African Journal of Biotechnology Volume 15 Number 42, 19 October 2016 ISSN 1684-5315

ABOUT AJB

The African Journal of Biotechnology (AJB) (ISSN 1684-5315) is published weekly (one volume per year) by Academic Journals.

African Journal of Biotechnology (AJB), a new broad-based journal, is an open access journal that was founded on two key tenets: To publish the most exciting research in all areas of applied biochemistry, industrial microbiology, molecular biology, genomics and proteomics, food and agricultural technologies, and metabolic engineering. Secondly, to provide the most rapid turn-around time possible for reviewing and publishing, and to disseminate the articles freely for teaching and reference purposes. All articles published in AJB are peer-reviewed.

Contact Us

Editorial Office: [email protected]

Help Desk: [email protected]

Website: http://www.academicjournals.org/journal/AJB

Submit manuscript online http://ms.academicjournals.me/

Editor-in-Chief Associate Editors

Prof. Dr. AE Aboulata George Nkem Ude, Ph.D Plant Breeder & Molecular Biologist Plant Path. Res. Inst., ARC, POBox 12619, Giza, Egypt Department of Natural Sciences 30 D, El-Karama St., Alf Maskan, P.O. Box 1567, Crawford Building, Rm 003A Ain Shams, Cairo, Bowie State University Egypt 14000 Jericho Park Road Bowie, MD 20715, USA Dr. S.K Das Department of Applied Chemistry and Biotechnology, University of Fukui, Japan

Editor Prof. Okoh, A. I. Applied and Environmental Microbiology Research Group (AEMREG), N. John Tonukari, Ph.D Department of Biochemistry and Microbiology, Department of Biochemistry University of Fort Hare. Delta State University P/Bag X1314 Alice 5700, PMB 1 South Africa Abraka, Nigeria Dr. Ismail TURKOGLU

Department of Biology Education, Education Faculty, Fırat University,

Elazığ, Turkey

Prof T.K.Raja, PhD FRSC (UK) Department of Biotechnology PSG COLLEGE OF TECHNOLOGY (Autonomous) (Affiliated to Anna University) Coimbatore-641004, Tamilnadu,

INDIA.

Dr. George Edward Mamati

Horticulture Department, Jomo Kenyatta University of Agriculture

and Technology,

P. O. Box 62000-00200,

Nairobi, Kenya.

Dr. Gitonga Kenya Agricultural Research Institute,

National Horticultural Research Center, P.O Box 220, Thika, Kenya.

Editorial Board

Prof. Sagadevan G. Mundree Dr. E. Olatunde Farombi Department of Molecular and Cell Biology Drug Metabolism and Toxicology Unit University of Cape Town Department of Biochemistry Private Bag Rondebosch 7701 University of Ibadan, Ibadan, Nigeria South Africa Dr. Stephen Bakiamoh Dr. Martin Fregene Michigan Biotechnology Institute International Centro Internacional de Agricultura Tropical (CIAT) 3900 Collins Road

Km 17 Cali-Palmira Recta Lansing, MI 48909, USA AA6713, Cali, Colombia Dr. N. A. Amusa Prof. O. A. Ogunseitan Institute of Agricultural Research and Training Laboratory for Molecular Ecology Obafemi Awolowo University Department of Environmental Analysis and Design Moor Plantation, P.M.B 5029, Ibadan, Nigeria University of California, Irvine, CA 92697-7070. USA Dr. Desouky Abd-El-Haleem Environmental Biotechnology Department & Dr. Ibrahima Ndoye Bioprocess Development Department, UCAD, Faculte des Sciences et Techniques Genetic Engineering and Biotechnology Research Departement de Biologie Vegetale Institute (GEBRI), BP 5005, Dakar, Senegal. Mubarak City for Scientific Research and Technology Laboratoire Commun de Microbiologie Applications, IRD/ISRA/UCAD New Burg-Elarab City, Alexandria, Egypt. BP 1386, Dakar Dr. Simeon Oloni Kotchoni Dr. Bamidele A. Iwalokun Department of Plant Molecular Biology Biochemistry Department Institute of Botany, Kirschallee 1, Lagos State University University of Bonn, D-53115 Germany. P.M.B. 1087. Apapa – Lagos, Nigeria Dr. Eriola Betiku Dr. Jacob Hodeba Mignouna German Research Centre for Biotechnology, Associate Professor, Biotechnology Biochemical Engineering Division, Virginia State University Mascheroder Weg 1, D-38124, Agricultural Research Station Box 9061 Braunschweig, Germany Petersburg, VA 23806, USA Dr. Daniel Masiga Dr. Bright Ogheneovo Agindotan International Centre of Insect Physiology and Ecology, Plant, Soil and Entomological Sciences Dept Nairobi, University of Idaho, Moscow Kenya ID 83843, USA Dr. Essam A. Zaki Dr. A.P. Njukeng Genetic Engineering and Biotechnology Research Département de Biologie Végétale Institute, GEBRI, Research Area, Faculté des Sciences B.P. 67 Dschang Borg El Arab, Post Code 21934, Alexandria Université de Dschang Egypt

Rep. du CAMEROUN

Dr. Alfred Dixon Prof. Christine Rey International Institute of Tropical Agriculture (IITA) Dept. of Molecular and Cell Biology, PMB 5320, Ibadan University of the Witwatersand, Oyo State, Nigeria Private Bag 3, WITS 2050, Johannesburg, South Africa

Dr. Sankale Shompole Dept. of Microbiology, Molecular Biology and Biochemisty, Dr. Kamel Ahmed Abd-Elsalam University of Idaho, Moscow, Molecular Markers Lab. (MML) ID 83844, USA. Plant Pathology Research Institute (PPathRI) Agricultural Research Center, 9-Gamma St., Orman, Dr. Mathew M. Abang 12619, Germplasm Program Giza, Egypt International Center for Agricultural Research in the Dry Areas Dr. Jones Lemchi (ICARDA) P.O. Box 5466, Aleppo, SYRIA. International Institute of Tropical Agriculture (IITA) Onne, Nigeria Dr. Solomon Olawale Odemuyiwa Pulmonary Research Group Prof. Greg Blatch Department of Medicine Head of Biochemistry & Senior Wellcome Trust Fellow 550 Heritage Medical Research Centre Department of Biochemistry, Microbiology & University of Alberta Biotechnology Edmonton Rhodes University Canada T6G 2S2 Grahamstown 6140

Prof. Anna-Maria Botha-Oberholster South Africa Plant Molecular Genetics Department of Genetics Dr. Beatrice Kilel Forestry and Agricultural Biotechnology Institute P.O Box 1413 Faculty of Agricultural and Natural Sciences Manassas, VA 20108 University of Pretoria USA ZA-0002 Pretoria, South Africa Dr. Jackie Hughes Dr. O. U. Ezeronye Research-for-Development Department of Biological Science Michael Okpara University of Agriculture International Institute of Tropical Agriculture (IITA) Umudike, Abia State, Nigeria. Ibadan, Nigeria

Dr. Joseph Hounhouigan Dr. Robert L. Brown Maître de Conférence Southern Regional Research Center, Sciences et technologies des aliments U.S. Department of Agriculture, Faculté des Sciences Agronomiques Agricultural Research Service, Université d'Abomey-Calavi New Orleans, LA 70179. 01 BP 526 Cotonou

République du Bénin Dr. Deborah Rayfield

Physiology and Anatomy Bowie State University Department of Natural Sciences Crawford Building, Room 003C Bowie MD 20715,USA

Dr. Marlene Shehata Dr. Yee-Joo TAN University of Ottawa Heart Institute Department of Microbiology Genetics of Cardiovascular Diseases 40 Ruskin Street Yong Loo Lin School of Medicine, K1Y-4W7, Ottawa, ON, CANADA National University Health System (NUHS), National University of Singapore Dr. Hany Sayed Hafez MD4, 5 Science Drive 2, The American University in Cairo, Singapore 117597 Egypt Singapore

Dr. Clement O. Adebooye Prof. Hidetaka Hori Department of Plant Science Laboratories of Food and Life Science, Obafemi Awolowo University, Ile-Ife Nigeria Graduate School of Science and Technology, Niigata University. Dr. Ali Demir Sezer Niigata 950-2181, Marmara Üniversitesi Eczacilik Fakültesi, Japan Tibbiye cad. No: 49, 34668, Haydarpasa, Istanbul, Turkey Prof. Thomas R. DeGregori University of Houston, Dr. Ali Gazanchain Texas 77204 5019, P.O. Box: 91735-1148, Mashhad, USA Iran.

Dr. Anant B. Patel Dr. Wolfgang Ernst Bernhard Jelkmann Centre for Cellular and Molecular Biology Medical Faculty, University of Lübeck, Uppal Road, Hyderabad 500007 Germany India Dr. Moktar Hamdi Prof. Arne Elofsson Department of Biochemical Engineering, Department of Biophysics and Biochemistry Laboratory of Ecology and Microbial Technology Bioinformatics at Stockholm University, National Institute of Applied Sciences and Technology. Sweden BP: 676. 1080,

Tunisia Prof. Bahram Goliaei

Departments of Biophysics and Bioinformatics Laboratory of Biophysics and Molecular Biology Dr. Salvador Ventura University of Tehran, Institute of Biochemistry and Department de Bioquímica i Biologia Molecular Biophysics Institut de Biotecnologia i de Biomedicina Iran Universitat Autònoma de Barcelona Bellaterra-08193 Dr. Nora Babudri Spain Dipartimento di Biologia cellulare e ambientale Università di Perugia Dr. Claudio A. Hetz Via Pascoli Faculty of Medicine, University of Chile Italy Independencia 1027

Santiago, Chile Dr. S. Adesola Ajayi Seed Science Laboratory Department of Plant Science Prof. Felix Dapare Dakora Faculty of Agriculture Research Development and Technology Promotion Obafemi Awolowo University Cape Peninsula University of Technology, Ile-Ife 220005, Nigeria Room 2.8 Admin. Bldg. Keizersgracht, P.O. 652, Cape Town 8000, South Africa

Dr. Geremew Bultosa Dr. Luísa Maria de Sousa Mesquita Pereira Department of Food Science and Post harvest IPATIMUP R. Dr. Roberto Frias, s/n 4200-465 Porto Technology Portugal Haramaya University Personal Box 22, Haramaya University Campus Dr. Min Lin Dire Dawa, Animal Diseases Research Institute Ethiopia Canadian Food Inspection Agency Ottawa, Ontario, Dr. José Eduardo Garcia Canada K2H 8P9 Londrina State University Brazil Prof. Nobuyoshi Shimizu Department of Molecular Biology, Prof. Nirbhay Kumar Center for Genomic Medicine Malaria Research Institute Keio University School of Medicine, Department of Molecular Microbiology and 35 Shinanomachi, Shinjuku-ku Immunology Tokyo 160-8582, Johns Hopkins Bloomberg School of Public Health Japan E5144, 615 N. Wolfe Street Baltimore, MD 21205 Dr. Adewunmi Babatunde Idowu

Department of Biological Sciences Prof. M. A. Awal University of Agriculture Abia Department of Anatomy and Histplogy, Abia State, Bangladesh Agricultural University, Nigeria Mymensingh-2202,

Bangladesh Dr. Yifan Dai Associate Director of Research Prof. Christian Zwieb Revivicor Inc. Department of Molecular Biology 100 Technology Drive, Suite 414 University of Texas Health Science Center at Tyler Pittsburgh, PA 15219 11937 US Highway 271 USA Tyler, Texas 75708-3154 USA Dr. Zhongming Zhao Department of Psychiatry, PO Box 980126, Prof. Danilo López-Hernández Virginia Commonwealth University School of Medicine, Instituto de Zoología Tropical, Facultad de Ciencias, Richmond, VA 23298-0126, Universidad Central de Venezuela. USA Institute of Research for the Development (IRD), Montpellier, Prof. Giuseppe Novelli France Human Genetics, Department of Biopathology, Prof. Donald Arthur Cowan Tor Vergata University, Rome, Department of Biotechnology, Italy University of the Western Cape Bellville 7535 Cape Town, South Africa Dr. Moji Mohammadi 402-28 Upper Canada Drive Dr. Ekhaise Osaro Frederick Toronto, ON, M2P 1R9 (416) 512-7795 University Of Benin, Faculty of Life Science Canada Department of Microbiology P. M. B. 1154, Benin City, Edo State, Nigeria.

Dr. Azizul Baten Prof. Jean-Marc Sabatier Department of Statistics Directeur de Recherche Laboratoire ERT-62 Shah Jalal University of Science and Technology Ingénierie des Peptides à Visée Thérapeutique, Sylhet-3114, Université de la Méditerranée-Ambrilia Biopharma Bangladesh inc., Faculté de Médecine Nord, Bd Pierre Dramard, 13916, Dr. Bayden R. Wood Marseille cédex 20. Australian Synchrotron Program France Research Fellow and Monash Synchrotron Research Fellow Centre for Biospectroscopy Dr. Fabian Hoti School of Chemistry Monash University Wellington Rd. PneumoCarr Project Clayton, Department of Vaccines 3800 Victoria, National Public Health Institute Australia Finland Dr. G. Reza Balali Prof. Irina-Draga Caruntu Molecular Mycology and Plant Pthology Department of Histology Department of Biology Gr. T. Popa University of Medicine and Pharmacy University of Isfahan 16, Universitatii Street, Iasi, Isfahan Romania Iran

Dr. Dieudonné Nwaga Dr. Beatrice Kilel Soil Microbiology Laboratory, P.O Box 1413 Biotechnology Center. PO Box 812, Manassas, VA 20108 Plant Biology Department, USA

University of Yaoundé I, Yaoundé, Prof. H. Sunny Sun Cameroon Institute of Molecular Medicine

National Cheng Kung University Medical College Dr. Gerardo Armando Aguado-Santacruz 1 University road Tainan 70101, Biotechnology CINVESTAV-Unidad Irapuato Taiwan Departamento Biotecnología

Km 9.6 Libramiento norte Carretera Irapuato-León Prof. Ima Nirwana Soelaiman Irapuato, Department of Pharmacology Guanajuato 36500 Faculty of Medicine Mexico Universiti Kebangsaan Malaysia Jalan Raja Muda Abdul Aziz Dr. Abdolkaim H. Chehregani 50300 Kuala Lumpur, Department of Biology Malaysia Faculty of Science Bu-Ali Sina University Prof. Tunde Ogunsanwo Hamedan, Faculty of Science, Iran Olabisi Onabanjo University, Ago-Iwoye. Dr. Abir Adel Saad Nigeria Molecular oncology Dr. Evans C. Egwim Department of Biotechnology Institute of graduate Studies and Research Federal Polytechnic, Alexandria University, Bida Science Laboratory Technology Department, Egypt PMB 55, Bida, Niger State, Nigeria

Prof. George N. Goulielmos Dr. Aritua Valentine Medical School, National Agricultural Biotechnology Center, Kawanda University of Crete Agricultural Research Institute (KARI) Voutes, 715 00 Heraklion, Crete, P.O. Box, 7065, Kampala, Greece Uganda

Dr. Uttam Krishna Prof. Yee-Joo Tan Cadila Pharmaceuticals limited , Institute of Molecular and Cell Biology 61 Biopolis Drive, India 1389, Tarsad Road, Proteos, Singapore 138673 Dholka, Dist: Ahmedabad, Gujarat, Singapore India

Prof. Mohamed Attia El-Tayeb Ibrahim Prof. Viroj Wiwanitkit Department of Laboratory Medicine, Botany Department, Faculty of Science at Qena, South Valley University, Qena 83523, Faculty of Medicine, Chulalongkorn University, Egypt Bangkok Thailand Dr. Nelson K. Ojijo Olang’o Department of Food Science & Technology, Dr. Thomas Silou JKUAT P. O. Box 62000, 00200, Nairobi, Universit of Brazzaville BP 389 Kenya Congo

Dr. Pablo Marco Veras Peixoto Prof. Burtram Clinton Fielding University of New York NYU College of Dentistry University of the Western Cape 345 E. 24th Street, New York, NY 10010 Western Cape, USA South Africa

Prof. T E Cloete Dr. Brnčić (Brncic) Mladen University of Pretoria Department of Microbiology and Faculty of Food Technology and Biotechnology, Plant Pathology, Pierottijeva 6, University of Pretoria, 10000 Zagreb, Pretoria, Croatia. South Africa Dr. Meltem Sesli Prof. Djamel Saidi College of Tobacco Expertise, Laboratoire de Physiologie de la Nutrition et de Turkish Republic, Celal Bayar University 45210, Sécurité Akhisar, Manisa, Alimentaire Département de Biologie, Turkey. Faculté des Sciences, Université d’Oran, 31000 - Algérie Dr. Idress Hamad Attitalla Algeria Omar El-Mukhtar University,

Dr. Tomohide Uno Faculty of Science, Department of Biofunctional chemistry, Botany Department, El-Beida, Libya. Faculty of Agriculture Nada-ku, Kobe., Hyogo, 657-8501, Dr. Linga R. Gutha Japan Washington State University at Prosser, Dr. Ulises Urzúa 24106 N Bunn Road, Faculty of Medicine, Prosser WA 99350-8694 University of Chile Independencia 1027, Santiago, Chile

Dr Helal Ragab Moussa Dr Takuji Ohyama Bahnay, Al-bagour, Menoufia, Faculty of Agriculture, Niigata University Egypt. Dr Mehdi Vasfi Marandi Dr VIPUL GOHEL University of Tehran DuPont Industrial Biosciences Danisco (India) Pvt Ltd Dr FÜgen DURLU-ÖZKAYA 5th Floor, Block 4B, Gazi Üniversity, Tourism Faculty, Dept. of Gastronomy DLF Corporate Park and Culinary Art DLF Phase III

Gurgaon 122 002 Dr. Reza Yari Haryana (INDIA) Islamic Azad University, Boroujerd Branch

Dr. Sang-Han Lee Dr Zahra Tahmasebi Fard Department of Food Science & Biotechnology, Roudehen branche, Islamic Azad University Kyungpook National University Daegu 702-701, Dr Albert Magrí Korea. Giro Technological Centre

Dr. Bhaskar Dutta Dr Ping ZHENG DoD Biotechnology High Performance Computing Zhejiang University, Hangzhou, China Software Applications Institute (BHSAI) Dr. Kgomotso P. Sibeko U.S. Army Medical Research and Materiel Command University of Pretoria 2405 Whittier Drive Frederick, MD 21702 Dr Greg Spear Rush University Medical Center Dr. Muhammad Akram Faculty of Eastern Medicine and Surgery, Prof. Pilar Morata Hamdard Al-Majeed College of Eastern Medicine, University of Malaga Hamdard University,

Karachi. Dr Jian Wu Harbin medical university , China Dr. M. Muruganandam Departtment of Biotechnology Dr Hsiu-Chi Cheng St. Michael College of Engineering & Technology, National Cheng Kung University and Hospital. Kalayarkoil, India. Prof. Pavel Kalac University of South Bohemia, Czech Republic Dr. Gökhan Aydin Suleyman Demirel University, Dr Kürsat Korkmaz Atabey Vocational School, Ordu University, Faculty of Agriculture, Department of Isparta-Türkiye, Soil Science and Plant Nutrition

Dr. Rajib Roychowdhury Dr. Shuyang Yu Centre for Biotechnology (CBT), Department of Microbiology, University of Iowa Visva Bharati, Address: 51 newton road, 3-730B BSB bldg. Iowa City, West-Bengal, IA, 52246, USA India.

