DOCSLIB.ORG

Phyllonorycter Styracis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Phyllonorycter Styracis JAPB187_proof ■ 9 October 2016 ■ 1/4 Journal of Asia-Pacific Biodiversity xxx (2016) 1e4 55 HOSTED BY Contents lists available at ScienceDirect 56 57 Journal of Asia-Pacific Biodiversity 58 59 60 journal homepage: http://www.elsevier.com/locate/japb 61 62 63 Original article 64 65 1 First discovery of winter-emerging leaf-miner: Phyllonorycter styracis 66 2 67 3 (Kumata, 1963) (Lepidoptera, Gracillariidae) from Korea with DNA 68 4 barcode 69 5 70 6 * 71 7 Q15 Da-Som Kim, Bong-Kyu Byun 72 8 Department of Biological Science and Biotechnology, Hannam University, Daejeon, South Korea 73 9 74 10 75 11 article info abstract 76 12 77 13 Article history: In this study, Phyllonorycter styracis Kumata, which emerges in winter season, is reported for the first 78 14 Received 22 February 2016 time from Korea. Adult and genitalic characters of the moth are briefly redescribed with available in- 79 Received in revised form 15 formation, including its distributional range and host plant. In addition, DNA barcoding for correct 80 20 August 2016 16 identification of the species is presented. Accepted 1 September 2016 81 Copyright Ó 2016, National Science Museum of Korea (NSMK) and Korea National Arboretum (KNA). 17 Available online xxx 82 Production and hosting by Elsevier. This is an open access article under the CC BY-NC-ND license (http:// 18 83 creativecommons.org/licenses/by-nc-nd/4.0/). 19 Keywords: 84 20 Gracillariidae 85 Korea 21 86 22 Lepidoptera new record 87 23 Phyllonorycter 88 24 89 25 90 26 91 27 Introduction list: P. similis. Park and Han (1986) reported three new species: 92 28 Phyllonorycter leucocorona, Phyllonorycter orientalis, and Phyllonor- 93 29 Q1 The family Gracillariidae constitutes the major group of leaf ycter pygmaea. Thus, 14 species have been known from Korea at 94 30 miners; so far, 1,880 species have been described from this family present. In addition, one species of Phyllocnistidae, which is closely 95 31 worldwide (De Prins and De Prins 2012). Among the genera in related to the family Gracillariidae, has been known from Korea 96 32 Gracillariidae, Phyllonorycter is one of the largest groups (The Entomological Society of Korea and Korean Society of Applied 97 33 comprising 401 described species (De Prins and De Prins 2005, Entomology 1994; Byun et al 2009; Paek et al 2010; Park et al 2012). 98 34 Q2 2012). They are generally small and shiny moths showing the Recently, Phyllocnistis citrella Stainton, belonging to Phyllocnistidae, 99 35 characteristic behavior in sitting posture, that is, the body lying has become a notorious pest affecting citrus trees in the southern 100 36 parallel to the surface when lowering the head (Davis and Robinson regions of Korea (Lee et al 2015; Kim et al 2015). 101 37 1999). In this study, we found a species of Phyllonorycter, P. styracis 102 fi fi 38 In Korea, the rst record of the genus Phyllonorycter was Kumata, which was rst collected in October 2014 from Mt. Pal- 103 “ 39 Phyllonorycter ringoniella, listed in List of Forest Insect Pests in gong, which is located in the middle-eastern part of Korea, and then 104 ” 40 Korea (Ko 1969) under the name Lithocolletis ringoniella. Later, re-emerged in January 2015. This species is known to be endemic to 105 fi 41 Shin et al (1983) reported 10 species for the genus: Phyllonorycter Japan until now, but has been reported for the rst time from Korea 106 fl 42 nipponicella, Phyllonorycter acutissimae, Phyllonorycter kamijoi, in this study. Adult and genitalic characteristics are brie y rede- 107 43 Phyllonorycter aino, Phyllonorycter issikii, Phyllonorycter koreana, scribed, and available information including the distributional 108 44 Phyllonorycter pastorella, Phyllonorycter melacoronis, P. ringoniella, ranges and host plants are also discussed. In addition, DNA barcode 109 fi 45 and Phyllonorycter ulmi. In addition, Kumata et al (1983) listed 11 for the correct identi cation of the species was extracted and 110 46 species of Phyllonorycter adding one species to the aforementioned sequenced in this study. 