Tubby Mice Succumb to Blindness, Deafness, and Obesity

INVESTIGATING THE NEUROBIOLOGICAL ROLE OF TUBBY,

A PROTEIN INVOLVED IN OBESITY

RYAN MUI

A THESIS SUBMITTED IN CONFORMITY WITH

THE REQUIREMENTS FOR THE DEGREE OF

MASTER OF SCIENCE

THE DEPARTMENT OF MOLECULAR GENETICS

UNIVERSITY OF TORONTO

SAMUEL LUNENFELD RESEARCH INSTITUTE

INVESTIGATING THE NEUROBIOLOGICAL ROLE OF TUBBY, A PROTEIN INVOLVED IN OBESITY

Ryan Mui

Master of Science 2010

Department of Molecular Genetics

University of Toronto

Samuel Lunenfeld Research Institute

ABSTRACT

Tubby mice succumb to blindness, deafness, and obesity. Vision and auditory

deficits are attributed to neurodegeneration and tubby-associated obesity has been

postulated to result from neuronal deficits in brain regions controlling weight regulation.

TUB has been implicated in Gαq signaling and 2 isoforms of TUB, found exclusively in

the brain, may have opposing effects on transactivation. Toward this end, I developed

several cell culture assays to interrogate TUB function and found that TUB directs

neuronal outgrowth in an isoform-specific manner. One isoform directs stable and polar

outgrowth while the other directs multiple process outgrowths and branching. These

effects can occur via Gαq signaling and require nuclear localization. Furthermore, I have

found that the serotonergic system of tubby mice displays morphological and innervation deficits. Since the serotonergic system is implicated in modulating moods and behaviours, including appetite, these deficits may result in the obesity and motivational issues observed in tubby mice.

iii

ACKNOWLEDGEMENTS

First and foremost, I would like to gratefully express my gratitude to my supervisor, Dr. Sabine Cordes, whose expertise, patience, and enthusiastic support has considerably enriched my graduate experience at Mt. Sinai Hospital. The mentorship and training that Dr. Cordes has provided me throughout these years is truly invaluable. Furthermore, I would also like to thank my committee members, Dr. Gabrielle Boulianne and Dr. James Dennis for their constructive feedback and guidance throughout the various stages of my personal development and throughout the revisions of this thesis. Finally, I would like to thank all the members of the Cordes lab. Thank you for all the laughs and memories- they are more than enough to last a lifetime.

TABLE OF CONTENTS

ABSTRACT ……………………………………………………………………... ii

ACKNOWLEDGEMENTS ………………………………………………………. iii

TABLE OF CONTENTS …………………………………………………………. iv

LIST OF FIGURES …………………………………………………………...... vi

LIST OF TABLES ………………………………………………………………... vii

LIST OF ABBREVIATIONS ……………………………………………………. viii

1.0 INTRODUCTION …………………………………………………………… 1

1.1 Intrinsic regulation of neuronal outgrowth …………………………… 1 1.2 Tubby, a putative transcription factor involved in Gαq signaling ……. 2 1.3 Neuronal deficits resulting in the obesity phenotype are not fully Understood ……………………………………………………………. 5 1.4 The tubby mutation might result from deficits in serotonin-signaling .. 8 1.5 The tubby and anorexia mouse mutation manifest opposite phenotypes .. 9 1.6 Anorexia-associated lethality can be suppressed by the TUB protein ….. 11

2.0 MATERIALS AND METHODS …………………………………………… 14

2.1 Generation and genotyping of anorexia mice…………………………… 14 2.2 Analysis of TUB isoform protein levels in anx/anx and anx/+ brain regions via Western blotting ……………………………………………. 14 2.3 Generation of TUB Constructs and accessory constructs ………………. 15 2.4 N2A cell culture and reagents ………………………………………… 17 2.5 Generation of stable cell lines ………………………………………… 17 2.6 Western blotting to verify protein levels ……………………………… 17 2.7 Morphological studies in N2A ………………………………………….. 18 2.8 Quantification detection criteria used to evaluate neuritic outgrowth in N2A …………………………………………………………………… 20 2.9 Generation of primary striatal and hippocampal cultures ………………. 21 2.10 Immunocytochemistry ………………………………………………….. 22 2.11 Morphological studies in primary striatal and hippocampal neurons ….. 22 2.12 Generation of tub/tub mice ……………………………………………... 23 2.13 Analysis of serotonergic neuronal innervation in the hippocampus ……. 24

3.0 RESULTS ……………………………………………………………………. 25 3.1 Relative protein levels of full length versus Δ5 TUB are increased in brain regions of C57 anx/anx mice……………………………………… 25 v

3.2 PIP2 binding sequesters TUB from the nucleus in N2A cells ………….. 26 3.3 N2A cells undergo minor differentiation after 48 hours of incubation …. 28 3.4 Constitutively activated TUB promotes isoform-specific neuritic outgrowth formation in N2A cells ……………………………………… 29 3.5 Cells expressing constitutively activated full length and Δ5 TUB do not secrete factors into the media that promote isoform-specific neuritic outgrowth ……………………………………………………………….. 32 3.6 Unactivated TUB is nuclear upon activation by substance P through the neurokinin-1 receptor and directs isoform-specific neuritic outgrowth … 32 3.7 TUB can exist in cytoplasmic vesicle-like entities ……………………... 36 3.8 Nuclear localization of TUB is essential for isoform-specific neuritic outgrowth in N2A cells …………………………………………………. 37 3.9 Constitutively activated full length and Δ5 TUB direct isoform-specific neuritic outgrowth in primary striatal neuronal cultures ………………... 40 3.10 Constitutively activated full length and Δ5 TUB direct isoform-specific neuritic outgrowth in primary hippocampal neuronal cultures …………. 43 3.11 Summary of TUB-effects on neuritic outgrowth in different cell lines … 45 3.12 Serotonergic neuronal innervation and morphology is affected in the hippocampus of tub/tub mice …………………………………………… 46

4.0 DISCUSSION ………………………………………………………………... 50 4.1 Relative levels of full length versus Δ5 TUB are increased in the hippocampus of anx/anx mice …………………………………………... 50 4.2 TUB directs isoform-specific neuritic outgrowth through Gαq signaling and translocation to the nucleus ………………………………………… 50 4.3 Constitutively activated TUB directs isoform-specific neuritic outgrowth in primary striatal and hippocampal neurons ……………….. 55 4.4 Analyzing TUB function and regulation using cell culture-based assays . 58 4.5 The regulation of Tubby splicing on neuritic outgrowth ………………... 59 4.6 Aberrant morphology and innervation of serotonergic neurons in the hippocampus of tub/tub mice …………………………………………… 60

5.0 CONCLUSIONS …………………………………………………………….. 62

6.0 APPENDIX …………………………………………………………………... 63 6.1 The mood stabilizers lithium and valproic acid promote process formation and elongation in N2A cells and enhance the isoform-specific cell shape changes of constitutively activated TUB ……………………. 63

7.0 REFERENCES ………………………………………………………………. 67

LIST OF FIGURES

Figure 1: TUB is implicated in Gaq signaling as a possible transcription regulator ……………………………………………………………….. 4

Figure 2: Isoform levels of TUB in the brain ……………………………………. 12

Figure 3: Immunoblotting for TUB-isoforms in anx/anx mice and anx/+ mouse brain regions …………………………………………………………… 25

Figure 4: Stable expression of TUB-RFP isoforms (unactivated and constitutively activated) in N2A cells …………………………………. 27

Figure 5: Percentage of neurite-bearing cells in stable cell lines ………………... 28

Figure 6: Isoform-specific cell shape changes occur in constitutively activated TUB-expressing N2A cells ……………………………………………. 31

Figure 7: TUB isoform-specific neuritic outgrowth is not the result of a cellular secreted factor ………………………………………………………… 32

Figure 8: TUB can be activated by substance P through the neurokinin-1 receptor to direct isoform-specific cell shape changes ………………. 35

Figure 9: The TUB protein can exist in cytosolic vesicles in N2A cells ……….. 36

Figure 10: The K39KKR to LAAA mutation in the nuclear localization signal attenuates nuclear accumulation and TUB-isoform specific neuritic outgrowth …………………………………………………………….. 39

Figure 11: Constitutively activated TUB directs isoform-specific cell shape changes in primary striatal neurons ………………………………….. 42

Figure 12: Constitutively activated TUB directs isoform-specific cell shape changes in primary hippocampal neurons ……………………………. 45

Figure 13: Mice homozygous for the tubby mutation display aberrant serotonergic innervation in the hippocampus ………………………... 49

Figure 14: Relative levels of full length TUB and Δ5 TUB could be important for regulating neuronal outgrowth ……………………………………….. 59

Figure 15: The mood stabilizers lithium and valproic acid promote process formation and elongation in N2A cells and enhance the isoform- specific cell shape changes of constitutively activated TUB ………… 63

vii

LIST OF TABLES

Table 1: Hypothalamic dysregulation in tub/tub mice ………………………… 8

Table 2: Analysis of process outgrowth (mean percentage average ± standard error) and degree of branching (average number of processes ± standard error) in stable cell lines ……………………………………. 29

Table 3: Analysis of process outgrowth (mean percentage average ± standard error) and degree of branching (average number of processes ± standard error) before and after activation of TUB via substance P and the neurokinin-1 receptor ………………………………………... 34

Table 4: Analysis of process outgrowth (mean percentage average ± standard error) and degree of branching (average number of processes ± standard error) when nuclear accumulation of TUB is attenuated …… 37

LIST OF APPENDICES

Appendix: The mood stabilizers lithium and valproic acid promote process formation and elongation in N2A cells and enhance the isoform- specific cell shape changes of constitutively activated TUB …………. 63

viii

LIST OF ABBREVIATIONS

5-HT serotonin 5-HTT serotonin transporter AgRP agouti-related protein α-MSH α-melanocyte stimulating hormone CAT chloramphenicol acetyltransferase DBD DNA binding domain GFP green fluorescent protein GPCR G-protein coupled receptor Hrct neuropeptide preproorexin MAP1A microtubule associated protein 1A MAP2 microtubule associated protein 2 N2A neuroblastoma 2A NFAT nuclear factor of activated T cells NF-κB nuclear factor-κB NK1 neurokinin-1 receptor NLS nuclear localization signal NPY neuropeptide Y PIP2 phosphotidylinositol-4,5-bisphosphate PLC phospholipase C POMC pro-opiomelanocortin receptor RBG-3 Rab GTPase-activating protein RFP red fluorescent protein SP substance P TAD transcription activation domain TUB Tubby

1.0 INTRODUCTION

1.1 Intrinsic regulation of neuronal outgrowth

Neurons are defined by the morphology of their intricately elaborate axons and dendrites, which are well suited for their specific function and crucial in mediating proper synapse formation and synaptic transmission. Neuronal outgrowth is a dynamic process that involves the rapid remodeling of actin filaments and microtubules within growth cones in response to extracellular signals, which, in turn, activate intracellular cascades that modulate neuronal plasticity [1]. While the intrinsic programs that regulate neuronal plasticity will involve different molecular processes, they are likely to all converge, at least in part, by altering gene expression. Interestingly, signal transduction pathways that affect neuronal structure and function seem to result in the increase of intracellular calcium, a second messenger that has been implicated in regulating gene expression at multiple levels such as mRNA splicing, translation, and transcription activation, the latter of which has been more thoroughly investigated in the context of neuronal outgrowth [2- 5]. Significant progress has been made in identifying latent transcriptional regulators at the cell periphery that are translocated to the nucleus following activation to potentiate activity-dependent transcription regulation. Two such transcription factors are nuclear factor of activated T cells (NFAT) and nuclear factor-κB (NF-κB), which are held inactive in the cytoplasm until the rapid influx of calcium [6-9]. Even though these inducible cytoplasmic transcription factors present an effective mechanism through which external signals are translated directly to the nucleus, their activation is not tightly regulated by a specific receptor and/or ligand. In addition, their activity relies on calcium influx, which would also activate additional signaling pathways. Thus, the mechanisms by which calcium signals regulate specific gene expression responses through NFAT and NF-κB remain elusive. Alternatively, tighter regulation would have the transcription factor sequestered to the membrane, coupled to a specific receptor that awaits a specific ligand in order to potentiate transcription regulation. Interestingly the Tubby protein, which has the ability to bind phosphoinositol lipids of the membrane [10], is postulated to regulate transcription in response to Gαq

1 signaling in neurons through two brain-specific isoforms. These isoforms have presumptive antagonistic effects on transactivation. While to date, a role for Tubby in neurons has not been fully fleshed out, our lab has accumulated evidence to suggest that isoform levels of Tubby may regulate neuronal outgrowth. Toward this end, the bulk of my work has been focused on testing the ability of specific Tubby isoforms to direct neuronal outgrowth via Gαq signaling, which would represent a tightly controlled mechanism by which neurons use to modulate neuronal plasticity in response to Gαq ligands.

1.2 Tubby, a putative transcription factor involved in Gαq signaling

The tubby mutation, which arose spontaneously in a breeding colony in the Jackson Laboratories [11] results in early blindness and deafness, coupled with age-onset obesity that is associated with insulin resistance [12, 13]. Since tubby was first cloned, sequence alignments demonstrated that the C- terminus of the TUB protein is highly conserved in many organisms across the plant and animal kingdom including mice and humans, in addition to other organisms such as Drosophila, Caenorhabditis elegans, Arabidopsis, rice, and maize, suggesting that TUB may play a fundamental role in all of these organisms [14, 15]. In mice and humans, Tubby is the founding member of a novel gene family that encompasses 3 other proteins (Tubby-like proteins 1-3), all of which lack homology to any protein of known function [12, 13, 16]. The highly conserved and unique C-terminus of Tubby and its family members contain 260 amino acids which have been referred to as the “TUB domain” [15]. The tubby mutation, which encompasses a G- to-T transversion in the splice site junction of exon 11, results in the substitution of the terminal 44 amino acids of the “TUB domain” with 26 different intron-encoded amino acids [12]. Furthermore, the tubby phenotype is recapitulated following targeted deletion of the Tubby gene in mice, suggesting that tubby is indeed a loss-of-function mutation [17] and the “TUB domain" mediates the primitive functions of this gene. Two single nucleotide polymorphisms in the “TUB domain” of human TUB have been associated with obesity and type 2 diabetes [18], suggesting that the TUB protein might affect weight regulation and metabolism in humans.

2 While TUB function is poorly understood [12, 14, 19], elegant structure-function analyses and standard biochemical assays have provided some clues. These data suggest that TUB is a membrane-bound transcription regulator in phosphotidylinositol signaling [10, 14]. TUB contains a nuclear localization signal (NLS) and a putative transcription activation domain (TAD) in its N-terminus, and a phosphotidylinositol-4,5-bisphosphate (PIP2) binding domain, and a putative DNA binding domain at its C-terminus (Figure 1A). Taken together, these data suggest that TUB is initially tethered to the membrane via PIP2 and bound to Gαq. Gαq is activated upon Gαq-specific ligand binding to the G- protein coupled receptor (GPCR), which in turn activates phospholipase C-β (PLCβ). Activated PLC-β then cleaves PIP2, releasing TUB from the membrane, regulating in its translocation to the nucleus [10] (Figure 1B). Given its DNA binding domain, which in gel shift experiments has been shown to non-specifically bind double stranded DNA, TUB could be acting as a transcription factor [14]. Furthermore, the N-terminus of TUB is reminiscent of transactivation domains of other transcriptional regulators and TUB has been shown to activate transcription through a GAL4/chloramphenicol acetyltransferase (CAT) reporter system [14]. Specifically in the brain, two splice isoforms of TUB exist and are distinguished by the presence or absence of exon 5 [12], and we will refer to these as full length TUB and Δ5 TUB, respectively. Interestingly, the presence of exon 5 has been shown to be crucial for transactivation using the Gal4/CAT reporter system, suggesting that alternative splicing of TUB might regulate transcriptional activation of currently, unknown genes [14] (Figure 1C).

