with recombinant vaccinia increases HPV-16 E7-specific T cell precursor frequencies of HPV-16 E7- expressing DNA vaccines. Vaccine 2000;18(19):2015-22.
[278] Christensen ND, Han R, Cladel NM, Pickel MD. Combination treatment with intralesional cidofovir and viral-DNA vaccination cures large cottontail rabbit papillomavirus-induced papillomas and reduces recurrences. Antimicrobial Agents and Chemotherapy 2001;45(4):1201-9.
[279] Kang TH, Lee JH, Song CK, et al. Epigallocatechin-3-gallate enhances CD8(+) T cell-mediated antitumor immunity induced by DNA vaccination. Cancer Research 2007;67(2):802-11.
265 [280] A Phase II Trial of Polyphenon E for Cervical Cancer Prevention. Available at www.clinicaltrials.gov , (Identifier NCT00303823). 2010. (GENERIC) Ref Type: Generic
[281] Hung CF, Monie A, Alvarez RD, Wu TC. DNA vaccines for cervical cancer: from bench to bedside. Experimental and Molecular Medicine 2007;39(6):679-89.
[282] van Poelgeest MIE, van Seters M, van Beurden M, et al. Detection of human papillomavirus (HPV) 16-specific CD4+T-cell immunity in patients with persistent HPV16-induced vulvar intraepithelial neoplasia in relation to clinical impact of imiquimod treatment. Clinical Cancer Research 2005;11(14):5273-80.
[283] Le T, Menard C, Hicks-Boucher W, Hopkins L, Weberpals J, Fung-Kee-Fung M. Final results of a phase 2 study using continuous 5% Imiquimod cream application in the primary treatment of high-grade vulva intraepithelial neoplasia. Gynecologic Oncology 2007;106(3):579-84.
[284] Kreuter A, Hochdorfer B, Stucker M, et al. Treatment of anal intraepithelial neoplasia in patients with acquired HIV with imiquimod 5% cream. Journal of the American Academy of Dermatology 2004;50(6):980-1.
[285] Stanley MA. Imiquimod and the imidazoquinolones: mechanism of action and therapeutic potential. Clinical and Experimental Dermatology 2002;27(7):571-7.
[286] Schon M, Bong AB, Drewniok C, et al. Tumor-selective induction of apoptosis and the small-molecule immune response modifier imiquimod. Journal of the National Cancer Institute 2003;95(15):1138-49.
[287] Saiag P, Bauhofer A, Bouscarat F, et al. Imiquimod 5% cream for external genital or perianal warts in human immunodeficiency virus-positive patients treated with highly active antiretroviral therapy: an open-label, noncomparative study. British Journal of Dermatology 2009;161(4):904-9.
[288] Higano CS, Schellhammer PF, Small EJ, et al. Integrated Data From 2 Randomized, Double-Blind, Placebo-Controlled, Phase 3 Trials of Active Cellular Immunotherapy With Sipuleucel-T in Advanced Prostate Cancer. Cancer 2009;115(16):3670-9.
[289] Small EJ, Fratesi P, Reese DM, et al. Immunotherapy of hormone-refractory prostate cancer with antigen-loaded dendritic cells. Journal of Clinical Oncology 2000;18(23):3894-903.
[290] Burch PA, Breen JK, Buckner JC, et al. Priming tissue-specific cellular immunity in a phase I trial of autologous dendritic cells for prostate cancer. Clinical Cancer Research 2000;6(6):2175-82.
[291] Small EJ, Schellhammer PF, Higano CS, et al. Placebo-controlled phase III trial of immunologic therapy with sipuleucel-T (APC8015) in patients with metastatic, asymptomatic hormone refractory prostate cancer. Journal of Clinical Oncology 2006;24(19):3089-94.
266 [292] Han R, Reed CA, Cladel NM, Christensen ND. Intramuscular injection of plasmid DNA encoding cottontail rabbit papillomavirus E1, E2, E6 and E7 induces T cell- mediated but not humoral immune responses in rabbits. Vaccine 1999;17(11-12):1558- 66.