111 47 112 48 113 Materials and methods 49 * Corresponding author. Tel.: þ82 42 629 8892; fax: þ82 42 629 8750. 114 50 E-mail address: [email protected] (B.-K. Byun). 115 All materials examined in this study were collected from Mt. 51 Peer review under responsibility of National Science Museum of Korea (NSMK) and 116 Korea National Arboretum (KNA). Palgong, Korea, and now preserved at the Systematic Entomology 52 117 53 http://dx.doi.org/10.1016/j.japb.2016.09.008 118 54 pISSN2287-884X eISSN2287-9544/Copyright Ó 2016, National Science Museum of Korea (NSMK) and Korea National Arboretum (KNA). Production and hosting by Elsevier. 119 This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). Please cite this article in press as: Kim D-S, Byun B-K, First discovery of winter-emerging leaf-miner: Phyllonorycter styracis (Kumata, 1963) (Lepidoptera, Gracillariidae) from Korea with DNA barcode, Journal of Asia-Pacific Biodiversity (2016), http://dx.doi.org/10.1016/ j.japb.2016.09.008 JAPB187_proof ■ 9 October 2016 ■ 2/4 2 DS Kim, BK Byun / Journal of Asia-Pacific Biodiversity xxx (2016) 1e4 1 66 2 67 3 68 4 69 5 70 6 71 7 72 8 73 9 74 10 75 11 76 12 77 Figure 1. Adult and pupa of Phyllonorycter styracis (Kumata, 1963): A, adult; B, pupa after emerging. 13 78 14 79 15 Laboratory, Hannam University, Daejeon, Korea. Adults of both Genus Phyllonorycter Hübner, 1822 80 16 sexes were dissected for examination of genitalic structures and Type species: Phalaena rajella Linnaeus, 1758 81 17 samples were fixed on glass slides with Euparal mountant in ¼ Phyllonorycter Hübner, 1806 82 18 accordance with the procedure recommended by Holloway et al ¼ Lithocolletis Hübner, 1825 83 19 Q3 (1987). The images for the species were taken using a digital ¼ Eucestis Hübner, 1825 84 20 camera attached on the microscope (Leica M205 C; Leica Micro- ¼ Eucesta Hübner, 1826 85 21 systems, Wetzlar, Hesse, Germany). ¼ Hirsuta Bruand, 1851 86 22 Cytochrome c oxidase subunit I gene was extracted for DNA ¼ Lithocolletes Hübner, Dyar 1903 87 23 barcoding according to the protocols of Canadian Center for DNA ¼ Phyllonorycter Lord Walsingham (de Grey), 1914 88 24 Barcoding (Biodiversity Institute of Ontario, University of Guelph, ¼ Hirsuta Fletcher, 1929 89 25 Q4 Guelph, ON, Canada) and the DNA was amplified using the 90 26 primer LepF1 (attcaaccaatcataaagatattgg)/LepR1 (taaacttctggatgtc Phyllonorycter styracis Kumata, 1963 때죽나무가는나방 (신칭) 91 27 caaaaaatca; Hebert et al 2004). Polymerase chain reaction condi- 92 28 Q5 tions for amplification were as follows: at 94 C for 5 minutes, 5 Lithocolletis styracis Kumata, 1963:56e58. TL: Hikosan, Kyushu, 93 29 cycles of 94 C at 30 seconds/45 C at 30 seconds/72 C at 1 minute, Japan. Holotype: Entomological Laboratory, Kyusyu University. 94 30 40 cycles of 94 C at 30 seconds/51 C at 30 seconds/72 Cat1 Adult (Figure 1A). Wingspan 7e8 mm. Length of head and tho- 95 31 minute, and 72 C at 7 minutes. All sequences were assembled with rax 1.5e1.7 mm. Head smooth with shiny white scales on frons; 96 32 CodonCode aligner version 2.0.6 (CodonCode Co., Centerville, MA, apex of the head with tufts of rough scales, mixed with white and 97 33 USA) after the amplification. yellowish brown; ocelli absent and compound eye blackish; 98 34 antennae ciliate and covered with pale brown scales on the edge of 99 35 