Figure 1. TUB is implicated in Gαq signaling as a possible transcription regulator. (A) Structural domains identified in TUB [10, 14] (figure adapted from [14]). (B) Nuclear translocation of TUB could be mediated through Gαq signaling [10, 14] (figure modified from [10]). (C) Isoforms of TUB are postulated to regulate transcription

TUB expression has been shown most abundantly in nervous tissue within the eye, ear and brain [12, 20, 21], and there has been an intense interest in analyzing neuronal deficits in tubby mutants. While this hunt has generated a considerable amount

4 of data addressing neurodegeneration when TUB is non-functional or absent, the normal function of the Tubby protein in neurons is unknown.

1.3 Neuronal deficits resulting in the obesity phenotype are not fully understood

Vision and hearing loss have been well documented in tubby mice and is attributed to neurosensory degeneration of photoreceptor cells in the eye and cochlear hair cells of the ear, respectively [17, 22-25]. The nature of these degenerative effects suggests that TUB could be involved in the trafficking of cargo proteins along the cytoskeleton. In the eye, outer segments of rod cells in the retina fail to develop in tubby mice, and this has been attributed to mislocalization of rhodopsin and inapproprriate light/dark compartmentalization of β-arrestin and α-transducin [22, 24]. In the ear, strain- specific variations in microtubule-associated protein 1a (MAP1A) have been shown to rescue the hearing deficits of tubby mice [26, 27]. If vesicular trafficking and/or interactions with MAP1A are critical features of TUB function, TUB may mediate the transport of cargo along microtubules and/or cytoskeletal architecture in neurons. Thus, TUB may play a crucial role in the nervous system. However, neuronal deficits contributing to weight regulation have been only suggestive at best, and are not nearly as dramatic as those reported in the eye and ear. A role for TUB in weight regulation seems to be conserved in evolution as deletion of the tubby ortholog, tub-1 in C.elegans also results in fat accumulation [28]. In support of TUB function in the transport of cargo, TUB-1 has been shown to interact with RabGTPase-activating protein (RBG-3) in a yeast two-hybrid screen and has been shown, using time-lapse photography, to undergo transport in vesicular particles along the dendrites and axoneme of ciliated neurons [29]. Since RabGTPase-activating proteins inactivate RabGTPases, which regulate vesicular transport [30], it is tempting to speculate that TUB-1 might be involved in neuronal trafficking as a transporter or as cargo, which could be important for weight regulation. Interestingly, rbg-3 RNAi has been shown to decrease fat storage in tub-1 mutants, suggesting that biologically, RBG-3 is likely a downstream target of TUB-1 in fat storage [29]. While a direct role for TUB in neuronal trafficking has yet to be reported with respect to weight regulation in tubby mice, many reports suggest aberrant expression

5 patterns of key regulators of food intake in the brain. The hippocampus and the hypothalamus are regions of the brain that abundantly express TUB [12], the latter of which is known to regulate balance between hunger, satiety, and energy metabolism and thus, have a large impact on feeding behaviour and weight regulation [31-33]. Studies that have investigated possible hypothalamic deficits in tubby mice have yielded interesting results which point to possible disturbances in hypothalamic neuroendocrine pathways as a result of abnormal gene expression. These findings are summarized in Table 1. Interestingly and somewhat counterintuitively, semi-quantitative radioactive in situ hybridization showed that the arcuate nucleus of adult tubby mice displayed transcriptional down-regulation of the orexigenic neuropeptides agouti-related protein (AgRP) (71.7±11.3% of heterozygous mice) and neuropeptide Y (NPY) (approximately 38% lower than wildtype controls) [34, 35]. However, using the same techniques, NPY mRNA was also found to be upregulated approximately 30-fold in the dorsomedial and ventromedial hypothalamic nuclei [34], areas that are normally involved in satiety regulation and appetite suppression [36] and thus, would not normally express high levels of NPY [37]. Furthermore, semi-quantitative radioactive in situ hybridization in the arcuate nucleus of tubby mice shows a reduction of approximately 20% of pro- opiomelanocortin (POMC) mRNA in comparison to wildtype controls. Since the POMC receptor is activated by the anorexigenic peptide α-melanocyte-stimulating hormone (α- MSH and a product of POMC cleavage) and de-activated by AgRP, it has been suggested that the tubby mutation could be disrupting the hyptholamic melanocortin system [34, 35]. In addition, real-time quantitative RT-PCR performed on the hypothalamus of tubby mice revealed a nearly 64-fold increase of neuropeptide preproorexin (Hrct) mRNA and immunohistochemistry revealed higher orexin protein levels in the somas of orexin neurons of the lateral hypothalamus relative to controls (heterozygote and wildtype) [38]. This could ultimately affect the autonomic nervous system which eventually reaches the liver, the site that has been reported to be the cause of respiratory and carbohydrate metabolism defects that require tubby mice to rely predominantly on lipid metabolism for energy requirements [38]. Investigations into the chemical neuroanatomy of the mediobasal hypothalamus reveals the presence of unusually large cholinergic and GABAergic nerve terminals surrounding blood vessels that display abnormal vascular

6 innervation into the arcuate nucleus [39]. It has been suggested that possible abnormal gene expression in the hypothalamus might result from compromised blood flow that would otherwise facilitate communication between the periphery and neurons to effectively regulate neuronal transcription programs [35, 39]. Despite all of these interesting findings, it is still unclear whether discrepancies in the expression of genes crucial in regulating hunger and satiety cues result from a direct or an indirect consequence of the tubby mutation. Furthermore, the role in which TUB plays in regulating these expression programs is still unknown. There is also evidence suggesting that tubby-associated obesity could be linked to deficits in energy expenditure. Neuronal cell culture experiments and Tubby expression

studies in hypothyroid mice suggest that the thyroid hormone T3 upregulates Tubby expression, a finding that was supported by a differential-display screen demonstrating

that the Tubby gene is regulated downstream of the T3 receptor. This suggests that TUB is a possible regulator of metabolism [40]. More recently, tubby-associated obesity has been attributed to a reduction in activity without hyperphagia [41]. In contrast to previous findings [11, 38], food intake was found to be dramatically reduced in both mice heterozygous and homozygous for the tubby mutation compared to normal mice. Although food intake was comparable in tub/+ and tub/tub mice, tub/+ mice did not develop obesity because unlike tub/tub mice, they were found to exercise at normal levels. By contrast, tubby mice were found to be less active. It is possible that tubby mice reduce food intake to compensate for an excess of energy that they do not use and rather store in the form of fat [41]. This would be in agreement with their constant reliance on lipid metabolism for energy [38]. Most interestingly however, along with a reduction in food intake, tubby mice resisted voluntary use of the running wheel and Rota-Rod. Since all three of these activities have a reward-based association component with motivation, the authors have suggested that the tubby mutation may also encompass a motivational behavioural defect reminiscent of depression [41], which might be the cause of neuronal deficits that involve the regulation of motivation.

7 Table 1. Hypothalamic dysregulation in tub/tub mice

IF= immunofluorescence, RT-QPCR= reverse transcription quantitative polymerase chain reaction, ISH=in situ hybridization

1.4 The tubby mutation might result from deficits in serotonin-signaling

The hypothalamic dysregulation and possible motivational behavioural defects observed in tubby mice could be indicative of abnormalities residing in the serotonergic system, which has been extensively studied in regards to feeding behaviour and depression. Increasing serotonin neurotransmission and serotonin bioavailability are common mechanisms of successful anorexigenic and anti-depressant pharmacological agents [42, 43]. Serotonin (5-HT) does not cross the blood brain barrier. 5-HT requirements in the brain must derive from serotonergic pathways that innervate the brain [44, 45]. Serotonergic innervation into cortical and subcortical regions is thus, extensive, highly organized, and paramount for many cellular processes and signaling programs in the brain that would require that 5-HT is delivered at appropriate levels and to the appropriate places. With respect to hypothalamic regulation of feeding behaviour and energy expenditure, many of the orexigenic and anorexigic pathways rely on serotonin levels supplied by serotonergic innervation in the hypothalamus. Serotonergic fibers making contact with the arcuate and paraventricular nuclei of the hypothalamus [46-48] play a role in NPY expression and secretion. 5-HT1B and 5-HT2C receptor antagonists such as methysergide increase appetite and result in NPY mRNA upregulation in the arcuate nucleus and increased secretion into the paraventricular nucleus [49], while fenfluoramine and fluoxetine, agents which inhibit 5-HT re-uptake induce anorexia and reduce NPY mRNA expression in the arcuate nucleus [50, 51]. Serotonin pathways have also been shown to modulate food intake through the melanocortin systems by

8 differentially regulating the secretion of α-MSH and AgRP, which evoke agonistic and antagonistic effects on melanocortin receptors, respectively. Specifically, in the arcuate nucleus, 5-HT has been shown to hyperpolarize and inhibit the activity of NPY/AgRP neurons and decrease inhibitory postsynaptic currents onto POMC neurons [52] in the regulation of feeding behaviour and energy balance. Furthermore, 5-HT receptors, such

as the 5HT2c receptor, located on post-synaptic 5HT targets, play a significant role in 5-

HT neurotransmission, and in support of their appetite suppression characteristics, 5-HT2c receptor knockout mice also develop obesity [53-55]. Thus, the aberrant expression of NPY, AgRP, and POMC observed in tubby mice, could be attributed to deficits in serotonin bioavailability or neurotransmission in the hypothalamus.

1.5 The tubby and anorexia mouse mutation manifest opposite phenotypes

Since the genetic identification of tubby-associated obesity, many reports and reviews of other obesity-causing mouse mutations (spontaneous and transgenic) have contrasted their findings to the tubby mutation. These comparisons been successful in identifying many characteristic similarities and overlapping abnormalities that could further our understanding of TUB function. Given our current understanding of tubby- associated obesity, the tubby-associated obesity closely resembles that of fat mice, which have a mutation in the carboxypeptidase E gene resulting in defective sorting and processing of neuropeptide ligands of the melanocortin-4 receptor [11, 53, 56, 57] and transgenic mice which lack the appetite suppressing 5HT2c receptor [53-55], all of which result in age-onset obesity without severe hyperphagia. Furthermore, these receptors signal through Gαq [58, 59] and have been implicated in human weight regulation [43, 60-62]. Using a different approach, our lab has decided to study TUB function in light of the anorexia mouse mutation, which exhibits an opposite array of phenotypes compared to the tubby mutation. Mice homozygous for the anorexia mutation fail to thrive as a result of poor appetite and display an unusual pattern of characteristics such as aggression, hyperactivity, body tremors, headweaving, uncoordinated gait, and seizures [63, 64]. These mice ultimately die by 3-5 weeks depending on their genetic background

9 [63]. Like tubby, the anorexia phenotype has been attributed to neuronal deficits. While their phenotypes are remarkably dissimilar, these effects may be the result of defects in common pathways. Like tubby mice, anorexia mice display aberrant expression patterns of NPY, AgRP, and POMC. While NPY and AgRP mRNA expression in the arcuate cell bodies of anorexia mice are unaltered, NPY and AgRP protein distribution is abnormally restricted to arcuate cell bodies and barely detectable along innervating axons and in axonal terminals, although at present, it is difficult to rule out that this is not a secondary consequence of neurodegeneration. This aberrant expression is concomitant with a decrease in expression in the paraventricular hypothalamic nucleus and other hypothalamic regions [65, 66], which normally would mediate orexigenic behaviour [67]. Furthermore, like tubby mice, the arcuate nucleus of anorexia mice also display a decrease in transcription levels of POMC mRNA [68]. Thus, it is possible that tubby and anorexia both result from similarly converging dysfunctional hypothalamic peptidergic programs that could affect energy metabolism. Interestingly, the hyperactive behaviours associated with the anorexia mutation can be induced in normal mice by over-simulating serotonin receptors with serotonin (5- HT) and by contrast, the serotonergic antagonist 5,7-dihydroxytryptamine ameliorates these behaviours in anorexia mice [64]. Furthermore, 5-HT transporter (5-HTT) mRNA levels are downregulated in the raphe nucleus of anorexia mice [69]. This could suggest that the anorexia phenotype is caused by hyper-active 5-HT-signaling, which would likely require an increase in serotonin bioavailability. In conjunction with 5-HT signaling deficits, anorexia mice display dramatic hyperinnervation of serotonergic neurons in brain regions such as the frontal cortex, hippocampus, olfactory bulb [70] and the hypothalamus [71]. Taken together, these results suggest that the serotonergic targets of

anorexia mice could be receiving too much serotonin. By striking contrast, 5HT2c receptor knockout mice display age-onset obesity that is comparable to tubby mice.

Since TUB has been shown to interact with the 5HT2c receptor via Gαq signaling [9], and given that mice lacking this receptor are hyperactive [72], it is possible that TUB could be implicated in the response of cellular targets to serotonin, and hence, be important for the serotonergic system. Given that anorexia mice fail to thrive as a result of excessive 5- HT signaling, it could be possible that tubby mice suffer from obesity due to

10 compromised 5-HT signaling. While there has certainly been suggestive evidence alluding to possible defects in serotonergic activity in the tubby mouse [41], the serotonergic system has yet to be directly investigated in light of TUB function.

1.6 Anorexia-associated lethality can be suppressed by the TUB protein

While investigations over nearly two decades have examined the neurodegeneration changes which result from the tubby mutation, the functional role of TUB in the brain has remained elusive. So far, studies have focused primarily on the consequences of TUB deletion. While studying the loss of TUB function has identified possible defects that could contribute to the tubby phenotype, these investigations have not explained the respective role of each of the two naturally occurring isoforms [12], which are predicted to have different functions [14]. Our lab has generated data suggesting that TUB may modify the anorexia mutation as a function of the differential expression of TUB isoforms. Genetic mapping of Molossinus (Molf) x C57BL/6J intercrossing performed by Dennis Kim revealed that the anorexia phenotype can be suppressed on a hybrid background, and mapped to a 10Mb region on chromosome 7. Of the possible suppressor genes in this region, we have obtained data to suggest that TUB is a likely candidate of anorexia suppression. Hybrid C57/Molf anx/anx mice were generated by intercrossing the anx/+ progeny obtained from an initial Molf +/+ and C57 anx/+ mice cross. While anorexia mice on a C57BL/6J background die by P19-P21, anorexia mice on a hybrid background displayed a broad range of survival between P21 and P34. Full length versus Δ5 TUB levels vary in different mouse strains. RT-PCR by Michael Huynh performed on brain lysates show that in C57 mice, there is a higher ratio of full length versus Δ5 TUB and this is reversed in Molf mice, which display higher levels of Δ5 versus full length TUB (Figure 2A), similar to previously reported findings [12]. Interestingly, Dennis Kim found that anorexia mice homozygous for the C57 TUB allele live longer and display less head weaving, uncoordination, and body tremors than anorexia mice homozygous for the Molf TUB allele, suggesting that suppression of the anorexia phenotype might be attributed to variance in TUB isoform levels. To this end, Michael Huynh further determined on a

11 C57BL/6J background that the full length TUB construct is expressed at higher levels in anorexia mice (Figure 2B), suggesting that full length TUB might be suppressing the anorexia phenotype. Finally, Dennis Kim has also shown that mice homozygous for both tubby and anorexia succumb to a faster onset of anorexia-associated deterioration and lethality than mice homozygous for anorexia alone, suggesting that manifestation of the anorexia phenotype is more dramatic in the absence of functional TUB. Since the serotonergic system displays aberrant hyperinnervation in anorexia mice, and given that the anorexia phenotype can be ameliorated through manipulations of the serotonergic system or via different TUB-isoform levels, we hypothesized that TUB function could involve mechanisms that affect neuronal outgrowth. Specifically, we hypothesized that full length TUB promotes stable and organized neuronal outgrowth while Δ5 TUB modulates this stability by enabling plasticity.

Figure 2. Isoform levels of TUB in the brain. (A) RT-PCR performed by Michael Huynh showing that Molf and C57 mice contain different levels of full length versus ΔTUB in the brain. (B) RT-PCR performed by Michael Huynh showing that full length TUB is upregulated in the brains of C57 anorexia mice.