[293] Brandsma JL, Xiao W. Infectious Virus-Replication in Papillomas Induced by Molecularly Cloned Cottontail Rabbit Papillomavirus Dna. Journal of Virology 1993;67(1):567-71.
[294] Nindl I, Rindfleisch K, Lotz B, Schneider A, Durst M. Uniform distribution of HPV 16 E6 and E7 variants in patients with normal histology, cervical intra-epithelial neoplasia and cervical cancer. International Journal of Cancer 1999;82(2):203-7.
[295] Wheeler CM, Yamada T, Hildesheim A, Jenison SA. Human papillomavirus type 16 sequence variants: Identification by E6 and L1 lineage-specific hybridization. Journal of Clinical Microbiology 1997;35(1):11-9.
[296] Yamada T, Wheeler CM, Halpern AL, Stewart ACM, Hildesheim A, Jenison SA. Human Papillomavirus Type-16 Variant Lineages in United-States Populations Characterized by Nucleotide-Sequence Analysis of the E6, L2, and L1 Coding Segments. Journal of Virology 1995;69(12):7743-53.
[297] Yamada T, Manos MM, Peto J, et al. Human papillomavirus type 16 sequence variation in cervical cancers: A worldwide perspective. Journal of Virology 1997;71(3):2463-72.
[298] Munger K, Phelps WC, Bubb V, Howley PM, Schlegel R. The E6-Gene and E7- Gene of the Human Papillomavirus Type-16 Together Are Necessary and Sufficient for Transformation of Primary Human Keratinocytes. Journal of Virology 1989;63(10):4417-21.
[299] Hudson JB, Bedell MA, Mccance DJ, Laimins LA. Immortalization and Altered Differentiation of Human Keratinocytes Invitro by the E6 and E7 Open Reading Frames of Human Papillomavirus Type-18. Journal of Virology 1990;64(2):519-26.
[300] Ressing ME, vanDriel WJ, Celis E, et al. Occasional memory cytotoxic T-cell responses of patients with human papillomavirus type 16-positive cervical lesions against a human leukocyte antigen-A*0201-restricted E7-encoded epitope. Cancer Research 1996;56(3):582-8.
[301] Bontkes HJ, de Gruijl TD, van den Muysenberg AJC, et al. Human papillomavirus type 16 E6/E7-specific cytotoxic T lymphocytes in women with cervical neoplasia. International Journal of Cancer 2000;88(1):92-8.
[302] Hohn H, Pilch H, Gunzel S, et al. CD4(+) tumor-infiltrating lymphocytes in cervical cancer recognize HLA-DR-restricted peptides provided by human papillomavirus-E7. Journal of Immunology 1999;163(10):5715-22.
[303] Zehbe I, Wilander E, Delius H, Tommasino M. Human papillomavirus 16 E6 variants are more prevalent in invasive cervical carcinoma than the prototype. Cancer Research 1998;58(4):829-33.
267 [304] Bredenbeck A, Losch FO, Sharav T, et al. Identification of noncanonical melanoma-associated T cell epitopes for cancer immunotherapy. Journal of Immunology 2005;174(11):6716-24.
[305] Hu JF, Cladel N, Peng XW, Balogh K, Christensen ND. Protective immunity with an E1 multivalent epitope DNA vaccine against cottontail rabbit papillomavirus (CRPV) infection in an HLA-A2.1 transgenic rabbit model. Vaccine 2008;26(6):809-16.
[306] Pogue RR, Eron J, Frelinger JA, Matsui M. Amino-Terminal Alteration of the Hla-A- Asterisk-0201-Restricted Human-Immunodeficiency-Virus Pol Peptide Increases Complex Stability and In-Vitro Immunogenicity. Proceedings of the National Academy of Sciences of the United States of America 1995;92(18):8166-70.
[307] Schell TD, Lippolis JD, Tevethia SS. Cytotoxic T lymphocytes from HLA-A2.1 transgenic mice define a potential human epitope from simian virus 40 large T antigen. Cancer Research 2001;61(3):873-9.
[308] Norbury CC, Chambers BJ, Prescott AR, Ljunggren HG, Watts C. Constitutive macropinocytosis allows TAP-dependent major histocompatibility complex class I presentation of exogenous soluble antigen by bone marrow-derived dendritic cells. European Journal of Immunology 1997;27(1):280-8.