Systematic accounts each segment; scape with long scales; haustellum elongate; labial 100 36 palps straight with white scales. Thorax covered with goldish yel- 101 37 102 Order Lepidoptera Linnaeus, 1758 low scales and two whitish streaks to vertical. Forewing slender; Q6 38 Family Gracillariidae Stainton, 1854 ground color yellowish brown with white stripes; basal dash white 103 39 Subfamily Lithocolletinae Stainton, 1854 and three pairs of white stripe repeated across up and down with 104 40 105 41 106 42 107 43 108 44 109 45 110 46 111 47 112 48 113 49 114 50 115 51 116 52 117 53 118 54 119 55 120 56 121 57 122 58 123 59 124 60 125 61 126 62 127 63 128 64 129 65 Figure 2. Male and female genitalia: A, male genitalia; B, aedeagus; C, female genitalia. Scale bars: 0.5 mm. 130 Please cite this article in press as: Kim D-S, Byun B-K, First discovery of winter-emerging leaf-miner: Phyllonorycter styracis (Kumata, 1963) (Lepidoptera, Gracillariidae) from Korea with DNA barcode, Journal of Asia-Pacific Biodiversity (2016), http://dx.doi.org/10.1016/ j.japb.2016.09.008 JAPB187_proof ■ 9 October 2016 ■ 3/4 DS Kim, BK Byun / Journal of Asia-Pacific Biodiversity xxx (2016) 1e4 3 1 66 2 67 3 68 4 69 5 70 6 71 7 72 8 73 9 74 10 75 11 76 12 77 13 78 14 79 15 Figure 3. Habitats and leaf mines of Phyllonorycter styracis: A, the habitats of the species in Mt. Palgong, Korea, November 2015; B, P. styracis mine on the host plants. 80 16 81 17 82 18 blackish spot; whitish “u” on the apex of forewing; blackish brown Discussion 83 19 scales scattered in the outer margin with long pale brownish cilia. 84 20 Hindwing lanceolate and more narrow than forewing; ground color P. styracis (Kumata) was described from Japan as an endemic 85 21 pale gray with long silver hairs in the outer margin; a vivid brown species. In this study, we found the species for the first time from 86 22 spot in the proximal region of hindwing.
Load more

Recommended publications
  • Phyllonorycter Issikii
    EUROPEAN AND MEDITERRANEAN PLANT PROTECTION ORGANIZATION ЕВРОПЕЙСКАЯ И СРЕДИЗЕМНОМОРСКАЯ ОРГАНИЗАЦИЯ ПО КАРАНТИНУ И ЗАЩИТЕ РАСТЕНИЙ ORGANIZATION EUROPEENNE ET MEDITERRANEENNE POUR LA PROTECTION DES PLANTES Data Sheets on Forest Pests Phyllonorycter issikii IDENTITY Name: Phyllonorycter issikii (Kumata) Synonym: Lithocolletis issikii Kumata Taxonomic position: Insecta: Lepidoptera, Gracillariidae Common name: Lime leaf miner (English); Липовая минирующая моль-пестрянка (Russian). Bayer computer code: PRYCIS HOSTS Larvae of P. issikii make folded mines in the lower side of leaves of Tilia spp (preferred host). The native hosts in the Far East are, T cordata, T. amurensis, T. mandshurica, T. maximowicziana and other Tilia, but also Betula platyphylla (Ermolaev, 1977; Kozlov, 1991; Orlinskii et al., 1991b). In the West of Russia, Tilia cordata is the preferred host (and also where it is introduced in the East). P.issikii has not specifically been recorded on Tilia platyphyllas or the hybrid T europea, most widely oplanted in western Europe. GEOGRAPHICAL DISTRIBUTION EPPO region: Lithuania (recently introduced), Russia (South of the Far East; South and centre of the European part – introduced: cities of Voronezh, Samara, Ufa, Moscow and their vicinities), Ukraine (introduced). Asia: Korea, Russia (South of the Far East), Japan (Kumata et al., 1983; Kozlov, 1991; Orlinskii et al., 1991). EU: Absent. BIOLOGY The caterpillars of the first generation of P. issikii pupate in the second half of June; moths fly from the end of June till the middle of July. The second generation develops from the end of July till the end of August; moths fly from the middle of August till the beginning of September. Folded mines are located on the lower side of leaves.