In the experiments presented here, I show that upregulation of full length TUB mRNA results in higher protein levels of TUB in anorexia mice. With respect to TUB function, I present evidence using murine neuroblastoma 2A (N2A) cells and primary neuronal culture that TUB function promotes isoform-specific neuritic outgrowth. Furthermore, I show that TUB isoform-directed neuronal outgrowth requires nuclear localization and can be regulated via the Gαq-coupled neurokinin-1 receptor. In line with

12 a role in neuronal outgrowth, my investigation of the serotonergic system in tub/tub mice reveals both morphological and innervation deficits in the hippocampus.

13 2.0 MATERIALS AND METHODS

2.1 Generation and genotyping of anorexia mice

anx/+ mice were obtained from the mouse mutant resource at the Jackson Laboratories (Bar Harbor, Maine, USA). Heterozygous mice on a nonagouti hybrid background referred to as B6C3Fe a/a-anx/J were crossed onto C57Bl6/J strains. After more than 10 generations of backcross to C57Bl6/J, progeny from heterozygous intercrosses were genotyped as follows. Genomic DNA from tail clips were amplified by polymerase chain reaction (PCR) using the following primers: 5’- GATGGCGCTGAGGCGGAGCATG-3’ and 5’-CTGCGTCCTAGTCTCGGCCTTC-3’. Each 50μL PCR reaction contained 5μL of 10xRACE buffer, 5μL DMSO, 0.4μL of 25mM dNTPs, 38.15μL water, 0.1μL of 200μM primer, 0.25μL Taq polymerase (NEB) and 1μL of DNA. The program consisted of a primary denaturation step of 2 minutes at 96oC, followed by the denaturation step of 30 seconds at 94oC, annealing step for 30 seconds at 55oC, and elongation step for 45 seconds at 72oC. Cycles were repeated 35 times before the final last extension step of 7 minutes at 72oC. The resulting 250 bp PCR product was digested with NlaIV, which cuts normal but not anx DNA, and subsequently analyzed on a 3% agarose gel. The wildtype product was digested into 180 and 70 base pair fragments while the homozygous mutant product was left undigested. All animal husbandry and experiments were performed accordingly to CCAC standards.

2.2 Analysis of TUB isoform protein levels in anx/anx and anx/+ brain regions via Western blotting

Brain lysates of the cerebral cortex, cerebellum, and hippocampus were prepared by Joanna Yu, a present graduate student in our lab. Harvested tissue was homogenized using a pestle in RIPA buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 2mM EDTA, 1% NP-40, 0.1% SDS) supplemented with a 1:500 dilution of specificity protease inhibitor cocktail (Sigma) at 4oC. Lysates were then clarified by centrifugation at 4oC for 10 minutes. Protein concentration was measured using Bradford reagent (Bio-Rad) according to the manufacturer’s instructions and 30-60μg of lysate from each sample was

14 separated via SDS-PAGE on 12% gels, and transferred to nitrocellulose membranes (Amersham). Membranes were blocked in 5% nonfat milk and 2% BSA in Tris-buffered saline, supplemented with Tween 20 (10 mM Tris, pH 7.3, 150 mM NaCl, 0.1% Tween 20). Membranes were then incubated overnight at 4oC in primary antibody against TUB (Santa Cruz). Immunoreactive antibodies were detected using horseradish peroxidase- conjugated secondary antibody (Santa Cruz) for 1 hour at room temperature, followed by the addition of enhanced chemiluminescence (ECL) reagent (PerkinElmer). ImageQuant 5.0 was used to generate desitometry plots of full length versus Δ5 TUB levels. Standard student t-tests were used to compare data sets.

2.3 Generation of TUB constructs and accessory constructs

Full length and Δ5 TUB isoform expression constructs were generated using the coding sequence of the murine TUB gene in addition to constructs of these isoforms that harbor a previously reported K330A mutation in the PIP2 binding domain that attenuated PIP2 binding. These constructs were generated by Michael Huynh, a former graduate student in the lab, using Gateway Recombination (Invitrogen), which is a technology that facilitates cloning in a manner that circumvents the limitations of traditional cloning via the use restriction endonucleases. The ease of this method involved flanking the gene of interest with unique sequences (Gateway attachment sites) that allowed the transfer of the gene into the Gateway-adapted vector pDONR 201, a vector which was designed to facilitate the recombineering of the gene of interest into an expression vector, such as pDEST. We used the expression vectors pDEST 47 and CAGGS, which were modified by insertion of RFP downstream from our gene of interest (using NheI). Full length and Δ5 TUB cDNA was generated using RT-PCR from brain tissue via the following primers in PFX polymerase PCR reactions: 5’GGGGACAAGTTTGTACAAAAAAGCAGGCTGGAGACATGACTTCCAAGCCG CATTCCGAC-3’ and 5’GGGGACCACTTTGTACAAGAAAGCTGGGTCGCAGGCCAGCTTGCTGTCAAA G-3’. Full length and Δ5 TUB harboring a mutation in the PIP2 binding domain (K330 to A330) was generated using two PCR products that were subsequently ligated together. The 5’ TUB coding region PCR product employed the following primers:

15 5’-GAGAATTCTGGAGACATGACTTCCAAGCCCGCATTC-3’ and 5’-GTCTCGCGAATGCCCCGATATAGCTATCGCCTC-3’. The 3’TUB coding region PCR product employed the following primers: 5’-GAGAATTCATTCGCGAGCAACCTGATGGGCACCAAGTTC-3’ and 5’-GAGGATCCGTCGCAGGCCAGCTTGCTGTCAAAG-3’. The HA-tagged NK-1 receptor construct was generously provided by Dr. Mark vonZastrow, from the University of California, San Francisco. Constitutively activated full length and Δ5 TUB constructs harboring a previously characterized mutation in the nuclear localization signal was generated by mutating amino acid sequence K39KKK to LAAA in our original constitutively activated TUB-GFP constructs. The mutation was introduced in lieu of the functional NLS sequence via PCR. The forward primer contained the mutation in addition to an upstream ApaI site, and the 3’ end of the PCR amplified sequence contained a SacII site. This procedure employed the following primers: 5’- CAGCGGGCCCTGTTGGAACAGAAGCAGCTGGCAGCAGCACAAGAGCCCTTAT GGTACAG-3’ and 5’-CTCACGGTCTAGGTGCAGAAAGTAGGTG-3’. Each 50μL PCR reaction contained 5μL of Taq polymerase buffer (+Mg), 0.4μL of 25mM dNTPs, 42.85μL water, 0.25μL of 200μM primer, 0.25μL Taq polymerase (NEB) and 1μL of DNA. The program consisted of a primary denaturation step of 4 minutes at 95oC, followed by the denaturation step of 1 minute at 95oC, annealing step for 1 minute at 57oC, and elongation step for 1 minute at 72oC. Cycles were repeated 35 times before the final last extension step of 10 minutes at 72 oC. The PCR fragment harboring the NLS mutation was gel purified (Qiagen) according to the manufacturer’s instructions. The PCR fragment and TUB containing pDEST47 vectors (constitutively activated full length and Δ5 TUB) were digested with ApaI and SacII and gel purified once again. The digested PCR fragment was then ligated into digested full length and Δ5 TUB containing pDEST47 vectors.

16 2.4 N2A cell culture and reagents

The murine Neuroblastoma 2A cell line (N2A) was obtained from the American Type Culture Collection (ATCC). Neuro2A cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM, Samuel Lunenfeld Research Institution), supplemented with 10% fetal bovine serum (FBS), and antibiotics (100U/mL penicillin, 100µg/mL o streptomycin) at 37 C in a humidified atmosphere of 5% CO2. Cells were routinely split 1:5 every 3-4 days (85% confluence) using 1xPBS supplemented with 0.04%EDTA. Following 25 passages, cells were routinely discarded and replaced with a fresh stock. Frozen stocks were stored at -80oC or in liquid nitrogen in FBS supplemented with 7.5% DMSO.

2.5 Generation of stable cell lines

Stable N2A cell lines expressing TUB were preferentially used in place of transient expression in attempts to control expression levels. DNA vectors and Effectene Transfection Reagent (Qiagen) was used to transfect cells. Stable Cells were selected based on their resistance to the aminoglycoside phosphotransferase antibiotic G418, provided by the NeoR gene (0.5mg/ml). Individual clones were picked and assessed for TUB expression via fluorescence of RFP. Subsequently, TUB levels were assessed by Western blot analysis. 3 cell lines for each TUB construct displaying comparable expression levels were chosen for further analysis.

2.6 Western blotting to verify protein levels

Whole cell lysates were generated by gently lysing N2A cells in RIPA buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 2mM EDTA, 1% NP-40, 0.1% SDS) supplemented with a 1:500 dilution of protease inhibitor cocktail (Sigma) at 4oC. Lysates were then clarified by centrifugation at 4oC for 10 minutes. Protein concentration was measured using Bradford reagent (Bio-Rad) according to the manufacturer’s instructions and 30-60μg of lysate from each sample was separated via SDS-PAGE on 12% gels, and transferred to nitrocellulose membranes (Amersham). Membranes were blocked in 5%

17 nonfat milk and 2% BSA in Tris-buffered saline, supplemented with Tween 20 (10 mM Tris, pH 7.3, 150 mM NaCl, 0.1% Tween 20). Membranes were then incubated overnight at 4oC in primary antibody against RFP (Chemicon). Immunoreactive antibodies were detected using horseradish peroxidase-conjugated secondary antibody (Santa Cruz) for 1 hour at room temperature, followed by the addition of enhanced chemiluminescence (ECL) reagent (PerkinElmer).

2.7 Morphological studies in N2A

For experiments evaluating the neuritic outgrowth induced by constitutively activated TUB-isoform expression versus unactivated TUB-isoform expression, cells were seeded at an initial density of 1 x 105 cells/well (40%) onto 25 mm glass coverslips in 6 well plates (Falcon) and incubated for 48h before scoring morphological changes. Cells were fixed in 3.7% paraformaldehyde for 15 minutes and subsequently washed 3 times with 1xPBS. Cover slips were then mounted with Vectashield mounting media supplemented with Dapi, and examined using phase contrast microscopy. In addition, Alexafluor 488 Phalloidin (Invitrogen) was used to label F-actin (according to the manufacturer’s instructions) to highlight morphological differences more delicately and examined using standard fluorescence microscopy using a 63x objective and 100x objective for magnification of processes. Neuritic outgrowth in neurite-bearing cells was evaluated using our standard quantification detection criteria for N2A cells (see below), N=300. In order to determine if it was TUB’s direct influence on the cell and not the influence of a secreted factor that resulted in morphological outgrowth, we treated the vector control expressing cells and both inactive TUB isoform expressing cells to conditioned media, which consisted of media obtained by incubating either the long or short activated TUB expressing cells for 48 hours. Cell morphology was examined by phase contrast microscopy and neurite outgrowth in neurite-bearing cells was evaluated using our standard quantification detection criteria for N2A cells (see below), N=50. For experiments evaluating the activation of membrane-bound TUB using the neurokinin-1 (NK1) receptor (HA-tagged) and substance P on neuritic outgrowth, cells

18 were seeded at an initial density of 30% (7.5 x 104 cells/well) onto 25 mm glass coverslips and incubated for 14h prior to transfection. Cells were then transfected with the NK1 receptor (0.4 µg) using the Effectene Transfection Reagent (Qiagen) according the manufacturer’s instructions. The transfection reagent was removed after 12 hours and replaced with fresh media, supplemented with substance P (SP, 4nM). Cells were incubated in SP-supplemented media for an additional 48h before scoring morphological changes. Cell morphology was visualized against labeled NK1 receptor. Immunocytochemistry was determined as follows. Cells were fixed in 3.7% paraformaldehyde (in 1xPBS) for 15 minutes and subsequently permeabilized with 0.1% Triton X-100 in 1xPBS for 5 minutes. Cells were then blocked with 3% normal goat serum and 3% fetal bovine serum in 1xPBS for 30 minutes. Cells were then incubated for 1 hour with primary antibody to HA (1:400) and then incubated for 45 minutes with Alexafluor 488 secondary antibody (1:500). Coverslips were then mounted with Vectashield mounting media containing Dapi, and examined with confocal laser microscopy. All images were taken using the 63x objective and neurite outgrowth in neurite-bearing cells was evaluated using our standard quantification detection criteria for N2A cells (see below), N=150. For experiments evaluating whether nuclear localization was necessary for isoform-specific neuritic outgrowth, cells were seeded at an initial density of 30% (7.5 x 104 cells/well) onto 25 mm glass cover slips and incubated for 14h prior to transfection. Cells were then transfected with the appropriate construct using the Effectene Transfection Reagent (Qiagen). The transfection reagent was removed after 12h and replaced with fresh media. Cells were incubated for an additional 48h before scoring morphological changes. Cells were then fixed in 3.7% paraformaldehyde for 15 minutes and subsequently washed 3 times with 1xPBS. Alexafluor 594 Phalloidin (Invitrogen) was used according to the manufacturer’s instructions to label F-actin to highlight the morphology of cells. Cover slips were then mounted with Vectashield mounting media containing Dapi and examined using confocal laser microscopy. All images were taken using the 63x and 100x objective and neurite outgrowth in neurite-bearing cells was evaluated using our standard quantification detection criteria for N2A cells (see below), N=150.

19 For experiments evaluating the effects of lithium and valproic acid on our stable cell lines, cells were seeded at an initial density of 7.5 x 104 cells/well (30%) onto 25 mm glass coverslips. Following 14 hours of incubation, media was replaced either with media containing 10mM lithium or 5mM valproic acid for 48 hours. Cells were then fixed in 3.7% paraformaldehyde for 15 minutes and subsequently washed 3 times with 1xPBS and Phalloidin was used to label F-actin to highlight the morphology of cells. Phalloidin Alexafluor 488 (Invitrogen) was used according to the manufacturer’s instructions. Cover slips were then mounted with Vectashield mounting media containing Dapi and examined using confocal laser microscopy. All images were taken using the 63x objective and neurite outgrowth in neurite-bearing cells was evaluated using our standard quantification detection criteria for N2A cells (see below), N=150.

2.8 Quantification detection criteria used to evaluate neuritic outgrowth in N2A

Following 48 hours of incubation, N2A cells can display a very heterogeneous population of cells that either do not extend any processes, or extend minor processes, which could range from few to many. It was thus necessary to screen all cells before scoring to ensure that at minimum, cells fit for scoring met set standard criteria before any neuritic outgrowth analysis could be performed. We thus adopted a universal screening system in which we would score only “neurite-bearing cells,” a term that we use to describe any cell that extended at least 1 process that was greater than ½ a soma in length. Cells that met this requirement were scored more thoroughly using our quantification detection criteria, which involved grouping proportions of cells according to the number of primary processes extending from their somas that was greater than 1 soma length and by evaluating the number of secondary and tertiary processes formed on primary processes. Chi-Squared tests were used to compare process outgrowth between samples and standard two-sample t-significance tests were used to compare the number of secondary and tertiary processes formed between samples.