[309] Lutz MB, Kukutsch N, Ogilvie ALJ, et al. An advanced culture method for generating large quantities of highly pure dendritic cells from mouse bone marrow. Journal of Immunological Methods 1999;223(1):77-92.
[310] Kreider JW, Cladel NM, Patrick SD, et al. High-Efficiency Induction of Papillomas In-Vivo Using Recombinant Cottontail Rabbit Papillomavirus Dna. Journal of Virological Methods 1995;55(2):233-44.
[311] Falk K, Rotzschke O, Stevanovic S, Jung G, Rammensee HG. Allele-Specific Motifs Revealed by Sequencing of Self-Peptides Eluted from Mhc Molecules. Nature 1991;351(6324):290-6.
[312] Kast WM, Brandt RMP, Drijfhout JW, Melief CJM. Human-Leukocyte Antigen-A2.1 Restricted Candidate Cytotoxic T-Lymphocyte Epitopes of Human Papillomavirus Type- 16 E6-Protein and E7-Protein Identified by Using the Processing-Defective Human Cell Line-T2. Journal of Immunotherapy 1993;14(2):115-20.
[313] SH van der Burg, MJ Visseren, RM Brandt, WM Kast, CJ Melief. Immunogenicity of peptides bound to MHC class I molecules depends on the MHC-peptide complex stability. Journal of Immunology 1996;156(9):3308-14.
[314] Hu JF, Cladel NM, Wang ZH, Han RC, Pickel MD, Christensen ND. GM-CSF enhances protective immunity to cottontail rabbit papillomavirus E8 genetic vaccination in rabbits. Vaccine 2004;22(9-10):1124-30.
[315] Sette A, Vitiello A, Reherman B, et al. The Relationship Between Class-I Binding Affinity and Immunogenicity of Potential Cytotoxic T-Cell Epitopes. Journal of Immunology 1994;153(12):5586-92.
268 [316] Bosch FX, Manos MM, Munoz N, et al. Prevalence of Human Papillomavirus in Cervical-Cancer - A Worldwide Perspective. Journal of the National Cancer Institute 1995;87(11):796-802.
[317] Levi F, Randimbison L, LaVecchia C, Franceschi S. Incidence of invasive cancers following carcinoma in situ of the cervix. British Journal of Cancer 1996;74(8):1321-3.
[318] Beutner KR, Ferenczy A. Therapeutic approaches to genital warts. American Journal of Medicine 1997;102(5A):28-37.
[319] O'Mahony C. Genital warts - Current and future management options. American Journal of Clinical Dermatology 2005;6(4):239-43.
[320] Parker KC, Bednarek MA, Coligan JE. Scheme for Ranking Potential Hla-A2 Binding Peptides Based on Independent Binding of Individual Peptide Side-Chains. Journal of Immunology 1994;152(1):163-75.
[321] Rammensee HG, Bachmann J, Emmerich NPN, Bachor OA, Stevanovic S. SYFPEITHI: database for MHC ligands and peptide motifs. Immunogenetics 1999;50(3-4):213-9.
[322] Kast WM, Brandt RMP, Sidney J, et al. Role of Hla-A Motifs in Identification of Potential Ctl Epitopes in Human Papillomavirus Type-16 E6 and E7 Proteins. Journal of Immunology 1994;152(8):3904-12.
[323] Micheletti F, Bazzaro M, Canella A, Marastoni M, Traniello S, Gavioli R. The lifespan of major histocompatibility complex class I peptide complexes determines the efficiency of cytotoxic T-lymphocyte responses. Immunology 1999;96(3):411-5.
[324] Borbulevych OY, Baxter TK, Yu ZY, Restifo NP, Baker BM. Increased immunogenicity of an anchor-modified tumor-associated antigen is due to the enhanced stability of the peptide/MHC complex: Implications for vaccine design. Journal of Immunology 2005;174(8):4812-20.
[325] Sarobe P, Pendleton CD, Akatsuka T, et al. Enhanced in vitro potency and in vivo immunogenicity of a CTL epitope from hepatitis C virus core protein following amino acid replacement at secondary HLA-A2.1 binding positions. Journal of Clinical Investigation 1998;102(6):1239-48.