Dr. Mousavi Khaneghah College of Applied Science and Technology-Applied Food Science, Tehran, Iran.

Dr. Qing Zhou Department of Biochemistry and Molecular Biology, Oregon Health and Sciences University Portland.

Dr Legesse Adane Bahiru Department of Chemistry, Jimma University, Ethiopia.

Dr James John School Of Life Sciences, Pondicherry University, Kalapet, Pondicherry

African Journal of Biotechnology

Table of Content: Volume 15 Number 42 19 October, 2016

ARTICLES

Alternative tube caps on in vitro growth of Orbignya oleifera Burret.: An Arecaceae native cerrado domain 2368 Mariluza Silva LEITE, Paula Sperotto Alberto FARIA, Flávia Dionísio PEREIRA, Fabiano Guimarães SILVA, Aurélio Rúbio NETO and João das Graças SANTANA

On-line methanol sensor system development for recombinant human serum albumin production by Pichia pastoris 2374 Panchiga Chongchittapiban, Jӧrgen Borg, Yaowapha Waiprib, Jindarat Pimsamarn and Anan Tongta

Cloning and expression analysis of alcohol dehydrogenase (Adh) hybrid promoter isolated from Zea mays 2384 Ammara Masood, Nadia Iqbal, Hira Mubeen, Rubab Zahra Naqvi, Asia Khatoon and Aftab Bashir

Production and characterization of endoglucanase secreted by Streptomyces capoamus isolated from Caatinga 2394

Rafael Lopes e Oliveira, Camila Beatriz Atanásio Borba, Sergio Duvoisin Junior, Patricia Melchionna Albuquerque, Gláucia Manoella de Souza Lima, Norma Buarque de Gusmão, Edmar Vaz de Andrade and Leonor Alves de Oliveira da Silva

Vol. 15(42), pp. 2368-2373, 19 October, 2016 DOI: 10.5897/AJB2016.15604 Article Number: 279B32A61165 ISSN 1684-5315 African Journal of Biotechnology Copyright © 2016 Author(s) retain the copyright of this article http://www.academicjournals.org/AJB

Full Length Research Paper

Alternative tube caps on in vitro growth of Orbignya oleifera Burret.: An Arecaceae native cerrado domain

Mariluza Silva LEITE, Paula Sperotto Alberto FARIA, Flávia Dionísio PEREIRA, Fabiano Guimarães SILVA*, Aurélio Rúbio NETO and João das Graças SANTANA

Instituto Federal de Educação, Ciência e Tecnologia Goiano, Campus Rio Verde. Rod. Sul Goiana Km 01, Cx. P. 66. CEP 75.901-970, Rio Verde – Goiás, Brazil.

Received 7 August, 2016; Accepted 12 October, 2016

The babassu (Orbignya oleifera Burret) is a palm that contains oilseeds whose biomass can be used for biofuel production. Due to difficulties in germinating the species, in vitro cultivation techniques are sought as a viable alternative to expand studies on germination. The objective of this study was to evaluate different types of tube caps for in vitro growth of babassu seedlings. Thus, zygotic embryos were inoculated in tubes containing MS medium with a 50% salt concentration, which were sealed with diferent caps, a cotton plug, plastic cap, PVC film and plastic cap with PVC film. During the in vitro culture, the mean length of seedlings, the formation of the cotyledon petiole and root, as well as oxidation of the explants were evaluated. The cotton plug exhibited a positive effect on the initial steps of in vitro cultivation, which promoted more vigorous plants with greater mean lengths; however, its effect decreased as the cultivation time increased. The cotton plug is an alternative and eight-fold less expensive than a conventional plug, which favors early in vitro growth of O. oleifera Burret.

Key words: Babassu, Goiás Cerrado, tissue culture.

INTRODUCTION

Orbignya oleifera Burret (synonym Attalea vitrivir Zona) Maranhão, Piauí, Tocantins, Goiás, Amazonas, Pará and belongs to the family Arecaceae known as "babassu" and Mato Grosso (Lima et al., 2006). Babassu exhibits great is distributed in forests or in open areas (Santos et al., potential for exploitation because the plant can be used in 2015). This palm is native from central-western, northern gardening and landscaping, and the fruit mesocarp and northeastern Brazil. Clusters of individuals from this produces high-quality charcoal that is used as an energy species are referred to as masses and are located in source in steel mills (Teixeira, 2008). Babassu seeds transition areas between the Amazon basin rainforests, may be consumed fresh; processed during cosmetic and the cerrado (Brazilian savanna) and the semi-arid region lubricant production to obtain an oil that is rich in lauric of northeastern Brazil, which cover approximately 18.5 acid and that is used for human consumption; or used for million hectares and are distributed in the states biodiesel (Lima et al., 2007; Martins et al., 2009; Souza et

*Corresponding author. E-mail: [email protected].

Author(s) agree that this article remains permanently open access under the terms of the Creative Commons Attribution License 4.0 International License Leite et al. 2369

Figure 1. Morphological characteristics of babassu (Orbignya oleifera Burret). (A) The mother plant; (B) transversal and longitudinal sections of the fruit; (C) seeds; and (D) zygotic embryos. Scale: 2 cm.

al., 2011). objective of this study was to evaluate the effect of Germination of most Arecaceae family species is slow different types of caps on in vitro growth of babassu and irregular and typically involves low multiplication seedlings. rates; propagation is sexual (Rubio Neto et al., 2015). However, current technological advances involving in vitro techniques has optimized healthy and well- MATERIALS AND METHODS developed seedling production (Silva et al., 2012; Pereira et al., 2006; Tzec-Sima et al., 2006). The Acquisition of plant material microenvironment inside culture tubes is directly related The experiment was conducted at the Laboratory of Culture and to the type of cap used, affecting aeration and the Plant Tissues, Goiano Federal Institute, Rio Verde Campus, Goiás incidence of light for in vitro cultivation, which, in turn, (GO), Brazil. The species studied was classified by Dra. Sousa from may be related to variable culture behavior (Corrêa et al., the Federal University of Acre, Floresta Campus, Cruzeiro do Sul, 2015; Santana et al., 2008; Souza et al., 2007). Caps that Acre, Brazil. A voucher specimen was deposited at the Jataiense Herbarium of the Federal University of Goiás, Jataí Campus, under are not hermetically sealed allow greater gas exchange collection number 5641. between the atmospheric air and internal tube The fruits were collected after abscission from a population of environment, which promotes better leaf transpiration and plants located at the Santa Barbara farm in the municipality of prevents ethylene accumulation (Corrêa et al., 2015; Piranhas – GO, Brazil, at coordinates 16º 22’015” S and 51º Nepomuceno et al., 2009; Emam and Esfahan, 2014). 55’715” W and an elevation of 389 m. The climate, according to Certain alternatives, such as using cotton plugs or Koppen (1948) classification was Cfa and the soil classified as Oxisoil. Subsequently, the fruits were broken in a hydraulic press to filters with micropores to plug the tubes, may facilitate crack the endocarp. The kernels were thereafter removed from gas exchange, which favors seedling growth and inside the fruit, and the zygotic embryos removed using a scalpel development in vitro without microorganism (Figure 1). contamination (Fernandes et al., 2013). New alternatives for improving plant growth and reducing costs are desirable for optimizing large-scale commercial Sterilization production. Based on this information and a lack of The embryos were wrapped in gauze and immersed in 70% ethanol reports on in vitro O. oleifera (Burret) cultivation, the for 1 min followed by immersion in a 20% sodium hypochlorite 2370 Afr. J. Biotechnol.

solution (NaOCl; commercial bleach - 2.5% active chlorine) for 20 which opens in a slit. The roots emitted from the lower min and rinsed three times with sterile water in a laminar flow region of the cotyledon petiole at 120 days of cultivation chamber. (Figure 2A, B, C and D). The explants did not exhibit

oxidation regardless of the cap used. In vitro establishment Interaction between time and types of seals were first observed; thereafter, data were discussed together, in The embryos were cultured in test tubes (25 x 150 mm) containing which linear behavior was noted in function of time 20 mL of MS medium (Murashige and Skoog, 1962) with 50% salt evaluation seals utilized. At 120 days of in vitro culture, and 30 g L-1 sucrose and supplemented with 3.5 g L-1 agar (Dinâmica®- Brazil); the pH was adjusted to 5.7 ± 0.03. seedlings were obtained with a maximum length of 5.33 Subsequently, the medium was autoclaved at 121ºC and 1.05 kg cm in the sealed culture condition with cotton cap, cm-2 for 20 min. Test tubes containing the embryos were capped followed by PVC with length of 4.99 cm. For sealing cap using one of four means: cotton plug, plastic cap (polypropylene), and cap with PVC, less length -an average of 3.91 and PVC film and plastic cap wrapped with PVC film. The tubes were 4.32 cm, respectively was observed (Figure 3). maintained in a growth room for 120 days at 25 ± 3ºC and 45% The cotton plug exhibited a positive effect on the early relative humidity, every 30 days; the embryos were transferred to a new culture medium identical to the first, and were maintained stages of in vitro cultivation, promoting more vigorous under a 16-h photoperiod and 11.86 W m2 which was generated plants. Tubes sealed with plastic caps wrapped with PVC using white fluorescent bulbs. film exhibited a lower percentage of root formation (17.0%) (Table 1). The positive effects on the initial growth of embryos Water loss from the culture medium and seedling shoots in tubes sealed with a cotton plug

The test tubes with the different caps were characterized based on may be explained by the greater water vapor loss rate water loss by daily weighing on an analytical balance (AND-HR- (WVRL) and aeration that this cap promoted for the 200, d=0.1 mg- made in Japan) for 32 days. Also, every 30 days it plants (Figure 4). This type of cap facilitates greater gas was exchanged for a new culture medium identical to the first. exchange between the atmospheric air and inner tube environment, which allows better leaf transpiration and

Evaluation and experimental design prevents the accumulation of harmful gases, such as ethylene (Corrêa et al., 2015; Iarema et al., 2012). Counts were performed every day up to 30 days of culture to The initial amount of water in the culture medium, assess the percent germination and vigor using a germination regardless of the cap, was approximately 17.5 g. The speed index, which was calculated, based on the formula proposed type of cap exerted a significant effect (p < 0.05) from the by Maguire (1962); and at 120 days, root formation (RF), formation 7th day of cultivation, when the samples exhibited greater of the cotyledon petiole and oxidation of the zygotic embryos was evaluated. The seedlings were considered normal when they water loss in tubes sealed with the cotton plug. exhibited shoots and root systems. At 30, 60, 90 and 120 days of Comparing the initial and final quantities of water in the cultivation, the mean seedling length was assessed, for this medium at 32 days of cultivation, the tubes sealed with variable was considered the design in a split plot. cotton plugs exhibited 22% water loss, and the tubes The experimental design was completely randomized (CRD) and sealed with the conventional cap exhibited 2% water loss. consisted of four treatments (cotton plug, plastic cap, PVC film and Although the cotton plug allowed greater evaporation and plastic cap wrapped with PVC film) with 30 replicates; each replicate consisted of one test tube, totaling 120 experimental units. reduced the initial volume of the culture medium by 22%, The numerical data were subjected to Analysis of Variance these phenomena were not detrimental to seedling (ANOVA) and Tukey’s test for qualitative factors and regression growth, most likely because the culture medium was analysis for the quantitative factors with 5% probability. The changed every 30 days. program SISVAR was used to analyze the data (Ferreira, 2011). Polypropylene plastic caps are the most widely used

caps in laboratories for tissue cultivation due to their RESULTS AND DISCUSSION resistance to high temperatures; such caps can be autoclaved without deformation. However, other cap Contamination was not observed in any treatment. The types, such as cotton plugs and PVC film, are used due different types of seals did not affect the quality of to the high cost of these caps. Using cotton as a plug has seedlings in vitro. For all caps, embryo germination and advantages, including preventing explant drying, initial seedling growth were observed, which suggests contamination control, permitting gas exchange with the that in vitro multiplication of babassu via zygotic embryos external environment and reducing the cost in the final was viable. Embryo germination was demonstrated by production of seedlings (Assis et al., 2012; Pinheiro et al., cotyledon petioles lengthening, which results in seedling 2013). Growth of the seedlings cultured in vitro using the shoot and root formation characteristic of remote cotton plug, as observed in this study, has been germination. described in several studies as a promising practice for The cotyledon petiole formed between 30 and 60 days stimulating improved photoautotrophic micropropagation of cultivation, and the shoot was emitted beginning at 90 (Fernandes et al., 2013; Nepomuceno et al., 2009; days of cultivation originating from the cotyledon petiole, Saldanha et al., 2012; Santana et al., 2011). Leite et al. 2371

Figure 2. In vitro Orbignya oleifera (Burret) cultivation at 120 days in 50% MS medium with different cap types. (A) T1: cotton plug; (B) T2: plastic cap; (C) T3: PVC film; and (D) T4: plastic cap wrapped with PVC film. SH: shoot; CP: cotyledon petiole; and RT: root. Scale bar: 1 cm.

7

6

5

4

3

MSL (cm)

2 Cotton plug Y= 1.458 + 0.0323X; r2= 0.99** Plastic cap Y= 1.641 + 0.020X; r2= 0.89** 1 PVC film Y= 1.275 + 0.031X; r2= 0.97** Plastic cap with PVC Y= 1.563 + 0.024X; r2= 0.94** 0 30 60 90 120

Days

Figure 3. Mean seedling length (MSL) evaluated at 30, 60, 90 and 120 days of cultivation in babassu (Orbignya oleifera Burret) zygotic embryos, cultured in vitro with different types of caps cotton plug, plastic cap, PVC film and plastic,cap with PVC film. **Significant at p <0.01. 2372 Afr. J. Biotechnol.

Table 1. Germination speed index (GSI) at 30 and 120 days, root formation (RF), of cultivation in babassu (Orbignya oleifera Burret) zygotic embryos, cultured in vitro with different types of caps.

Type of cap GSI RF 120 days (%) Cotton plug 0.18± 0.10az 77.0± 0.36a Plastic cap 0.12± 0.03b 60.0± 0.48ab PVC film 0.12± 0.03b 43.0± 0.49bc Plastic cap with PVC film 0.13± 0.04ab 17.0± 0.28c

ZMeans followed by the same letter do not differ significantly according to Tukey’s test at a 5% probability. ± Standard error of the mean.

Figure 4. Water vapor loss rate (WVLR) from the culture medium with babassu seedlings (Orbignya oleifera Burret.) in tubes with different cap types: plastic cap with PVC film, plastic cap, PVC film, and cotton plug, which were evaluated after 32 days. *Significant at p <0.05.