2.9 Generation of primary striatal and hippocampal cultures

Joanna Yu prepared primary striatal and hippocampal neurons from embryonic day 17 mouse brains, cultured in 24 well tissue culture plates on glass coverslips (Fisher). Prior to dissection, all coverslips were flamed and then coated with filter sterilized poly- L-lysine in borate buffer (0.2mg/mL, pH=8.5) and laminin (2μg/mL) overnight. Poly-L- lysine and laminin was removed by aspiration and coverslips were then rinsed 3 times with sterile tissue culture grade water prior to dissection. Dissection procedures were as follows. On day 17, pregnant ICR mice (obtained from the Toronto Centre of Phenogenomics) were sacrificed via cervical dislocation and the fetuses were removed quickly by cesarean section under sterile conditions and placed over ice in a Petri dish containing Hanks’ balanced salt solution (HBSS). Brains were quickly removed from fetuses and via microscope dissection, the hippocampi and striata were dissected after removal of the pia mater. Different embryonic brain tissues from the same litter were pooled and spun down at 1000 RPM for 5 minutes at room temperature. Following centrifugation, HBSS was removed and tissues were digested with 1.5 mL 0f 0.25% with EDTA for 15 minutes at 37oC with gentle flicking every 5 minutes. All samples were subsequently washed 3 times with 10 mL of DMEM with 10% FBS before gentle manual dissociation using 3 mL of 37°C DMEM with 10% FBS with a fire polished glass pipette bulb using a pipette aide not attached to a vacuum pump. All samples were triturated with the glass pipette bulb 25-30 times. Following dissociation, 1-2 X 106 cells per electroporation were centrifuged at 1000 RPM for 5 min at room temperature and resuspended in 100μl of RT Nucleofector® Solution (Amaxa Mouse Nueron Nucleofector Kit, Lonza). This yielded approximately 100μL of cell suspension, which was then combined with 2μg of constitutively activated full length TUB-RFP (in CAGGS vector) or constitutively activated Δ5 TUB-RFP (in CAGGS vector) and transferred into a certified cuvette provided in the Amaxa kit. Samples were electroporated in the Amaxa electroporator machine using Nucleofector® program O-005. Following electroporation, samples were transferred into an eppendorf containing 500μL of 37°C RPMI media and were left to incubate at 37°C for 10 minutes in an incubator set at atmospheric 5% CO2. Cells were plated at a density of 1.6-3.3 X 105 per coverslip. Following 4 hours of

21 incubation, half the media was replaced with fresh 37°C DMEM containing 10% FBS. The following day, half the media was replaced with Neurobasal media supplemented with (B27, L-glutamine, N2, and Pen Strep). Cells were left to incubate for 7 days, whereupon half the media was replaced with fresh supplemented Neurobasal media every 1-2 days.

2.10 Immunocytochemistry

Immunocytochemistry was performed as follows. Cells were fixed in 3.7% paraformaldehyde (in 1xPBS) for 15 minutes and subsequently permeabilized with 0.1% Triton X-100 in 1xPBS for 5 minutes. Cells were then blocked with 10% normal goat serum and 1% fetal bovine serum in 1xPBS for 30 minutes before incubation for 1 hour in rabbit and mouse primary antibodies against RFP (Santa Cruz, 1:300) and MAP2 (Santa Cruz, 1:500), respectively, followed by incubation for 45 minutes in Alexafluor 594 and 488 secondary antibodies (Invitrogen, 1:500). Coverslips were then mounted with Vectashield mounting media containing Dapi, and examined with confocal laser microscopy.

2.11 Morphological studies in primary striatal and hippocampal neurons

Striatal neurons electroporated with constitutively activated full length and Δ5 TUB, in addition to unelectroporated cells were scored according to process number and bi-polar character. Neurons were scored by counting primary processes extending from the soma that were greater than 1 soma in length, secondary processes extending from primary processes, and tertiary processes extending from secondary processes per cell. In this analysis, small hair-like extensions that did not display uniform width were not counted. We scored bipolar character by counting cells with processes greater than 2 soma lengths that were 180 degrees extended in opposite directions. Since hippocampal neurons are even more complex in morphology than striatal neurons with respect to the degree of branching and length of processes, it was therefore necessary to adopt new scoring criteria to investigate the effects of long and short TUB

22 on process extension morphology. Cells were scored according to the number of primary processes extending from the soma that were greater than 1 soma length, the number of branch points that resulted in branches that were greater than 1 soma length, the number of tiny neuronal projections, and the distance along the major process (in soma lengths) until the first branch point. Standard two-sample t-significance tests were applied to the data to determine the level of significance between samples analyzed.

2.12 Generation of tub/tub mice

Mice heterozygous for the tubby mutation (tub/+ ) were obtained from the mouse mutant resource at the Jackson Laboratories (Bar Harbor, Maine, USA). Genotyping analysis was as follows. Genomic DNA from tail clips were amplified by polymerase chain reaction (PCR) using the following primers: forward primer, 5’- CAGGACTCTAGATCACTACAG-3’ and reverse primer, 5’- GAGTCTCTATCGAACGCTTC-3’. Each 50μL PCR reaction contained 5μL of 10x Thermopolymerase buffer (NEB), 0.4μL of 25mM dNTPs, 42.85μL water, 0.25μL of 200μM primer, 0.25μL Taq polymerase (NEB) and 1μL of DNA. The program consisted of a primary denaturation step of 2 minutes at 96oC, followed by the denaturation step of 30 seconds at 94oC, annealing step for 30 seconds at 55oC, and elongation step for 45 seconds at 72oC. Cycles were repeated 35 times before the final last extension step of 7 minutes at 72 oC. PCR products were then digested with HpyCH4III according to the manufacturer’s directions and analyzed on a 3.4% agarose gel. The wildtype product was digested into 286, 136, and 76 base pair fragments, and the tub/tub mutant product was digested into 286 and 232 base pair fragments. Animals were cared for and handled according to approved animal use protocols, which comply with Samuel Lunenfeld Research Institute animal care committee. Mice were euthanized by cervical dislocation.

23 2.13 Analysis of serotonergic neuronal innervation in the hippocampus

Immunohistochemisty to visualize serotonergic neurons was performed on 20 μM sagittal brain sections (fixed and embedded in O.C.T compound) of 6 month old tub/tub and normal mice and analyzed using confocal microscopy (5 μM stack of 0.4 μM slices). Slides were taken out of the -80oC freezer and warmed at room temperature for 10 minutes before three consecutive 5 minute washes in 1xPBS. Sections were outlined using a Histopen and blocked at room temperature with 10% normal goat serum (NGS) in 1xPBS-T (0.3% Triton-X). Primary rabbit anti-serotonin transporter antibody (Calbiochem) was added at 1:400 overnight at 4oC in 2% NGS in 1xPBS-T. After three consecutive 5 minute washes in 1xPBS-T, secondary Alexfluor 488 anti-rabbit antibody (Invitrogen) was added at 1:500 in 2% NGS in1xPBS-T for 1 hour at room temperature. After three consecutive 5 minute washes and 2 consecutive 10 minute washes in 1xPBS- T, coverslips were applied using Vectashield mounting media with Dapi stain. 10 sections from each animal were stained and analyzed via confocal laser microscopy.

24 3.0 RESULTS

3.1 Relative protein levels of full length versus Δ5 TUB are increased in brain regions of C57 anx/anx mice

Our lab has previously obtained preliminary data to suggest that full length TUB might be suppressing the anorexia phenotype. RT-PCR analysis revealed that full length TUB is upregulated relative to Δ5 TUB in the brains of anorexia mice. In addition, our lab has previously found that increased survival of anx/anx mutants correlates with increased levels of full length versus Δ5 TUB. Molossinus (Molf/Ei) mice express higher mRNA levels of Δ5 TUB than full-length TUB and C57BL6/J (C57) mice express higher mRNA levels of full length TUB than Δ5 TUB. Interestingly, anorexia mice homozygous for the C57 alleles of Tub live substantially longer than those homozygous for the Molf TUB allele, suggesting that suppression of the anorexia lethality phenotype might be attributed to variance in TUB isoform levels. I have recently found through western blot analysis that the ratio of full length versus Δ5 TUB protein is increased in the hippocampus of anx/anx animals (Figure 3A and B). Since hypersprouting is one of the devastating neuronal deficits of this mutation, and given our recent data, it is possible that TUB might be affecting and or suppressing neuronal outgrowth through the regulation of its splice isoform levels. This prompted us to directly examine possible isoform-specific effects of TUB on neuritic outgrowth.

CRB CRX HIP CRB CRX HIP

Figure 3. Immunoblotting for TUB-isoforms in anx/anx mice and anx/+ mouse brain regions. (A) Immunoblot analysis of cerebellar, cortical, and hippocampal brain lysates (CRB, CRX, HIP, respectively) obtained from anx/anx and anx/+ mice (25 and 15

25 seconds represent exposure time). (B) Densitometry analysis of the ratio between full length and Δ5 TUB in anx/+ and anx/anx animals. N=3 animals, *p<0.05 (t-test).

3.2 PIP2 binding sequesters TUB from the nucleus in N2A cells

We decided first to investigate the possible isoform-specific effects of TUB on neuritic outgrowth using the murine neuroblastoma 2a (N2A) cell line because N2A cells are a well-defined and tractable in vitro neuronal model system that has been commonly used to study neurite outgrowth. We generated multiple stable cell lines of unactivated and constitutively activated full length and Δ5 TUB-expressing N2A cells, in addition to stable cell lines expressing an empty vector. Western blot and densitometry analysis were performed on cell lysates to determine protein levels of TUB-RFP expression in all stable cell lines (Figure 4B). With respect to protein localization, in its unactivated form, full length and Δ5 TUB are clearly found at the membrane and not the nucleus (Figure 4Ai-ii). In contrast, constitutively activated full length and Δ5 TUB (which contain a K330 to A330 mutation in their PIP2 binding domain) were found predominantly in the nucleus (Figure 4Aiii-iv). While protein localization did not differ appreciably between full length and Δ5 TUB in N2A cells, we next decided to investigate if the differences in protein localization between unactivated and constitutively activated TUB had an effect on neuritic outgrowth.

Figure 4. Stable expression of TUB-RFP isoforms (unactivated and constitutively activated) in N2A cells. (A) Representative N2A cells 48 hours after plating. TUB-RFP is shown in red and dapi stained nuclei in blue. (i-ii) Full length and Δ5 TUB-RFP at the membrane. (iii-iv) Constitutively activated full length and Δ5 TUB-RFP in the nucleus. (B) Immunoblotting for RFP displays relative TUB levels in our stable cell lines (top).

27 Densitometry analysis of RFP protein versus tubulin in our TUB-expressing stable cell lines (bottom). Samples shown in red were used for initial morphological analysis.

3.3 N2A cells undergo minor differentiation after 48 hours of incubation

N2A cells generally exhibit a fibroblast-like morphology and start to extend minor neurite-like projections from their cell bodies 24 hours after plating. Since our objective was to determine the effects of TUB on neuritic outgrowth, we wanted to first determine what proportion of our cell lines were actually neurite-bearing by 48 hours, and hereafter, use the term “neurite bearing” in our investigation to describe any cell that has at least 1 neurite that is greater than half a soma length. We found that there was a modest increase in the population of neurite bearing cells that stably express constitutively activated full length and Δ5 TUB versus their unactivated counterparts, and the vector control (Figure 5).

Figure 5. Percentage of neurite-bearing cells in stable cell lines. Constitutively activated full length and Δ5 TUB-expressing cells exhibit a modest increase in their population of neurite-bearing cells. N=2.

28 3.4 Constitutively activated TUB promotes isoform-specific neuritic outgrowth formation in N2A cells

Next we evaluated and contrasted the degree to which neuritic outgrowth occurred within the subpopulations of neurite bearing cells to see if outgrowth was indeed isoform-specific. In a similar manner to N2A cells, the vector control along with the unactivated TUB-expressing cells extended minor neuritic processes, and these generally did not exceed 1 soma length (Figure 6Ai-iii). In contrast, constitutively activated full length and Δ5 TUB-expressing cells generally directed much longer neuritic processes in a strikingly isoform-specific manner (Figure 6Aiv-v). The majority of constitutively activated full length TUB-expressing cells exhibited either 1 or 2 long neuritic processes. When 2 processes were present, they typically extended 180o from each other in a bipolar manner. By contrast, the majority of constitutively activated Δ5 TUB-expressing cells exhibited multiple processes, ranging from 2 to 4 in number from cell bodies and exhibiting a higher degree of branching (Figure 6A). To quantify these observations more precisely, we next examined process outgrowth quantitatively by counting the number of processes greater than 1 soma length, and the number of secondary and tertiary processes formed. All evaluations were performed in triplicate and the data are displayed in Table 2.

Table 2. Analysis of process outgrowth (mean percentage average ± standard error) and degree of branching (average number of processes ± standard error) in stable cell lines

* denotes constitutively activated TUB

Chi-squared statistical analysis was performed to determine significant differences in process outgrowth between different cell lines. Cells stably expressing unactivated full length and Δ5 TUB did not differ significantly from the vector control or each other (Figure 6B, left graph). By contrast, cells stably expressing constitutively

29 activated full length TUB and Δ5 TUB displayed a significant difference in process outgrowth from their unactivated counterparts (p<0.001) and between each other (p<0.001) (Figure 6B, left graph). T-test statistical analysis was performed to determine significant differences in branching (number of secondary and tertiary processes formed) between different cell lines. Cells stably expressing full length and Δ5 TUB did not display a significant difference in secondary and tertiary process number from the vector control or each other. In addition, cells stably expressing unactivated full length TUB did not display a significant difference in secondary and tertiary process number from cells expressing constitutively activated TUB (Figure 6B, right graph). By contrast, cells stably expressing constitutively activated Δ5 TUB displayed a significantly greater number of secondary and tertiary processes than cells expressing unactivated Δ5 TUB (p<0.001) and cells stably expressing constitutively activated full length TUB (p<0.001) (Figure 6B, right graph). Taken together, it appears that constitutively activated full length and Δ5 TUB direct process outgrowth in terms of process formation and extension, and neuritic branching, in an isoform-specific manner. In addition, different stable cell lines expressing TUB (Figure 4B) were also analyzed and it appears that despite differences in TUB protein levels, similar morphological and isoform-specific effects directed from constitutively activated TUB were observable in terms of process outgrowth, and neuritic branching (Figure 6Ci-v).

Figure 6. Isoform-specific cell shape changes occur in constitutively activated TUB- expressing N2A cells. (Ai-v) Representative cells from stable cell lines after 48 hours of incubation. Cells were labeled with phalloidin (green). Constitutively activated full length TUB directs bipolar outgrowth while constitutively activated Δ5 TUB directs the outgrowth of multiple processes that display branching. (B) Quantification of neuritic process outgrowth verifies that process extension occurs in constitutively activated TUB expressing cells in an isoform-dependent manner (left). Constitutively activated Δ5 TUB directs the highest degree of neuritic branching (right). N=360, * p<0.001 (Chi-squared test), β p<0.001, γ p<0.001 (t-test). (Ci-v) Representative cells from remaining stable cell

31 lines (40x) after 48 hours of incubation. Cells were labeled with phalloidin (green) and display comparable neuritic outgrowth as cell lines that were scored despite expressing different levels of TUB-RFP (shown in Figure 1B).

3.5 Cells expressing constitutively activated full length and Δ5 TUB do not secrete factors into the media that promote isoform-specific neuritic outgrowth

We next decided to investigate whether or not N2A cells secreted soluble factors into the media that could induce the isoform-specific neuritic outgrowths observed as a consequence of having TUB in the nucleus. Conditioned media (obtained from either cells expressing constitutively activated full length or Δ5 TUB) was not able to induce the same morphological cell shape changes as their constitutively activated counterparts, suggesting that the conditioned media did not contain substantial amounts of any soluble factor that effected neuritic outgrowth (Figure 7).

Figure 7. TUB isoform-specific neuritic outgrowth is not the result of a cellular secreted factor. Conditioned media (* media obtained from constitutively activated full length TUB, ** media obtained from constitutively activated Δ5 TUB) was unable to induce neuritic outgrowth in unactived TUB-expressing cells.