[326] zur Hausen H. Immortalization of human cells and their malignant conversion by high risk human papillomavirus genotypes. Seminars in Cancer Biology 1999;9(6):405- 11.
[327] Hawleynelson P, Vousden KH, Hubbert NL, Lowy DR, Schiller JT. Hpv16 E6- Proteins and E7-Proteins Cooperate to Immortalize Human Foreskin Keratinocytes. Embo Journal 1989;8(12):3905-10.
[328] Salmon J, Nonnenmacher M, Caze S, et al. Variation in the nucleotide sequence of cottontail rabbit papillomavirus a and b subtypes affects wart regression and malignant transformation and level of viral replication in domestic rabbits. Journal of Virology 2000;74(22):10766-77.
269 [329] Salmon J, Ramoz N, Cassonnet P, Orth G, Breitburd F. A cottontail rabbit papillomavirus strain (CRPVb) with strikingly divergent E6 and E7 oncoproteins: An insight in the evolution of papillomaviruses. Virology 1997;235(2):228-34.
[330] Sun YP, Liu J, Yang M, et al. Identification and structural definition of H5-specific CTL epitopes restricted by HLA-A*0201 derived from the H5N1 subtype of influenza A viruses. Journal of General Virology 2010;91:919-30.
[331] Wen JS, Duan ZL, Jiang LF. Identification of a Dengue Virus-Specific HLA-A*0201- Restricted CD8(+) T Cell Epitope. Journal of Medical Virology 2010;82(4):642-8.
[332] Yu JJ, Goluguri T, Guentzel MN, et al. Francisella tularensis T-cell antigen identification using humanized HLA-DR4 transgenic mice. Clinical Vaccine Immunology 2010;17(2):215-22.
[333] Singh S, Mishra B. Identification and characterization of merozoite surface protein 1 epitope. Bioinformation 2009;4(1):1-5.
[334] Dönnes P, Elofsson A. Prediction of MHC class I binding peptides, using SVMHC. BMC Bioinformatics 2002;3(25)
[335] Feltkamp MCW, Vierboom MPM, Kast WM, Melief CJM. Efficient Mhc Class I- Peptide Binding Is Required But Does Not Ensure Mhc Class I-Restricted Immunogenicity. Molecular Immunology 1994;31(18):1391-401.
[336] Wucherpfennig KW. T cell receptor crossreactivity as a general property of T cell recognition. Molecular Immunology 2004;40(14-15):1009-17.
[337] Boniface JJ, Reich Z, Lyons DS, Davis MM. Thermodynamics of T cell receptor binding to peptide-MHC: Evidence for a general mechanism of molecular scanning. Proceedings of the National Academy of Sciences of the United States of America 1999;96(20):11446-51.
[338] Xiao W, Brandsma JL. High efficiency, long-term clinical expression of cottontail rabbit papillomavirus (CRPV) DNA in rabbit skin following particle-mediated DNA transfer. Nucleic Acids Research 1996;24(13):2620-2.
[339] Hu JF, Cladel NM, Budgeon L, Balogh KK, Christensen ND. Papillomavirus DNA complementation in vivo. Virus Research 2009;144(1-2):117-22.
[340] Sanderson S, Shastri N. Lacz Inducible, Antigen Mhc-Specific T-Cell Hybrids. International Immunology 1994;6(3):369-76.
[341] Hu JF, Schell TD, Peng X, Cladel NM, Balogh K, Christensen ND. Strong and Specific Protective and Therapeutic Immunity Induced by Single HLA-A2.1 Restricted Epitope DNA Vaccine in Rabbits. Procedia in Vaccinology 2009;1(1):4-14.
[342] Hu JF, Cladel N, Balogh K, Christensen N. Mucosally delivered peptides prime strong immunity in HLA-A2.1 transgenic rabbits. Vaccine 2010;28(21):3706-13.
