The Expression and Function of Leukocyte Immunoglobulin-Like Receptor A3: Potential Implication in Multiple Sclerosis

Hongyan An

A thesis submitted in fulfilment of the requirements for the degree of Doctor of Philosophy

School of Medical Sciences Faculty of Medicine The University of New South Wales

March 2016

THE UNIVERSITY OF NEW SOUTH WALES Thesis/Dissertation Sheet Surname or Family name: An First name: Hongyan Other name/s: Abbreviation for degree as given in the University calendar: PhD School: School of Medical Sciences Faculty: Medicine Title: The expression and function of leukocyte immunoglobulin-like receptor A3: potential implication in multiple sclerosis

Abstract LILRA3 is a soluble protein belonging to a family of highly homologous activating and inhibitory receptors mainly expressed on leukocytes and increasingly recognised as key immunoregulatory molecules in the immune system. LILRA3 gene deletion has been associated with multiple sclerosis (MS) susceptibility, but results are not consistent among different study populations. In our study, we found no link between LILRA3 gene deletion and MS susceptibility in a North American cohort. Instead, serum LILRA3 level was significantly increased in patients with MS and strongly associated with disease severity, suggesting that LILRA3 protein may play a role in disease progression. Indeed, we showed that elevated serum LILRA3 had a positive correlation with better clinical outcomes and anti-inflammatory cytokine IL-10, suggesting an anti-inflammatory role of LILRA3 in MS. Importantly, this study also suggested a potential use for measuring serum LILRA3 levels as a biomarker for disease severity in MS. The functions of LILRA3 in MS remain unknown due to the limited knowledge of its ligands. This thesis showed that Nogo 66, a potent neurite outgrowth inhibitor, is a new functional ligand for LILRA3. We showed that the high affinity binding of LILRA3 with Nogo 66 blocked Nogo 66-mediated inhibition of neurite outgrowth and promoted synapse formation in primary cortical neurons. In addition, LILRA3 is able to block Nogo 66-mediated suppression of MAPK signalling in primary cortical neurons. All these results suggested that LILRA3 acts as a broad antagonist to block the interactions between Nogo 66 and its neuronal receptors and their subsequent inhibitory effects and thus promote neuroregeneration. Despite the novel anti-inflammatory and neuroregenerative roles of LILRA3 in MS, little is known about the quaternary structure of LILRA3, which may be crucial for its ligand binding and functions. Preliminary results in this thesis showed that intracellular LILRA3 exists in multiple quaternary forms but is primarily secreted as monomeric protein and surprisingly is abundantly present in the nucleus of primary monocytes. Various quaternary structures of LILRA3 may contribute to its diverse biological functions. Importantly, this thesis unitised a new approach to study the quaternary structure of LILRA3 spatiotemporally at a single cell level.

Declaration relating to disposition of project thesis/dissertation

I hereby grant to the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or in part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all property rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation.

I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstracts International (this is applicable to doctoral theses only).

15/08/2016 …………………………………… …………………………………….. ……….………………… Signature Witness Signature Date

The University recognises that there may be exceptional circumstances requiring restrictions on copying or conditions on use. Requests for restriction for a period of up to 2 years must be made in writing. Requests for a longer period of restriction may be considered in exceptional circumstances and require the approval of the Dean of Graduate Research.

FOR OFFICE USE ONLY Date of completion of requirements for Award: COPYRIGHT STATEMENT ‘I hereby grant the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all proprietary rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation. I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstract International (this is applicable to doctoral theses only). I have either used no substantial portions of copyright material in my thesis or I have obtained permission to use copyright material; where permission has not been granted I have applied/will apply for a partial restriction of the digital copy of my thesis or dissertation.'

Signed ……………………………………………......

Date …15/08/2016…………………………………………......

AUTHENTICITY STATEMENT ‘I certify that the Library deposit digital copy is a direct equivalent of the final officially approved version of my thesis. No emendation of content has occurred and if there are any minor variations in formatting, they are the result of the conversion to digital format.’

Signed ……………………………………………......

Date ……15/08/2016………………………………………...... ORIGINALITY STATEMENT

‘I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project's design and conception or in style, presentation and linguistic expression is acknowledged.’

Signed ……………………………………………......

Date ………………15/08/2016……………………………......

