JAPB187_proof ■ 9 October 2016 ■ 1/4
Journal of Asia-Pacific Biodiversity xxx (2016) 1e4
55 HOSTED BY Contents lists available at ScienceDirect 56 57 Journal of Asia-Pacific Biodiversity 58 59 60 journal homepage: http://www.elsevier.com/locate/japb 61 62 63 Original article 64 65 1 First discovery of winter-emerging leaf-miner: Phyllonorycter styracis 66 2 67 3 (Kumata, 1963) (Lepidoptera, Gracillariidae) from Korea with DNA 68 4 barcode 69 5 70 6 * 71 7 Q15 Da-Som Kim, Bong-Kyu Byun 72 8 Department of Biological Science and Biotechnology, Hannam University, Daejeon, South Korea 73 9 74 10 75 11 article info abstract 76 12 77 13 Article history: In this study, Phyllonorycter styracis Kumata, which emerges in winter season, is reported for the first 78 14 Received 22 February 2016 time from Korea. Adult and genitalic characters of the moth are briefly redescribed with available in- 79 Received in revised form 15 formation, including its distributional range and host plant. In addition, DNA barcoding for correct 80 20 August 2016 16 identification of the species is presented. Accepted 1 September 2016 81 Copyright Ó 2016, National Science Museum of Korea (NSMK) and Korea National Arboretum (KNA). 17 Available online xxx 82 Production and hosting by Elsevier. This is an open access article under the CC BY-NC-ND license (http:// 18 83 creativecommons.org/licenses/by-nc-nd/4.0/). 19 Keywords: 84 20 Gracillariidae 85 Korea 21 86 22 Lepidoptera new record 87 23 Phyllonorycter 88 24 89 25 90 26 91 27 Introduction list: P. similis. Park and Han (1986) reported three new species: 92 28 Phyllonorycter leucocorona, Phyllonorycter orientalis, and Phyllonor- 93 29 Q1 The family Gracillariidae constitutes the major group of leaf ycter pygmaea. Thus, 14 species have been known from Korea at 94 30 miners; so far, 1,880 species have been described from this family present. In addition, one species of Phyllocnistidae, which is closely 95 31 worldwide (De Prins and De Prins 2012). Among the genera in related to the family Gracillariidae, has been known from Korea 96 32 Gracillariidae, Phyllonorycter is one of the largest groups (The Entomological Society of Korea and Korean Society of Applied 97 33 comprising 401 described species (De Prins and De Prins 2005, Entomology 1994; Byun et al 2009; Paek et al 2010; Park et al 2012). 98 34 Q2 2012). They are generally small and shiny moths showing the Recently, Phyllocnistis citrella Stainton, belonging to Phyllocnistidae, 99 35 characteristic behavior in sitting posture, that is, the body lying has become a notorious pest affecting citrus trees in the southern 100 36 parallel to the surface when lowering the head (Davis and Robinson regions of Korea (Lee et al 2015; Kim et al 2015). 101 37 1999). In this study, we found a species of Phyllonorycter, P. styracis 102 fi fi 38 In Korea, the rst record of the genus Phyllonorycter was Kumata, which was rst collected in October 2014 from Mt. Pal- 103 “ 39 Phyllonorycter ringoniella, listed in List of Forest Insect Pests in gong, which is located in the middle-eastern part of Korea, and then 104 ” 40 Korea (Ko 1969) under the name Lithocolletis ringoniella. Later, re-emerged in January 2015. This species is known to be endemic to 105 fi 41 Shin et al (1983) reported 10 species for the genus: Phyllonorycter Japan until now, but has been reported for the rst time from Korea 106 fl 42 nipponicella, Phyllonorycter acutissimae, Phyllonorycter kamijoi, in this study. Adult and genitalic characteristics are brie y rede- 107 43 Phyllonorycter aino, Phyllonorycter issikii, Phyllonorycter koreana, scribed, and available information including the distributional 108 44 Phyllonorycter pastorella, Phyllonorycter melacoronis, P. ringoniella, ranges and host plants are also discussed. In addition, DNA barcode 109 fi 45 and Phyllonorycter ulmi. In addition, Kumata et al (1983) listed 11 for the correct identi cation of the species was extracted and 110 46 species of Phyllonorycter adding one species to the aforementioned sequenced in this study. 