3.6 Unactivated TUB is nuclear upon activation by substance P through the neurokinin-1 receptor and directs isoform-specific neuritic outgrowth

We next decided to address whether or not TUB mediates Gαq dependent neuritic outgrowth by developing an assay in which we could activate membrane bound

32 unactivated TUB after 24 hours of incubation to see if this too would result in the same isoform-specific morphological cell shape changes observed when TUB was constitutively activated. Since TUB has been implicated in Gαq signaling, we transfected unactivated TUB-expressing cells with the Gαq receptor neurokinin-1, and activated the receptor with its natural ligand, substance P. Upon activation with substance P, there was a dramatic accumulation of TUB in the nucleus of cells transfected with the neurokinin-1 receptor (Figure 8A). Notably, even in the presence of high substance P levels TUB was not found exclusively in the nucleus of these cells, and could be detected at the membrane and in the cytoplasm (Figure 8A, far right). 48 hours following the addition of substance P, unactivated TUB-expressing cells expressing the neurokinin-1 receptor exhibited similar isoform-specific neuritic outgrowth as their constitutively activated counterparts (Figure 8A). The majority of substance P-activated full length TUB-expressing cells exhibited either 1 or 2 long neuritic processes. When 2 processes were present, they typically extended 180o from each other in a bipolar manner. By contrast, the majority of substance P-activated Δ5 TUB-expressing cells exhibited multiple processes, ranging from 2 to 4 in number from cell bodies and exhibiting a higher degree of branching (Figure 8A and 8B). We also decided to perform a time course post-activation and noted that these isoform-specific cell shape changes can be observed as early as 24 hours post-activation, indicating that the isoform-specific effects of TUB activation are quire immediate and indeed drastic (Figure 8B). To quantify these observations more precisely, we next examined process outgrowth quantitatively by counting the number of processes greater than 1 soma length, and the number of secondary and tertiary processes formed. All evaluations were performed in triplicate and the data are displayed in Table 3.

33 Table 3. Analysis of process outgrowth (mean percentage average ± standard error) and degree of branching (average number of processes ± standard error) before and after activation of TUB via substance P and the neurokinin-1 receptor

* denotes activated TUB via substance P and the neurokinin-1 receptor

Chi-squared statistical analysis was performed to determine significance of process outgrowth between different cell lines and treatments. In the absence of substance P, cells stably expressing unactivated full length and Δ5 TUB expressing the neurokinin-1 receptor did not differ significantly from the vector control or each other (Figure 8C, left graph). By contrast, when co-expressing the neurokinin-1 receptor and treated with substance P, full length TUB and Δ5 TUB displayed a significant difference in process outgrowth from their unactivated counterparts (p<0.001) and between each other (p<0.001) (Figure 8C, left graph). T-test statistical analysis was performed to determine significant differences in branching (number of secondary and tertiary processes formed) between different cell lines and treatments. In the absence of substance P, cells stably expressing unactivated full length and Δ5 TUB expressing the neurokinin- 1 receptor did not display a significant difference in secondary and tertiary process number from the vector control or each other (Figure 8C, right graph). Interestingly, substance P-activated full length TUB directed significantly more secondary and tertiary processes relative to their unactivated counterparts (p<0.01) (Figure 8C, right graph). However, the most dramatic increase in branching was directed through substance P- activated Δ5 TUB, directing significantly more secondary and tertiary processes relative to unactivated Δ5 TUB (p<0.001) and substance P-activated full length TUB (p<0.01) (Figure C, right graph). Taken together, these findings suggest that TUB isoform-specific neuritic outgrowth can occur via Gαq signaling through substance P and the neurokinin-1 receptor. Now that we had reason to suspect that activated TUB (constitutively activated

34 or ligand activated) directed isoform-specific neuritic outgrowth, our next goal was to investigate possible mechanisms that could be at play.

Figure 8. TUB can be activated by substance P through the neurokinin-1 receptor to direct isoform-specific cell shape changes. (A) Unactivated full length and Δ5 TUB- RFP (red) is membrane bound in cells transfected with the neurokinin-1 receptor (green) and accumulate in the nucleus following the addition of substance P where they direct isoform-specific morphological changes. (B) Isoform-specific morphological changes can be detected as early as 24 hours post-activation. (C) Quantification of neuritic process outgrowth verifies that process extension occurs when unactive TUB is activated

35 substance P in an isoform-dependent manner (left). While both full length and Δ5 TUB direct neuritic branching once activated by substance P, activated Δ5 TUB directs the most significant number of secondary and tertiary processes (right). N=150, * p<0.001 (Chi-squared test), α p<0.01, β p<0.001, γ p<0.01 (t-test).

3.7 TUB can exist in cytoplasmic vesicle-like entities

We have now shown using two separate assays that isoform-specific morphological cell shape changes occur when TUB accumulates in the nucleus because it is unable to bind to the membrane or released from the membrane upon activation. TUB function has been implicated in the nucleus as a candidate transcription factor and in the cytoplasm in the transport of cargo. Even though our data thus far suggests that nuclear localization is likely required for TUB function, we have consistently observed the presence of as yet unreported cytoplasmic vesicle-like entities that contain TUB in our stable cell lines and in N2A cells that transiently express TUB (Figure 9). We were now poised to interrogate the molecular mechanisms by which TUB functions in order to determine if nuclear localization was indeed essential for TUB function.

Figure 9. The TUB protein can exist in cytosolic vesicles in N2A cells. N2A cell expressing (A) full length TUB-RFP and (B) Δ5 TUB-RFP shows discrete cytosolic vesicles (shown with white arrows) that contain TUB-RFP (red) outside of the nucleus (dapi stained in blue). Cell shape is visualized using NK-1 (green).

36 3.8 Nuclear localization of TUB is essential for isoform-specific neuritic outgrowth in N2A cells

We were able to directly address whether or not nuclear localization of TUB was essential for the induction of isoform-specific neuritic outgrowth by generating constitutively activated full length and Δ5 TUB constructs harboring a K39KKR to L39AAA mutation (NLS_Mut) in its nuclear localization signal that had been previously shown to attenuate TUB accumulation in the nucleus [14]. In N2A cells, both isoforms of constitutively activated TUB harboring the mutation in its nuclear localization signal were indeed cytoplasmic and devoid from the nucleus (Figure 11A and 11B), while their non-mutant counterparts were nuclear (Figure 10B), suggesting that nuclear TUB was not simply an artifact of over-expression. Remarkably, while constitutively activated full length and Δ5 TUB transient expression in N2A cells resulted in isoform-specific neuritic outgrowth, the same phenotype could not be induced by the TUB isoforms harboring the mutation in the nuclear localization signal, suggesting that nuclear localization of TUB is essential for isoform-specific neuritic outgrowth (Figure 10B). To quantify these observations more precisely, we next examined process outgrowth quantitatively by counting the number of processes greater than 1 soma length, and the number of secondary and tertiary processes formed. All evaluations were performed in triplicate and the data are displayed in Table 4.

Table 4. Analysis of process outgrowth (mean percentage average ± standard error) and degree of branching (average number of processes ± standard error) when nuclear accumulation of TUB is attenuated

* denotes constitutively activated TUB

37 Chi-squared statistical analysis was performed to determine significant differences in process outgrowth between cells expressing different TUB constructs. Cells expressing constitutively activated full length and Δ5 TUB harboring the NLS mutation did not differ significantly from untransfected N2A cells or each other in terms of process outgrowth (Figure 10C, left graph). Furthermore, significant differences in process outgrowth were detected in cells expressing TUB constructs harboring the NLS mutation relative to their constitutively activated counterparts (with a functional nuclear localization signal) (p<0.001) (Figure 10C, left graph). T-test statistical analysis was performed to determine significant differences in branching (number of secondary and tertiary processes formed) between cells expressing different TUB constructs. Cells transiently expressing constitutively activated full length and Δ5 TUB harboring the NLS mutation did not display a significant difference in secondary and tertiary process number from the vector control or each other (Figure 10 C, right graph). In addition, cells transiently expressing constitutively activated full length TUB harboring the NLS mutation did not display a significant difference in secondary and tertiary process number from cells expressing constitutively activated full length TUB (Figure 10C, right graph). By contrast, a significant difference in branching was detected between cells expressing Δ5 TUB harboring the NLS mutation and constitutively activated Δ5 TUB (p<0.001). Thus, while these findings alone do not exclude a cytoplasmic mechanism, nuclear TUB function appear to be a crucial step in directing isoform-specific neuritic outgrowth.

Figure 10. The K39KKR to LAAA mutation in the nuclear localization signal attenuates nuclear accumulation and TUB-isoform specific neuritic outgrowth. (A) N2A cells transiently transfected with constitutively activated full length (left, top) and Δ5 (left, bottom) TUB-GFP (green) harboring a mutation in the NLS are unable to enter the nucleus (blue). (B) Constitutively activated TUB-GFP (green) isoforms harboring a mutation in their nuclear localization signal are unable to direct the same isoform-specific neuritic outgrowth phenotypes of their constitutively activated counterparts (cell shape stained with phalloidin stained F-actin in red). (C) Quantification of neuritic process

39 outgrowth (left graph) and branching (right graph) verify that nuclear localization of TUB is essential for cell shape changes. N=150, * p<0.001, ** p<0.03 (Chi-squared test), β p<0.001, γ p<0.01 (t-test).

3.9 Constitutively activated full length and Δ5 TUB direct isoform-specific neuritic outgrowth in primary striatal neuronal cultures

To test whether TUB isoforms could influence neuronal morphology of primary neurons, we investigated the effects of constitutively activated full length and Δ5 TUB- RFP in primary striatal neurons. Striatal neurons do not naturally express the Tubby gene and thus, we could assay if TUB had an isoform-specific effect on neuritic outgrowth without the interference of endogenous TUB. Although not nearly as dramatic and obvious as in N2A cells, we ultimately found that isoform-specific neuritic outgrowth was indeed detectable according to our scoring analysis (representative cells depicted in Figure 11Ai-iii). While primary process outgrowth from the soma varied in both number and length, our preliminary data suggest that striatal neurons expressing Δ5 TUB-RFP showed a modest increase in the number of processes greater than 1 soma length (3.4 ± 0.2) than in cells that expressed full length TUB-RFP (2.5 ± 0.1) or unelectroporated cells (2.5 ± 0.3) (Figure 11B, left graph). We next decided to evaluate the degree of neuritic branching and the extent of directed process outgrowth. Our branching analysis showed that while there were very few secondary and tertiary neurites formed in unelectroporated cells (2.1 ± 0.5 and 0.2 ± 0.1, respectively) , there was a general increase in branching as a result of constitutively activated TUB-RFP expression, the degree of which was also isoform-specific (Figure 11B, left graph). Striatal neurons expressing constitutively activated full length TUB-RFP displayed generally minimal neurite branching and in distinctive regions where branching did occur, neurites were formed with uniform density and even spacing between neurites. On average, these cells displayed 6.0 ± 0.5 secondary processes and 0.4 ± 0.2 tertiary processes. By contrast, cells expressing constitutively activated Δ5 TUB-RFP displayed a higher degree of branching. In these cells, not only was there in general more secondary and tertiary processes formed (8.7 ± 0.6 and 2.0 ± 0.2) but branching occurred unevenly and at high densities in certain regions, which was rarely observed in their constitutively activated full length counterparts. Our analysis

40 evaluating the extent of process outgrowth showed that more than half of the neurons electroporated with constitutively activated full length TUB-RFP exhibited processes that extended in a bipolar manner (57.8% ± 6.9) (Figure 11B, right graph). This was higher than that observed in unelectroporated cells (32.5% ± 11.6) and cells expressing Δ5 TUB- RFP (26.7% ± 6.7). Thus, in striatal neurons, constitutively activated TUB appears to direct isoform-specific neuritic outgrowth that either affects the manner in which processes are directed, or the degree of neuritic branching.

Figure 11. Constitutively activated TUB directs isoform-specific cell shape changes in primary striatal neurons. (A) Striatal neurons (i) and striatal neurons electroporated with either constitutively activated full length (ii) or Δ5 (iii) TUB (red). Dapi stained nuclei are shown in blue and MAP2 labeled in green. (B) Quantification of process outgrowth (left graph, blue bar), neuritic branching (left graph, red and yellow bars) and evaluation of bipolar character (right graph) verifies that cell shape changes occur in an

activated and isoform-dependent manner. Nunelectroporated =25, Nfull length TUB=52, NΔ5 TUB =50, τ p<0.01, γ p<0.01, α p<0.05, β p<0.05, σ p<0.01, * p<0.01 (t-test).

42 3.10 Constitutively activated full length and Δ5 TUB direct isoform-specific neuritic outgrowth in primary hippocampal neuronal cultures

We next decided to investigate any possible isoform-specific effects of TUB on neuritic outgrowth in hippocampal neurons, which normally express TUB and thus, would be more likely to have a more biologically relevant role for TUB in contrast to striatal neurons. Due to the heterogeneous and complex morphologies that hippocampal neurons naturally exhibit, neurons were scored based on the number of processes extending from the soma, number of branch points, number of tiny neuronal projections, and the distance (in soma lengths) until the first branch point. Under these scoring parameters, we were able to detect isoform-specific effects on neuritic outgrowth (representative cells depicted in Figure 12Ai-iii). The obvious difference observed was that hippocampal neurons expressing constitutively activated Δ5 TUB-RFP have a greater number of processes extending from the soma (2.8 ± 0.3) than their full length TUB-RFP expressing counterparts (1.5 ± 0.2) (Figure Bi). Interestingly, the average number of processes extending from the soma in constitutively activated full length TUB-RFP expressing cells (1.6 ± 0.2) was lower than in unelectroporated cells (2.2 ± 0.4) the latter of which was not significant from constitutively activated Δ5 TUB-RFP expressing cells, suggesting possibly that full length TUB could be suppressing process outgrowth in hippocampal neurons. Our branch point analysis revealed that there was an increase in the average number of branch points in cells electroporated with constitutively activated Δ5 TUB-RFP (2.4 ± 0.5) than in their full length TUB-RFP expressing counterparts (1.4 ± 0.3) and unelectroporated cells (1.3 ± 0.2) (Figure 12Bii). It also appeared that branching occurred significantly further along the dominant process of cells expressing constitutively activated full length TUB than those expressing constitutively activated Δ5 TUB and cells that were unelectroporated (Figure 12Biii). Finally, our quantitative analysis evaluating the number of tiny neuronal projections detected only a modest difference between constitutively activated full length and Δ5 TUB-expressing neurons, although the degree of neuronal projections in these cells was higher than those of unelectroporated cells (Figure 12Biv). Taken together, our results suggest that TUB has an isoform-specific effect on process outgrowth and neuronal branching in primary hippocampal neurons.

Figure 12. Constitutively activated TUB directs isoform-specific cell shape changes in primary hippocampal neurons. (A) Hippocampal neurons (i) and hippocampal neurons electroporated with either constitutively activated full length (ii) or Δ5 (iii) TUB (red). Dapi stained nuclei are shown in blue and MAP2 labeled in green. (B) Quantification of process outgrowth from the soma (i), the number of branch points, α p<0.05, β p<0.01 (ii), the number of tiny neuronal projections, α p<0.01, β p<0.05 (iii) and the distance until the first branch point, α p<0.01, β p<0.01 (iv) suggest that TUB mediates isoform-specific neuritic changes in hippocampal neurons, α p<0.05.

Nunelectroporated =15, Nfull length TUB=30, NΔ5 TUB =28, all stats shown encompass t-test analysis.

3.11 Summary of TUB-effects on neuritic outgrowth in different cell lines

Table 5A-C summarizes the isoform-specific effects of TUB on neuritic outgrowth in N2A cells, primary striatal neurons, and primary hippocampal neurons. In general, full length TUB does not promote the outgrowth of more processes from the soma and has a minimal effect on branching. By contrast, Δ5 TUB directs an increase in process outgrowth from the soma and directs a higher degree of neuritic branching.

45 Table 5. Summary of isoform-specific effects of TUB on neuritic outgrowth in N2A cells (A), striatal neurons (B), and hippocampal neurons (C)

* denotes constitutively activated TUB, ^ denotes substance P-activated TUB

3.12 Serotonergic neuronal innervation and morphology is affected in the hippocampus of tub/tub mice

Since Δ5 TUB is postulated to suppress transcription activation, and the tubby mutation results in a premature stop codon that disrupts the DNA binding domain, we hypothesized that Δ5 TUB and tubby might have the same phenotype in neurons since both would negatively affect transactivation. In order to test this hypothesis, we decided to look at serotonergic neuronal innervation in the brain of tub/tub mice. Our analysis was based on 1 normal and 1 tub/tub mouse (6-months of age) and consisted of analyzing ten 20µM thick sections through the hippocampus. In the hippocampus of normal mice, the Schaffer collateral was innervated by beaded and smooth serotonergic axons in a

46 fasiculated and unidirectional manner (Figure 13Bi, ii). By contrast, in tub/tub mice, this region was innervated by defasiculated serotonergic axons, which appear overall, smoother than those of normal mice (Figure 13Ci, ii).