Similar results were obtained using Anadenanthera observed in seedlings cultured in tubes sealed with colubrina (Vell.) Brenan var. cebil (Griseb) Altschul plastic caps without PVC film and in tubes sealed with seedlings cultured in test tubes sealed with cotton plugs; cotton plugs (Santana et al., 2008). greater shoot lengths were produced compared with Among the caps tested, using the cotton plug produced seedlings cultured in test tubes sealed with PVC film greater initial in vitro babassu growth compared with the (Nepomuceno et al., 2009). Using the cotton plug also plastic cap; moreover, the cotton plug can be easily produced a positive effect in Annona glabra L. cultivation constructed. Using the cotton plug promoted greater gas (Santana et al., 2011), where more expanded leaves, exchange and reduced the medium weight, which greater lengths and greater shoot dry matter weights indicates less relative humidity inside the tube. Thus, it is were observed. a potential alternative for commercial in vitro propagation The root biomass of seedlings grown in tubes sealed systems based on photoautotrophic growth patterns. with plastic caps wrapped with PVC most likely decreased due to less gas exchange (Figure 3) because condensation was observed on the inner walls of these Conclusion tubes. The same phenomenon was observed with A. glabra L., in which the highest rooting percentages were The type of sealing of the test tubes influence the in vitro Leite et al. 2373

growth of seedlings babassu (Orbignya oleifera Burret) Lima JRDO, Silva RBD, Silva CCMD, Santos LSSD, Santos Jr JRD, by identifying cotton plug as the best alternative, being Moura EM, Moura CVRD (2007). Biodiesel from babassu (Orbignya sp.) synthesized via ethanolic route. Quím. Nova 30(3):600-603. production with low cost and manpower. Maguire JD (1962). Speed of germination-aid in selection and evoluation for seedling emergence and vigor. Crop Sci. 2(2):176-177. Martins CC, Bovi MLA, Nakagawa J, Machado CG (2009). Drying and Conflict of Interests storage of jussara seeds. Rev. Árvore 33(4):635-642. Murashige T, Skoog F (1962). A revised medium for rapid growth and bioassays with tabacco tissue culture. Physiol. Plant. 15(3):473-497. The authors have not declared any conflict of interests. Nepomuceno CF, Rios APS, Queiroz SRO, Pelacani CR, Santana JRF (2009). In vitro morphophysiological answers of the seedlings of Anadenanthera colubrina (Vell.) Brenan var. cebil (Griseb) Altschul. Rev. Árvore 33(3):481-490. ACKNOWLEDGEMENTS Pereira JES, Marciel TMS, Costa FHS, Pereira MAAP (2006). In vitro germination of zygotic embryos of murmuru (Astrocaryum ulei). The authors thank the Coordination for the Improvement Ciênc. Agrotec. 30(2): 251-256. of Higher Education Personnel – CAPES) and the Pinheiro MVM, Martins FB, Xavier A, Otoni WC (2013). Gas exchange affects in vitro morphogenesis of two olive cultivars (Olea europaea National Council for Scientific and Technological L.). Rev. Árvore, 37(1): 19-29. Development – CNPq) for the financial support granted to Rubio Neto A, Silva FG, Sales JF, Pires LL, Freitas BSM, Souza AL this study; the Goiano Federal Institute - Rio Verde (2015). Effect sof drying temperature on viability of macaw palm Campus, and Dra. Maria Cristina de Sousa for classifying (Acrocomia aculeata) zygotic embryos. Afr. J. Biotechnology, 14(4): 319-326. the species under study. Saldanha CW, Otoni CG, de Azevedo JLF, Dias LLC, do Rêgo MM, Otoni WC (2012). A low-cost alternative membrane system that promotes growth in nodal cultures of Brazilian ginseng [Pfaffia Abbreviations glomerata (Spreng.) Pedersen]. Plant Cell, Tissue and Organ Culture, 110(3), 413-422. Santana JRF, Paiva R, Pereira FD, Oliveira LM (2008). Stimulus of the ANOVA, Analysis of variance; CRD, complete photoautotrophic behavior during the in vitro rooting of Annona glabra randomized design, MS, Murashige e Skoog; PVC, L., I. Development of root system and shoot. Ciênc. Agrotec. polyvinylchloride; WVRL, water vapor loss rate. 32(1):80-86. Santana JRFD, Paiva R, Souza AVD, Oliveira LMD (2011). Effect of different culture tube caps and concentrations of activated charcoal and sucrose on in vitro growth and budding induction of Annona REFERENCES glabra L. Ciênc. Agrotec. 35(5):916-923. Santos RRM, Cavallari MM, Pimenta MAS, Abreu AG, Costa MR, Assis KCD, Pereira F, Cabral JSR, Silva FG, Silva JW, Santos SCD Guedes ML (2015). Population genetic structure of Attalea vitrivir (2012). In vitro cultivation of Anacardium othonianum Rizz.: effects of Zona (Arecaceae) in fragmented areas of southeast Brazil. Genet. salt concentration and culture medium volume. Acta Sci. Mol. Res. 14(2):6472-6481. Agron. 34(1):77-83. Silva MR, Carvalho Júnior OA, Souza ÉM, Mitja D, Chaib Filho H Corrêa JPO¸Vital CE, Pinheiro MVM, Batista DS, Azevedo JFL, (2012). Mulivariate factor analysis applied to the characterization of Saldanha CW, Cruz ACF, Matta FM, Otoni WC (2015). In vitro Babassu (Attalea Speciosa Mart. ex Spreng) occurrence area in photoautotrophic potential and ex vitro photosynthetic competence of Cocal river basin. Soc. Nat. 24(2):267-281. Pfaffia glomerata (Spreng.) Pedersen accessions. Plant Cell Tissue Souza JA, Silva LC, Corrêa MGS, Schuch MW (2007). In vitro rooting of Organ Cult. 121(2):289-300. the apple tree rootstock - m9 related to seal, sucrose and support Emam M, Esfahan EZ (2014). Effect of chemical (enriched-CO2 and material in the culture medium. Sci. Agraria 8(2):161- 164. sucrose-free medium) and physical factors (light period and Souza MH, Monteiro CA, Figueredo PM, Nascimento FRF, Guerra RN temperature) on rooting and hardening of Sorbus aucuparia L. (2011). Ethnopharmacological use of babassu (Orbignya phalerata plantlets. Int. J. Biosci. 4(5):176-181. Mart) in communities of babassu nut breakers in Maranhão, Brazil. J. Fernandes DÁ, Azevedo PH, Costa RB, Brondani GE (2013). Types of Ethnopharmacol. 133(1):1-5. packing and concentration of sucrose in culture in vitro of Tectona Teixeira MA (2008). Babassu-a new approach for an ancient Brazilian grandis L.f. Rev. Agric. 88(3):218-228. biomass. Biomass Bioenergy 32(9):857-864. Ferreira DF (2011) SISVAR: A Computer Statistical Analysis System. Tzec-Sima MA, Orellana R, Robert ML (2006). In vitro rescue of Ciênc. Agrotec. 35(6):1039-1042. isolated embryos of bactris major jacq. and desmoncus orthacanthos Iarema L, Cruz ACF, Saldanha CW, Dias LLC, Vieira RF, Oliveira EJ, mart., potentially useful native palms from the Yucatan Peninsula Otoni WC (2012). Photoautotrophic propagation of Brazilian ginseng (Mexico). In vitro Cell. Dev. Biol. Plant 42(1):54-58. [Pfaffiaglomerata (Spreng.) Pedersen]. Plant Cell Tissue Organ Cult. 110(2):227-238. Koppen W (1948). Climatologia. Con um estudio de los climas de la tierra México. Ed. Fondo de Cultura Economica, 478 p. Lima AM, Vidaurre GB, Lima RM, Brito EO (2006). Use of babaçu staple fiber as alternative raw material for panel production. Rev. Árvore 30(4):645-650.

Vol. 15(42), pp. 2374-2383, 19 October, 2016 DOI: 10.5897/AJB2015.15122 Article Number: 9F7C65461169 ISSN 1684-5315 African Journal of Biotechnology Copyright © 2016 Author(s) retain the copyright of this article http://www.academicjournals.org/AJB

Full Length Research Paper

On-line methanol sensor system development for recombinant human serum albumin production by Pichia pastoris

Panchiga Chongchittapiban1, Jӧrgen Borg2, Yaowapha Waiprib3, Jindarat Pimsamarn1 and Anan Tongta4*

1Department of Chemical Engineering, Faculty of Engineering, King Mongkut's University of Technology Thonburi (KMUTT), 126 Pracha-utid Road, Bangmod, Toongkru, Bangkok 10140, Thailand. 2Pilot Plant Development and Training Institute (PDTI), 49 Soi Tientalay 25, Bangkhuntien-Chaithalay Road, Thakham, Bangkhuntien, Bangkok 10150, Thailand. 3Department of Fishery Products, Faculty of Fisheries, Kasetsart University (KU), 50 Ngam Wong Wan Road, Ladyaow, Chatuchak, Bangkok 10900, Thailand. 4Division of Biotechnology, School of Bioresources and Technology, King Mongkut’s University of Technology Thonburi (KMUTT), 49 Soi Tientalay 25, Bangkhuntien-Chaithalay Road, Thakham, Bangkhuntien, Bangkok 10150, Thailand.

Received 23 November 2015; Accepted 30 June, 2016

An on-line methanol sensor system was developed using a methanol probe, methanol sensor unit and peristaltic pump. The system was commanded using data acquisition (DAQ) and LabVIEW software. Calibration of the methanol sensor system was done in a medium environment with yeast cells during cells adaptation to methanol metabolism after glycerol feeding was stopped. The correlation equations between voltage output signal from the methanol sensor unit and residual methanol in culture broth were created with third order polynomial regression. This developed system was implemented for on- line methanol control in recombinant human serum albumin (rHSA) protein production by P. pastoris KM71 at methanol levels of 4 and 10 g/l with controlled fluctuations at 13.0 and 11.3% of oscillation, respectively. The accumulated amounts of recombinant protein from two levels of methanol concentration controls (4 and 10 g/l) were similar but the proteins were produced at a different rate related with methanol concentration in the broth. Therefore, the control at 10 g/l methanol had a higher production rate (0.53 mg-protein/g dry-cellh) than 4 g/l methanol control (0.38 mg-protein/g dry-cellh) as it reached the maximum protein concentration in a shorter time, even though its cell yield was less than that of 4 g/l methanol control. At the end of the experiments, the high cell density environment caused both cell and protein reduction by cell autolysis and protease degradation. However, the protein decrease could be prevented by taking protein induction at a low temperature and a pH where protease does not function.

Key words: Methanol monitoring, methanol sensor, on-line methanol, Pichia pastoris, recombinant human serum albumin.

INTRODUCTION

Human serum albumin (HSA) produced in the liver is a molecular weight of 66.5 kDa, HSA comprises about one- major protein component of human blood plasma. With a half of the blood serum protein (approximately 40 g/l) Chongchittapiban et al. 2375

(Huang et al., 2005; Kaoru, 2006; Belew et al., 2008). three-stage fermentation process (Çelik and Çalik, 2012; HSA functions as a carrier protein for steroids, fatty acids Potvin et al., 2012; Looser et al., 2015). The first stage is and thyroid hormones and plays a role in stabilizing batch fermentation where P. pastoris is cultured on extracellular fluid volume in blood (Huang et al., 2005; glycerol. Fed batch culture, the second stage, starts Belew et al., 2008). It was used clinically as a therapeutic when glycerol in the initial step is depleted, glycerol is fed agent in hypoalbuminemia or traumatic shock (Kobayashi into the culture in order to prolong the growth and et al., 2000a; Watanabe et al., 2001; Huang et al., 2005; increase the yeast cells to a higher density. The third Ohya et al., 2005; Kaoru, 2006) and applied to stabilize stage is the induction stage where protein production is blood volume during surgery and during shock or burn induced by the addition of methanol. Methanol as the cases (Dong et al., 2012). It was also used for the inducer of the AOX1 promoter has been commonly used formulation of protein therapeutics, vaccine formulation to express the heterologous protein in the recombinant P. and manufacturing, coating of medical devices and drug pastoris. Not only the inducing chemical, but methanol is delivery (Zhang et al., 2013). In 2011, the worldwide also poisonous to the P. pastoris cells if it exists at a high demand for HSA was estimated to be more than 500 concentration (Khatri and Hoffmann, 2006). However, a tons/year (He et al., 2011) and the demand has since low methanol concentration is inadequate for protein been increasing. Traditionally, HSA is produced by expression (Gonçalves et al., 2013). Thus, the optimum fractionation from human plasma but this method is amount of methanol should be regulated strictly (Minning limited by human blood supply and has the risk of et al., 2001; Hong et al., 2002; Lee et al., 2003b; Potvin contamination of blood-derived pathogens (Kobayashi et et al., 2012). To achieve these constrains, methanol al., 2000a; Watanabe et al., 2001; Ohya et al., 2005; monitoring and control are very important. Gas-liquid Kaoru, 2006; Belew et al., 2008). Therefore, recombinant chromatography (GC) and high performance liquid compounds from genetically modified organisms were chromatography (HPLC) are both expensive and hardly used to solve these problems (Daly and Hearn, 2005; implemented on-line (Guarna et al., 1997; Hong et al., Kaoru, 2006). Recombinant human serum albumin 2002; Potvin et al., 2012; Gonçalves et al., 2013). (rHSA) has been produced in various expression However, methanol concentration could be alternatively systems, including Escherichia coli (Latta et al., 1987), indicated by dissolved oxygen (DO) monitoring. When Saccharomyces cerevisiae (Sleep et al., 1990), Bacillus cells are actively grown with available carbon sources, subtilis (Saunders et al., 1987), Kluyveromyces lactis DO in the broth is used up and the level becomes very (Saliola et al., 1999), Pichia pastoris (Kobayashi et al., low. When the carbon source is depleted, the DO level 2000a, b; Watanabe et al., 2001; Ohya et al., 2005; immediately increases. If the carbon source is provided, Belew et al., 2008; Sohn et al., 2010; Stadlmayr et al., the DO again decreases (Lee et al., 2003a). These 2010; Dong et al., 2012), transgenic animals (Barash et phenomena are used to control the DO tension range al., 1993) and transgenic plants (Huang et al., 2005; He and can be applied to methanol feeding (Lee et al., et al., 2011; Zhang et al., 2013). 2003a; Lee et al., 2003b). If DO tension reaches above a P. pastoris is a methylotrophic yeast which is widely set value, then the methanol is fed into the bioreactor and used to produce various recombinant proteins. The it is stopped when DO tension falls below a lower set popularity of P. pastoris as a host for the production of value. The DO value can rise to reach the upper set point recombinant proteins has drawn attention due to several again when the methanol is completely depleted, then the advantages (Sohn et al., 2010; He et al., 2011; Çelik and feeding cycle resumes. In this way, the concentration of Çalik, 2012; Krainer et al., 2012; Potvin et al., 2012; methanol fluctuates; it might be kept under control and Garcia-Ortega et al., 2013; Fickers, 2014; Byrne, 2015; sometimes reaches toxic levels (Minning et al., 2001). Çalik et al., 2015). The main reasons are that the However, this technique is rather complicated to genetics of P. pastoris can be easily manipulated to implement (Irani et al., 2015) and cannot be used in express foreign proteins and can perform post- glycerol-methanol mixed feeding (Hong et al., 2002). In translational modifications presented in higher eukaryotes. addition, it is not appropriate for application if the rate of Moreover, P. pastoris can be grown to very high cell methanol assimilation is slow which exhibits MutS and densities (Krainer et al., 2012; Fickers, 2014; Byrne, Mut- phenotypes because yeast cells might be exposed 2015), in some instances reaching 200 g/l (Heyland et al., to non-inducing levels of methanol (Guarna et al., 1997; 2010). In addition, P. pastoris has few natively secreted Hong et al., 2002). In order to solve both insufficient and proteins at relatively low concentrations and can simplify excessive methanol feeding, an on-line methanol subsequent purifications of the secreted recombinant monitoring system was developed by many researchers protein (Potvin et al., 2012). Heterologous protein (Guarna et al., 1997; Katakura et al., 1998; Zhou et al., expression from P. pastoris is normally produced by a 2002; Schenk et al., 2007). The system was capable of

*Corresponding author. E-mail: [email protected] or [email protected].