    [Show full text]
  • Checkered Beetles Moths (Lepidoptera: Gracillariidae) – Hazardous Phytophags of Arboreal and Shrubby Plants of Botanical Gardens and Plantings of Kiev M
    UDC 632.634.791.937 (477.75) © 2017 Checkered beetles moths (Lepidoptera: Gracillariidae) – hazardous phytophags of arboreal and shrubby plants of botanical gardens and plantings of Kiev M. Lisovyi, O. Sylchuk Natsional University of Life and Environmental Sciences of Ukraine, Heroev Oborony str., 13, Kyiv, 03041, Ukraine P. Chumak, V. Kovalchuk, Botanichny Garden of Acad. O. Fomina The purpose. To carry out probes on revealing and specification of species composition of checkered moths (Lepidoptera: Gracillariidae) in conditions of botanical gardens and plantings of Kiev. Methods. Standard methods of faunistic research in entomology, population ecology, and protection of plants. Results. It is determined that 24 kinds of checkered moths are eating 54 kinds of plants which are widely used for gardening in Kiev. For the first time the following kinds are revealed: Phyllonorycter issikii, Phyllonorycter platani, and Phyllonorycter emberizaepennella. At calculation of Palii-Kovnatski indexes they specified that in city plantings the dominant phytophags are Cameraria ohridella (94,11%), Phyllonorycter populifoliella (86,37%) and Gracillaria syringella (59,14%). They consider that in formation of the secondary areal of invasion kinds of checkered moths the great value has an areal of spread of the host-plant. Environmental analysis is carried out of checkered moths of family Gracillariidae which is spread in cities of the Europe and which are absent in fauna of cities of Ukraine. That has important theoretical and practical value for ecology, entomology and protection of plants against hazardous checkered moths. Conclusions. All the probed kinds of checkered moths by their trophic specialization may be distributed into polyphages (6 kinds), oligophages (14 kinds) and monophages (3 kinds).
    [Show full text]
  • A New Leaf-Mining Moth from New Zealand, Sabulopteryx Botanica Sp
    A peer-reviewed open-access journal ZooKeys 865: 39–65A new (2019) leaf-mining moth from New Zealand, Sabulopteryx botanica sp. nov. 39 doi: 10.3897/zookeys.865.34265 MONOGRAPH http://zookeys.pensoft.net Launched to accelerate biodiversity research A new leaf-mining moth from New Zealand, Sabulopteryx botanica sp. nov. (Lepidoptera, Gracillariidae, Gracillariinae), feeding on the rare endemic shrub Teucrium parvifolium (Lamiaceae), with a revised checklist of New Zealand Gracillariidae Robert J.B. Hoare1, Brian H. Patrick2, Thomas R. Buckley1,3 1 New Zealand Arthropod Collection (NZAC), Manaaki Whenua–Landcare Research, Private Bag 92170, Auc- kland, New Zealand 2 Wildlands Consultants Ltd, PO Box 9276, Tower Junction, Christchurch 8149, New Ze- aland 3 School of Biological Sciences, The University of Auckland, Private Bag 92019, Auckland, New Zealand Corresponding author: Robert J.B. Hoare ([email protected]) Academic editor: E. van Nieukerken | Received 4 March 2019 | Accepted 3 May 2019 | Published 22 Jul 2019 http://zoobank.org/C1E51F7F-B5DF-4808-9C80-73A10D5746CD Citation: Hoare RJB, Patrick BH, Buckley TR (2019) A new leaf-mining moth from New Zealand, Sabulopteryx botanica sp. nov. (Lepidoptera, Gracillariidae, Gracillariinae), feeding on the rare endemic shrub Teucrium parvifolium (Lamiaceae), with a revised checklist of New Zealand Gracillariidae. ZooKeys 965: 39–65. https://doi.org/10.3897/ zookeys.865.34265 Abstract Sabulopteryx botanica Hoare & Patrick, sp. nov. (Lepidoptera, Gracillariidae, Gracillariinae) is described as a new species from New Zealand. It is regarded as endemic, and represents the first record of its genus from the southern hemisphere. Though diverging in some morphological features from previously de- scribed species, it is placed in genus Sabulopteryx Triberti, based on wing venation, abdominal characters, male and female genitalia and hostplant choice; this placement is supported by phylogenetic analysis based on the COI mitochondrial gene.