48 Figure 13. Mice homozygous for the tubby mutation display aberrant serotonergic innervation in the hippocampus. (A) Schematic representative of fields (1-4) taken at 100x magnification in the Schaffer collateral of the hippocampus. CA1-3= cornu ammonis 1-3, DG= dentate gyrus, 5-HT= serotonergic neurons (shown innervating the Schaffer collateral). (B) Representative fields 1-4 taken throughout the Schaffer collateral of the hippocampus of normal mice (i). 200x magnification taken of field 3 (white arrows indicate larger varicosities) (ii). (C) Representative fields 1-4 taken throughout the Schaffer collateral of the hippocampus of tub/tub mice (i). 200x magnification taken of field 3 (ii). Nnormal=1, Ntub/tub=1

49 4.0 DISCUSSION

4.1 Relative levels of full length versus Δ5 TUB are increased in the hippocampus of anx/anx mice

Our western blot analysis revealed that the anorexia mouse mutation resulted in an increase in relative protein levels of full length versus Δ5 TUB in the hippocampus, while relative levels of TUB isoforms in the cortex and cerebellum remained unaffected. This could suggest that full length TUB might be modifying the anorexia mouse mutation in specific regions of the brain. Therefore, we are currently investigating other brain regions that might influence TUB isoform levels as a result of the anorexia mutation. Identifying specific brain regions that display increased levels of full length versus Δ5 TUB levels might provide clues to exactly how full length TUB might be ameliorating the anorexia phenotype.

4.2 TUB directs isoform-specific neuritic outgrowth through Gαq signaling and translocation to the nucleus

Phospholipid binding experiments and structural crystallography work suggest that TUB has a PIP2 binding domain that is common to all members of this protein family [10]. Amino acids 310, 330, 332, and 363 have been shown to be crucial for PIP2 binding and substitution at these sites for alanine attenuates membrane binding [10], resulting in the accumulation of TUB in the nucleus. Furthermore, structure-function analyses have suggested that TUB signaling from the membrane to the nucleus might be Gαq activity-dependent whereby full length and Δ5 TUB isoforms might have opposing effects on transcription activation in the nucleus post-activation [14]. However, downstream gene targets have yet to be fully identified and TUB function in neurons has remained largely elusive. Towards this end, I developed several cell culture-based assays in Neuro2A cells to investigate TUB function in the nucleus which included assaying the effects of constitutively activated full length and Δ5 TUB-RFP, Gαq ligand activation of unactivated full length and Δ5 TUB-RFP, and finally constitutively activated full length and Δ5 TUB-GFP that harbor a mutation in their nuclear localization signal. Collectively,

50 my data in N2A cells suggest that alternative splicing of TUB and Gαq activity- dependent TUB signaling from the membrane to the nucleus could present a precise mechanism through which a neuron modulates neuronal plasticity and branching. My first assay investigated the effects of unactivated TUB versus constitutively activated TUB in N2A cells and detected an isoform-specific effect on neuritic outgrowth only in cells expressing constitutively activated full length or Δ5 TUB. While my scoring system detected no difference in process outgrowth in cells stably expressing unactivated membrane-bound TUB-RFP that was significantly different from cells stably expressing an empty vector, by contrast, cells stably expressing constitutively activated full length and Δ5 TUB-RFP displayed significantly detectable isoform-specific process outgrowth relative to their unactivated controls and each other. Constitutively activated full length TUB directed predominantly bipolar morphologic outgrowth of two long processes and constitutively activated Δ5 TUB directed the outgrowth of multiple processes, many of which exhibited a high degree of branching. The integrity of these isoform-specific morphological characteristics were reproducible in other N2A cell lines stably expressing the same TUB-RFP constructs, despite variations in protein levels, which suggests that the isoform-specific morphological phenotypes we detected were not the result of genome insertion. Given that alternative splicing of TUB is unique to the brain [12] and that full length TUB could function to stabilize neuronal processes and polarity while Δ5 TUB could function to enable plasticity, it is tempting to speculate that alternative splicing of TUB could be important for neuronal outgrowth in the brain. Furthermore, since the presence of exon 5 has been shown to be crucial for transactivation using a Gal4/chloramphenicol acetyltransferase reporter system, it is also tempting to speculate that full length TUB could be activating intrinsic cellular programs that direct neuronal process stability while Δ5 TUB could be inactivating them. Thus, the inclusion or exclusion of exon 5 could act as an intrinsic molecular switch that alters TUB function accordingly so that neurons can properly reach their targets and flexibly adapt to their environment. Since unactivated TUB-RFP predominantly localized to the membrane and constitutively activated TUB-RFP localizes predominantly to the nucleus, we suspected that PIP2 binding likely sequesters TUB activity. Since it has been postulated that TUB

could be an effector or modulator of Gαq signaling [10], we next assayed whether or not

51 Gαq activity dependent membrane to nucleus shuttling of TUB could direct isoform- specific neuritic outgrowth in N2A cells. Thus, I developed an assay through which unactivated membrane-sequestered

TUB could be activated using the Gαq-coupled receptor neurokinin-1 and its natural ligand, substance P. While complete nuclear translocation of TUB in N2A cells had been

shown previously using Gαq-coupled receptors such as the serotonin receptor 5HT2c (constitutively activated) and the acetylcholine M1 receptor (upon stimulation by acetylcholine), and by constitutively activated Gαq [10], I have observed that while substance P activation through the neurokinin-1 receptor does indeed translocate TUB to the nucleus, an appreciable amount of TUB remains at the membrane. This observation suggests either that membrane binding is not impeded after receptor stimulation as previously postulated, or that membrane-bound TUB following activation could be coupled to other Gαq coupled receptors, such as the melanocortin-4 receptor, which is not activated by substance P and also found in N2A cells [73] or that there might be pools of TUB that respond to signals other than Gαq. Furthermore, as previously observed with constitutively activated TUB-RFP, the nuclear distribution of TUB-RFP by ligand- activation was not found to be uniform, and TUB-RFP could be found intensely and predominantly in circular nuclear bodies that are not always chromatin-rich. This is in agreement with similar observations reported in Cos-7 cells, whereby it was suggested that TUB could be localized in the nucleolus [74], however, the identity of those nuclear compartments was not fully validated. Further investigation will be needed to identify these nuclear structures and their identification might be important to interrogate TUB function in the nucleus. Furthermore, since TUB is not biologically constitutively activated, the results of this ligand-activated assay show that the TUB isoform-specific neuritic effects observed using constitutively activated TUB isoforms are recapitulated when TUB is translocated to the nucleus through the neurokinin-1 receptor by substance P. This suggests that the mutation in the PIP2 domain present in our constitutively activated constructs is not the primary cause of neuritic outgrowth and suggests that isoform-specific neuritic outgrowth is likely the direct consequence of TUB function. In addition, cells treated with substance P that were not transfected with the neurokinin-1 receptor did not activate TUB-RFP or result in TUB-induced neuritic outgrowth,

52 suggesting that the neurokinin-1 receptor is likely expressed at low levels in N2A cells. Since previous work has shown nuclear localization of TUB using constitutively activated Gαq, we could have employed a plethora of other Gαq-coupled receptors. However, we specifically selected the neurokinin-1 receptor for several reasons. Firstly, in contrast to the 5HT2c receptor, which can be auto-activated [75], the neurokinin-1 receptor activation is mediated by a specific ligand, substance P. Secondly, activation of the neurokinin-1 receptor has not been previously reported to regulate neuritic morphogenesis, unlike other Gαq-coupled receptors such as the melanocortin-4 receptor [73] and dopamine D1 receptor [76]. It would be interesting to investigate if neuritic morphogenesis following stimulation of these specific receptors involves TUB. Cells treated with substance P displayed morphological neuritic outgrowth only if they expressed the neurokinin-1 receptor, suggesting that TUB function is likely intrinsic. In order to confirm this, we treated unactivated TUB-expressing cells with media obtained from either cells expressing constitutively activated full length or Δ5 TUB and did not detect any morphological changes that were different than the vector control expressing cells. Numerous studies have investigated possible mechanisms that TUB could be involved in and these studies have yielded a wide array of possible cellular mechanisms. To date, TUB has been suggested to regulate gene transcription [14], Gαq signaling [10], vesicular trafficking of cargo (RNA and protein) [22, 24, 26, 74], cytoskeletal dynamics [26], and insulin signaling [77]. TUB-directed neuronal outgrowth could very well be the result of one, and possibly more of these exciting possibilities. Furthermore, the function of membrane-bound TUB has not been fully addressed in our investigation and while it appears that PIP2 binding could function to sequester TUB activity as it relates to neuritic outgrowth, this interaction could be relevant in other contexts that were undetectable by our assay. We next decided to see if we could investigate possible molecular mechanisms by which TUB mediated neuritic outgrowth. Despite previous work that implicates TUB in transcription regulation [10, 14], direct evidence that TUB is a bona fide transcription factor is lacking. Furthermore, I have detected intense TUB-RFP localization in non- chromatin rich regions of the nucleus, suggesting that the nuclear function of TUB could involve mechanisms other than, or in addition to, transcription regulation. While

53 functions of TUB in the nucleus are still elusive, there is direct evidentiary support that TUB could be involved in the transport of cargo and possibly cytoskeletal dynamics [24, 26]. TUB has been implicated in the proper transport of rhodopsin, β-arrestin, and α- transducin in the eye and has been implicated in a non-direct interaction with Microtubule-Associated-Protein 1A (MAP1A) in the ear [24-26], implying that TUB could be involved in vesicular trafficking of cargo and or possibly cytoskeletal dynamics. Cytoskeleton reorganization and remodeling would be consistent with our findings that TUB-directs neuritic outgrowth and could be important for the formation and neurotransmission of synapses. Indeed from Phalloidin staining of F-actin, it appears that constitutively activated full length and Δ5 TUB direct long filaments of polymerized actin in the soma and neuritic branches of N2A cells, although this might only be a secondary consequence of TUB function. In line with a role of TUB in vesicular trafficking, we have consistently observed the presence of cytoplasmic vesicles that contain TUB in stable and transient TUB-expressing N2A cells. These vesicles are, to the best of our knowledge, unreported to date and their predominantly cytoplasmic nature might be attributed to masking of the nuclear localization signal either due to the vesicles themselves or through conformational changes that TUB could adopt to mediate its function in these vesicles. Taken together, we felt that the best way to address potential molecular mechanisms would be to directly interrogate the necessity, if any, of nuclear localization on TUB function. Generating constitutively activated full length and Δ5 TUB harboring a previously reported mutation (K39KKR to L39AAA) in its nuclear localization signal [14] enabled the determination of whether isoform-specific cell shape changes could occur if nuclear localization of TUB was attenuated. In line with previous findings [14], constitutively activated TUB harboring this mutation in its nuclear localization signal localized exclusively in the cytoplasm. However, TUB distribution was not uniform in the cytoplasm and many puncta-like vesicles containing TUB were still clearly observable. Most interestingly, the NLS mutant constructs failed to direct the isoform-specific neuritic outgrowth of their constitutively activated counterparts, suggesting strongly that nuclear localization is essential for TUB function. However, we are unable to fully discount the possibility that having both the PIP2 and NLS mutated in our constructs

54 results in a non-functional protein. In order to address whether or not the NLS mutation affects TUB function, it would be worth adding an exogenous NLS to the N-terminus of our NLS mutated TUB constructs to determine if TUB function can be restored. Furthermore, our findings alone do not dismiss a cytoplasmic role of TUB in mediating neuritic outgrowth, as TUB-containing vesicles are still present even when the majority of TUB has translocated to the nucleus. What our findings do point to however, is that TUB does have a crucial function in the nucleus in terms of neuritic outgrowth in N2A cells, functions which could involve but are not limited to transcription activation. There remains a lack of definitive evidence indicating that TUB functions as a bona fide transcription data. It is possible that TUB participates in vesicular transport, and TUB function could rely on nuclear localization if TUB mediates the transport of cargo obtained in the nucleus. In agreement with other findings, we have consistently observed that TUB localizes significantly to discrete and non-chromatin rich regions within the nucleus, which have been suggested to consist of the nucleolus [74]. We intend to perform staining of the nucleolar marker fibrillarin to identify whether TUB indeed localizes to the nucleolus. If TUB function in the nucleus involves the nucleolus, TUB could be transporting machinery that could be involved in protein synthesis. Towards this end, I am currently generating stable cell lines that express flag-tagged TUB (full length, Δ5, and their respective constitutively activated forms) in N2A cells for mass spectrometry and microarray analysis. Mass spectrometry will help identify possible proteins that could interact with TUB. If TUB pulls down proteins that are related to transcription, the use of microarray analysis may uncover possible gene targets if TUB is indeed a transcription factor.

4.3 Constitutively activated TUB directs isoform-specific neuritic outgrowth in primary striatal and hippocampal neurons

While N2A cells are commonly used to study neurite outgrowth, they are not neurons and thus, likely lack additional cell signaling programs that are present in neurons. To validate our morphologic findings in N2A cells and to test TUB function in neurons, we decided to investigate the effects of constitutively activated full length and

55 Δ5 TUB in primary striatal and hippocampal neurons on neuritic outgrowth. While it is difficult to predict how TUB-directed neuritic outgrowth in N2A cells translates in the context of neuronal outgrowth, our data suggests that TUB also directs neuritic outgrowth in an isoform-specific manner in striatal and hippocampal neurons. In these neurons, like N2A cells, we found that full length TUB directs polarity of outgrowth over process outgrowth while Δ5 TUB enables plasticity, by either directing the outgrowth of more processes or by directing branching. We selected striatal neurons because these neurons do not express endogenous TUB [20]. In the majority of electroporated striatal neurons, constitutively activated full length TUB directed bipolar outgrowth of 2 long processes and constitutively Δ5 TUB directs the outgrowth of multiple processes, processes of which extend from the soma in a variable and non-polar manner. Furthermore, while both isoforms of TUB directed the outgrowth of secondary processes, Δ5 TUB directed the highest degree of branching with respect to both secondary and tertiary processes. These results are in agreement with our observed TUB isoform-directed neuritic outgrowth in N2A cells. Despite this agreement, given that striatal neurons would likely not have a biological function for TUB in vivo, it is uncertain whether the morphological changes observed are biologically relevant; although this in itself does not imply that striatal neurons lack cellular programs that TUB could participate in. In contrast to striatal neurons, TUB is strongly expressed in the hippocampus [12, 20]. In line with our findings thus far, we have found that TUB also appears to regulate neuronal plasticity in an isoform-specific manner in hippocampal neurons. In the majority of electroporated hippocampal neurons, constitutively activated full length TUB directed the outgrowth of fewer primary processes than Δ5 TUB. Interestingly, unelectroporated cells displayed an average number of primary processes that were in between cells electroporated with full length and Δ5 TUB. A significant difference was detected only between unelectroporated cells and cells electroporated with full length TUB, suggesting that full length TUB in hippocampal neurons might be suppressing process outgrowth from the soma. However, what was consistent in all cells analyzed was the presence of a dominant primary process which was longer and exhibited a higher degree of branching complexity in comparison to other processes. While both isoforms of TUB directed the

56 outgrowth of many tiny neuronal projections variably along the dominant primary process and its branches, Δ5 TUB directed a higher degree of branching, branching which also occurred closer to the soma. Taken together, our data in striatal and hippocampal neurons suggest that TUB could be important for neuronal outgrowth in the brain and could be important during development or during a neuron’s lifetime. The astonishingly precise and highly organized wiring of the brain underscores the importance of mechanisms by which neuronal processes are extended and guided so that they can reach their proper targets. The cytoskeleton of growth cones is dynamic and neuronal processes are constantly extended and retracted throughout a neuron’s lifetime in response to various environmental and or intrinsic cues [78-80]. While most research has centered on investigating extrinsic factors that regulate axonal or dendritic growth, there remains a lack of understanding with regards to the possible intrinsic programs that mediate neuronal plasticity in response to environmental cues [80]. Given that TUB has been implicated in Gαq-activity dependent isoform-specific transcription regulation [10, 14], our data suggest that levels of full length versus Δ5 TUB in a neuron could be an important intrinsic mechanism that neurons use to modulate neuronal outgrowth. Understanding possible genes and cellular processes that enable these morphological changes as a consequence of TUB signaling could open doors and new directions in how we view process outgrowth in neurons. There are numerous transcription regulation programs that modulate neuronal outgrowth and at this time, it would be premature to speculate on how these might be influenced by TUB, given that there are currently no verified downstream gene targets. With respect to activity-dependent neuronal outgrowth it has been recently shown that Gαq activation results in the proteosomal degradation of Gαs proteins and attenuated cAMP production through Akt activation [81]. Activation of Akt has been associated with axon growth [82], axon caliber (which encompasses neurofilaments such as F-actin) and axonal branching [83]. Unfortunately, there are few reports suggesting that Gαq signaling is directly involved in neuronal outgrowth. One report has found that the melanocortin α-MSH stimulates neurite outgrowth in N2A cells specifically through the Gαq receptor melanocortin-4 [73], a receptor that has also been implicated in the regulation of satiety in the hypothalamus [84]. Unfortunately, our preliminary findings alone fail to address how and when environmental and or internal

57 factors influencing TUB-directed outgrowth could become important for neurons. It is tempting to speculate that isoform levels of TUB could be important during neuronal development, although the late onset of tubby-associated obesity suggests that a lack of functional TUB becomes relevant only in adulthood. A developmental role for TUB might be more relevant in the context of Tubby-like protein 3 (TULP 3), given that TULP 3 has recently been shown to suppress hedgehog signaling [85] and TULP 3 knockout mice display neural tube defects and do not survive past the embryonic stage [86, 87].