Author(s) agree that this article remains permanently open access under the terms of the Creative Commons Attribution License 4.0 International License 2376 Afr. J. Biotechnol.

managing methanol feeding and was able to keep stage, the culture was exponentially fed with glycerol feed medium residual methanol in broth cultures at a constant level (50% w/v glycerol with 15 ml/l PTM1) by using predetermined (Guarna et al., 1997; Hellwig et al., 2001; Suwannarat et exponential feeding rate calculated by Equation 1 according to d’Anjou and Daugulis (1997) and Jahic et al. (2002) until the cell al., 2013). S concentration reached 100 g/l. The yeast cell concentration was In this study, a genetically modified Mut P. pastoris calculated with Equation 2 to predetermine the glycerol feeding KM71 strain, which produces and secretes rHSA, was time. used as a model to study on-line methanol control in  heterologous protein expression processes. set uset tt0  F  X 0V0e (1) S0YX / S MATERIALS AND METHODS

X V u tt  Organism X  0 0 e set 0 (2) V Genetically modified P. pastoris KM71 capable of expressing and secreting rHSA was used in all the experiments. The P. pastoris Where F is glycerol feed rate (l/h), X is biomass concentration in dry clone was provided by Dr. Witoon Tirasophon, Mahidol University, weight (g/l), X0 is biomass concentration in dry weight at initial Thailand. The strain was created by inserting the coding DNA feeding (g/l), V is the medium volume (l), V0 is the medium volume sequence for mature full length HSA into the expression vector at initial feeding (l), S0 is the substrate (glycerol) concentration in pPICZA. This expression vector was then integrated into the inlet feed (g/l), YX/S is the yield coefficient biomass per substrate, –1 genome of P. pastoris KM71. glycerol (g/g), µset is the specific growth rate set point (h ), t is the run time (h) and t0 is the initial feeding time (h). The controlled condition was the same as in batch stage. Media

Yeast extract peptone dextrose (YPD) media contained 10 g yeast Protein induction extract, 20 g peptone and 20 g dextrose per liter of deionized water. Basal salt media (BSM) contained 26.7 ml 85% H3PO4, 0.93 g After reaching the predetermined cell density (100 g/l), glycerol CaSO4, 18.2 g K2SO4, 14.9 g MgSO4.7H2O, 4.13 g KOH, 50.0 g feeding was stopped and the culture was left for 4 h for the glycerol and 6.7 ml PTM1 trace salt in deionized water to a total starvation phase. Methanol with 15 ml/l PTM1 was then fed into the volume of 1 L. The PTM1 trace salt contained 0.5 g CoCl2.6H2O, bioreactor in order to induce rHSA expression. An initial pulse of 20.0 g ZnCl2, 65 g FeSO4.7H20, 6.0 g CuSO4.5H2O, 3.0 g methanol was firstly fed into the bioreactor to a level of 10 g/l and MnSO4.H2O, 0.1 g KI, 0.2 g Na2MoO4.2H2O, 0.02 g H3BO3, 5.0 ml left for 4 h. During this time, both methanol concentration and H2SO4 and 0.2 g biotin in deionized water to a total volume of 1 L. voltage output signal were monitored for methanol probe The PTM1 trace salt was sterilized by filtration. calibration. After that, the methanol feed was controlled by on-line methanol sensor. The temperature was set to 22°C (Anasontzis

Preparation of inoculums and Penã, 2014) and the pH to 6.00 (Kobayashi et al., 2000a) during the induction phase. P. pastoris stored at -80°C was used to inoculate a starter culture in

YPD media which was subsequently incubated at 30°C and 250 Sample analysis rpm. The starter culture was then used to inoculate 100 ml BSM which was continuously incubated at the same condition as before Samples were taken during fermentation and centrifuged at 9000 until reaching an OD of 20. The BSM inoculums were then 600 rpm for 5 min at 4°C to separate yeast cells from fermented broth. transferred aseptically to 1 L of BSM (working volume) in a 2 L Yeast cell concentration was determined by measuring OD and bioreactor (BIOSTAT B, B. Braun Biotech International, Melsungen, 600 then converted to dry cell weight by OD-dry cell weight correlation. Germany). The volume of inoculum used in all the experiments was Glycerol and methanol concentrations in the fermented broth were 10% of the working volume of the bioreactor. analyzed by HPLC (Shimadzu Ltd., Tokyo, Japan). The column

used for HPLC was an Anemex HPX-87 H Column (Bio Rad) and Batch fermentation the temperature was set at 45°C in combination with 0.5 mM sulfuric acid as mobile phase and a flow rate of 0.6 ml/min. The batch fermentations were performed with 1 L BSM in a 2 L Detection was done using a refractive index detector. Total protein bioreactor. The temperature was set to 30°C and pH was concentration in the harvested broth was analyzed by Bradford assay and bovine serum albumin (BSA) was used as standard maintained at 5 by using 25% NH4OH and 85% H3PO4. Dissolved oxygen was kept above 20% saturation by using cascaded control protein (Suwannarat et al., 2013). Samples from the culture of agitation to maintain dissolved oxygen at the set value. Aeration supernatant were analyzed by SDS-PAGE on 12% gels according to standard protocols. The protein in the SDS-PAGE gels was was supplied at 2 vvm and pure oxygen was used and mixed with TM the air if the stirrer could not control this value. Foaming was visualized by Coomassie blue staining with Imperial Protein Stain monitored and controlled by an antifoam sensor which would (Thermo Fisher Scientific). occasionally add antifoam (Antifoam 204, Sigma, Deisenhofen,

Germany) into the culture broth to prevent excessive foaming On-line methanol sensor development during fermentation.

Methanol detector and sensor units used in this study were Fed batch fermentation developed by Reven Biotech Inc., Canada. The system of these devices was described by Guarna and co-workers (1997). The When glycerol in BSM was depleted after the batch fermentation methanol was controlled using external control mode and Chongchittapiban et al. 2377

d

Air c e b

g a

f

Figure 1. Schematic diagram of the developed methanol controlling system. (a) Bioreactor. (b) Methanol probe. (c) Methanol sensor unit. (d) Data acquisition (DAQ) device. (e) Peristaltic pump. (f) Methanol feed reservoir. (g) Computer set. Arrows indicate direction of signal and mass flow.

commanded by data acquisition (DAQ) with LabVIEW software polynomial regression (Guarna et al., 1997) using the curve fitting version 7.0 of National Instruments Corporation, USA, providing a function in Excel program, as shown in Figure 3. control program and user interface. The methanol sensor system was set up as shown in Figure 1. The methanol probe was immersed in the broth and connected with the methanol sensor unit by gas flow connection which supplied dry clean air to flush out RESULTS AND DISCUSSION volatile methanol gas to the Figaro model TGS 822 SnO2 organic vapor sensor mounted in a plexiglass housing (in methanol sensor All the experiments were initiated by batch fermentation unit) (Guarna et al., 1997). The output from sensor was a voltage using 1 L working volume BSM in a 2 L bioreactor; the signal transmitted via the RS 232 port to the DAQ device controlling the peristaltic pump by on/off control. As shown in Figure 2, the results are shown in Figure 4. The biomass (dry cell diagram of methanol on-line instruction by the DAQ application with weight) of initial yeast cells increased from 0.5 to 24 g/l LabVIEW software controlled methanol concentration in the broth; within 30 h, while glycerol was assimilated and when the measured methanol concentration was lower than a set decreased from 40 g/l until it was depleted. After glycerol value, the peristaltic pump for methanol feeding medium was had been depleted, the fed-batch stage was started in stimulated for a cyclic time (adjusted through user interface at 5 s order to prolong the growth phase of P. pastoris and for this study) and stopped to wait for a new signal or new methanol concentration (if the concentration was still below the set point, the increased yeast cells to a high density. In this stage, pump was stimulated again). This operation was taken until the yeast cells were fed more glycerol with glycerol feed methanol concentration reached the set point. The sensor was medium (50% w/v glycerol with 15 ml/l PTM1) into the turned on for 8 h or more before induction phase for stabilizing bioreactor. The feed pattern of glycerol addition voltage baseline. Sensor calibration was required by making a depended on exponential growth of cells, therefore, the correlation between voltage output signal and methanol residue in feeding strategy was done based on Equation 1 (d’Anjou fermented broth detected with off-line HPLC. and Daugulis, 1997; Jahic et al., 2002). Glycerol feeding time and cell concentration could be calculated by Methanol sensor calibration Equation 2. During the fed-batch stage, the set was set -1 at 0.08 h to avoid metabolic overflow (Suwannarat et al., Calibration was done during the yeast cells accommodation to 2013; Looser et al., 2015). When the yeast cells reached methanol metabolism in the induction stage (during 4 h after the the predetermined concentration, 100 g/l (at 54th h) in the initial methanol pulse at 10 g/l) by monitoring the voltage output bioreactor, the glycerol feed was stopped and, thus, the signal from the methanol sensor device and the residual methanol concentration in culture broth detected by off line HPLC. The fed-batch stage was finished. After 4 h where the cells correlation of these observed data were set up with the third order used up left over glycerol residual and some metabolites, 2378 Afr. J. Biotechnol.

START

Voltage output signal from DAQ device

Voltage signal to Methanol concentration (g/l)

Methanol > Set point concentration

NO YES

Pump feeding No pump feeding (5 s)

Stop pump feeding

Figure 2. Schematic diagram of on-line methanol control system flow chart.

the induction phase was started at the 58th h by adding continuing the experiment. Normally, the initiated methanol to a concentration of about 10 g/l, in order to methanol concentration in the bioreactor was used at 2-4 activate the AOX1 promoter to express the rHSA protein. g/l (d’Anjou and Daugulis, 2001; Trinh et al., 2003; Potvin The solution was then left for a few hours (4 h) before et al., 2012), however, 10 g/l methanol was used for this Chongchittapiban et al. 2379

a 10.00 9.00 y = 0.18964x3 - 1.30008x2 + 4.01100x - 2.27236

8.00 r² =0. 99797

7.00 6.00 5.00 4.00

3.00 Methanol (g/l) Methanol 2.00 1.00 0.00 0.00 1.00 2.00 3.00 4.00 5.00 6.00 Voltage (V)

20.00 b y = 0.26071x3 - 1.62224x2 + 3.68655x - 2.06728 18.00 r² = 0.99623 16.00 14.00 12.00 10.00 8.00

Methanol (g/l) Methanol 6.00 4.00 2.00 0.00 0.00 1.00 2.00 3.00 4.00 5.00 6.00 Voltage (V)

Figure 3. Correlation of voltage signal and methanol residue; y is methanol concentration (g/l), x is voltage signal (V) and r2 is correlation coefficient.

study. The higher concentration of methanol used in this signal from methanol sensor devices and methanol study not only activated the AOX1 promoter and induced decrease was detected by off-line HPLC. Therefore, the rHSA expression, but was also used to calibrate the correlation between residual methanol in culture broth (by methanol sensor probe and devices. It had been reported off-line HPLC) and voltage output signal measured by that the culture medium did not influence the calibration methanol sensor devices was created. As non-linearity of where the characteristics of the probe were virtually the the sensor response (Guarna et al., 1997), the correlation same measuring in either methanol-water solution or was set up with the third order polynomial regression culture medium with or without cells (Guarna et al., obtained by using the curve fitting function in Excel 1997), however, both fermentation medium and biomass program (as shown in Figure 3). In Experiment 1, the affected the calibration curve according to Ramon and correlation equation was: co-workers (2004), which corresponded to the preliminary 3 2 methanol sensor test (data not shown). During the 4 h 푦 = 0.18964푥 − 1.30008푥 + 4.01100푥 − 2.27236 period, where yeast cells adapted themselves from (3) glycerol to methanol metabolism in substrate change, the calibration was taken by monitoring the voltage output Where, x is voltage output signal form methanol sensor 2380 Afr. J. Biotechnol.

device (volt, V) and y is residual methanol concentration methanol sensor system developed in this study could in culture broth (g/l). The correlation curve is shown in implement methanol level control in high cells density of Figure 3a and the correlation coefficient (r2) is 0.99797. recombinant protein production. The results of methanol After calibration, this correlation was used for methanol control in Experiment 1 and 2 (Figure 4a and b, concentration control in the induction stage of Experiment respectively) showed that the highest cells and protein 1 at set point, 4 g/l. The methanol control system (Figure concentrations were respectively 162.15 and 5.98 g/l at 1) was commanded by DAQ with LabVIEW program the 156th h (98th h of induction) in Experiment 1 and providing the user interface of methanol concentration 152.13 and 5.94 g/l at the 132nd h (74th h of induction) in monitoring and control. The methanol residual in broth Experiment 2. The accumulated protein secreted into was still detected to evaluate the on-line control using off- culture broth was alike but in different production rate line HPLC. In 4 g/l methanol induction (Experiment 1), the accordingly as shown in Figure 4, where the protein methanol control was in the range of 4 ± 0.52 g/l which concentration curve in 10 g/l methanol induction (Figure was 13.0% of oscillation (the result was illustrated by  4b) was more incline than the curve of 4 g/l methanol symbol in Figure 4a). The methanol concentration used induction (Figure 4a), therefore, the protein reached its for protein induction in Experiment 1 was controlled at 4 maximum in a shorter time. This showed that the specific g/l according to the best result for P. pastoris strain KM71 productivities of secreted protein (calculated at maximum producing human growth hormone (hGH) (Suwannarat et protein concentration) were 0.38 and 0.53 mg-protein/g al., 2013). Varying the inducing methanol concentration, dry-cellh in 4 and 10 g/l methanol controls, respectively. the other experiment (Experiment 2) was operated with As a consequence, in the non-inhibitory methanol level, 10 g/l methanol control, in induction stage as the recombinant protein production rate was increased preliminary study showed that P. pastoris strain KM71 relative to the methanol concentration corresponding to could endure methanol concentration more than 10 g/l Katakura et al. (1998), Khatri and Hoffmann (2006) and and the report by Bushell and co-workers (2003) showed Damasceno et al. (2004). The secreted protein with HSA that the AOX1 promoter was fully induced at 10 g/l protein of about 80-86% (from previous studies) was methanol. However, Kupcsulik and Sevella (2004) analyzed, the rHSA was compared with standard HSA investigated a range of methanol concentrations from (67 kDa) by SDS-PAGE, as shown in Figure 5, which 0.45-8.85 g/l that did not show characteristics of showed the same molecular size. In this study, high metabolic inhibition, but out of this range was not studied. methanol levels did not significantly affect protein Therefore, the methanol control at 10 g/l in the induction production in spite of cell yield which decreased stage was chosen for Experiment 2. Likewise in corresponding to Bushell et al. (2003) and Schenk et al. Experiment 1, the methanol sensor probe and devices (2007), hence cell yield in higher methanol induction was were also calibrated during the 4 h where cells less than the lower methanol induction, but it reached the accommodated to methanol metabolism. The correlation maximum cell concentration in a shorter time. After, equation and calibration curve shown in Figure 3b with r2 methanol feeding was stopped because the assimilation at 0.99623 for Experiment 2 was: was not taken due to the yeast cells entering stationary phase reaching its maximum, therefore the growth began 3 2 푦 = 0.26071푥 − 1.62224푥 + 3.68655푥 − 2.06728 (4) to slow which was caused by a limitation of some other components (d’Anjou and Daugulis, 2000) and some Using Equation 4 for Experiment 2, the methanol level in metabolites produced by the cells. In the high cell density the bioreactor was on-line controlled at 10 g/l; however, culture environment, cell autolysis and proteolytic off-line HPLC also still analyzed residual methanol to degradation made the yeast cells and protein to decrease assess the control of methanol sensor devices. The on- (Cregg et al., 2000), therefore, yeast cells decreased line methanol control at 10 g/l methanol induction continuously after the maximum growth at the end of the experiment varied in the range of 10 ± 1.13 g/l which was experiment which is shown in Figure 4. However, 11.30% of oscillation (the result was illustrated by  secreted proteins were not reduced owing to the symbol in Figure 4b). The fluctuation of methanol control condition of induction at low temperature (22°C) which in this study was not more than 13% which could be could reduce proteolysis (Potvin et al., 2012; Gonçalves acceptable, but could be improved next time by adjusting et al., 2013; Anasontzis and Penã, 2014). In addition, pH the methanol feeding pump times (via the user interface) 6 was not appropriate for protease enzyme activity in to less than 5 s (used in this study). Comparing Equation rHSA production (Kobayashi et al., 2000a) then the 3 and 4, the correlation between residual methanol in proteolytic activity could be minimized by optimizing pH culture broth and voltage output signal of these equations and temperature during cultivation (Curvers et al., 2001). were dissimilar in each calibration. Consequently, it was necessary to calibrate the methanol sensor probe and Conclusion devices before use, especially for the procedure with both culture medium and biomass which corresponds to The on-line methanol sensor system was developed by Ramon et al. (2004). It demonstrated that the on-line commanding the methanol detector and sensor unit using Chongchittapiban et al. 2381

1 2

Induction phase Fed Fed phase batch 50 phase Batch 200 8.0 a 40 150 6.0

30

100 4.0

20 Cell dry weight (g/l)

Total protein (g/l) protein Total

Glycerol (g/l) (g/l) weight dry Cell

Glycerol (g/l), MeOH (g/l) MeOH (g/l), Glycerol MeOH (g/l) 50 2.0 10 Total protein (g/l)

0 0 0.0 0 50 100 150 200 250 3 Time (h)

4

5 6

Induction phase Fed Fed phase batch 50 phase Batch 200 8.0

b 40 150 6.0

30

Cell dry weight (g/l) 100 4.0 20 Glycerol (g/l) MeOH (g/l)

Total protein (g/l) protein Total Total protein (g/l) (g/l) weight dry Cell

Glycerol (g/l), MeOH (g/l) MeOH (g/l), Glycerol 50 2.0 10

0 0 0.0 0 50 100 150 200 250

7 Time (h)

Figure 4. P. pastoris growth behavior. a) inducing at 4 g/l methanol; b) inducing at 10 g/l methanol. 2382 Afr. J. Biotechnol.

kDa M 1 2 Thailand) for supplying the recombinant cell line from Intracellular Singnaling Lab, Institute of Molecular Biology and Genetics, Mahidol University. This work was 117 supported a grant by Thailand Graduate Institute of 85 Science and Technology (TGIST), National Science and Technology Development Agency (NSTDA), Thailand. 67 kDa