270 [343] Doorbar J. The papillomavirus life cycle. Journal of Clinical Virology 2005;32:S7- S15
[344] Gry M, Rimini R, Stromberg S, et al. Correlations between RNA and protein expression profiles in 23 human cell lines. Bmc Genomics 2009;10
[345] Culp TD, Christensen ND. Quantitative RT-PCR assay for HPV infection in cultured cells. Journal of Virological Methods 2003;111(2):135-44.
[346] Singh CR, Moulton RA, Armitige LY, et al. Processing and presentation of a mycobacterial antigen 85B epitope by murine macrophages is dependent on the phagosomal acquisition of vactiolar proton ATPase and in situ activation of cathepsin D. Journal of Immunology 2006;177(5):3250-9.
[347] Han R, Reed CA, Cladel NM, Christensen ND. Immunization of rabbits with cottontail rabbit papillomavirus E1 and E2 genes: protective immunity induced by gene gun-mediated intracutaneous delivery but not by intramuscular injection. Vaccine 2000;18(26):2937-44.
[348] Christensen ND. Cottontail rabbit papillomavirus (CRPV) model system to test antiviral and immunotherapeutic strategies. Antiviral Chemistry & Chemotherapy 2005;16:355-62.
[349] Rous P, Beard JW. The progression to carcinoma of virus-induced rabbit papillomas (Shope). Journal of Experimental Medicine 1935;62(4):523-U96
[350] Bedell MA, Jones KH, Grossman SR, Laimins LA. Identification of Human Papillomavirus Type-18 Transforming Genes in Immortalized and Primary-Cells. Journal of Virology 1989;63(3):1247-55.
[351] Helt AM, Galloway DA. Destabilization of the retinoblastoma tumor suppressor by human papillomavirus type 16 E7 is not sufficient to overcome cell cycle arrest in human keratinocytes. Journal of Virology 2001;75(15):6737-47.
[352] Potthoff A, Schwannecke S, Nabi G, et al. Immunogenicity and efficacy of intradermal tattoo immunization with adenoviral vector vaccines. Vaccine 2009;27(21):2768-74.
[353] Pokorna D, Polakova I, Kindlova M, et al. Vaccination with human papillomavirus type 16-derived peptides using a tattoo device. Vaccine 2009;27(27):3519-29.
[354] Stone JD, Demkowicz WE, Stern LJ. HLA-restricted epitope identification and detection of functional T cell responses by using MHC-peptide and costimulatory microarrays. Proceedings of the National Academy of Sciences of the United States of America 2005;102(10):3744-9.
[355] Toebes M, Coccoris M, Bins A, et al. Design and use of conditional MHC class I ligands. Nature Medicine 2006;12(2):246-51.
271 [356] Rodenko B, Toebes M, Hadrup SR, et al. Generation of peptide-MHC class I complexes through UV-mediated ligand exchange. Nature Protocols 2006;1(3):1120- 32.
[357] Rodriguez F, Harkins S, Slifka MK, Whitton JL. Immunodominance in virus-induced CD8(+) T-cell responses is dramatically modified by DNA immunization and is regulated by gamma interferon. Journal of Virology 2002;76(9):4251-9.
[358] Campo MS. Animal models of papillomavirus pathogenesis. Virus Research 2002;89(2):249-261.
[359] Campo MS, Roden RBS. Papillomavirus Prophylactic Vaccines: Established Successes, New Approaches. Journal of Virology 2010;84(3):1214-20.
[360] Nicholls PK, and Stanley MA. The immunology of animal papillomaviruses. Veterinary Immunology and Immunopathology 2000;73(2):101-27.
[361] zur Hausen H. Papillomaviruses in the causation of human cancers - a brief historical account. Virology 2009;384(2):260-65.
[362] Lowy DR, and Schiller JT. Prophylactic human papillomavirus vaccines. Journal of Clinical Investigation 2006;116(5):1167-73.
[363] Hu JF, Cladel NM, Pickel MD, ChristensenND. Amino acid residues in the carboxy-terminal region of cottontail rabbit papillomavirus E6 influence spontaneous regression of cutaneous papillomas. Journal of Virology 2002;76(23):11801-8.
[364] Hu JF, Han RC, Cladel NM, Pickel MD, Christensen ND. Intracutaneous DNA vaccination with the E8 gene of cottontail rabbit papillomavirus induces protective immunity against virus challenge in rabbits. Journal of Virology 2002;76(13):6453-9.