4.4 Analyzing TUB function and regulation using cell culture-based assays Although TUB has been implicated in Gαq signaling, whereby TUB might potentiate transcription regulation [10, 14], TUB function still remains elusive. Thus, we have developed rapid cell culture-based assays that will enable us to better understand and dissect TUB function and TUB-related molecular mechanisms. Here, we have presented for the first time, assays that test TUB function in N2A cells and primary neuronal culture and from our data, suggest that TUB might play a role in regulating isoform-specific neuronal outgrowth. Now that we have addressed what effects are mediated by TUB following nuclear translocation, our assays can be used to explore many other exciting avenues concerning TUB function and regulation raised by other groups. Our data suggest that TUB could function as an integrator of neurokinin-1- mediated signals. However, our assays provide the means to test a battery of other GPCRs in addition to other possible receptors that TUB has been postulated to signal through. For instance, given that TUB has been implicated in insulin signaling through the insulin receptor [77], it would be interesting to determine the effects, if any, of insulin on TUB localization and neuritic outgrowth. It is tempting to speculate that TUB may function to modulate neuronal outgrowth and the transmission of signals generated by insulin in brain regions that control appetite and weight regulation. Furthermore, since the tubby mutation may manifest in behavioural abnormalities such as a lack in motivation, it would be interesting to test TUB function on neuritic outgrowth in response to mood stabilizers (see Appendix). It is possible that TUB could play a role in how these drugs evoke their effects.

58 4.5 The regulation of Tubby splicing on neuritic outgrowth

Neuronal stability, elongation, retraction, and branching of processes are crucial to ensure proper neuronal connectivity with proper targets in the brain. Our analysis of TUB function involved the over-expression of one TUB isoform. However, it is tempting to speculate that in vivo, the development of proper neuronal circuits and activity- dependent neuronal plasticity might rely on relative levels of full length and Δ5 TUB, which would be subject to dynamic fluctuation (Figure 14).

Figure 14. Relative levels of full length TUB and Δ5 TUB could be important for regulating neuronal outgrowth. When neuronal branching and process outgrowth is required, relative levels of Δ5 versus full length TUB might increase (top). When neuronal stability is required, levels relative levels of full length versus Δ5 TUB might increase (bottom).

Both full length and Δ5 TUB are present in N2A cells and whole brain extracts. This observation suggests that there might be a baseline balance between levels of TUB isoforms. Relative levels of full length TUB in the brain are increased in C57 mice homozygous for the anorexia mutation (Michael Huynh, unpublished), suggesting that relative levels of TUB isoforms can be dramatically altered in response to unknown influences. In the context of the anorexia mutation, these effects appear to be restricted to specific brain regions, such as the hippocampus. At the present, we do not know how Tubby splicing is regulated. However, given the dramatic isoform-specific effects of TUB on neuronal outgrowth, it would be interesting to identify signals that direct Tubby splicing and splicing factors that may be involved.

59 4.6 Aberrant morphology and innervation of serotonergic neurons in the hippocampus of tub/tub mice

Since the most dramatic neuronal deficit in anorexia mice involved aberrant innervation of the serotonergic system and in light of our hypothesis that TUB is a regulator of neuronal outgrowth, we attempted to see if there were serotonergic neuronal deficits in the brains of tub/tub mice. In light of the possible tubby-associated motivational deficits [41], we decided to look at serotonergic innervation in the hippocampus, a brain structure that has been associated with modulating incentive and motivation with respect to appetite, activity [88, 89] and depression [90, 91]. While serotonergic innervation occurs throughout the hippocampus, we chose to analyze innervation through the Schaffer collateral-commissural pathway, which consists of innervating axons from CA1 pyramidal cells, because this region exhibits the highest degree of serotonergic innervation in contrast to other hippocampal regions such as the dentate gyrus and CA3 regions [92, 93]. While there is evidence to suggest that 5-HT axonal innervation in the hippocampus can originate from the dorsal raphe nucleus [94, 95], the majority of serotonergic neurons innervating the hippocampus originate from the median raphe [92, 96]. Thus, the majority of axons in the hippocampus exhibit a plexus of axons that travel in straight trajectories and display spherical beaded varicosities known as M-fibers, which are characteristic features of median raphe serotonergic neurons [92]. Our preliminary results suggest that the organization of serotonergic innervation and morphological structure of serotonergic neurons is aberrant in the Schaffer collateral-commissural pathway of tubby mice. As expected, serotonergic fibers in normal mice displayed beaded varicosities that innervated the Schaffer collateral- commissural pathway in a fasiculated and unidirectional manner towards the CA1 regions. By contrast, in tubby mice, this brain region was innervated by smoother and less varicose serotonergic fibers, in a defasiculated manner. A hallmark feature of serotonergic neurons is that they display astonishing dynamic flexibility [97], however, the mechanisms that regulate serotonergic branching and innervation are elusive. It is tempting to speculate that the loss of TUB results in serotonergic defasiculation and branching because essentially tubby acts like the Δ5 TUB isoform. If full length TUB competes with Δ5 TUB to transactivate genes that are important for stable and organized

60 neuronal outgrowth, the consequences of a non-functional TUB protein would parallel the effects of Δ5 TUB, which does not have the ability to potentiate transcription. Interestingly, M. spretus and M. castaneous mice, which display significantly more Δ5 versus full length TUB are more susceptible to diet-induced obesity than C57 mice, which display the opposite isoform levels [12]. It would be interesting to generate stable cell lines expressing TUB constructs that harbor the tubby mutation to see whether morphological outgrowth parallels the effects of Δ5 TUB. Furthermore, recent microarray analysis performed in the cerebral cortex of tubby mice shows down-regulation of the p21-activated kinase 1 (Pak 1) protein, whose roles have been shown to modulate polarity and cytoskeletal dynamics and resist apoptosis [98-100]. The authors suggest that TUB influence on Pak1 expression could have an impact on neurodegeneration and axonal outgrowth, and our results are supportive of their hypothesis. Our results also indicate that the loss of TUB function may result in the loss of varicosities along serotonergic neurons. Serotonergic varicosities have been reported to be extrasynaptic sites for 5-HT release [101], and would likely be 5-HT sources for CA neuronal dendrites in the Schaffer collateral-commissural pathway of the hippocampus. It is possible that tubby-associated obesity results from aberrant serotonin levels at serotonergic synapses, which would result in less 5-HT neurotransmission. This is in contrast to 5HT2c receptor knockout mice, which exhibit age-onset obesity like tubby mice, possibly due to reduced 5-HT neurotransmission and anorexia mice, which are emaciated, possibly due to hyperactive 5-HT neurotransmission. We are currently underway to investigate 5-HT innervation in other brain regions of tub/tub animals.

61 5.0 CONCLUSIONS

Our data suggest that full length TUB directs stability and polarity of neuronal processes while Δ5 TUB modulates plasticity by directing process outgrowth and branching. Full length TUB is upregulated in brain regions of anorexia mice that display hyperinnervation of the serotonergic system. Therefore, as a modifier, full length TUB could be facilitating the stabilization of these 5-HT neuronal branching fibers. Although regulatory mechanisms still remain elusive, TUB function depends on nuclear localization, functioning possibly as a transcription regulator and/or in intracellular trafficking. The isoform-specific morphological inducing properties of TUB would be an effective neuronal method in controlling neuroplasticity and this could be important for synaptic and post-receptor signaling. Towards this end, the tubby mutation, which abrogates TUB function, results in abnormal non-varicose 5-HT fibers innervating the Schaffer collateral commissural pathway. This deficit could decrease the bioavailability of 5-HT and thus, compromise 5-HT neurotransmission in the hippocampus.

62 6.0 APPENDIX

6.1 The mood stabilizers lithium and valproic acid promote process formation and elongation in N2A cells and enhance the isoform-specific cell shape changes of constitutively activated TUB

The tubby mutation associates in a region of mouse chromosome 7 that is homologous to a region on human chromosome 11 implicated in bipolar disorder. Lithium and valproic acid are two drugs that have been shown to control the course of this mental illness and other forms of depression. Since lithium and valproic acid have also been implicated in neurite outgrowth, we decided to see how these mood-stabilizing agents affected TUB function in N2A cells. A high concentration of lithium (10 mM) and valproic acid (5 mM) was used because these concentrations have been used in previous studies that investigated morphological differentiation in N2A cells. In general, both lithium and valproic acid induced neuritic outgrowth and cell lines exhibited a higher population of neurite bearing cells than cells that were untreated (Figure 15B). Interestingly, under treatment, constitutively activated full length and Δ5 TUB-expressing cells retained their isoform-specific morphological cell shape integrity and displayed in general, longer neurites in a higher percentage of neurite-bearing cells versus their untreated counterparts, suggesting that these mood stabilizing drugs can enhance TUB isoform-specific neuritic outgrowth or detection of such outgrowths (Figure 15A). We next decided to analyze neuritic outgrowth according to bipolar character and the number of primary processes extending from the soma as these were the single and most defining characteristics that differentiated full length versus Δ5 TUB-directed neuritic outgrowth. Our quantitative analysis evaluating bipolar character was able to detect an increase in the proportion of cells that extended bipolar processes in constitutively activated full length TUB-expressing cells that were treated with lithium (2-fold) and valproic acid (1.4-fold) in comparison to untreated constitutively activated full length TUB- expressing cells and all other remaining cell types analyzed (treated and untreated) (Figure 15C). This suggested strongly that the bipolar character of full length TUB is not only retained, but also enhanced by lithium and valproic acid. In addition, our quantitative analysis of process outgrowth was able to detect an increase in the proportion

63 of constitutively activated Δ5 TUB-expressing cells that exhibited more than 3 processes when treated with lithium (2.5-fold) and valproic acid (2.3-fold) (Figure 15D). This proportion was twice that of untreated Δ5 TUB-expressing cells and both were in striking contrast to the barely detectable proportion of remaining cell types (treated and untreated). These data suggest that process outgrowth directed by constitutively activated Δ5 TUB can be enhanced by lithium and valproic acid.

65 Figure 15. The mood stabilizers lithium and valproic acid induce neuritic process outgrowth in N2A cells and enhance the effects of constitutively activated TUB in an isoform-specific manner. (A) Stable cell lines (top panel), and stable cell lines treated with 10 mM of lithium chloride (middle panel) and 5 mM of valproic acid (bottom panel). (B) Lithium and valproic acid induce differentiation uniformly across stable cell lines. (C) A greater proportion of constitutively activated full length TUB-expressing cells exhibit bi-polar process outgrowth when treated with lithium and valproic acid. (D) A greater proportion of constitutively activated Δ5 TUB-expressing cells extend more than 3 processes greater than 1 soma length. N=150.

As expected, lithium and valproic acid both induced neuritic outgrowth in N2A cells and N2A cells expressing unactivated TUB-RFP. However, very interestingly, these agents enhanced the striking isoform-specific neuritic outgrowth that was mediated by constitutively activated full length and Δ5 TUB. TUB-function could be important in the etiology and treatment of bipolar disorder, which is treated by lithium and valproic acid.

66 7.0 REFERENCES

1. Flavell, S.W. and M.E. Greenberg, Signaling mechanisms linking neuronal activity to gene expression and plasticity of the nervous system. Annu Rev Neurosci, 2008. 31: p. 563-90. 2. Abe, K., Neural activity-dependent regulation of gene expression in developing and mature neurons. Dev Growth Differ, 2008. 50(4): p. 261-71. 3. Keith, C.H. and M.T. Wilson, Factors controlling axonal and dendritic arbors. Int Rev Cytol, 2001. 205: p. 77-147. 4. Krichevsky, A.M. and K.S. Kosik, Neuronal RNA granules: a link between RNA localization and stimulation-dependent translation. Neuron, 2001. 32(4): p. 683- 96. 5. Xie, J., Control of alternative pre-mRNA splicing by Ca(++) signals. Biochim Biophys Acta, 2008. 1779(8): p. 438-52. 6. Crabtree, G.R., Generic signals and specific outcomes: signaling through Ca2+, calcineurin, and NF-AT. Cell, 1999. 96(5): p. 611-4. 7. Crabtree, G.R. and E.N. Olson, NFAT signaling: choreographing the social lives of cells. Cell, 2002. 109 Suppl: p. S67-79. 8. Kaltschmidt, C., B. Kaltschmidt, and P.A. Baeuerle, Brain synapses contain inducible forms of the transcription factor NF-kappa B. Mech Dev, 1993. 43(2-3): p. 135-47. 9. Kaltschmidt, C., et al., Constitutive NF-kappa B activity in neurons. Mol Cell Biol, 1994. 14(6): p. 3981-92. 10. Santagata, S., et al., G-protein signaling through tubby proteins. Science, 2001. 292(5524): p. 2041-50. 11. Coleman, D.L. and E.M. Eicher, Fat (fat) and tubby (tub): two autosomal recessive mutations causing obesity syndromes in the mouse. J Hered, 1990. 81(6): p. 424-7. 12. Kleyn, P.W., et al., Identification and characterization of the mouse obesity gene tubby: a member of a novel gene family. Cell, 1996. 85(2): p. 281-90. 13. Noben-Trauth, K., et al., A candidate gene for the mouse mutation tubby. Nature, 1996. 380(6574): p. 534-8. 14. Boggon, T.J., et al., Implication of tubby proteins as transcription factors by structure-based functional analysis. Science, 1999. 286(5447): p. 2119-25. 15. North, M.A., et al., Molecular characterization of TUB, TULP1, and TULP2, members of the novel tubby gene family and their possible relation to ocular diseases. Proc Natl Acad Sci U S A, 1997. 94(7): p. 3128-33. 16. Chung, W.K., et al., Molecular mapping of the tubby (tub) mutation on mouse chromosome 7. Genomics, 1996. 32(2): p. 210-7. 17. Stubdal, H., et al., Targeted deletion of the tub mouse obesity gene reveals that tubby is a loss-of-function mutation. Mol Cell Biol, 2000. 20(3): p. 878-82. 18. Shiri-Sverdlov, R., et al., Identification of TUB as a novel candidate gene influencing body weight in humans. Diabetes, 2006. 55(2): p. 385-9. 19. Ikeda, A., P.M. Nishina, and J.K. Naggert, The tubby-like proteins, a family with roles in neuronal development and function. J Cell Sci, 2002. 115(Pt 1): p. 9-14.