48 REFERENCES

Anasontzis GE, Penã MS (2014). Effects of temperature and glycerol and methanol-feeding profiles on the production of recombinant galactose oxidase in Pichia pastoris. Biotechnol. Prog. 30(3):728- 34 735. Barash I, Faerman A, Baruch A, Nathan M, Hurwitz DR, Shani M (1993). Synthesis and secretion of human serum albumin by mammary gland explants of virgin and lactating transgenic mice. 26 Transgenic Res. 2(5):266-276. Belew M, Yan LM, Zhang W, Caldwell K (2008). Purification of recombinant human serum albumin (rHSA) produced by genetically modified Pichia pastoris. Sep. Sci. Technol. 43(11):3134-3153. 19 Bushell ME, Rowe M, Avignone-Rossa CA, Wardell JN (2003). Cyclic fed-batch culture for production of human serum albumin in Pichia pastoris. Biotechnol. Bioeng. 82(6):678-683. Byrne B (2015). Pichia pastoris as an expression host for membrane Figure 5. SDS-PAGE analysis of the P. pastoris protein structural biology. Curr. Opin. Biotechnol. 32:9-17. KM71 produced HSA protein. Lane 1, standard Çalik P, Ata Ö, Güneş H, Massahi A, Boy E, Keskina A, Öztürk S, Zerze HSA (67 kDa); lane 2, supernatant. GH, Özdamar TH (2015). Recombinant protein production in Pichia pastoris under glyceraldehyde-3-phosphate dehydrogenase promoter: From carbon source metabolism to bioreactor operation parameters. Biochem. Eng. J. 95:20-36. Çelik E, Çalik P (2012). Production of recombinant proteins by yeast data acquisition (DAQ) with LabVIEW software providing cells. Biotechnol. Adv. 30:1108-1118. a control program and user interface. This developed Cregg JM, Cereghino JL, Shi J, Higgins DR (2000). Recombinant system was capable of managing the methanol feed and protein expression in Pichia pastoris. Mol. Biotechnol. 16:23-52. Curvers S, Brixius P, Klauser T, Thömmes J, Weuster-Botz D, Takors was able to keep residual methanol in broth culture at a R, Wandrey C (2001). Human chymotrypsinogen B production with constant level. The fluctuation of methanol controls were Pichia pastoris by integrated development of fermentation and 13.0 and 11.3% at inducing methanol levels 4 and 10 g/l, downstream processing. Part 1. Fermentation. Biotechnol. Prog. respectively. In the non-inhibitory methanol level, the 17:495-502. d’Anjou MC, Daugulis AJ (1997). A model-based feeding strategy for production rate of recombinant protein increased with fed-batch fermentation of recombinant Pichia pastoris. Biotechnol. methanol concentration in the culture broth despite cell Tech. 11(12):865-868. yield reduction, therefore the protein reached the d’Anjou MC, Daugulis AJ (2000). Mixed-feed exponential feeding for maximum in a shorter time. The specific productivities of fed-batch culture of recombinant methylotrophic yeast. Biotechnol. Lett. 22:341-346. secreted protein were 0.38 and 0.53 mg-protein/ g dry- d’Anjou MC, Daugulis AJ (2001). A rational approach to improving cell-h in 4 and 10 g/l methanol controls, respectively. Cell productivity in recombinant Pichia pastoris fermentation. Biotechnol. lysis and proteolytic degradation caused a decrease in Bioeng. 72(1):1-11. cells and proteins in high cell density environments, but Daly R, Hearn MTW (2005). Expression of heterologous proteins in Pichia pastoris: a useful experimental tool in protein engineering and the protein degradation in this study could be prevented production. J. Mol. Recognit. 18:119-138. by induction at a low temperature (22°C) and pH 6 which Damasceno LM, Pla I, Chang H-J, Cohen L, Ritter G, Old LJ, Batt CA was not appropriate for protease activity. (2004). An optimized fermentation process for high-level production of a single-chain Fv antibody fragment in Pichia pastoris. Protein Expr. Purif. 37:18-26. Dong Y, Zhang F, Wang Z, Du L, Hao A, Jiang B, Tian M, Li Q, Jia Q, Conflict of Interests Wang S, Xiu Z (2012). Extraction and purification of recombinant human serum albumin from Pichia pastoris broths using aqueous two-phase system combined with hydrophobic interaction The authors have not declared any conflict of interests. chromatography. J. Chromatogr. A. 1245:143-149. Fickers P (2014). Pichia pastoris: a workhorse for recombinant protein production. Curr. Res. Microbiol. Biotechnol. 2(3):354-363. ACKNOWLEDGEMENTS Garcia-Ortega X, Ferrer P, Montesinos JL, Valero F (2013). Fed-batch operational strategies for recombinant Fab production with Pichia pastoris using the constitutive GAP promoter. Biochem. Eng. J. The authors thank Dr. Witoon Tirasophon of Shrimp 79:172-181. Molecular Biology Research Group, Institute of Molecular Gonçalves AM, Pedro AQ, Maia C, Sousa F, Queiroz JA, Passarinha Bioscience, Mahidol University, Thailand (25/25 LA (2013). Pichia pastoris: A recombinant microfactory for antibodies and human membrane proteins. J. Microbiol. Biotechnol. 23(5):587- Phuttamonthon 4 Road, Salaya, Nakhon Pathom 73170, 601. Chongchittapiban et al. 2383

Guarna MM, Lesnicki GJ, Tam BM, Robinson J, Radziminski CZ, Minning S, Serrano A, Ferrer P, Sola´ C, Schmid RD, Valero F (2001). Hasenwinkle D, Boraston A, Jervis E, MacGillivray RTA, Turner RFB, Optimization of the high-level production of Rhizopus oryzae lipase in Kilburn DG (1997). On-line monitoring and control of methanol Pichia pastoris. J. Biotechnol. 86:59-70. concentration in shake-flake cultures of Pichia pastoris. Biotechnol. Ohya T, Ohyama M, Kobayashi K (2005). Optimization of human serum Bioeng. 56(3):279-286. albumin production in methylotrophic yeast Pichia pastoris by He Y, Ning T, Xie T, Qiu Q, Zhang L, Sun Y, Jiang D, Fu K, Yin F, repeated fed-batch fermentation. Biotechnol. Bioeng. 90(7):876-887. Zhang W, Shen L, Wang H, Li J, Lin Q, Sun Y, Li H, Zhu Y, Yang D Potvin G, Ahmad A, Zhang Z (2012). Bioprocess engineering aspects of (2011). Large-scale production of functional human serum albumin heterologous protein production in Pichia pastoris: A review. from transgenic rice seeds. Proc. Natl. Acad. Sci. 108(47):19078- Biochem. Eng. J. 64:91-105. 19083. Ramon R, Feliu JX, Cos O, Montesinos JL, Berthet FX, Valero F (2004). Hellwig S, Emde F, Raven NPG, Henke M, Logt Pvd, Fischer R (2001). Improving the monitoring of methanol concentration during high cell Analysis of single-chain antibody production in Pichia pastoris using density fermentation of Pichia pastoris. Biotechnol. Lett. 26:1447- on-line methanol control in fed-batch and mixed-feed fermentations. 1452. Biotechnol. Bioeng. 74(4):344-352. Saliola M, Mazzoni C, Solimando N, Crisà A, Falcone C, Jung G, Fleer Heyland J, Fu J, Blank LM, Schmid A (2010). Quantitative physiology of R (1999). Use of the KlADH4 promoter for ethanol-dependent Pichia pastoris during glucose-limited high-cell density fed-batch production of recombinant human serum albumin in Kluyveromyces cultivation for recombinant protein production. Biotechnol. Bioeng. lactis. Appl. Environ. Microbiol. 65(1):53-60. 107(2):357-368. Saunders CW, Schmidt BJ, Mallonee RL, Guyer MS (1987). Secretion Hong F, Meinander NQ, Jönsson LJ (2002). Fermentation strategies for of human serum albumin from Bacillus subtilis. J. Bacteriol. improved heterologous expression of laccase in Pichia pastoris. 169(7):2917-2925. Biotechnol. Bioeng. 79(4):438-449. Schenk J, Marison IW, von Stockar U (2007). A simple method to Huang LF, Liu YK, Lu CA, Hsieh SL, Yu SM (2005). Production of monitor and control methanol feeding of Pichia pastoris fermentations human serum albumin by sugar starvation induced promoter and rice using mid-IR spectroscopy. J. Biotechnol. 128:344-353. cell culture. Transgenic Res. 14:569-581. Sleep D, Belfield GP, Goodey AR (1990). The secretion of human Irani ZA, Maghsoudi A, Shojaosadati SA, Motamedian E (2015). serum albumin from the yeast Saccharomyces cerevisiae using five Development and in silico analysis of a new nitrogen-limited feeding different leader sequences. Nat. Biotechnol. 8:42-46. strategy for fed-batch cultures of Pichia pastoris based on a simple Sohn SB, Graf AB, Kim TY, Gasser B, Maurer M, Ferrer P, Mattanovich pH-control system. Biochem. Eng. J. 98:1-9. D, Lee SY (2010). Genome-scale metabolic model of methylotrophic Jahic M, Rotticci-Mulder JC, Martinelle M, Hult K, Enfors S-O (2002). yeast Pichia pastoris and its use for in silico analysis of heterologous Modeling of growth and energy metabolism of Pichia pastoris protein production. Biotechonol. J. 5:705-715. producing a fusion protein. Bioprocess Biosyst. Eng. 24:385-393. Stadlmayr G, Mecklenbräuker A, Rothmüller M, Maurer M, Sauer M, Kaoru K (2006). Summary of recombinant human serum albumin Mattanovich D, Gasser B (2010). Identification and characterisation development. Biologicals. 34:55-59. of novel Pichia pastoris promoters for heterologous protein Katakura Y, Zhang W, Zhuang G, Omasa T, Kishimoto M, Goto Y, Suga production. J. Biotechnol. 150:519-529. KI (1998). Effect of methanol concentration on the production of Suwannarat Y, Saeseaw S, Chanasutthiprapa N, Tongta A (2013). human2-glycoprotein I domain V by a recombinant Pichia pastoris: A Comparison between constant methanol feed and on-line monitoring simple system for the control of methanol concentration using a feed control for recombinant human growth hormone production by semiconductor gas sensor. J. Ferment. Bioeng. 86(5):482-487. Pichia pastoris KM71. Afr. J. Biotechnol. 12(11):1267-1274. Khatri NK, Hoffmann F (2006). Impact of methanol concentration on Trinh LB, Phue JN, Shiloach J (2003). Effect of methanol feeding secreted protein production in oxygen-limited cultures of recombinant strategies on production and yield of recombinant mouse endostatin Pichia pastoris. Biotechnol. Bioeng. 93(5):871-879. from Pichia pastoris. Biotechnol. Bioeng. 82(4):438-444. Kobayashi K, Kuwae S, Ohya T, Ohda T, Ohyama M, Ohi H, Watanabe H, Yamasaki K, Kragh–Hansen U, Tanase S, Harada K, Tomomitsu K, Ohmura T (2000a). High-level expression of Suenaga A, Otagiri M (2001). In vitro and in vivo properties of recombinant human serum albumin from the methylotrophic yeast recombinant human serum albumin from Pichia pastoris purified by a Pichia pastoris with minimal protease production and activation. J. method of short processing time. Pharm. Res. 18(12):1775-1781. Biosci. Bioeng. 89(1):55-61. Zhang Q, Yu H, Zhang F, Shen Z (2013). Expression and purification of Kobayashi K, Kuwae S, Ohya T, Ohda T, Ohyama M, Tomomitsu K recombinant human serum albumin from selectively terminable (2000b). High level secretion of recombinant human serum albumin transgenic rice. J. Zhejiang Univ. Sci. B Biomed. Biotechnol. by fed-batch fermentation of the methylotrophic yeast, Pichia 14(10):867-874. pastoris, based on optimal methanol feeding strategy. J. Biosci. Zhou XS, Lu J, Fan WM, Zhang YX (2002). Development of a Bioeng. 90(3):280-288. responsive methanol sensor and its application in Pichia pastoris Krainer FW, Dietzsc C, Hajek T, Herwig C, Spadiut O, Glieder A (2012). fermentation. Biotechnol. Lett. 24:643-646. Recombinant protein expression in Pichia pastoris strains with an engineered methanol utilization pathway. Microb. Cell Fact. 11(22). Kupcsulik B, Sevella B (2004). Effect of methanol concentration on the recombinant Pichia pastoris MutS fermentation. Periodica Polytechnica Ser. Chem. Eng. 48(2):73-87. Latta M, Knapp M, Sarmientos P, Bréfort G, Becquart J, Guerrier L, Jung G, Mayaux J-F (1987). Synthesis and purification of mature human serum albumin from E. coli. Nat. Biotechnol. 5:1309-1314. Lee CY, Lee SJ, Jung KH, Katoh S, Lee EK (2003a). High dissolved oxygen tension enhances heterologous protein expression by recombinant Pichia pastoris. Process Biochem. 38:1147-1154. Lee CY, Nakano A, Shiomi N, Lee EK, Katoh S (2003b). Effects of substrate feed rates on heterologous protein expression by Pichia pastoris in DO-stat fed-batch fermentation. Enzyme Microb. Technol. 33:358-365. Looser V, Bruhlmann B, Bumbak F, Stenger C, Costa M, Camattari A, Fotiadis D, Kovar K (2015). Cultivation strategies to enhance productivity of Pichia pastoris: A review. Biotechnol. Adv. 33:1177- 1193.

Vol. 15(42), pp. 2384-2393, 19 October, 2016 DOI: 10.5897/AJB2016.15366 Article Number: 1E1423A61173 ISSN 1684-5315 African Journal of Biotechnology Copyright © 2016 Author(s) retain the copyright of this article http://www.academicjournals.org/AJB

Full Length Research Paper

Cloning and expression analysis of alcohol dehydrogenase (Adh) hybrid promoter isolated from Zea mays

Ammara Masood1*, Nadia Iqbal1, Hira Mubeen1, Rubab Zahra Naqvi1, Asia Khatoon1 and Aftab Bashir2

1National Institute for Biotechnology and Genetic Engineering (NIBGE), Faisalabad, Pakistan. 2Department of Biological Sciences, F. C. College University, Lahore, Pakistan.

Received 28 March, 2016; Accepted 21 September, 2016

Hybrid promoters are created by shuffling of DNA fragments while keeping intact regulatory regions crucial of promoter activity. Two fragments of alcohol dehydrogenase (Adh) promoter from Zea mays were selected to generate hybrid promoter. Sequence analysis of both alcohol dehydrogenase promoter fragments through bioinformatics tools identified several crucial cis regulatory elements and transcription factors binding sites. Both fragments were separately cloned in the TA vector (pTZ57R/T) and fused to get the complete hybrid promoter (Adh-H). Alcohol dehydrogenase hybrid promoter was further cloned in expression vector pGR1 through adaptor ligation. Transient β-glucuronidase (GUS) assay revealed that hybrid promoter exhibited high expression under anaerobic conditions in wheat tissues. From the study it is concluded that hybrid promoter (Adh-H) may be used to derive gene expression in monocots during anaerobic conditions. The present work also provides an important insight in the designing of hybrid monocot promoters to improve multiple traits in crops without facing intellectual property rights (IPRs) issues.

Key words: Hybrid promoter, histochemical β-glucuronidase (GUS) assay staining, cis regulatory elements, alcohol dehydrogenase, Zea mays.

INTRODUCTION

Promoters are regulatory elements that control trans- 2004). A variety of plant promoters are being used in cription and the level of gene expression (Hernandez- different genetic engineering strategies for gene Garcia et al., 2014). Several promoters isolated from expression studies as well as introduction of transgene viral, bacterial and plant origin have been characterized for crop improvement and bio-pharmaceutical and used extensively in transgene expression system applications. The strength and expression behavior of (Yoshida and Shinmyo, 2000; Muller and Wasseneger, promoter depends upon interaction promoter cis

*Corresponding author. E-mail: [email protected].

Author(s) agree that this article remains permanently open access under the terms of the Creative Commons Attribution License 4.0 International License Masood et al. 2385

regulatory elements with transcription factors (Atchison, The present work was designed to construct a hybrid 1988). Analyzing promoter sequence through available promoter and to evaluate the efficiency of this promoter databases like plantCARE and plantPAN, we can predict by transient expression using GUS reporter gene. The promoter expression and strength (Lescot et al., 2001). main objectives of the study aimed at identification of Complete understanding of the regulatory regions and promoter regions of Adh gene variants from HTGS transcription factors in the regulatory regions would help database available at NCBI. These promoter fragments in designing new synthetic/ hybrid promoters for tissue were separately cloned in TA vector and fused to specific or constitutive expression of transgenes. These generate hybrid promoter. Finally, transient expression promoters may be used to generate transgenic plants analysis of hybrid promoter was analyzed in monocot transformed with multi genes where single promoter may plant wheat. The novel hybrid promoter may be part of lead to gene silencing due to post transcriptional gene expression cassette to improve cereals crops without silencing (Mol et al., 1989). There have several hybrid facing IPR issues. promoters been synthesized including E4/E8 promoter (De Boer et al., 1983) and tacI/tacII promoter (Bestwick and Kellogg, 2000). The expression analysis of these MATERIALS AND METHODS promoters was conducted in monocots and dicots (Lee et al., 2007). In the present study, we have generated a For generation of alcohol dehydrogenase promoter, two fragments located on distinct chromosomes were picked from High through hybrid alcohol dehydrogenase promoter and analyzed its put Genomic Sequences (HTGS). Fragment-I (AdhI) of 1.1 Kb was cis regulatory elements and expression behavior in retrieved from HTGS sequence of Zea mays chromosome 1 monocot system. (AC190915.3). The second fragment (Adh-II) of 390 pb was Alcohol dehydrogenase (Adh, EC 1.1.1.1) is an enzyme isolated from HTGS sequence of Z. mays chromosome 4 that catalyzes interconversion of aldehydes and alcohols (AC213880.3). Various bioinformatics tools were used to predict regulatory regions in both fragments. Fragment-I was to be ligated (Arnold et al., 2013) and detoxification of acetaldehydes + upstream of fragment-II in TA cloning vector though directional (Garabagi et al., 2005). It maintains cellular level of NAD cloning. For amplification of alcohol dehydrogenase promoter which is constantly required in several crucial fragments, multiple sets of primer pairs were designed with specific biochemical reactions. Its activity has been detected in a restriction sites to facilitate cloning. The fragment-I contained SacI vast number of higher plants including Arabidopsis, restriction site in forward primers and ApaI site the reverse primers. maize, wheat, rice, tomato, potato and pea (Batut et al., The forward primers for fragment-II contained ApaI and reverse primers had HindIII site (Table 1). 2013; Mardanova et al., 2007). Adh is essential for the survival of plants during prolonged anaerobic conditions, fruit ripening and seedling development (Thompson et al., Cloning of alcohol dehydrogenase promoter in TA cloning 2010). Two Adh genes have been reported in maize, vector named Adh1 and Adh2, which are located on distinct chromosomes. Adh1 is located on chromosome 1 and The alcohol dehydrogenase hybrid promoter was generated by joining the two fragments from each variant. Both Adh promoter Adh2 on chromosome 4 (Calo et al., 2013). The 5' fragments were amplified using Zeamays DNA as template. Both untranslated region of the Adh mRNAs showed a promoter fragments were PCR amplified using selected primers and conserved sequence (G-TCNGGAGTGG) at about 45 cloned independently in TA cloning vector. Annealing temperatures, base pairs upstream from the translation start site. This genomic DNA and Mg+2 concentrations were optimized prior to conserved sequence was located in both Adh1 and Adh2 cloning. genes and supposed to be important in an-aerobiosis. Several regulatory elements associated with anaerobic Generation of alcohol dehydrogenase hybrid promoter induction have been identified in Adh1 promoter. These anaerobic response elements (AREs) of Adh1 have two PTZ vector having promoter fragment-II was digested with ApaI and copies of GC-element (59-GCC[G/C]C-39) and two HindIII to generate sticky ends complementary to fragment-I. copies of GT-elements (59-[T/C]GGTTT-39). GC- Promoter fragment-I was also digested with SacI and ApaI to join upstream of promoter fragment II cloned in TA vector. Both regulatory elements are required for the expression of fragments-I and II were ligated at ApaI site and transformed. Hybrid Adh1 while GT motif is involved in general anaerobic promoter clone was confirmed through restriction with SacI and induction (Petolino and Davies, 2013). The 5´UTR region HindIII. Alcohol dehydrogenase hybrid promoter clone (Adh-H) was of the tobacco Adh gene was reported to be an efficient then used for further cloning in the plant expression vector pGR1. translational enhancer in Arabidopsis and tobacco (Satoh et al., 2004). Adh promoter also showed expression in Cloning of alcohol dehydrogenase hybrid promoter in pGR1 aerobic conditions. However, the expression level is very low in aerobic conditions as compared to in anaerobic A Plant expression vector pGR1 (provided by gene isolation group, conditions. Hundreds of polypeptides are synthesized in NIBGE) had 35S promoter fused to GUS gene followed by CaMV roots under aerobic conditions including Adh, but the terminator. From pGR1 vector, 35S promoter was excised using SacI and HindIII enzymes. Hybrid alcohol dehydrogenas promoter expression level of Adh increases several folds during was picked from TA vector and cloned into pGR1 by replacing 35S anaerobic conditions (Chung and Ferl, 1999). promoter. The resultant clone containing hybrid promoter was 2386 Afr. J. Biotechnol.