111 47 112 48 113 Materials and methods 49 * Corresponding author. Tel.: þ82 42 629 8892; fax: þ82 42 629 8750. 114 50 E-mail address: [email protected] (B.-K. Byun). 115 All materials examined in this study were collected from Mt. 51 Peer review under responsibility of National Science Museum of Korea (NSMK) and 116 Korea National Arboretum (KNA). Palgong, Korea, and now preserved at the Systematic Entomology 52 117 53 http://dx.doi.org/10.1016/j.japb.2016.09.008 118 54 pISSN2287-884X eISSN2287-9544/Copyright Ó 2016, National Science Museum of Korea (NSMK) and Korea National Arboretum (KNA). Production and hosting by Elsevier. 119 This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Please cite this article in press as: Kim D-S, Byun B-K, First discovery of winter-emerging leaf-miner: Phyllonorycter styracis (Kumata, 1963) (Lepidoptera, Gracillariidae) from Korea with DNA barcode, Journal of Asia-Pacific Biodiversity (2016), http://dx.doi.org/10.1016/ j.japb.2016.09.008 JAPB187_proof ■ 9 October 2016 ■ 2/4
2 DS Kim, BK Byun / Journal of Asia-Pacific Biodiversity xxx (2016) 1e4
1 66 2 67 3 68 4 69 5 70 6 71 7 72 8 73 9 74 10 75 11 76 12 77 Figure 1. Adult and pupa of Phyllonorycter styracis (Kumata, 1963): A, adult; B, pupa after emerging. 13 78 14 79 15 Laboratory, Hannam University, Daejeon, Korea. Adults of both Genus Phyllonorycter Hübner, 1822 80 16 sexes were dissected for examination of genitalic structures and Type species: Phalaena rajella Linnaeus, 1758 81 17 samples were fixed on glass slides with Euparal mountant in ¼ Phyllonorycter Hübner, 1806 82 18 accordance with the procedure recommended by Holloway et al ¼ Lithocolletis Hübner, 1825 83 19 Q3 (1987). The images for the species were taken using a digital ¼ Eucestis Hübner, 1825 84 20 camera attached on the microscope (Leica M205 C; Leica Micro- ¼ Eucesta Hübner, 1826 85 21 systems, Wetzlar, Hesse, Germany). ¼ Hirsuta Bruand, 1851 86 22 Cytochrome c oxidase subunit I gene was extracted for DNA ¼ Lithocolletes Hübner, Dyar 1903 87 23 barcoding according to the protocols of Canadian Center for DNA ¼ Phyllonorycter Lord Walsingham (de Grey), 1914 88 24 Barcoding (Biodiversity Institute of Ontario, University of Guelph, ¼ Hirsuta Fletcher, 1929 89 25 Q4 Guelph, ON, Canada) and the DNA was amplified using the 90 26 primer LepF1 (attcaaccaatcataaagatattgg)/LepR1 (taaacttctggatgtc Phyllonorycter styracis Kumata, 1963 때죽나무가는나방 (신칭) 91 27 caaaaaatca; Hebert et al 2004). Polymerase chain reaction condi- 92 28 Q5 tions for amplification were as follows: at 94 C for 5 minutes, 5 Lithocolletis styracis Kumata, 1963:56e58. TL: Hikosan, Kyushu, 93 29 cycles of 94 C at 30 seconds/45 C at 30 seconds/72 C at 1 minute, Japan. Holotype: Entomological Laboratory, Kyusyu University. 