[365] Hu J, Cladel NM, Budgeon LR, Reed CA, Pickel MD, Christensen ND. Protective cell-mediated immunity by DNA vaccination against Papillomavirus L1 capsid protein in the Cottontail Rabbit Papillomavirus model. Viral Immunology 2006;19(3):492-507.
[366] Breitburd F, Kirnbauer R, Hubbert NL, Nonnenmacher B, Trindinhdesmarquet C, Orth G, Schiller JT, Lowy DR. Immunization with Virus-Like Particles from Cottontail Rabbit Papillomavirus (CRPV) Can Protect Against Experimental Crpv Infection. Journal of Virology 1995;69(6):3959-63.
[367] A Multi-Center, Double-Blind, Randomized, Placebo-Controlled Study of Amolimogene (ZYC101a) in the Treatment of High-Grade Cervical Intraepithelial Lesions (CIN 2/3) of the Uterine Cervix. Available at www.clinicaltrials.gov , (Identifier NCT00002916). 2007.
[368] Hu,J; Budgeon,L.; Cladel,N.; Culp,T.; Balogh,K.; Christensen,N.D. Detection of L1, infectious virions and anti-L1 antibody in domestic rabbits infected with cottontail rabbit papillomavirus. Journal of General Virology 2007;88(12):3286-93.
272 [369] Daftarian P, Ali S, Sharan R, Lacey SF, La Rosa C, Longmate J, Buck C, Siliciano RF, Diamond DJ. Immunization with Th-CTL fusion peptide and cytosine-phosphate- guanine DNA in transgenic HLA-A2 mice induces recognition of HIV-infected T cells and clears vaccinia virus challenge. Journal of Immunology 2003;171(8):4028-39
[370] Velders MP, Weijzen S, Eiben GL, Elmishad AG, Kloetzel PM, Higgins T, Ciccarelli RB, Evans M, Man S, Smith L, Kast W.M. Defined flanking spacers and enhanced proteolysis is essential for eradication of established tumors by an epitope string DNA vaccine. Journal of Immunology 2001;166(9):5366-73.
[371] Gambhira R, Jagu S, Karanam B, Gravitt PE, Culp TD, Christensen ND, Roden RBS. Protection of rabbits against challenge with rabbit papillomaviruses by immunization with the N terminus of human papillomavirus type 16 minor capsid antigen L2. Journal of Virology 2007;81(21):11585-92.
[372] Gambhira R, Gravitt PE, Bossis I, Stern PL, Viscidi RP, Roden RBS. Vaccination of healthy volunteers with human papillomavirus type 16 L2E7E6 fusion protein induces serum antibody that neutralizes across papillomavirus species. Cancer Research 2006;66(23):11120-24.
[373] Tough DF, Borrow P, Sprent J. Induction of bystander T cell proliferation by viruses and type I interferon in vivo. Science 1996;272(5270):1947-50.
[374] Sun S, Zhang X, Touch DF, Sprent J. Type I interferon-mediated stimulation of T cells by CpG DNA. Journal of Experimental Medicine 1998;188(12):2335-42.
[375] Fuller DH, Rajakumar PA, Wilson LA, Trichel AM, Fuller JT, Shipley T, Wu MS, Weis K, Rinaldo CR, Haynes JR, Murphey-Corb M. Induction of mucosal protection against primary, heterologous simian immunodeficiency virus by a DNA vaccine. Journal of Virology 2002;76(7):3309-17.
[376] Fuller DH, Rajakumar PA, Wu MS, McMahon CW, Shipley T, Fuller JT, Bazmi A, Trichel AM, Allen TM, Mothe B, Haynes JR, Watkins DI, Murphey-Corb M. DNA immunization in combination with effective antiretroviral drug therapy controls viral rebound and prevents simian AIDS after treatment is discontinued. Virology 2006;348(1):200-15.
[377] Roy MJ, Wu MS, Barr LJ, Fuller JT, Tussey LG, Speller S, Culp J, Burkholder JK, Swain WF, Dixon RM, Widera G, Vessey R, King A, Ogg G, Gallimore A, Haynes JR, Fuller DH. Induction of antigen-specific CD8+T cells, T helper cells, and protective levels of antibody in humans by particle-mediated administration of a hepatitis B virus DNA vaccine. Vaccine 2000;19(7-8):764-78.