Table 1. Primers used for cloning of alcohol dehydrogenase hybrid promoter.

Primer Name of primer Sequence HAdhZmzV1F-1 5’AGTGAGCTCGATCCTAGGAGCTAAA 3’ Forward primers for Adh-fragment I HAdhZmzV1F2 5’AGTGAGCTCGATCCTAGGAGCTAAAGC 3’ HAdhZmzV1F-3 5’AGCGAGCTCCACTTAGCAAACCATTCTAGT 3 HAdhZmzV1R-1 5’TAAGGGCCCTCGGATGCGCCGC 3’ Reverse primers for Adh-fragment I HAdhZmzV1R2 5’TAAGGGCCCTCGGATGCGCCGCG 3’ HAdhZmzV1R-3 5’TAAGGGCCCCGCTAGCTCGGATCTG 3 HAdhZmzV2-F 5’GCAGGGCCCGGAAAACGGTAAACAAGAAA 3’ Forward primers for Adh-fragment II HAdhZmzV2F-2 5’GCAGGGCCCGGAAAACGGTAAACAAGAAAC 3’ HAdhZmzV2R1 5’ATCAAGCTT TGCTTGCTCTCTCTCTCTC 3’ Reverse primers for Adh-fragment II HAdhZmzV2R-2 5’ATCAAGCTT TGCTTGCTCTCTCTCTCTCTC 3’

named pGRAdh-H. of Zea mays chromosome 4; clone CH201-465N3 at position 70445-70056 under AC213880.3. BLASTp results of both upstream sequences confirmed there was Transient GUS assay no coding region. Patent BLAST results revealed that Transient expression studies were carried out to evaluate the novel promoter is 26% dissimilar to already patented activity of the alcohol dehydrogenase hybrid promoter using sequence (Accession No. 220526.1). Sequence analysis reporter gene (GUS) expression in the monocot plant like wheat. of both fragments revealed several cis acting motifs and Biolistic Particle Delivery System (PDS1000 He) was used for the transcription factor binding sites as identified through bombardment of vector constructs in wheat explants. For comparative analysis, a promoterless construct was used as PlantCARE. Nucleotide sequence and motifs of complete negative control. Vector pGR1 with GUS gene downstream of 35S hybrid are shown (Table 2 and Figure 1). Core promoter promoter was used as positive control. To monitor any false positive elements including TATA box and CAAT box were result, gold particles without any coating were also bombarded. present in hybrid promoter. There were several light Wheat leaf, spike, root and endosperm were used as explants for responsive motifs including ACE motif, Sp1 motif and the bombardment experiments. TCT motifs were detected in Adh-H promoter. A 5´UTR A 1 µg/µl of plasmid DNA of each construct was used for coating of 1 μm diameter sterile gold particles. Leaves, roots and spikes with consensus sequence TTTCTCTCTCT was also were taken from wheat plants grown in pots from green house. detected in Adh-H promoter. An anaerobic response Wheat seeds were soaked for 2 to 3 days in Petri plates containing element ARE (TGGTTT) was also observed in Adh-H sterile distilled water and cut with sterile blade longitudinally to promoter. Several other crucial motifs including LTR, expose endosperm. All tissues were placed on Petri plates MBS, TC-rich stretch and AuxRR-core were located in containing ½ MS medium (Murashige and Skoog, 1962) in a way to hybrid promoter. expose maximum surface area for bombardment. All wheat explants were bombarded at 27 mmHg vacuum using1100-psi Both promoter fragments were cloned separately in TA rupture disks and 9 cm target distance. Same conditions were used vector and ligated directionally to synthesize hybrid to bombard plasmids having 35S promoter coated and negative promoter. For functional characterization alcohol control coated gold particles. Petri plates were placed at 25±2ºC for dehydrogenase hybrid promoter was cloned in an 24 h and then submerged in GUS staining buffer containing 0.1M expression vector and analyzed through transient GUS X-Gluc. All tissues were incubated in dark at 37ºC for overnight till appearance of blue color and washed with 70% ethanol to stop assay in wheat. For amplification of Adh promoter reaction as well as to bleach chlorophyll from green tissues. A fragments I and II selected annealing temperature digital camera attached with microscope was used to photograph all through gradient PCR were 53.7 and 53.1°C respectively tissues. (Figure 2A and B). Adh promoter fragment-I was amplified using forward primer HAdhZmzV1F-2 having SacI restriction site, and reverse primer HAdhZmzV1R-2 RESULTS having ApaI restriction site. Adh promoter fragment-II was amplified at 53.1ºC with forward primer HAdhZmzV2F-1 A maize alcohol dehydrogenase gene was selected for having ApaI restriction site and reverse primer generation of hybrid promoter. Two upstream regions of HAdhZmzV2R-1 having HindIII restriction site (Table 1). alcohol dehydrogenase gene located at distinct Clones of both promoter fragments in TA vector were chromosomes were retrieved and analyzed through confirmed through digestion with SacI and ApaI (Figure bioinformatics tools. Fragment-I was retrieved from 3A and B). Clones were also confirmed by DNA HTGS sequence of Zea mays chromosome 1 of clone sequencing on an ABI 3100 Genetic Analyzer. Promoter CH201-528P20 at position 9934-8810 (AC190915.3). fragment II cloned in TA vector was ligated with fragment The Adh-II fragment was isolated from HTGS sequence I using ApaI and HindIII. Hybrid 1.5 kb promoter clone Masood et al. 2387

Table 2. Cis-regulatory elements in alcohol dehydrogenase hybrid promoter.

Motif Sequence Function 5´ UTR Py-Rich Stretch TTTCTCTCTCTCTC Cis-acting element conferring high transcription level. ABRE TACGTG Cis-acting element involved in abscisic acid responsiveness. ACE C/GT/CA/GACGTATT/C Cis-acting element involved in light responsiveness. ARE TGGTTT Cis-acting element essential for the anaerobic induction. ATGCAAAT Motif ATACAAAT Cis regulatory element associated to TGAGTCA motif AuxRR-core GGTCGAT Cis-acting element involved in auxin responsiveness. CAAT-box TCTAACCGG Common cis-acting element in promoter and enhancer region CAT-box GCCACT Cis-acting element related to meristem expression. ELI BOX-3 AAACCAATT Elicitor responsive elements GARE motif AAACAGA Gibberelin responsive element LTR CCGAAA Cis-acting element involved in low temperature response MBS TAACTG MYB binding site involved in drought inducibility. Sp1 CCC/G/A Light responsive element TATA-box TATAT/CATAT Core promoter element around -30 of transcription start site. TC-rich repeats ATTTTCTTCA Cis-acting element involved in stress and defense responsiveness TCT-motif TCTTAC Part of light responsive element Circadian CAAAGATATC Cis-acting element involved in circadian control

Figure 1. Complete nucleotide sequence of alcohol dehydrogenase hybrid promoter (Adh- H) showing cis acting regulatory motifs (PlantCARE analysis). Arrow indicates joining region of promoter fragment I and promoter fragment II. promoter fragment I and promoter fragment II.

2388 Afr. J. Biotechnol.

Figure 2. Gradient PCR of Adh-I and Adh-II promoter fragments: (A); PCR amplification Adh-I fragment at different annealing temperatures. M; 1 Kb ladder, Lanes 1-3 show PCR at 50.7, 53.7 and 48.4ºC respectively. (B); Gradient PCR of Adh-II. M; 1 Kb ladder, Lanes 1-3 represent PCR of Adh-II at 53.1, 51.1 and 48.3ºC respectively (underlined were temperatures selected for PCR amplification).

M 1 M 1 Figure 2. Gradient PCR of Adh-I and Adh-II promoter fragments: A); PCR amplification Adh-I fragment 6Kb 3Kb 2.8Kb 3Kb 2.8Kb

1Kb 1Kb 1.1Kb 390bp

A B

Figure 3. Cloning of Adh-I and Adh-II promoter fragments in TA cloning vector (A), Restriction digestion of Adh-I fragment with SacI and ApaI. M; 1 Kb ladder, Lane 1 represent Adh-I clone (1126bp). (B), Restriction digestion of Adh-II fragment with ApaI and HindIII. M; 1 Kb ladder, Lane 1 represents Adh-II clone (390 bp).

was confirmed through restriction with SacI and hindIII roots bombarded with Adh-H promoter exhibited high (Figure 4A). Adh hybrid (Adh-H) cloned in TA vector was GUS expression. The microscopic view revealed that subcloned in the plant expression vector pGR1. The instead of blue spots a diffused kind of blue staining was resultant vector construct having alcohol dehydrogenase observed in roots (Figure 8). The results revealed that hybrid promoter was named pGRAdhH and confirmed Adh promoter expressed GUS in leave tissues and the through digestion of resultant vector with SacI and HindIII staining intensity was comparable to the control plasmid (Figure 4B). PCR also confirmed the cloning of 1.5 Kb (pGR1). In wheat seeds, the GUS activity was not complete hybrids in pGR1 (Figure 4C). The pGRAdh, observed under Adh-H promoter as detected under 35S therefore, represents a transient expression vector promoter. However, the aleurone cells indicated the GUS having Adh promoter instead of 35S promoter to control expression (Figure 9). No GUS stain was detected in expression of GUS reporter gene (Figure 5). tissues bombarded with promoter-less constructs and To evaluate activity of hybrid promoter, transient GUS unbombarded negative controls. assay was performed in wheat tissues. Wheat leaves were bombarded with pGR1 under both 35S and Adh-H showed GUS expression (Figure 6). Wheat spikes DISCUSSION bombarded with 35s and Adh-H promoters showed GUS expression in pedicel attachment region (Figure 7). The The object of present study is to synthesize hybrid Masood et al. 2389

M 1 M 1 M 1 M 1 6Kb 6Kb 5.1Kb 3Kb 2.8Kb 3Kb 3Kb

1.5Kb 1.5Kb 1.5Kb 1Kb 1Kb 1Kb

A B C

Figure 4. Cloning of Adh hybrid promoter in TA cloning vector and expression vector pGR1. (A) Double digestion of Adh complete hybrid with SacI and HindIII showing 2.8 kb vector backbone along with 1.5 kb promoter clone. M; 1 Kb ladder, Lane 1; Hybrid Adh promoter (Adh-H) in TA cloning vector. (B) Confirmation of clone containing Adh-H promoter in pGR1: M; I Kb ladder (A); Double digestion with SacI and HindIII releasing 5.i pGR1 vector backbone and 1.5 Kb Hybrid Adh promoter (Adh-H). (C) Confirmation of cloning through PCR amplification. M; I Kb ladder (A); PCR analysis of Adh-H promoter using promoter specific primers.

Figure 5. Physical map of pGRAdhH vector.

promoter to develop novel regulatory sequence in order were already patented but hybrid promoter had only 74% to control gene expression. A variety of promoters are similarity with patented sequences. In hybrid Adh available for introduction and expression of transgenes in promoter, along with core promoter elements most of the plants. However, these promoters cannot be used freely crucial regulatory motif were remained intact and due to IPR policy. Along with isolation of novel promoters, functional. Essential cis-acting regulatory elements of synthesis of hybrid promoter is also carried out for gene Adh-H promoter (TATA box and CAAT box) are often expression. In the present study, two fragments of Adh conserved in many species and localized at 50 to 100 bp promoter located no different chromosomes of maize upstream of the transcription start site (TSS), while the were fused to generate hybrid promoter. Although, other cis-regulatory motifs around them are variably nucleotide sequences of both fragment-1 and fragemt-2 placed. The most common cis-regulatory element in 2390 Afr. J. Biotechnol.

Figure 6. Transient GUS expression wheat leaves. (A) Positive control (35S promoter); (B) Adh-H promoter showing the localized GUS activity as blue spots; (C) Negative control; (D) Un-bombarded GUS stained tissues.

A B

C D

Figure 7. Transient expression in wheat spikes. (A) Positive control (35S promoter); (B) Adh-H promoter; (C) Negative control; (D) Un-bombarded GUS stained tissues.

Masood et al. 2391

A B

C D

Figure 8. Transient GUS expression in wheat roots. (A) Positive control (2X35S promoter); (B) Adh-H promoter; (C) Negative control; (D) Un-bombarded GUS stained root tissues.

Figure 9. Transient GUS expression in wheat seeds. (A) 2X35S promoter Positive control; (B) Adh-H promoter Showing the localized GUS activity in the form of blue spots confined to the aleurone layer; (C): Negative control; (D) Negative control; Un-bombarded GUS stained tissues. 2392 Afr. J. Biotechnol.

hybrid Adh promoter is anaerobic responsive element expression in the roots under aerobic conditions also (ARE), that was first identified in maize and Arabidopsis requires all the same GC and GT-rich motifs that are Adh1 promoters (Park et al., 2012). ARE motif was activated in hypoxic conditions. However, the expression present in both fragments of Adh promoter. Anaerobic under aerobic conditions is several folds less than that of response element (ARE) consists of GT- and GC-motifs, anaerobic conditions (Arnold et al., 2013). On the other which are both crucial for gene expression especially hand, expression of Adh-H the sectioned germinating under anaerobic conditions. These GC- and GT-rich wheat seed revealed the expression in aleurone layer but motifs are able to activate transcription in response to not in the endosperm indicating that Adh promoter does hypoxia in wheat protoplasts, maize protoplasts and not express in wheat endosperm. Although hybrid Adh-H hypoxic tobacco plants (Deal and Henikoff, 2011). There promoter exhibited expression in most of wheat tissues are different binding sites for all the cis-regulatory motifs but roots showed significantly high expression. The that specifically bind and activate the particular regulatory hybrid Adh-H promoter may be used to derive specific element. GCBP-1 is the binding sites of GC motif and it is expression in roots or anaerobic conditions. important in the hypoxic activation of gene expression mediated by the ARE sequence. A conserved sequence (G-TCNGGAGTGG) is located at about 45 bp upstream Conclusion from the translation start site and has been proposed to be important in anaerobiosis (Hou et al., 2012). Similarly, Along with exploration of novel promoters, hybrid a drought and ABA induced transcription factor AtMYB2 promoters are synthesized for gene transformation. In the binds to the GT-motif as GT-motif site resembling to Myb- current study, two fragments of maize Adh promoter from transcription factor-binding site. distinct chromosomes were ligated to synthesize. Along Analysis of the regulatory sequences in Adh-H with crucial regulatory elements, Adh-H promoter promoter also showed the presence of some important contained a number of anaerobic response elements. motifs that may serve as essential regulatory elements in Through transient GUS assay, hybrid Adh promoter promoter activity. Regulatory motifs within the second showed expression in wheat plants especially in roots. fragment of Adh-H hybrid showed much variation with This may be related to presence of anaerobic response that of already reported promoter, although some elements in Adh-H promoter. From the study, it is common motifs were also identified. A 5´ UTR Py rich concluded that hybrid Adh-H promoter may be used to stretch present at -369 and -373 position of Adh-II expression transgenes in monocots especially root confers high transcriptional level in Adh-II, while this related expression. stretch was absent in the reported promoter. The 5´ UTR Py rich stretch was first reported in the HMG2 stretch of tomato promoter, where it helps in advanced transcription Conflict of Interests (Peremarti et al., 2010). There are three motifs which were found associated with the selected Adh-II fragment The authors have not declared any conflict of interests. but have not been reported in the previously characterized Adh promoter. The first one named AuxRR-motif is present within the promoter region of ACKNOWLEDGEMENTS