94 30 40 cycles of 94 C at 30 seconds/51 C at 30 seconds/72 Cat1 Adult (Figure 1A). Wingspan 7e8 mm. Length of head and tho- 95 31 minute, and 72 C at 7 minutes. All sequences were assembled with rax 1.5e1.7 mm. Head smooth with shiny white scales on frons; 96 32 CodonCode aligner version 2.0.6 (CodonCode Co., Centerville, MA, apex of the head with tufts of rough scales, mixed with white and 97 33 USA) after the amplification. yellowish brown; ocelli absent and compound eye blackish; 98 34 antennae ciliate and covered with pale brown scales on the edge of 99 35 Systematic accounts each segment; scape with long scales; haustellum elongate; labial 100 36 palps straight with white scales. Thorax covered with goldish yel- 101 37 102 Order Lepidoptera Linnaeus, 1758 low scales and two whitish streaks to vertical. Forewing slender; Q6 38 Family Gracillariidae Stainton, 1854 ground color yellowish brown with white stripes; basal dash white 103 39 Subfamily Lithocolletinae Stainton, 1854 and three pairs of white stripe repeated across up and down with 104 40 105 41 106 42 107 43 108 44 109 45 110 46 111 47 112 48 113 49 114 50 115 51 116 52 117 53 118 54 119 55 120 56 121 57 122 58 123 59 124 60 125 61 126 62 127 63 128 64 129 65 Figure 2. Male and female genitalia: A, male genitalia; B, aedeagus; C, female genitalia. Scale bars: 0.5 mm. 130
Please cite this article in press as: Kim D-S, Byun B-K, First discovery of winter-emerging leaf-miner: Phyllonorycter styracis (Kumata, 1963) (Lepidoptera, Gracillariidae) from Korea with DNA barcode, Journal of Asia-Pacific Biodiversity (2016), http://dx.doi.org/10.1016/ j.japb.2016.09.008 JAPB187_proof ■ 9 October 2016 ■ 3/4
DS Kim, BK Byun / Journal of Asia-Pacific Biodiversity xxx (2016) 1e4 3
1 66 2 67 3 68 4 69 5 70 6 71 7 72 8 73 9 74 10 75 11 76 12 77 13 78 14 79 15 Figure 3. Habitats and leaf mines of Phyllonorycter styracis: A, the habitats of the species in Mt. Palgong, Korea, November 2015; B, P. styracis mine on the host plants. 80 16 81 17 82 18 blackish spot; whitish “u” on the apex of forewing; blackish brown Discussion 83 19 scales scattered in the outer margin with long pale brownish cilia. 84 20 Hindwing lanceolate and more narrow than forewing; ground color P. styracis (Kumata) was described from Japan as an endemic 85 21 pale gray with long silver hairs in the outer margin; a vivid brown species. In this study, we found the species for the first time from 86 22 spot in the proximal region of hindwing. the middle-eastern part of Korea. The host plant, S. japonicus Sieb. & 87 23 Male genitalia (Figures 2A and 2B). Uncus absent; tegument Zucc., is distributed mainly in the southern regions of Korea. The 88 24 narrow and membranous; tuba analis extremely thin membrane; collecting sites were located near the valley mixed with Quercus 89 25 vinculum as long as the upper side of genitalia and Y shaped; saccus tree community and the host plants found in the understory 90 26 absent; valva moderate and asymmetrical; left valva large, 1.4 times vegetation of the Quercus trees. The larvae mine the leaves of the 91 27 than right, with setae on two-third of valva to terminal margin; a host plants forming an oval mine between the veins of leaves. The 92 28 pair of pectinifer in one-third of valva. Aedeagus narrow and more life cycle of the species was not well studied, but it is interesting to 93 29 slender toward apex; cornuti absent and hook on the apex. have an emergence season in winter. In this study, we collected the 94 30 Q7 Female genitalia (Figure 2C). Palpillae analis asymmetrical, pupae from the fallen leaves of host plants in October 2014 and 95 31 moderate, and small with a dozen of long hairs. Apophyses poste- adults emerged in January 2015. In Japan, the species emerges in 96 32 riores short but as long as apophyses anteriores. Ostium bursae October, November, and early spring. However, there is a need to 97 33 relatively elongate, gradually narrowed downward. Ductus bursae investigate their correct flying season and the reason for having the 98 34 fairly slender, membranous, and as long as three times of corpus cold season for their emergence. 