[378] Kamath AT, Sheasby CE, Tough DF. Dendritic cells and NK cells stimulate bystander T cell activation in response to TLR agonists through secretion of IFN-alpha beta and IFN-gamma. Journal of Immunology 2005;174(2):767-76.
[379] Klinman DM, Yamshchikov G, Ishigatsubo Y. Contribution of CpG motifs to the immunogenicity of DNA vaccines. Journal of Immunology 1997;158(8):3635-39.
273 [380] Drape RJ, Macklin MD, Barr LJ, Jones S, Haynes JR, Dean HJ. Epidermal DNA vaccine for influenza is immunogenic in humans. Vaccine 2006;24(21):4475-81.
[381] Roberts LK, Barr LJ, Fuller DH, McMahon CW, Leese PT, Jones S. Clinical safety and efficacy of a powdered Hepatitis B nucleic acid vaccine delivered to the epidermis by a commercial prototype device. Vaccine 2005;23(40):4867-78.
[382] Verstrepen BE, Bins AD, Rollier CS, Mooij P, Koopman G, Sheppard NC, Sattentau Q, Wagner R, Wolf H, Schumacher TNM, Heeney JL, Haanen JBAG. Improved HIV-1 specific T-cell responses by short-interval DNA tattooing as compared to intramuscular immunization in non-human primates. Vaccine 2008;26(26):3346-51.
[383] Polack FP, Lee SH, Permar S, Manyara E, Nousari HG, Jeng Y, Mustafa F, Valsamakis A, Adams RJ, Robinson HL, Griffin DE. Successful DNA immunization against measles: Neutralizing antibody against either the hemagglutinin or fusion glycoprotein protects rhesus macaques without evidence of atypical measles. Nature Medicine 2000;6(7):776.
[384] Kamili S, Spelbring J, Carson D, Krawczynski K. Protective efficacy of hepatitis E virus DNA vaccine administered by gene gun in the cynomolgus macaque model of infection. Journal of Infectious Diseases 2004;189(2):258-64.
[385] Bergman PJ, Camps-Palau MA, McKnight JA, Leibman NF, Craft DM, Leung C, Liao J, Riviere I, Sadelain M, Hohenhaus AE, Gregor P, Houghton AN, Perales MA, Wolchok JD. Development of a xenogeneic DNA vaccine program for canine malignant melanoma at the Animal Medical Center. Vaccine 2006;24(21):4582-85.
[386] Liao JC, Gregor P, Wolchok JD, Orlandi F, Craft D, Leung C, Houghton AN, Bergman PJ. Vaccination with human tyrosinase DNA induces antibody responses in dogs with advanced melanoma. Cancer Immunity 2006;6:8.
[387] Kim DJ, Hoory T, Wu TC, Hung CF. Enhancing DNA vaccine potency by combining a strategy to prolong dendritic cell life and intracellular targeting strategies with a strategy to boost CD4(+) T cells. Human Gene Therapy 2007;18(11):1129-39.
[388] Robinson HL. Nucleic acid vaccines: An overview. Vaccine 1997;15(8):785-87.
[389] Fuller DH, Loudon P, Schmaljohn C. Preclinical and clinical progress of particle- mediated DNA vaccines for infectious diseases. Methods 2006;40(1):86-97.
[390] Bansal A, Jackson B, West K, Wang SX, Lu S, Kennedy JS, Goepfert PA. Multifunctional T-cell characteristics induced by a polyvalent DNA prime/protein boost human immunodeficiency virus type 1 vaccine regimen given to healthy adults are dependent on the route and dose of administration. Journal of Virology 2008;82(13):6458-69.
[391] Rao SS, Gomez P, Mascola JR, Dang V, Krivulka GR, Yu F, Lord CI, Shen L, Bailer R, Nabel GJ, Letvin NL. Comparative evaluation of three different intramuscular delivery methods for DNA immunization in a nonhuman primate animal model. Vaccine 2006;24(3):367-73.