Adh-II and absent in the reported Adh promoter. AuxRR- The financial support for current study was provided by motif is essential cis-element involved in auxin the Ministry of Food and Agriculture (Min. FA), responsiveness (Yang et al., 2013). Abscisic acid Government of Pakistan and Higher Education regulatory element such as ABRE is the second motif Commission (HEC), Pakistan. absent in published promoter but found in Adh-H at position 179 bp upstream of TSS. This motif is involved in abscisic acid responsiveness (Narusaka et al., 2003). REFERENCES The last identified motifs, CATT and P-box, were not reported in the patented Adh promoter but present in the Arnold CD, Gerlach D, Stelzer C, Boryń LM, Rath M, Stark A (2013). Genome-wide quantitative enhancer activity maps identified by second fragment (Adh-II) of the promoter characterized in STARR-seq. Science 339(6123):1074-1077. this studies. Atchison M (1988). Enhancers: Mechanism of action and cell specificity. To evaluate the potential strength of Adh-H promoter, Ann. Rev. Cell Biol. 4:53-71. GUS expression level was determined in various wheat Batut P, Dobin A, Plessy C, Carninci P, Gingeras TR (2013). High- fidelity promoter profiling reveals widespread alternative 23promoter tissues, that is, roots, endosperm, leaves and spike. Adh usage and transposon-driven developmental gene expression. hybrid is a constitutive promoter and is expressed at a Genome Res. 23(1):169-180. moderate level in all wheat tissues. However, expression Bestwick RK, Kellogg JA (2000). Synthetic hybrid tomato E4/E8 plant was raised many folds in roots under normal condition. promoter – Patent 18049. Chung HJ, Ferl RJ (1999). Arabidopsis alcohol dehydrogenase This shows that expression may be increased under expression in both shoots and roots is conditioned by root growth hypoxic or anoxic conditions. It is reported that environment. Plant Physiol. 121(2):429-436. Masood et al. 2393

De Boer HA, Comstock LJ, Vasser M (1983). The tac promoter: a Narusaka Y, Nakashima K, Shinwari ZK, Sakuma Y, Furihata T, Abe H, functional hybrid derived from the trp and lac promoters. Proc. Natl. Narusaka M, Shinozaki K, Yamaguchi‐Shinozaki K (2003). Acad. Sci. USA 80(1):21-25. Interaction between two cis‐acting elements, ABRE and DRE, in Deal RB, Henikoff S (2011). Histone variants and modifications in plant ABA‐dependent expression of Arabidopsis rd29A gene in response gene regulation. Curr. Opin. Plant Biol. 14(2):116-122. to dehydration and high‐salinity stresses. Plant J. 34(2):137-148. Garabagi F, Duns G, Strommer J (2005). Selective recruitment of Adh Park SH, Bang SW, Jeong JS, Jung H, Redillas MC, Kim HI, Lee KH, genes for distinct enzymatic functions in Petunia hybrid. Plant Mol. Kim YS, Kim JK (2012). Analysis of the APX, PGD1 and R1G1B Biol. 58(2):283-294. constitutive gene promoters in various organs over three homozygous Hernandez-Garcia CM, Finer JJ (2014). Identification and validation of generations of transgenic rice plants. Planta 235(6):1397-1408. promoters and cis-acting regulatory elements. Plant Sci. 217:109- Peremarti A, Twyman RM, Gómez-Galera S, Naqvi S, Farré G, Sabalza 119. M, Miralpeix B, Dashevskaya S, Yuan D, Ramessar K (2010). Hou L, Chen L, Wang J, Xu D, Dai L, Zhang H, Zhao Y (2012). Promoter diversity in multigene transformation. Plant Mol. Biol. 73(4- Construction of stress responsive synthetic promoters and analysis of 5):363-378. their activity in transgenic Arabidopsis thaliana. Plant Mol. Biol. Rep. Petolino JF, Davies JP (2013). Designed transcriptional regulators for 30(6):1496-506. trait development. Plant Sci. 201:128-136. Lee LY, Kononov ME, Bassuner B, Frame BR, Wang K (2007). Novel Satoh J, Kato K, Shinmyo A (2004). The 5′-untranslated region of the plant transformation ectors containing the super promoter. Plant tobacco alcohol dehydrogenase gene functions as an effective Physiol. 145:1294-1300. translational enhancer in plant. J. Biosci. Bioeng. 98(1):1-8. Lescot M, Déhais P, Thijs G, Marchal K, Moreau Y, Van de Peer Y, Thompson CE, Fernandes CL, de Souza ON, de Freitas LB, Salzano Rouzé P, Rombauts S (2002). PlantCARE, a database of plant cis- FM (2010). Evaluation of the impact of functional diversification on acting regulatory elements and a portal to tools for in silico analysis Poaceae, Brassicaceae, Fabaceae, and Pinaceae alcohol of promoter sequences. Nucleic Acids Res. 30(1):325-327. dehydrogenase enzymes. J. Mol. Model. 16(5):919-928. Mardanova ES, Zamchuk LA, Ravin NV (2007). The 5′-untranslated Yang Z, Patra B, Li R, Pattanaik S, Yuan L(2013). Promoter analysis region of the maize alcohol dehydrogenase gene provides efficient reveals cis-regulatory motifs associated with the expression of the translation of mRNA in plants under stress conditions. Mol. Biol. WRKY transcription factor CrWRKY1 in Catharanthus roseus. Planta 41(6):914-919. 238(6):1039-1049. Mol JNM, Stuitje AR, van der Krol A (1989) Genetic manipulation of Yoshida K, Shinmyo A (2000) .Transgene expression systems in plant, floral pigmentation genes. Plant Mol. Biol. 13:287-295. a natural bioreactor. J. Biosci. Bioeng. 90(4):353-562. Muller AE, Wassenegger A (2004). Control and silencing of transgene expression. Hand book of Plant Biotech., John Wiley & Sons, Ltd. pp. 291-330. Murashige T, Skoog F (1962). A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant. 15(3):473- 497.

Vol. 15(42), pp. 2394-2401, 19 October, 2016 DOI: 10.5897/AJB2015.14610 Article Number: 5D9291061182 ISSN 1684-5315 African Journal of Biotechnology Copyright © 2016 Author(s) retain the copyright of this article http://www.academicjournals.org/AJB

Full Length Research Paper

Production and characterization of endoglucanase secreted by Streptomyces capoamus isolated from Caatinga

Rafael Lopes e Oliveira1,3*, Camila Beatriz Atanásio Borba2, Sergio Duvoisin Junior1, Patricia Melchionna Albuquerque1,4, Gláucia Manoella de Souza Lima2, Norma Buarque de Gusmão2, Edmar Vaz de Andrade3 and Leonor Alves de Oliveira da Silva2,3

1Laboratory of Applied Chemistry and Technology, Chemical Engineering Course, School of Technology, State University of Amazonas, CEP 69050-020, Manaus-AM, Brazil. 2Department of Antibiotics, Biological Sciences Center, Federal University of Pernambuco, Brazil, CEP 50670-901, Recife-PE, Brazil. 3Multidisciplinary Support Center, Federal University of Amazonas, CEP 69077-000, Manaus-AM, Brazil. 4Graduate Program in Biotechnology and Natural Resources, School of Health Sciences, State University of Amazonas, CEP 69065-001, Manaus-AM, Brazil.

Received 31 March, 2015; Accepted 9 September, 2016

Cellulases are hydrolases of great importance to industries, especially due to their ability to produce ethanol via hydrolysis of cellulolytic materials. Actinomycetes are the producers of these enzymes, particularly the genus Streptomyces sp. The present study is the first report on the production and characterization of cellulolytic complex secreted by Streptomyces capoamus, isolated from the rhizosphere soil of Caatinga. In selecting the microbial producers of cellulolytic complex in qualitative tests, 171x microorganism showed the most expressive enzymatic index. Regarding the production time of the complex, fermentation was done for 7 days, with aliquots being taken every 24 h. Peak production was obtained during 48 h fermentation. It was done at 37ºC and under an agitation of 180 rpm. It was noted also that the 171x micro-organism produced the enzyme in greater quantity. The experiment was done with the most significant actinomycetes (171x), optimal substrate concentration (carboximeticellulose), cultivation temperature and pH of initial output. The results showed that a higher cellulolytic complex was obtained with 2% substrate, 45°C temperature and initial pH 4.0. The microorganism was identified at genus level by microculture method; and with molecular identification method, it was identified as S. capoamus UFPEDA-3410. In optimal culture conditions, this strain produced 0.309 U/mL cellulose, a good production for a thermostable endoglucanase stable in a broad range of pH and stable temperature. It has potential applications in a wide range of industries. Industrial processes are generally carried out at elevated temperatures. Therefore enzymes with a high optima temperature and stability are desired for such applications.

Key words: Cellulase activity, actinomycetes, fermentation, carboxymethyl cellulose.

e Oliveira et al. 2395

INTRODUCTION arid region of Northeast of Brazil. It has a rhizosphere rich in microorganisms that produce enzymes with Cellulose is the most abundant biological compound in biotechnological potential thus the overall objective of the terrestrial and aquatic ecosystem and is the main research is to produce and characterize endoglucanase component of plant biomass (Shankar et al., 2011). It is secreted by Streptomyces capoamus isolated Caatinga. the dominant waste material from agricultural industries in the form of stalks, stems and husk. There has been MATERIALS AND METHODS great interest in utilizing cellulose as an energy resource and feed (Balachandrababu et al., 2012). Cellulose is Screening of cellulose composed of D-glucose units linked together to form linear chain via ß-1,4-glycosidic linkages (Salmon and To select microorganisms capable of producing cellulases, qualitative assays were performed. 87 actinomycetes strains were Hudson, 1997). inoculated into agar medium containing 1% carboxymethylcellulose Cellulose is commonly degraded by cellulase. Cellulolytic (CMC), and subsequently incubated for up to 7 days at 37°C. To enzyme system is a complex mixture of enzyme proteins visualize the hydrolysis zone, plates were developed using a 0.1% with different specificities, which act synergistically to Congo red solution and then washed with a 1 M NaCl solution hydrolyze glycosidic bonds. The three major cellulase (Pratima et al., 2012). The ratio of the diameters of the hydrolysis zone and the diameter of the colony were calculated in order to enzyme activities are: Endocellulase or 1,4--D- select the largest producer of cellulase. The highest proportion was glucanglucanohydrolases (EC 3.2.1.4.); exocellulase or assumed to greater activity (Ariffin et al., 2006). 1,4--D-glucancellobiohydrolase (EC 3.2.1.91) and beta- glucosidase or -D-glucosideglucohydrolases (EC 3.2.1.21) (Nishida et al., 2007). Organism and growth

Cellulases are among the industrially important The identification of actinobacteria (171x) was carried out by hydrolytic enzymes and are of great significance in members of the genetics laboratory and collection of micro- present day biotechnology. Cellulases are widely used in organisms/UFPEDA. S. capoamus, UFPEDA-3410, a new single food, feed, textile and pulp industries (Nakari and producer of cellulase was used in this study. This was identified and Penttila, 1995). The bioconversion of cellulosic materials deposited in microorganisms culture collection (UFPEDA) at the is now a subject of intensive research as a contribution to Department of Antibiotics, Federal University of Pernambuco. The actinobacteria were cultured in ISP-2 solid at 37°C for 7 days to do the development of large scale conversion process colony purity check. beneficial to mankind (Sreeja et al., 2013). The pre-inoculum was obtained by culturing in 48 h fermentation Cellulolytics enzymes are produced from plant, animal medium containing 50 ml of ISP2 liquid in which 5 agar blocks of 9 and microbial sources. For commercial production, mm diameter was inoculated and incubated at 37°C under agitation microbial enzymes have the enormous advantage of of 120 rpm. Subsequently, 5 ml of this pre-inoculum was added to 50 mL of ISP2 liquid medium containing 1% carboxymethyl cellulose being scalable to high-capacity production by established as the only carbon source. It was incubated at 37°C for 96 h under fermentation techniques (Tahtamouni et al., 2006). stirring at 120 rpm, and then filtered to obtain the enzyme complex. Different authors report that actinomycetes are potential All assays were performed in triplicate. cellulose producers and help considerably in recycling nutrients in the biosphere. Also, they are involved in the Cellulase assay primary degradation of organic matter in compost and related materials (Goodfellow and Williams, 1983; Jang The tested filtrate was subjected to dosages of enzyme and protein and Chen, 2003; Prasad and Sethi, 2013; Mohanta, activity. The cellulolytic activity was determined using carboxymethyl 2014). cellulose as a substrate. The reaction mixture is composed of 0.5 The rise of enzyme and advancement in biotechnology ml of 1% (w / v) substrate, 0.1 M sodium acetate buffer (50 mM, pH industries have led to the research and selection of the 5.6) and 0.5 ml of the culture supernatant. The mixture was incubated at 50°C for 30 min. The reducing sugar released was sources and production processes of enzyme, since it is measured by DNS method. A cellulase activity unit was defined as a promising alternative to reduce the waste arising from the amount of enzyme which liberates 1 µmol of glucose per other industries. Enzyme production, characterization and minute. In all cases, the specific activity was expressed as units of application are an enduring, fundamental and vital area of activity per milligram of protein. current research. Caatinga, a dry tropical deciduous vegetation, Determination of protein composed of small trees, bushes and grasses, xerophiles and deciduous plants, is the largest vegetation type. It The protein concentration was determined by the method of 2 covers an approximately 845, 000 km area, in the semi- Bradford (1976) using bovine serum albumin as standard.

*Corresponding author. Email: [email protected]. Tel: +55(92)98801-5869.

Author(s) agree that this article remains permanently open access under the terms of the Creative Commons Attribution License 4.0 International License 2396 Afr. J. Biotechnol.

Enzyme production from various substrates Table 1. Screening of actinomycetes strains with cellulolytic activity. To select the source of inducing carbon for the production of the enzyme, S. capoamus strain was inoculated into Erlenmeyer flasks Microorganisms Ratio of zone size and colony size (125 mL) containing 100 ml of liquid medium ISP2. 1% of each 757 2.636 ± 0.600 substrate (carboxymethylcellulose, passion fruit residue, and corn cobs) was incubated at 37°C, and pH 6.5 under stirring (120 rpm) 818B 2.076 ± 0.400 for up to 168 h. Aliquots were taken every 24 h. The various 178 4.666 ± 0.090 enzyme complexes were subjected to enzymatic dosages, based 171X 3.961 ± 0.054 on the method previously described. All assays were performed in triplicate. 753A 0.692 ± 0.005 800X 2.65 ± 0.050 247 1.531 ± 0.240 Effect of substrate concentration, pH and temperature on 875A 2.04 ± 0.180 cellulase production 874 1.609 ± 0.210 Different substrate concentrations (0.5, 1 and 2%) were tested for 871 1.977 ± 0.090 optimizing the production of cellulolytic complex secreted by S. 869 1.833 ± 0.320 capoamus fermented under the conditions specified in the previous 867 1.857 ± 0.110 steps. The effect of initial pH (4.0 to 8.0) and temperature of 30 to 55°C on the production of cellulolytic complex was studied. After the 868 1.921 ± 0.120 incubation period, each test was submitted to enzymatic and 763 2.214 ± 0.500 protein measurements. All assays were performed in triplicate. 4T 2.300 ± 0.280 20G 2.950 ± 0.040 5M 2.300 ± 0.060 Enzyme characterization 7N 2.960 ± 0.025 Optimum pH and temperature for cellulolytic complex activity 16I 1.730 ± 0.110 12Q 1.660 ± 0.500 The best pre-established production conditions for obtaining the cellulolytic complex were characterized as optimal pH and temperature. The enzymatic activity was determined at different pH values using McIlvaine buffer of 2.5 to 8.0 at 50°C. The optimum Platinum Taq DNA polymerase (Invitrogen Life Technologies), in a temperature test reaction was performed at the optimum pH and final volume of 25 µL. The reaction conditions were: 5 min of cellulolytic complex was incubated between 30 and 90°C (Silva and denaturation at 94°C, followed by 25 cycles of 1 min at 94°C, 30 s Carmona, 2008). at 52°C and 2 min at 72°C, a final extension of 10 min at 72°C. The amplification product was analyzed by electrophoresis in 1.2% agarose gel and, subsequently, the sample was sent for Stability of cellulolytic complex at different temperatures and sequencing. The sample was sequenced by Macrogen and this pH sequence was compared to all sequences in Genbank, using the software Blast of the National Center for Biotechnology Information In the characterization of the stability of the cellulolytic complex at (NCBI) (www.ncbi.nlm.nih.gov). The sequence was aligned with the different pH, the enzymatic complex was diluted (1: 1) in McIlvaine software Clustal and the phylogenetic tree was constructed using buffer (pH 3.0 to 9.0) and maintained at 25°C for 24 h. Then Mega 5.5. Topology was assessed by analyzing bootstrap (1,000 residual enzymatic activity was determined. In the detection of the resampling). thermal stability of the cellulolytic complex, the enzyme was incubated at different temperatures (50, 60, 80) and time intervals of 10, 20, 30, 60, 90 and 192 min. The residual activity was RESULTS AND DISCUSSION determined with the optimum conditions used for the said enzyme (Silva and Camona, 2008). All assays were performed in triplicate. Cellulase activity of actinomycetes was carried out using preliminary screening method by hydrolyzing the substrate incorporated in the basal salt medium. The Molecular identification present study is a preliminary characterization of cellulase activities of 87 strains of actinomycetes isolated DNA extraction was performed through the culture grown in a liquid from the soil samples of different locations. A total of 20 medium of ISP-2 for 48 h at 37ºC. Subsequently, the sample was centrifuged and DNA extraction was performed using the Wizard (23%) actinomycetes isolates found to be positive on Genomic DNA Purification kit (Promega), according to screening media (cellulose Congo-Red agar) producing manufacturer’s instructions. The DNA sequence was assessed by clear zone (Table 1) indicated the cellulase enzyme electrophoresis on agarose gel. Then, amplification of the 16S activity. 4 were isolated and as a result, an H/C value rRNA gene was performed through the technique of polymerase greater than 2.9 was obtained (H: hydrolysis halo chain reaction (PCR), using universal oligonucleotides (fD15´- diameter; C: colony diameter (Table 1). This shows that AGAGTTTGATCCTGGCTCAG-3`; rD15´- AAGGAGGTGATCCAGCC–3´). The reaction consisted of the the strains could produce cellulases with high activities, following: a mixture of 50 ng of DNA, 10 pmoles of each which might have the potential to liberate glucose from oligonucleotide, 200 mM of dNTP, 1.5 mM of MgCl2, 1X buffer, 1 U cellulose. Previous studies have shown that, screening of e Oliveira et al. 2397