TABLE OF CONTENT Table of contents ...... i List of tables ...... vi List of figures ...... vii Abbreviations ...... x Acknowledgments ...... xiv Published work from this thesis ...... xv Abstract ...... xvii Chapter 1: Introduction ...... 1 1.1 Overview ...... 1 1.2 Leukocyte immunoglobulin-like receptors (LILRs) ...... 2 1.2.1 Nomenclature of LILRs ...... 2

1.2.2 Extracellular structures of LILRs ...... 3

1.2.3 Intracellular structures of LILRs ...... 6

1.2.4 LILR-mediated activating or inhibitory signal transduction ...... 8

1.2.5 Expression and regulation of LILR mRNA and/or protein ...... 11

1.2.6 LILR ligands ...... 13

1.2.7 In vitro functions of LILRs ...... 18

1.2.8 Genetic diversity of LILRs and their associated diseases ...... 21

1.2.9 The expression of LILR protein in diseases ...... 27

1.3 Rodent orthologues of LILRs: Paired immunoglobulin-like receptors (PIRs) 29 1.3.1 The structure of PIRB ...... 30

1.3.2 PIRB ligands ...... 30

1.3.3 In vitro and in vivo functions of PIRB ...... 31

1.4 Nogo ...... 36 1.4.1 Nogo-A ...... 38

1.4.2 Nogo-B ...... 45

1.4.3 Nogo-C ...... 45

1.5 Multiple Sclerosis ...... 46 1.5.1 Environmental factors ...... 46

1.5.2 Genetic factors ...... 47

1.5.3 Diagnosis and clinical outcomes of MS ...... 48

1.5.4 The pathogenesis of MS ...... 50

1.5.5 Treatments for MS ...... 54

1.6 The potential relationship between LILRA3, Nogo 66 and MS ...... 55 1.7 Hypothesises ...... 57 1.8 Statement of and aims ...... 57 Chapter 2: Investigation of the link between LILRA3 gene and protein expression and multiple sclerosis ...... 59 2.1 Introduction ...... 59 2.2 Methods ...... 63 2.2.1 Study cohort ...... 63

2.2.2 Genomic DNA isolation from human sera ...... 63

2.2.3 LILRA3 genotyping ...... 64

2.2.4 LILRA3 Sandwich ELISA ...... 66

2.2.5 Multiplex bead cytokine assay ...... 66

2.2.6 Detection of LILRA3 in CSF by SDS-PAGE and Western blotting ...... 67

2.2.7 Statistical analysis ...... 67

2.3 Results ...... 69 2.3.1 Demography of study cohort...... 69

2.3.2 LILRA3 genotyping in patients with MS and healthy controls ...... 71

2.3.3 Links between 6.7 kbp LILRA3 gene deletion and LILRA3 protein production ...... 74

2.3.4 Comparisons of LILRA3 protein levels in sera of patients with MS and healthy controls ...... 75

2.3.5 Relationship between serum LILRA3 levels and EDSS in MS ...... 78

2.3.6 Associations between alteration in serum LILRA3 levels and changes in EDSS over time ...... 80

2.3.7 Correlations between LILRA3 and serum IL-10, IFN-γ and TNFα levels in patients with MS ...... 82 ii

2.3.8 The expression of LILRA3 protein in human CSF ...... 84

2.4 Discussion ...... 85 Chapter 3: Characterisation of functional interaction between LILRA3 and Nogo 66 ...... 91 3.1 Introduction ...... 91 3.2 Methods ...... 95 3.2.1 Cell lines culture ...... 95