99 35 bursae. Corpus bursae membranous and ovate with sclerotized 100 36 projections of signum laterally. 101 Uncited reference 37 Material examined. 2_3\, Mt. Palgong, Daegu, South Korea, 102 38 24 2014 (leg. BK Byun)-coll. SEL/HNU-5189, 5190, 5205; 1\, Mt. 103 Hübner, 1816e1826. 39 Palgong, Daegu, South Korea, 12 ii 2016 (leg. BK Byun)-coll. SEL/ Q14 104 40 HNU. 105 41 Distribution. Korea (South, new record), Japan (Kyushu, Honshu). 106 Acknowledgments Q8,9 42 Host plants (Figure 3B). Styracaceae: Styrax japonicus Sieb. & 107 43 Zucc. (Kumata 1963). Ptychonomous mine on the upper side of This work was supported by the 2016 Hannam University 108 44 leaves (De Prins and De Prins 2005). Research Fund and Forest Science & Technology Projects (Project 109 45 Biology (Figures 1B and 3A). Adults emerged in winter (in No. S111616L030110) provided by the Korean Forest Service. We 110 46 January) after the larval stage in fall. Before the emergence, pupae thank Dr Seung Jin Roh for collecting the species. 111 47 escape from the leaves of host plants. In Japan, this species over- 112 48 winters in the pupal stage, and emerges in the spring of next year 113 49 (Hirowatari 2013). References 114 50 DNA barcode. Cytochrome c oxidase subunit I gene was extracted 115 Bruand T. 1851. Catalogue du Doubs. (Suite.) Tinéides. Mémoires de la Société 51 and sequenced. The sequence of P. styracis (Kumata) in Korea is as d’émulation du Doubs 1849:23e68. 116 52 follows (655 bp): Byun BK, Park KT, Bae YS, et al. 2009. A checklist of the Microlepidoptera in Korea 117 53 AGATATTGAACTCTTATTTATTTTGGAATTGAGCAGGAATAATTGATC (Lepidoptera). Pocheon, South Korea: Korea National Arboretum. 118 54 Davis DR, Robinson GS. 1999. The Tineoidea and Gracillarioidea. In: Kristensen NP, 119 TTCTCTAAGAATTATAATTCGAGCTGAATTAGGAAATCCAGGATCTTTAA editor. Lepidoptera, moths and butterflies, 1: Evolution, systematics, and bioge- 55 TCGGAGACGATCAAATTTATAATACAATTGTAACAGCTCATGCATTTATC ography. Berlin, Germany: Walter de Gruyter. Q10 120 56 ATAATTTTTTTCATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGA De Prins W, De Prins J. 2005. Gracillariidae. In: Landry B, editor. World catalogue of 121 57 CTTGTTCCTCTAATACTCGGAGCTCCAGACATAGCTTTCCCCCGACTTAAT insect, Vol. 6. Stenstrup, Denmark: Apollo Books. Q11 122 De Prins W, De Prins J. 2012. Systematics, revisionary taxonomy, and biodiversity of 58 AACATAAGATTTTGATTATTACCTCCCTCATTATTATTATTAGTTTCAAGA Afrotropical Lithocolletinae (Lepidoptera: Gracillariidae). Zootaxa 3594:1e283. 123 59 AGAATTGTAGAAAATGGAGCAGGTACTGGTTGAACTGTTTACCCTCCTTT Dyar HG. 1903. A list of the North American Lepidoptera and key to the literature 124 e 60 ATCTTCTAATATTGCTCACGCTGGTAGATCTGTAGATTTAGCTATTTTTTC of this order of insects. Bulletin of the United States National Museum 52:i xix. 125 1e723. 61 CCTTCACCTTGCAGGAATTTCCTCAATCTTAGGGGCTATTAATTTTATTAC Fletcher TB. 1929. A list of the generic names used for Microlepidoptera. Memoirs of 126 62 AACTATTATTAATATACGAACTAATGGTATAAAATTTGATAATATACCTCT the Department of Agriculture in India: Entomological Series 11:1e244. 127 63 ATTTGTATGAGCTGTAGGTATTACAGCCTTACTTTTATTATTATCATTACC Hebert PDN, Penton EH, Burns J, et al. 2004. Ten species in one: DNA barcoding 128 revealed cryptic species in the neotropical skipper butterfly, Astraptes fulger- 64 TGTATTAGCAGGAGCAATTACTATATTACTAACAGACCGAAATTTAAATA ator. Proceedings of the National Academy of Sciences of the United States of 129 65 CATCCTTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACAC America 101:14812e14817. 130