Figure 1. Effect of different substrate carboxymethylcellulose (CMC), passion fruit residue (PFP), and corn cobs (CC) on cellulase production by S. capoamus.

cellulases was carried out by carboxymethylcellulose microorganisms secrete extracellular enzymes (Santos, agar plate assay method. Hydrolysis zones were 2013). The organic residues may be used in this process visualized by staining of cellulose-agar media with not only as the carbon source, but as solid support Congo-Red solution after the growth of microorganisms (Pandey et al., 2000). (Selvam et al., 2011; Bui, 2014; Lin et al., 2012). The In this study, using carboxymethyl cellulose (CMC), 171X strains of actinomycetes were selected to study passion fruit residue (PFP) and corn cobs (CC) as their ability to secrete the cellulolytic complex in the substrate, actinobacteria S. capoamus (171X) produced fermentation liquid medium. The 171X strain had better highest CMCase enzyme in 48 h, with a peak enzymatic use when grown on CMC compared to the other activity of 0.139 U/ml for the CMC (Figure 1). From the substrates tested (Figure 1). The morphological and data obtained, it was observed that the low cost molecular features of the isolate were identified. DNA substrates tested favored the production of cellulolytic extraction was performed using the Wizard Genomic complex. These results are similar to those reported by DNA Purification kit (Promega). The strain was deposited Ferreira et al. (2012) and Santos et al. (2011) who in UFPEDA microbial culture collection center in Brazil as worked on filamentous fungi. In both research, peak UFPEDA-3410. It was preserved at Culture Collection production was obtained in 72 h culture. Ramirez and UFPEDA, Department of Antibiotics, Federal University of Coha (2003) reported the production of cellulases by 10 Pernambuco. Among well-established species of the strains of Streptomyces at 72 h. Maximum cellulolytic genus Streptomyces, 171X strain having the closest activity values were also achieved in 72 h by other strains sequence (99%) with type strains is identified as S. of Streptomyces (Ishaque and Kluepfel, 1980). capoamus. Considering the time the actinomycetes used in Cellulase production was found to be dependent upon producing the cellulolytic complex, the tested specimen the nature of the source used in culture media. The effect can be considered as more promising for industrial use; of several carbon sources on the cellulase production however, this is just one of the evaluation criteria. Similar was investigated using different substrates results were observed in other works such as Hsu et al. (carboxymethyl cellulose, corn cobs and passion fruit (2011), Alani et al. (2008), and Li and Strohl (1996). residue). The choice of the cheapest and appropriate CMC was further tested at different concentrations for substrate is of great importance for the successful the production of cellulase by S. capoamus strain. production of enzymes (Sadhu et al., 2013). The highest CMCase production increased with increase in substrate levels of extracellular cellulase activities were detected in (carboxymethylcellulose). 2% (0.237 U/mL) was optimum medium supplemented with carboxymethyl cellulose for cellulase production (Figure 2). Similar study on (Figure 1). cellulotic enzymes has been demonstrated in many The enzymatic hydrolysis of the cellulosic feedstock organisms (Narasimba et al., 2006; Kumar et al., 2012). has several advantages over the chemical processes pH is an important parameter in the production of because of its potential saccharification efficiency and enzymes. For CMCase production, pH 4.0 was found to lower energy consumption (Saratale et al., 2008, 2010). be optimum (0.2766 U/mL), as shown in Figure 3a. This During the fermentation process, the biomass-degrading result clearly indicates the acidophilic nature of 2398 Afr. J. Biotechnol.

0.05 1 2

Figure 2. Effect of different carboxymethylcellulose concentrations for cellulase production by Streptomyces capoamus.

(a) (b)

(a) (b)

30 35 40 45 50 55 Temperature (°C)

Figure 3. Effects of culture conditions on cellulaose production by S. capoamusin: (a) Culture initial pH effect (b) Temperature.

e Oliveira et al. 2399

(A) (B)

Figure 4. Temperature (a) and pH (b) influence on extracellular cellulase activity from S. capoamus.

(A) (B)

Figure 5. Temperature (a) and pH (b) influence on extracellular cellulase activity from S. capoamus.

actinomycete. George et al. (2001) and Mawadza et al. a temperature of 55°C (Crawford and Mccoy, 1972; (2000) have reported pH 4.0 as optimum for maximum Garda et al., 1997; Ramirez and Coha, 2003). cellulase production by Thermomonospora sp. and The favorable pH range used for the production of Bacillus sp., respectively. cellulase by S. capoamus was from 2.5 to 8.0; optimum Maximum extracellular cellulase production under pH was 5.5 (Figure 4b). In this range, there were shaking condition (Figure 3b) was observed only at 45°C significant activities (above 80%). for 48 h. Extracellular cellulase activity values were 0.309 Studies have shown that Streptomyces produced U/mL. Optimum temperature for CMCase production was maximum cellulase activities at pH 7.0 (Ishaque and 50°C (Jang and Chen, 2003; De Lima et al., 2005; Kluepfel, 1980; Li and Gal, 1998; George et al., 2001; Arunachalam et al., 2010). Saha et al., 2006; Prasad and Sethi, 2013). Similar results The properties of extracellular crude cellulase are with those found in this study were reported by Garda et shown in Figure 4. The profile of cellulases activity al. (1997), where S. halstedii presented maximum obtained from S. capoamus in relation to temperature cellulase activity at pH 6.0. It is shown that other genus of (Figure 4a) showed that the optimum temperature was actinomycetes, Thermomonospora sp., used a tolerable 60°C. pH of 5.0 for the production of cellulase and a wide pH Many studies have reported that the maximum activity range of 4.0 to 10.0 was used for residual enzymes of cellulases produced by bacteria has its peak in above 80% (Ishaque and Kluepfel, 1980; George et al., temperature ranging between 50 and 55°C, and it is 2001; Saha et al., 2006; Prasad and Sethi, 2013). interesting that in all the works cited, an activity above Besides optima temperature and pH, thermal stability 55°C falls below 40% of residual activity (Ishaque and constitutes a very important property for industrial Kluepfel, 1980; Li and Gao, 1996; George et al., 2001; enzymes (Gattinger et al., 1990). The thermal stability of Saha et al., 2006; Prasad and Sethi, 2013). Even in the extracellular crude cellulase obtained from studies with actinomycetes of the genus Streptomyces Streptomyces capoamus without substrate at 50, 60 and (S. halstedii, S. thermodiastaticus and S. reticuli) 80°C (Figure 5a) is quite thermostable, while the residual production peaks have shown a great cellulase activity at activity was above 80%. 2400 Afr. J. Biotechnol.

The pH stability of the cellulolytic complex of S. capoamus Gattinger LD, Duvnjak Z, Khan, AW (1990). The use of canola meal was assayed from 3.0 to 9.0 (Figure 5b). It showed high as a substrate for xylanase production by Trichoderma reesei. Appl. Microbiol. Biotechnol. 33(1):21-25. stability (above 80 %) at pH 3.0 - 9.0. George SP, Ahmad A, Rao MB (2001). Studies on This is the first report on the production of extracellular carboxymethilcellulase produced by an alkalothermophi- cellulase from S. capoamus. In optimal culture conditions licactinomycete. Bioresour. Technol. 77:171-175. this strain produced 0.309 U/mL cellulase, a good Goodfellow M, Williams ST (1983). Williams Ecology of actinomycetes. Annu. Rev. Microbiol. 37:189-216 production for a thermostable endoglucanase with a Hsu CL, Chang KS; Lai MZ, Chang TC, Chang YH, Jang HD (2011) broad range of pH and temperature stability. Industrial Pretreatment and hydrolysis of cellulosic agricultural wastes with a processes are generally carried out at elevated cellulase-producing Streptomyces for bioethanol production. Biomass temperatures; therefore enzymes with high optima Bioenergy 35:1878-1884. Ishaque M, Kluepfel D (1980). Cellulase complex of a mesophilic temperature and stability are desired for applications Streptomyces strain. Can. J. Microbiol. 26:183-189. (Viikari et al., 2007). The purification of the main Jang H, Chen K (2003). Production and characterization of components of this complex and its physicochemical thermostablecellulases from Streptomyces transformant T3e1. World characterization is being developed in our lab. J. Microbiol. Biotechnol. 19:263-268. Kumar D, Ashfaque M, Muthukumar M, Singh M, Garg N (2012). Production and characterization of carboxymethylcelulase from Paenibacilluspolyxa using mango peel as substrate. J. Environ. Biol. Conflict of Interests 33:81-84. Li X, Gao P (1996). Isolation and partial characterization of cellulose- degrading strain of Streptomyces sp. LX from soil. Lett. Appl. The authors have not declared any conflict of interests. Microbiol. 22:209-213. Li Y, Strohl WR(1996). Cloning, Purification, and Properties of a Phosphotyrosine Protein Phosphatase from Streptomyces coelicolor ACKNOWLEDGEMENT A3(2). J. Bacteriol. 178(1):136-142. Lin L, Kan X, Yan H, Wang D (2012). Characterization of extracellular cellulose-degrading enzymes from Bacillus thuringiensis strains. We acknowledge CAPES and FAPEAM for the financial Electron. J. Biotechnol. 15(3):2-7. support and the scholarship awarded to the first author. Mawadza C, Hatti-Kaul R, Zvauya R, Mattiasson B (2000) Purification and characterization of cellulases produced by twoBacillus strains. J. Biotechnol. 83:177-187. Mohanta YK (2014). Isolation of Cellulose-Degrading Actinomycetes REFERENCES and Evaluation of their Cellulolytic Potential. Bioeng. Biosci. 2(1):1-5. Nakari-Setala T, Penttila M (1995). Production of Trichoderma reesei Alani FA, William A, Anderson A, Murray M-Y (2008). New isolate of cellulases on glucose containing media. Appl. Environ. Microbiol. Streptomyces sp. with novel thermoalkalo tolerant cellulases. 61(10):3650-3655. Biotechnol. Lett. 30:123-126. Narasimba G, Sridevi A, Buddolla V, Subhosh CM, Rajasekher RB Ariffin H, Abdullah N, Umi Kalsom MS, Shirai Y, Hassan MA (2006). (2006). Nutrient effects on production of cellulolytic enzymes by Production and characterisation of cellulase by Bacilluspumilus EB3. Aspergillusniger. Afr. J. Biotechnol. 5:472-476. Int. J. Eng. Technol. 3(1):47-53. Nishida Y, Suzuki K, Kumagai Y, Tanaka H, Inoue A, Ojima T Arunachalam R, Wesely EG, George J, Annadurai G (2010). Novel (2007).Isolation and primary structure of a cellulase from the approaches for identification of Streptomyces noboritoensis TBG-V20 Japanese sea urchin Strongylocentrotusnudus. Biochimie 89:1002- with cellulose production. Curr. Res. Bacteriol. 3(1):15-26. 1011 Balachandrababu A, Revathi MM, Yadav A, Sakthivel N (2012). Pandey A, Soccol CR, Nigam P, Soccol VT (2000). Biotechnological Purification and characterization of a thermophilic cellulose from a potential of agroindustrial residues. I: sugarcane bagasse. Bioresour. novel cellulolytic strain, Paenibacillusbarcinonensis. J. Microbiol. Technol. 74:69-80. Biotechnol. 22:1501-1509. Prasad MP, Sethi R (2013). Optimization of cellulase production from a Bradford MM (1976). A rapid and sensitive method for the quantification novel bacterial isolate Mesorhizobium sp. From marine source. J. of microgram quantities of protein utilizing the principle of protein-dye Enzyme Res. 4(1):39-45. binding. Anal. Biochem. 72:248-254. Pratima G, Samant K, Sahu A (2011). Isolation of cellulose-degrading Bui HB (2014). Isolation of cellulolytic bacteria, including actinomycetes, bacteria and determination of their cellulolytic potential. Int. J. from coffee exocarps in coffee-producing areas in Vietnam. Int. J. Microbiol. Volume 2012 (2012), Article ID 578925, 5 pages. Recycl. Org. Waste Agric. 3:48. Ramirez P, Coha JM (2003). Degradación enzimática de celulosa por Crawford DL, Mccoy E (1972). Cellulases of Thermomonosporafusca actinomicetos termófilos: Aislamento, caracterización y and Streptomyces thermodiastaticus. J. Appl. Microbiol. 24(1):150- determinación de La actividad celulolítica. Rev. Peru. Biol. 10(1):67- 152. 77. De Lima ALG, Nascimento RP, Bom EPS, Coelho RRR (2005). Sadhu S, Saha P, Sen SK, Mayilraj S, Maiti TK (2013). Production, Streptomyces drozdowicziicellulase production using agroindustrial purification and characterization of a novel thermotolerant by-products and its potential use in the detergent and textile endoglucanase (CMCase) from Bacillus strain isolated from cow industries. Enzyme Microb. Technol. 37(2):272-277. dung. SpringerPlus 2(1):1-10. Ferreira Filho AS, Quecine MC, Bogas AC, Rossetto PB, Lima AOS, Saha S, Roy RN, Sen SK, Ray AK (2006). Characterization of cellulase- Lacava PT, Azevedo JL, Araújo WL (2012). Endophytic producing bacteria from the digestive tract of tilapia, Methylobacterium extorquens expresses a heterologous b-1,4- Oreochromismossambica (Peters) and grass carp, endoglucanase A (EglA) in Catharanthus roseus seedlings, a model Ctenopharyngodonidella (Valenciennes). Aquac. Res. 37:380-388. host plant for Xylella fastidiosa. World J Microbiol. Biotechnol. Salmon S, Hudson SM (1997). Crystal Morphology, biosynthesis, and 28:1475-148. Physical Assembly of celulose, chitin and chitosan. J. Macromol. Sci. Garda AL, Santamaria RI, Marcos MJ, Zhadan GG, Villar E, Shnyrov VL Rev C. Polym. Rev. 37(2):199-276. (1997). Two genes ecodingnaendoglucanase a cellulase-biding Santos FA (2013). Utilização das Cinzas de Cana-de-açúcar como protein are clustered and corregulated by a TTA codon in Material Pozolânico na Produção de Concreto. - Araçatuba, Streptomyces halsted JM8. Biochem. J. 324:403-411. SP:Fatec. e Oliveira et al. 2401

Santos TC, Amorim GM, Bonomo RCF, Franco M (2011). Sreeja SJ, Jeba MPW, Sharmila JFR, Steffi T, Immanuel G, Palavesam Determinação da atividade de CMCase e FPase da estipe A (2013). Optimization of cellulase production by Bacillus altitudinis fúngica Rhizopus sp. através da bioconversão do resíduo de APS MSU and Bacillus licheniformis APS2 MSU, gut isolates of fish seriguela (Spondias purpúrea L.). Unopar Científica Ciências Etroplussuratensis. Int. J. Adv. Res. Technol. 2(4):401-406. Biológicas e da Saúde. 13:145-149. Tahtamouni MEW, Hameed KM, Saadoun IM (2006). Biological control Saratale GD, Chen SD, Lo YC, Saratale RG, Chang JS (2008). Outlook of Sclerotiniasclerotiorum using indigenous chitolyticactinomycetes in of biohydrogen production from lignocellulosic feedstock using dark Jordan. Plant Pathol. J. 22:107-114. fermentation e a review. J. Sci. Ind. Res. 67:962-979. Viikari L, Alapuranen M, Puranen T, Vehmaanpeã J, Siika-Aho M Saratale GD, Saratale RG, Lo Y-C, Chang JS (2010). Multicomponent (2007).Thermo stable enzymes in lignocellulose hydrolysis. Adv. cellulase production by Cellulomonasbiazotea NCIM-2550 and their Biochem. Eng. Biotecnol. 108:121-145. applications for cellulosic biohydrogen production. Biotechnol. Prog. 26:406-416. Selvam K, Vishnupriya B, Bose VSC (2011). Screening and Quantification of Marine Actinomycetes Producing Industrial Enzymes Amylase, Cellulase and Lipase from South Coast of India. Int. J. Pharm. Biol. Arch. 2(5):1481-1487. Shankar TJ, Sokhansanj S, Hess JR, Wright CT, Boardman RD (2011). A review on biomass torrefaction process and product properties for energy applications. Ind. Biotechnol. 7(5):384-401. Silva LAO, Carmona EC (2008) . Production and characterization of extracellular xylanase by trichoderma inhamatum. Appl. Biochem. Biotecnol. 150(2):117-125.

African Journal of Biotechnology

Related Journals Published by Academic Journals

.Biotechnology and Molecular Biology Reviews .African Journal of Microbiology Research .African Journal of Biochemistry Research .African Journal of Environmental Science and Technology .African Journal of Food Science .African Journal of Plant Science .Journal of Bioinformatics and Sequence Analysis .International Journal of Biodiversity and Conservation