3.2.2 Production of recombinant LILRA3 proteins ...... 95

3.2.3 Production and purification of recombinant Nogo 66-His ...... 96

3.2.4 Peripheral blood mononuclear cells isolation ...... 98

3.2.5 Identification of LILRA3 binding proteins from PBMCs by Mass Spectrometry ...... 98

3.2.6 Surface plasmon resonance (SPR) ...... 99

3.2.7 Co-immunoprecipitation of Nogo 66 with LILRA3 ...... 100

3.2.8 Binding of Nogo 66 to plate-immobilised LILRA3 ...... 101

3.2.9 Primary mouse and human cortical neuron cultures ...... 102

3.2.10 Co-culture primary cortical neurons with Nogo 66-His and LILRA3-His ...... 102

3.2.11 Binding of LILRA3-APtag to mouse cortical neurons ...... 103

3.2.12 Nogo-A gene silencing ...... 104

3.2.13 Assessment of neurite outgrowth in cortical neurons ...... 108

3.2.14 Immunofluorescence staining ...... 108

3.2.15 Signalling molecules involved in Nogo 66-mediated inhibition...... 110

3.2.16 RNA isolation and cDNA synthesis ...... 111

3.2.17 Conventional Polymerase Chain Reaction ...... 112

3.2.18 Quantitative Real Time- PCR ...... 112

3.2.19 Immunoprecipitation of LILRA3 from adult brain lysate...... 113

3.2.20 Regulation the expression of LILRA3 in primary human cortical neurons ...... 113 iii

3.2.21 Statistical analysis ...... 114

3.3 Results ...... 115 3.3.1 Identification of Nogo 66 as a new ligand for soluble LILRA3 ...... 115

3.3.2 Production of recombinant LILRA3 and Nogo 66 proteins ...... 118

3.3.3 Recombinant LILRA3 bound to recombinant Nogo 66 with high affinity...... 122

3.3.4 Recombinant LILRA3 bound to native Nogo 66 expressed on cultured mouse cortical neurons with high affinity and specificity ...... 124

3.3.5 Confirmation of endogenous LILRA3 binding to endogenous cell surface Nogo ...... 129

3.3.6 LILRA3 significantly reversed Nogo 66-mediated inhibition of neurite outgrowth ...... 131

3.3.7 LILRA3 increased numbers of synaptic contacts in mouse cortical neurons ...... 139

3.3.8 LILRA3 reversed Nogo 66 mediated dephosphorylation of MEK and ERK ...... 143

3.3.9 The expression and the regulation of LILRA3 in the CNS ...... 145

3.4 Discussion ...... 149 Chapter 4: Studying the quaternary forms of LILRA3 in a single cell level ...... 155 4.1 Introduction ...... 155 4.2 Methods ...... 158 4.2.1 Generation of full-length LILRA3 plasmid constructs in mammalian expression vectors ...... 158

4.2.2 Transient transfection of HEK 293T cells with LILRA3 plasmid constructs ...... 162

4.2.3 Purification of microvesicles from culture supernatant of LILRA3 overexpressing HEK 293T cells ...... 162

4.2.4 Fractionation of proteins from different cellular compartments of LILRA3 overexpressing HEK 293T cells ...... 162

4.2.5 Western blotting or silver staining for LILRA3 proteins in culture supernatants and cell lysates of transfected HEK 293T cells ...... 163

4.2.6 Time-lapse and confocal microscopic imaging of HEK 293T cells transfected with LILRA3-EGFP or LILRA3-mCherry...... 164

4.2.7 N&B analysis of fluorescent tagged-intracellular LILRA3 ...... 165

4.2.8 Localisation of nuclear LILRA3 in transfected HEK 293T cells and primary monocytes using 2-colour super-resolution microscopy ...... 165

4.3 Results ...... 168 4.3.1 LILRA3 is secreted to culture supernatant in a time dependent manner 168

4.3.2 Intracellular LILRA3 is packed in microvesicles ...... 169

4.3.3 LILRA3 is secreted as vesicle-free monomeric form ...... 172

4.3.4 Detection of monomeric, dimeric and oligomeric LILRA3 in cytoplasm and nucleus ...... 173

4.3.5 Confirmation of the expression of LILRA3 protein in cell nucleus by super- resolution fluorescence microscopy ...... 178

4.4 Discussion ...... 180 Chapter 5: Final discussion and future directions ...... 185 Chapter 6: References ...... 196

LIST OF TABLES

Table 1-1: Leukocyte immunoglobulin-like receptors nomenclature ...... 3 Table 1-2: A comparison of the amino acid sequence homology of the extracellular domain of LILRA3 with other LILRs...... 6 Table 1-3: Expression pattern of mRNA (m) and Protein (P) of LILRs ...... 12 Table 1-4: A summary of LILR ligands and their binding affinities ...... 14 Table 1-5: Summary of LILRA functions...... 19 Table 1-6: Summary of LILRB functions ...... 20 Table 1-7: LILRA3 gene allelic frequencies in various populations ...... 27 Table 1-8: A summary of PIRB ligands including MHC and non-MHC molecules ...... 31 Table 1-9: Summary of phenotypes observed in various immune cells in PIRB knockout mice ...... 32 Table 2-1: Demography of study cohort ...... 70 Table 2-2: Distribution of allelic frequency, genotypes and phenotypes of LILRA3 deletion in control subjects and patients with MS ...... 72 Table 2-3: Distribution of genotypes of LILRA3 deletion in female and male control subjects and patients with MS ...... 72 Table 2-4: Logistic and linear regression analysis to investigate the association of LILRA3 gene deletion (-/- and -/+) to clinical subtypes, age of disease onset and disease severity ...... 73 Table 2-5: Multiple regression analysis to evaluate the independent contribution LILRA3 to EDSS in context of other relevant covariates (n=440) ...... 79 Table 3-1: The list of target sequences of Nogo and scramble shRNA ...... 105 Table 3-2: Primers used for qRT-PCR amplification ...... 113 Table 3-3: Mascot search results of proteins pulled down from plasma membranes of PBMC when using LILRA3-APtag bait but not control APtag (n=3) ...... 115