    [Show full text]
  • Noi Semnalări Ale Unor Specii De Insecte Forestiere Invazive În România
    Bucovina Forestieră 16(2): 161-174, 2016 Articole de cercetare DOI: 10.4316/bf.2016.015 Noi semnalări ale unor specii de insecte forestiere invazive în România N. Olenici, M.-L. Duduman Olenici N., Duduman M.-L., 2016. New records of some invasive forest insect species in Romania. Bucov. For. 16(2): 161-174. Abstract. New records of ten invasive insect species in Romania are presented. The studied species are: Cameraria ohridella Deschka & Dimic 1986, Parec- topa robiniella Clemens 1863, Phyllonorycter robiniella (Clemens 1859), Phyllonorycter issikii (Kumata 1963), Hyphantria cunea (Drury 1773), Obo- lodiplosis robiniae (Haldeman 1847), Leptoglossus occidentalis Heidemann 1910, Eopineus strobus (Hartig 1837), Megastigmus spermotrophus Wachtl 1893 and Harmonia axyridis Pallas 1773. The native range of each species, the first report and the present distribution in Europe and in Romania are discussed. The new records suggest that all the analysed species have established popu- lations in our country and a more widespread distribution than that previously known. Some of them attain sometimes locally or zonally high population levels and are regarded as important pests. For the most species, new obser- vations are necessary, both concerning their presence in the areas where they were not found so far, but also to assess the impact of insect populations on their hosts and on the recipient biocoenoses. A particular attention should be paid to the species H. axyridis, whose swarms invade the houses of the people during the autumn and could cause annoyance and possibly allergy. Citizen participation in observing and reporting of these new ”guests” is encouraged. Keywords alien species, invasive forest insects, new records, distribution, Romania Authors.
    [Show full text]
  • Interesting Lessons We Can Learn Using Past Herbarium Collections For
    LE STUDIUM Interdisciplinary Journal www.lestudium-ias.com FELLOWSHIP FINAL REPORT Interesting lessons we can learn using past herbarium collections for studying forest insect pest invasions Natalia Kirichenko1,2,3,5, Alain Roques2, Sylvie Augustin2, Carlos Lopez-Vaamonde3,4 1Sukachev Institute of Forest SB RAS, 660036 Krasnoyarsk, Russia 2Siberian Federal University, 660045 Krasnoyarsk, Russia 3INRA, UR633, Zoologie forestière, Orléans F-45075, France 4Institut de Recherche sur la Biologie de l’Insecte (IRBI), UMR 7261, CNRS/Université de Tours, UFR Sciences et Techniques, Tours, 37200, France 5 LE STUDIUM Institute for Advanced Studies, 45000 Orléans, France REPORT INFO ABSTRACT Fellow: Dr. Natalia Kirichenko From Sukachev Institute of Forest SB Historical herbaria collected around the world are valuable source of data RAS, Russia for studying past communities of folivore organisms and tracking their Host laboratory in region Centre-Val distributions through the time. Here we examined the world biggest de Loire: INRA, UR633, Zoologie herbarium collection stored in the Muséum National d'Histoire Naturelle forestière, Orléans Host scientist: Dr. Alain Roques (Paris, France) in order to explore past Tilia-feeding endophage Period of residence in region Centre- complexes and their populations in the Holarctic and clarify the expansion Val de Loire: August 2017 – history of the lime leafminer, Phyllonorycter issikii Kumata, 1963 November 2018 (Lepidoptera: Gracillariidae), an invasive pest in Europe damaging limes, Keywords : Leafmining insects, Tilia spp. (Malvaceae). invasions, herbarium, archival DNA, molecular taxonomy, the Holarctic 1- Introduction micromoth from the island of Mangareva (Gambier Islands, French Polynesia) (Hembry, Past herbarium collections have great value to 2013). science and serve not only important source of data for botanists.