67 20. Sahly, I., et al., Prominent neuronal-specific tub gene expression in cellular targets of tubby mice mutation. Hum Mol Genet, 1998. 7(9): p. 1437-47. 21. Ikeda, S., et al., Cell-specific expression of tubby gene family members (tub, Tulp1,2, and 3) in the retina. Invest Ophthalmol Vis Sci, 1999. 40(11): p. 2706- 12. 22. Ikeda, S., et al., Retinal degeneration but not obesity is observed in null mutants of the tubby-like protein 1 gene. Hum Mol Genet, 2000. 9(2): p. 155-63. 23. Kong, L., et al., Molecular mechanisms underlying cochlear degeneration in the tubby mouse and the therapeutic effect of sulforaphane. Neurochem Int, 2009. 54(3-4): p. 172-9. 24. Kong, L., et al., Bright cyclic light accelerates photoreceptor cell degeneration in tubby mice. Neurobiol Dis, 2006. 21(3): p. 468-77. 25. Ohlemiller, K.K., et al., Cochlear and retinal degeneration in the tubby mouse. Neuroreport, 1995. 6(6): p. 845-9. 26. Ikeda, A., et al., Microtubule-associated protein 1A is a modifier of tubby hearing (moth1). Nat Genet, 2002. 30(4): p. 401-5. 27. Ikeda, A., et al., Genetic modification of hearing in tubby mice: evidence for the existence of a major gene (moth1) which protects tubby mice from hearing loss. Hum Mol Genet, 1999. 8(9): p. 1761-7. 28. Ashrafi, K., et al., Genome-wide RNAi analysis of Caenorhabditis elegans fat regulatory genes. Nature, 2003. 421(6920): p. 268-72. 29. Mukhopadhyay, A., et al., C. elegans tubby regulates life span and fat storage by two independent mechanisms. Cell Metab, 2005. 2(1): p. 35-42. 30. Olkkonen, V.M. and H. Stenmark, Role of Rab GTPases in membrane traffic. Int Rev Cytol, 1997. 176: p. 1-85. 31. Mora Teruel, F., [The brain, hunger and satiety]. An R Acad Nac Med (Madr), 1992. 109(4): p. 717-24. 32. Morgane, P.J. and H.L. Jacobs, Hunger and satiety. World Rev Nutr Diet, 1969. 10: p. 100-213. 33. Panksepp, J., Is satiety mediated by the ventromedial hypothalamus? Physiol Behav, 1971. 7(3): p. 381-4. 34. Guan, X.M., H. Yu, and L.H. Van der Ploeg, Evidence of altered hypothalamic pro-opiomelanocortin/ neuropeptide Y mRNA expression in tubby mice. Brain Res Mol Brain Res, 1998. 59(2): p. 273-9. 35. Backberg, M., et al., Down-regulated expression of agouti-related protein (AGRP) mRNA in the hypothalamic arcuate nucleus of hyperphagic and obese tub/tub mice. Brain Res Mol Brain Res, 2004. 125(1-2): p. 129-39. 36. Unger, T.J., et al., Selective deletion of Bdnf in the ventromedial and dorsomedial hypothalamus of adult mice results in hyperphagic behavior and obesity. J Neurosci, 2007. 27(52): p. 14265-74. 37. Gehlert, D.R., et al., Localization of neuropeptide Y messenger ribonucleic acid in rat and mouse brain by in situ hybridization. Synapse, 1987. 1(1): p. 25-31. 38. Wang, Y., et al., Defective carbohydrate metabolism in mice homozygous for the tubby mutation. Physiol Genomics, 2006. 27(2): p. 131-40.

68 39. Backberg, M. and B. Meister, Abnormal cholinergic and GABAergic vascular innervation in the hypothalamic arcuate nucleus of obese tub/tub mice. Synapse, 2004. 52(4): p. 245-57. 40. Koritschoner, N.P., et al., Thyroid hormone regulates the obesity gene tub. EMBO Rep, 2001. 2(6): p. 499-504. 41. Coyle, C.A., S.C. Strand, and D.J. Good, Reduced activity without hyperphagia contributes to obesity in Tubby mutant mice. Physiol Behav, 2008. 95(1-2): p. 168-75. 42. Edwards, J.G. and I. Anderson, Systematic review and guide to selection of selective serotonin reuptake inhibitors. Drugs, 1999. 57(4): p. 507-33. 43. Miller, K.J., Serotonin 5-ht2c receptor agonists: potential for the treatment of obesity. Mol Interv, 2005. 5(5): p. 282-91. 44. Dahlstrom, A. and K. Fuxe, Localization of monoamines in the lower brain stem. Experientia, 1964. 20(7): p. 398-9. 45. Steinbusch, H.W. and R. Nieuwenhuys, Localization of serotonin-like immunoreactivity in the central nervous system and pituitary of the rat, with special references to the innervation of the hypothalamus. Adv Exp Med Biol, 1981. 133: p. 7-35. 46. Sawchenko, P.E., et al., The distribution and cells of origin of serotonergic inputs to the paraventricular and supraoptic nuclei of the rat. Brain Res, 1983. 277(2): p. 355-60. 47. Guy, J., G. Pelletier, and O. Bosler, Serotonin innervation of neuropeptide Y- containing neurons in the rat arcuate nucleus. Neurosci Lett, 1988. 85(1): p. 9- 13. 48. Leibowitz, S.F. and J.T. Alexander, Hypothalamic serotonin in control of eating behavior, meal size, and body weight. Biol Psychiatry, 1998. 44(9): p. 851-64. 49. Dryden, S., et al., The serotonin (5-HT) antagonist methysergide increases neuropeptide Y (NPY) synthesis and secretion in the hypothalamus of the rat. Brain Res, 1995. 699(1): p. 12-8. 50. Dube, M.G., et al., Effect of d-fenfluramine on neuropeptide Y concentration and release in the paraventricular nucleus of food-deprived rats. Brain Res Bull, 1992. 29(6): p. 865-9. 51. Rogers, P., P.E. McKibbin, and G. Williams, Acute fenfluramine administration reduces neuropeptide Y concentrations in specific hypothalamic regions of the rat: possible implications for the anorectic effect of fenfluramine. Peptides, 1991. 12(2): p. 251-5. 52. Heisler, L.K., et al., Serotonin reciprocally regulates melanocortin neurons to modulate food intake. Neuron, 2006. 51(2): p. 239-49. 53. Chen, D. and A. Garg, Monogenic disorders of obesity and body fat distribution. J Lipid Res, 1999. 40(10): p. 1735-46. 54. Carroll, K., C. Gomez, and L. Shapiro, Tubby proteins: the plot thickens. Nat Rev Mol Cell Biol, 2004. 5(1): p. 55-63. 55. Butler, A.A. and R.D. Cone, Knockout models resulting in the development of obesity. Trends Genet, 2001. 17(10): p. S50-4.

69 56. Cool, D.R. and Y.P. Loh, Carboxypeptidase E is a sorting receptor for prohormones: binding and kinetic studies. Mol Cell Endocrinol, 1998. 139(1-2): p. 7-13. 57. Normant, E. and Y.P. Loh, Depletion of carboxypeptidase E, a regulated secretory pathway sorting receptor, causes misrouting and constitutive secretion of proinsulin and proenkephalin, but not chromogranin A. Endocrinology, 1998. 139(4): p. 2137-45. 58. Julius, D., et al., Functional expression of the 5-HT1c receptor in neuronal and nonneuronal cells. Cold Spring Harb Symp Quant Biol, 1988. 53 Pt 1: p. 385-93. 59. Newman, E.A., et al., Activation of the melanocortin-4 receptor mobilizes intracellular free calcium in immortalized hypothalamic neurons. J Surg Res, 2006. 132(2): p. 201-7. 60. Ellingrod, V.L., et al., Weight gain associated with the -759C/T polymorphism of the 5HT2C receptor and olanzapine. Am J Med Genet B Neuropsychiatr Genet, 2005. 134B(1): p. 76-8. 61. Vaisse, C., et al., Melanocortin-4 receptor mutations are a frequent and heterogeneous cause of morbid obesity. J Clin Invest, 2000. 106(2): p. 253-62. 62. Wacker, D.A. and K.J. Miller, Agonists of the serotonin 5-HT2C receptor: preclinical and clinical progression in multiple diseases. Curr Opin Drug Discov Devel, 2008. 11(4): p. 438-45. 63. Johansen, J.E., et al., Evidence for hypothalamic dysregulation in mouse models of anorexia as well as in humans. Physiol Behav, 2007. 92(1-2): p. 278-82. 64. Maltais, L.J., P.W. Lane, and W.G. Beamer, Anorexia, a recessive mutation causing starvation in preweanling mice. J Hered, 1984. 75(6): p. 468-72. 65. Broberger, C., et al., The neuropeptide Y/agouti gene-related protein (AGRP) brain circuitry in normal, anorectic, and monosodium glutamate-treated mice. Proc Natl Acad Sci U S A, 1998. 95(25): p. 15043-8. 66. Broberger, C., et al., Hypothalamic neurohistochemistry of the murine anorexia (anx/anx) mutation: altered processing of neuropeptide Y in the arcuate nucleus. J Comp Neurol, 1997. 387(1): p. 124-35. 67. Chen, H.Y., et al., Orexigenic action of peripheral ghrelin is mediated by neuropeptide Y and agouti-related protein. Endocrinology, 2004. 145(6): p. 2607- 12. 68. Broberger, C., et al., Changes in neuropeptide Y receptors and pro- opiomelanocortin in the anorexia (anx/anx) mouse hypothalamus. J Neurosci, 1999. 19(16): p. 7130-9. 69. Jahng, J.W., et al., Differential expression of monoamine oxidase A, serotonin transporter, tyrosine hydroxylase and norepinephrine transporter mRNA by anorexia mutation and food deprivation. Brain Res Dev Brain Res, 1998. 107(2): p. 241-6. 70. Son, J.H., et al., Drastic and selective hyperinnervation of central serotonergic neurons in a lethal neurodevelopmental mouse mutant, Anorexia (anx). Brain Res Mol Brain Res, 1994. 25(1-2): p. 129-34. 71. Jahng, J.W., et al., Neuropeptide Y mRNA and serotonin innervation in the arcuate nucleus of anorexia mutant mice. Brain Res, 1998. 790(1-2): p. 67-73.

70 72. Nonogaki, K., et al., Hyperactivity and reduced energy cost of physical activity in serotonin 5-HT(2C) receptor mutant mice. Diabetes, 2003. 52(2): p. 315-20. 73. Adan, R.A., et al., Melanocortin receptors mediate alpha-MSH-induced stimulation of neurite outgrowth in neuro 2A cells. Brain Res Mol Brain Res, 1996. 36(1): p. 37-44. 74. He, W., et al., GFP-tagged expression and immunohistochemical studies to determine the subcellular localization of the tubby gene family members. Brain Res Mol Brain Res, 2000. 81(1-2): p. 109-17. 75. De Deurwaerdere, P., et al., Constitutive activity of the serotonin2C receptor inhibits in vivo dopamine release in the rat striatum and nucleus accumbens. J Neurosci, 2004. 24(13): p. 3235-41. 76. Schmidt, U., et al., Activation of dopaminergic D1 receptors promotes morphogenesis of developing striatal neurons. Neuroscience, 1996. 74(2): p. 453- 60. 77. Kapeller, R., et al., Tyrosine phosphorylation of tub and its association with Src homology 2 domain-containing proteins implicate tub in intracellular signaling by insulin. J Biol Chem, 1999. 274(35): p. 24980-6. 78. Tanaka, E.M. and M.W. Kirschner, Microtubule behavior in the growth cones of living neurons during axon elongation. J Cell Biol, 1991. 115(2): p. 345-63. 79. Davenport, R.W., E. Thies, and M.L. Cohen, Neuronal growth cone collapse triggers lateral extensions along trailing axons. Nat Neurosci, 1999. 2(3): p. 254- 9. 80. Goldberg, J.L., Intrinsic neuronal regulation of axon and dendrite growth. Curr Opin Neurobiol, 2004. 14(5): p. 551-7. 81. Tang, T., et al., Galphaq reduces cAMP production by decreasing Galphas protein abundance. Biochem Biophys Res Commun, 2008. 377(2): p. 679-84. 82. Namikawa, K., et al., Akt/protein kinase B prevents injury-induced motoneuron death and accelerates axonal regeneration. J Neurosci, 2000. 20(8): p. 2875-86. 83. Markus, A., J. Zhong, and W.D. Snider, Raf and akt mediate distinct aspects of sensory axon growth. Neuron, 2002. 35(1): p. 65-76. 84. Zhou, L., et al., Serotonergic pathways converge upon central melanocortin systems to regulate energy balance. Peptides, 2005. 26(10): p. 1728-32. 85. Cameron, D.A., T. Pennimpede, and M. Petkovich, Tulp3 is a critical repressor of mouse hedgehog signaling. Dev Dyn, 2009. 238(5): p. 1140-9. 86. Ikeda, A., et al., Neural tube defects and neuroepithelial cell death in Tulp3 knockout mice. Hum Mol Genet, 2001. 10(12): p. 1325-34. 87. Nishina, P.M., et al., Molecular characterization of a novel tubby gene family member, TULP3, in mouse and humans. Genomics, 1998. 54(2): p. 215-20. 88. Morgane, P.J., J.R. Galler, and D.J. Mokler, A review of systems and networks of the limbic forebrain/limbic midbrain. Prog Neurobiol, 2005. 75(2): p. 143-60. 89. Tracy, A.L., L.E. Jarrard, and T.L. Davidson, The hippocampus and motivation revisited: appetite and activity. Behav Brain Res, 2001. 127(1-2): p. 13-23. 90. Sheline, Y.I., Neuroimaging studies of mood disorder effects on the brain. Biol Psychiatry, 2003. 54(3): p. 338-52. 91. Sheline, Y.I., et al., Hippocampal atrophy in recurrent major depression. Proc Natl Acad Sci U S A, 1996. 93(9): p. 3908-13.

71 92. Mamounas, L.A., et al., Dual serotoninergic projections to forebrain in the rat: morphologically distinct 5-HT axon terminals exhibit differential vulnerability to neurotoxic amphetamine derivatives. J Comp Neurol, 1991. 314(3): p. 558-86. 93. Oleskevich, S. and L. Descarries, Quantified distribution of the serotonin innervation in adult rat hippocampus. Neuroscience, 1990. 34(1): p. 19-33. 94. Segal, M. and S. Landis, Afferents to the hippocampus of the rat studied with the method of retrograde transport of horseradish peroxidase. Brain Res, 1974. 78(1): p. 1-15. 95. Azmitia, E.C. and M. Segal, An autoradiographic analysis of the differential ascending projections of the dorsal and median raphe nuclei in the rat. J Comp Neurol, 1978. 179(3): p. 641-67. 96. Kreiss, D.S. and I. Lucki, Differential regulation of serotonin (5-HT) release in the striatum and hippocampus by 5-HT1A autoreceptors of the dorsal and median raphe nuclei. J Pharmacol Exp Ther, 1994. 269(3): p. 1268-79. 97. Azmitia, E.C. and P.M. Whitaker-Azmitia, Awakening the sleeping giant: anatomy and plasticity of the brain serotonergic system. J Clin Psychiatry, 1991. 52 Suppl: p. 4-16. 98. Jacobs, T., et al., Localized activation of p21-activated kinase controls neuronal polarity and morphology. J Neurosci, 2007. 27(32): p. 8604-15. 99. Schurmann, A., et al., p21-activated kinase 1 phosphorylates the death agonist bad and protects cells from apoptosis. Mol Cell Biol, 2000. 20(2): p. 453-61. 100. Sells, M.A., et al., Human p21-activated kinase (Pak1) regulates actin organization in mammalian cells. Curr Biol, 1997. 7(3): p. 202-10. 101. Maley, B.E., et al., Monoamine synaptic structure and localization in the central nervous system. J Electron Microsc Tech, 1990. 15(1): p. 20-33.