274 [392] Condon C, WatkinsSC, CelluzziCM, Thompson K, Falo LD. DNA-based immunization by in vivo transfection of dendritic cells. Nature Medicine 1996;2(10):1122-28.
[393] Eisenbraun MD, Fuller DH, Haynes JR. Examination of Parameters Affecting the Elicitation of Humoral Immune-Responses by Particle Bombardment-Mediated Genetic Immunization. DNA and Cell Biology 1993;12(9):791-97.
275 Vita Callie E. Bounds
Education: The Pennsylvania State University College of Medicine 2004-2010 Hershey, Pennsylvania Ph.D. in Microbiology and Immunology
The University of Southern Mississippi 1998-2002 Hattiesburg, Mississippi Bachelors of Science in Biochemistry and Molecular Biology Graduated suma cum laude
Honors and Achievements NIH Travel Award, 26th International Papillomavirus Conference; Montreal, Quebec 2010 Information Technology Representative, GSA 2005-2006 Recipient of the Jordon Endowed Scholarship for Academic Excellence in Chemistry 2001-2002 Recipient of the Litton Industries Scholarship 2000-2002 Barry M Goldwater Semi-finalist 2000 The University of Southern Mississippi Dean’s List (9 semesters) 1998-2002 Recipient of the Wal-Mart Scholarship for Academic Excellence 1998-1999 The University of Southern Mississippi Leadership Scholar 1998-1999 Honors College Scholar 1998-2002
Selected Abstracts/Presentations CE Bounds, J. Hu, K. Balogh, NM Cladel, and ND. Christensen. HPV16E7 Restricted Epitope Specific Protective Cellular Immunity to Early and Late Protein Targets. 26th International Papillomavirus Conference. Montreal, Canada 2010.
CE Bounds, J. Hu, LR Budgeon, K. Balogh, NM Cladel, and NDChristensen. DNA Vaccination via Tattooing Induces Protective Specific Immunity in HLA-A2.1 Transgenic Rabbits. 26th International Papillomavirus Conference. Montreal, Canada 2010.
CE Bounds, J. Hu, K. Balogh and ND Christensen. Characterizing the Immunogenicity of an APL Using Two Preclinical Animal Models. Abstract for poster presentation. 26th International Papillomavirus Conference. Montreal, Canada 2010.
CE Bounds, J. Hu, K. Balogh, LR Budgeon, NM Cladel, and ND Christensen. Assessing Potential HPV16 E7 HLA- A2.1-Restricted CD8 T-Cell Responses Using Two Complimenting Preclinical Animal Models. 25th International Papillomavirus Conference. Malmo, Sweden 2009.
J Hu, NM Cladel, CE Bounds, K Balogh, and ND Christensen. Mucosally Delivered Peptides Prime Strong Immunity in HLA-A2.1 Transgenic Rabbits. 25th International Papillomavirus Conference. Malmo, Sweden 2009.
CE Bounds, J. Hu, X. Peng, TD Schell, LR Budgeon, NM Cladel, and ND Christensen. An HLA-A2.1 Transgenic Rabbit Model System to Study Virus-Host Interactions during a Viral Infection. 24th International Papillomavirus Conference Beijing, China 2007.
Publications • Christensen, ND and Bounds, CE. Cross-Protective Responses to Human Papillomavirus Infection. Future Virology 2010;5(2):163-174
• Bounds, CE, Hu, J, Balogh, K, Cladel, NM, and Christensen, ND. Relocation of an HPV16 E7 HLA-A2.1- Restricted CD8+ T Cell Epitope into the Cottontail Rabbit papillomavirus (CRPV) Genome Increases the Protective Immunity Elicited in the CRPV/HLA-A2.1 Transgenic Rabbit Model. (In Revision for Vaccine)
• Bounds, CE, Hu, J, Budgeon, L, Balogh, K, Cladel, NM, and Christensen, ND. DNA Vaccination via Tattooing Induces Specific Protective Immunity to HLA-A2.1-Restricted CRPV E1 and HPV16 E7 Epitopes in HLA-A2.1 Transgenic Rabbits (In Preparation for Clinical and Vaccine Immunology)