    [Show full text]
  • Pedunculate Oak Leaf Miners' Community
    Article Pedunculate Oak Leaf Miners’ Community: Urban vs. Rural Habitat Jovan Dobrosavljevi´c 1,* , Cedomirˇ Markovi´c 1, Marija Marjanovi´c 2 and Slobodan Milanovi´c 1,3 1 Department of Forest Protection, Faculty of Forestry, University of Belgrade, Kneza Višeslava 1, 11030 Belgrade, Serbia; [email protected] (C.M.);ˇ [email protected] (S.M.) 2 Department of Landscape Horticulture, Faculty of Forestry, University of Belgrade, Kneza Višeslava 1, 11030 Belgrade, Serbia; [email protected] 3 Department of Forest Protection and Wildlife Management, Faculty of Forestry and Wood Technology, Mendel University in Brno, Zemedelska 3, 613 00 Brno, Czech Republic * Correspondence: [email protected]; Tel.: +381-603-375707 Received: 6 November 2020; Accepted: 30 November 2020; Published: 3 December 2020 Abstract: With the process of urbanization, cities are expanding, while forests are declining. Many conditions in the urban habitats are modified compared to those in the rural ones, so the organisms present reactions to these changes. To determine to what extent the habitat type influences insects, we tested the differences in the pedunculate oak (Quercus robur L.) leaf-mining insect community between urban and rural habitats in Serbia. Lower species richness, abundance, and diversity were determined on trees in the urban environment. Due to the differences in the habitat types, many of the species disappeared, while most of the remaining species declined. The seasonal dynamics of species richness, abundance, and diversity differed between the habitat types. Both rural and urban populations started with low values in May. Subsequently, rural populations gained higher species richness, abundance, and diversity.
    [Show full text]
  • Redalyc.Interactions Among Host Plants, Lepidoptera Leaf Miners And
    SHILAP Revista de Lepidopterología ISSN: 0300-5267 [email protected] Sociedad Hispano-Luso-Americana de Lepidopterología España Yefremova, Z. A.; Kravchenko, V. D. Interactions among host plants, Lepidoptera leaf miners and their parasitoids in the forest- steppe zone of Russia (Insecta: Lepidoptera, Hymenoptera) SHILAP Revista de Lepidopterología, vol. 43, núm. 170, junio, 2015, pp. 271-280 Sociedad Hispano-Luso-Americana de Lepidopterología Madrid, España Available in: http://www.redalyc.org/articulo.oa?id=45541421012 How to cite Complete issue Scientific Information System More information about this article Network of Scientific Journals from Latin America, the Caribbean, Spain and Portugal Journal's homepage in redalyc.org Non-profit academic project, developed under the open access initiative 271-280 Interactions among host 3/6/15 10:45 Página 271 SHILAP Revta. lepid., 43 (170), junio 2015: 271-280 eISSN: 2340-4078 ISSN: 0300-5267 Interactions among host plants, Lepidoptera leaf miners and their parasitoids in the forest-steppe zone of Russia (Insecta: Lepidoptera, Hymenoptera) Z. A. Yefremova & V. D. Kravchenko Abstract The article reports on the quantitative description of the food web structure of the community consisting of 65 species of Lepidoptera leaf miners reared from 34 plant species, as well as 107 species of parasitoid eulophid wasps (Hymenoptera: Eulophidae). The study was conducted in the forest-steppe zone of the Middle Volga in Russia over 13 years (2000-2012). Leaf miners have been found to be highly host plant-specific. Most of them are associated with only one or two plant species and therefore the number of links between trophic levels is 73, which is close to the total number of Lepidoptera species (linkage density is 1.12).
    [Show full text]
  • Pheromone Trap Catch of Harmful Microlepidoptera Species in Connection with the Chemical Air Pollutants
    International Journal of Research in Environmental Science (IJRES) Volume 2, Issue 1, 2016, PP 1-10 ISSN 2454-9444 (Online) http://dx.doi.org/10.20431/2454-9444.0201001 www.arcjournals.org Pheromone Trap Catch of Harmful Microlepidoptera Species in Connection with the Chemical Air Pollutants L. Nowinszky1, J. Puskás1, G. Barczikay2 1University of West Hungary Savaria University centre, Szombathely, Károlyi Gáspár Square 4 2County Borsod-Abaúj-Zemplén Agricultural Office of Plant Protection and Soil Conservation Directorate, Bodrogkisfalud, Vasút Street. 22 [email protected], [email protected] Abstract: In this study, seven species of Microlepidoptera pest pheromone trap collection presents the results of the everyday function of the chemical air pollutants (SO2, NO, NO2, NOx, CO, PM10, O3). Between 2004 and 2013 Csalomon type pheromone traps were operating in Bodrogkisfalud (48°10’N; 21°21E; Borsod-Abaúj- Zemplén County, Hungary, Europe). The data were processed of following species: Spotted Tentiform Leafminer (Phyllonorycter blancardella Fabricius, 1781), Hawthorn Red Midged Moth (Phyllonorycter corylifoliella Hübner, 1796), Peach Twig Borer (Anarsia lineatella Zeller, 1839), European Vine Moth (Lobesia botrana Denis et Schiffermüller, 1775), Plum Fruit Moth (Grapholita funebrana Treitschke, 1846), Oriental Fruit Moth (Grapholita molesta Busck, 1916) and Codling Moth (Cydia pomonella Linnaeus, 1758). The relation is linear, logarithmic and polynomial functions can be characterized. Keywords: Microlepidoptera, pests, pheromone traps, air pollution 1. INTRODUCTION Since the last century, air pollution has become a major environmental problem, mostly over large cities and industrial areas (Cassiani et al. 2013). It is natural that the air pollutant chemicals influence the life phenomena of insects, such as flight activity as well.