Please cite this article in press as: Kim D-S, Byun B-K, First discovery of winter-emerging leaf-miner: Phyllonorycter styracis (Kumata, 1963) (Lepidoptera, Gracillariidae) from Korea with DNA barcode, Journal of Asia-Pacific Biodiversity (2016), http://dx.doi.org/10.1016/ j.japb.2016.09.008 JAPB187_proof ■ 9 October 2016 ■ 4/4
4 DS Kim, BK Byun / Journal of Asia-Pacific Biodiversity xxx (2016) 1e4
1 Hirowatari T. 2013. Gracillarioidea. In: Nasu Y, Hirowatari T, Kishida Y, editors. The Lee S, Kim IK, Park YK, et al. 2015. Preliminary survey of indigenous parasites 20 2 standard of moths in Japan, Vol. IV. Tokyo, Japan: Gakken Education Publishing. associated with Phyllocnistis citrella Stainton (Lepidoptera, Gracillariidae) in 21 pp. 86e155. Jeju, Korea. Journal of Asia-Pacific Biodiversity 8:371e374. 3 Hübner J. 1796e1826. Sammlung Europäischer schmetterlinge. Achte Horde. Die Linnaeus C. 1758. Systema naturae. 10th ed. Stockholm, Sweden: Laurentius Salvius 22 4 schaben [Tineae]; nach der Natur geordnet, beschrieben und vorgestellt. Augsburg, [in Swedish]. 23 5 Germany: J. Hübner Verlagievi. 1e81. [in German]. Lord Walsingham (Thomas de Grey). 1914. Lepidoptera Heterocera (continued). 24 Hübner J. 1816e1826. Verzeichniss bekannter schmettlinge [sic]. Augsburg, Germany: Biologia Centrali-Americana, Lepidoptera-Heterocera 4 (1909e1915):225e392. Q12 6 J. Hübner Verlag. p. 431 [in German]. Paek MK, Hwang JM, Jung KS, et al. 2010. Checklist of Korean Peninsula. Seoul, South 25 7 Hübner J. 1822. Systematisch-alphabetisches verzeichnis aller bisher bey den Furbil- Korea: Nature and Ecology. Q13 26 8 dungen zur sammlung Europaischer schmetterlinge angegebenen gattungsbe- Park KT, Bae YS, Byun BK, et al. 2012. National list of species of Korea insect 27 nennungen; mit vormerkung auch augsburgischer gattungen. Augsburg, (Lepidoptera 1). Incheon, South Korea: National Institute of Biological 9 Germany: J. Hübner Verlag [in German]. Resources. 28 10 Kim DS, Choi CW, Lee S, et al. 2015. Taxonomic notes on Phyllocnistis citrella Park KT, Han SS. 1986. Seven species of Gracillariidae and Lyonetiidae (Lepidoptera) 29 11 (Lepidoptera: Gracillariidae) with genital structures and DNA barcode from new to Korea and a list of the known host plants for the families. Korean Journal 30 fi e e 12 Korea. Journal of Asia-Paci c Biodiversity 8:295 297. of Plant Protection 25:121 128. 31 Ko JH. 1969. A list of forest insect pests in Korea. Seoul, South Korea: Forest Research Shin YH, Park KT, Nam SH. 1983. Insecta (IX): Illustrated flora and fauna of Korea, Vol. 13 Institute. 27. Seoul, South Korea: Ministry of Education. 32 14 Kumata T. 1963. Taxonomic studies on the Lithocolletinae of Japan (Lepidoptera: Stainton HT. 1854. Lepidoptera: Tineina. In: Stainton HT, editor. Insecta britannica, 33 e 15 Gracillariidae) Parts I. Insecta Matsumurana 25:53 90. Vol. 3. London, UK: Lovell Reeve. 34 Kumata T, Kuroko H, Park KT. 1983. Some Korean species of the subfamily Lith- The Entomological Society of Korea and Korean Society of Applied Entomology 16 ocolletinae (Gracillariidae, Lepidoptera). Korean Journal of Plant Protection 22: (ESK/KSAE). 1994. Checklist of insects from Korea. Seoul, South Korea: Konkuk 35 17 213e227. University Press. 36 18 37 19 38
Please cite this article in press as: Kim D-S, Byun B-K, First discovery of winter-emerging leaf-miner: Phyllonorycter styracis (Kumata, 1963) (Lepidoptera, Gracillariidae) from Korea with DNA barcode, Journal of Asia-Pacific Biodiversity (2016), http://dx.doi.org/10.1016/ j.japb.2016.09.008