    [Show full text]
  • The Cassidinae Beetles of Longnan County (Jiangxi, China): Overview and Community Composition
    Biodiversity Data Journal 7: e39053 doi: 10.3897/BDJ.7.e39053 Research Article The Cassidinae beetles of Longnan County (Jiangxi, China): overview and community composition Peng Liu‡, Chengqing Liao‡‡, Jiasheng Xu , Charles L. Staines§, Xiaohua Dai ‡,| ‡ Leafminer Group, School of Life Sciences, Gannan Normal University, Ganzhou, China § Smithsonian Environmental Research Center, Edgewater, United States of America | National Navel-Orange Engineering Research Center, Ganzhou, China Corresponding author: Xiaohua Dai ([email protected]) Academic editor: Flávia Rodrigues Fernandes Received: 13 Aug 2019 | Accepted: 16 Oct 2019 | Published: 18 Oct 2019 Citation: Liu P, Liao C, Xu J, Staines CL, Dai X (2019) The Cassidinae beetles of Longnan County (Jiangxi, China): overview and community composition. Biodiversity Data Journal 7: e39053. https://doi.org/10.3897/BDJ.7.e39053 Abstract There are few reports on the community composition and diversity pattern of the Cassidinae species of China. Compared to the neighbouring provinces of Guangdong, Fujian and Zhejiang, the Cassidinae richness in Jiangxi Province is under-reported. Longnan City, a biodiversity hotspot in Jiangxi Province, was chosen to obtain the first overview of the Cassidinae beetles. The sample coverage curves for the three sample sites reached an asymptote which indicated sampling was sufficient for data analysis. A total of eight tribes, 16 genera, 59 species and 1590 individuals of Cassidinae beetles were collected. Most belonged to the tribe Hispini (1121 individuals; 70.5%), followed by the tribe Cassidini (161 individuals; 10.13%) and the tribe Oncocephalini (159 individuals; 10.0%). The remainder (149 individuals) belonged to five tribes (Gonophorini, Basiprionotini, Callispini, Notosacanthini and Aspidimorphini). The tribes Notosacanthini, Aspidimorphini and Oncocephalini were newly recorded for Jiangxi Province.
    [Show full text]
  • Taxonomic Studies on the Lithocolletinae of Japan (Lepidoptera : Gracillariidae) Part 2
    Title Taxonomic studies on the Lithocolletinae of Japan (Lepidoptera : Gracillariidae) Part 2 Author(s) Kumata, Tosio Citation Insecta matsumurana, 26(1), 1-48 Issue Date 1963-08 Doc URL http://hdl.handle.net/2115/9698 Type bulletin (article) File Information 26(1)_p1-48.pdf Instructions for use Hokkaido University Collection of Scholarly and Academic Papers : HUSCAP TAXONOMIC STUDIES ON THE LITHOCOLLETINAE OF JAPAN (LEPIDOPTERA : GRACILLARIIDAE) Part Ill) By TOSIO KUMATA Entomological Institute, Faculty of Agriculture Hokkaido University, Sapporo In this part there are given twenty-nine species attacking Ulmaceae, Rosaceae, Legumi­ nosae, Aceraceae, Ericaceae and Caprifoliaceae, and two host-unknown species of the Lithocolletinae_ Moreover, two new genera are erected for the reception of four new species attacking Leguminosae_ 7_ Species attacking Ulmaceae 32. Lithocolletis tritorrhecta Meyrick (Fig. 1; 3, I-K) Lithocolletis tritorrhecta Meyrick, 1935, Exot. Microlep. 4 : 596; Issiki, 1950, Icon. Ins. Jap.: 454, f. 1224. Phyllonorycter tritorrhecta: Inoue, 1954, Check list Lep. Jap. 1 : 28. This species is represented by the aestival and autumnal forms, which are different III colour. Aestival form: 0 ((. Face silvery-white; palpus whitish, with a blackish streak on pos­ terior surface; tuft of head golden-ochreous, mixed with many whitish scales in centre; antenna white, each segment ringed with dark brown apically. Thorax golden-ochreous, with two white, wide lines running along inner margins of tegulae, and with a white, small spot at posterior angle. Legs whitish; fore tibia clouded inside; mid tibia with three oblique black streaks outside; all tarsi with black blotches or spots at base, basal 1/3, 3/5 and 4/5.
    [Show full text]
  • Sex Attractant, Distribution and DNA Barcodes for The
    Sex attractant, distribution and DNA barcodes for the Afrotropical leaf-mining moth Phyllonorycter melanosparta (Lepidoptera: Gracillariidae) Jurate de Prins, Raimondas Mozūraitis, Carlos Lopez-Vaamonde, Rodolphe Rougerie To cite this version: Jurate de Prins, Raimondas Mozūraitis, Carlos Lopez-Vaamonde, Rodolphe Rougerie. Sex at- tractant, distribution and DNA barcodes for the Afrotropical leaf-mining moth Phyllonorycter melanosparta (Lepidoptera: Gracillariidae). Zootaxa, Magnolia Press, 2009, 2281, pp.53-67. 10.11646/zootaxa.2281.1.4. hal-02661007 HAL Id: hal-02661007 https://hal.inrae.fr/hal-02661007 Submitted on 30 May 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Zootaxa 2281: 53–67 (2009) ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Article ZOOTAXA Copyright © 2009 · Magnolia Press ISSN 1175-5334 (online edition) Sex attractant, distribution and DNA barcodes for the Afrotropical leaf-mining moth Phyllonorycter melanosparta (Lepidoptera: Gracillariidae) JURATE DE PRINS1,6, RAIMONDAS MOZŪRAITIS2, 5, CARLOS LOPEZ-VAAMONDE3 & RODOLPHE ROUGERIE 4 1Royal Museum for Central Africa, Leuvensesteenweg 13, B-3080 Tervuren, Belgium. E-mail: [email protected] 2School of Chemistry and Engineering, Royal Institute of Technology, Teknikringen 30 SE-10044, Stockholm, Sweden. E-mail: [email protected] 3Institut National de la Recherche Agronomique, UR0633 Zoologie Forestière, F-45075 Orléans, France.
    [Show full text]
  • Systematics, Phylogeny and Biology of a New Genus of Lithocolletinae (Lepidoptera: Gracillariidae) Associated with Cistaceae
    Zootaxa 3741 (2): 201–227 ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Article ZOOTAXA Copyright © 2013 Magnolia Press ISSN 1175-5334 (online edition) http://dx.doi.org/10.11646/zootaxa.3741.2.1 http://zoobank.org/urn:lsid:zoobank.org:pub:E37C82A2-27DA-42DE-A298-838578F6B179 Systematics, phylogeny and biology of a new genus of Lithocolletinae (Lepidoptera: Gracillariidae) associated with Cistaceae JURATE DE PRINS1,4, DONALD R. DAVIS2, ELIANE DE CONINCK1, JAE-CHEON SOHN2 & PAOLO TRIBERTI3 1Royal Museum for Central Africa, Tervuren, Belgium 2National Museum of Natural History, Smithsonian Institution, USA 3Museo di Storia Naturale, Verona, Italy 4Corresponding author. E-mail: [email protected] Abstract The gracillariid genus Triberta gen. nov. (Lepidoptera: Gracillariidae: Lithocolletinae Stainton, 1854) is described to ac- commodate two species formerly assigned to the genus Phyllonorycter Hübner, 1822: Triberta helianthemella (Herrich- Schäffer, 1861) comb. nov. and T. cistifoliella (Groschke, 1944) comb. nov. Triberta cistifoliella bona sp. is restored from synonymy based on morphological characters. The new genus is biologically associated with the plant family Cistaceae of the order Malvales and is endemic to the Palaearctics. Our molecular analysis of eleven nuclear genes failed to unambiguously place Triberta in the lithocolletine phylogeny, but revealed that this genus is distinct from either clade Phyllonorycter + Cremastobombycia and Cameraria. The distinctiveness of Triberta is also supported by inferred
    [Show full text]