LIST OF FIGURES

Figure 1-1: Schematic presentation of the structures of soluble LILRA3, activating LILRs (LILRAs) and inhibitory LILRs (LILRBs) ...... 5 Figure 1-2: Schematic diagram of signalling pathways initiated by activating and inhibitory LILRs in myeloid cells ...... 9 Figure 1-3: Gene organisation of LILRs and their genetic polymorphisms shown to link to certain diseases ...... 22 Figure 1-4: Schematic presentation of the speculated PIRB-mediated inhibition of neuroplasticity and neuroregeneration via the interaction with Nogo 66 or MHC class I molecule (MHC I) ...... 35 Figure 1-5: Schematic diagram of Nogo isoforms and structures ...... 37 Figure 1-6: Schematic representation of Nogo 66-mediated inhibition of neurite outgrowth and neuroplasticity ...... 40 Figure 1-7: Schematic diagram showing four distinct clinical outcomes in MS ..... 49 Figure 1-8: Schematic presentation of complex cells and mediators that orchestrate the forming of the MS lesions ...... 52 Figure 1-9: Schematic diagram of the potential relationship between LILRA3, Nogo 66 and MS ...... 56 Figure 2-1: LILRA3 genotyping schematic diagram and representative results .... 65 Figure 2-2: Links between LILRA3 genotype and protein expression ...... 74 Figure 2-3: Comparison of serum LILRA3 level between patients with MS and healthy controls ...... 76 Figure 2-4: Comparison of serum LILRA3 level among different subtypes of MS 77 Figure 2-5: Association of serum LILRA3 with disease severity (EDSS) ...... 78 Figure 2-6: Association between altered serum LILRA3 levels and fluctuated EDSS over time ...... 81 Figure 2-7:Correlations between LILRA3 and serum IL-10, IFN-γ and TNFα levels in 80 patients with MS ...... 83 Figure 2-8: Detection of LILRA3 protein in human CSF ...... 84 Figure 3-1: Schematic diagram of psi-LVRU6MP lentiviral vector ...... 104 Figure 3-2: Schematic presentation of lentivirus production and transduction to mouse cortical neurons ...... 107

vii

Figure 3-3: Nogo 66 is identified as LILRA3 binding protein by peptide mass spectrometry sequencing ...... 117 Figure 3-4: SDS-PAGE and silver staining of individual fractions collected during purification of recombinant LILRA3 proteins and APtag alone protein ...... 119 Figure 3-5: Production of recombinant Nogo 66-His from E.coli and purification using Profinity IMAC Nic-charged resin ...... 120 Figure 3-6: Purification of recombinant Nogo 66-His protein using HPLC ...... 121 Figure 3-7: Recombinant Nogo 66 (rNogo66) bound to recombinant LILRA3 (rLILRA3) with high affinity ...... 123 Figure 3-8: In-situ binding of recombinant LILRA3 to cell surface Nogo-A on primary mouse cortical neuron cultures ...... 125 Figure 3-9: High binding affinity of recombinant LILRA3-APtag to primary mouse cortical neurons ...... 126 Figure 3-10: Knocking down Nogo-A protein reduced LILRA3 binding to mouse cortical neurons ...... 128 Figure 3-11: Conformation of endogenous LILRA3 binding to endogenous cell surface Nogo-A and Nogo-B ...... 130 Figure 3-12: Schematic representation of Nogo 66-mediated inhibition of neurite outgrowth ...... 132 Figure 3-13: LILRA3 significantly reversed Nogo 66-mediated inhibition of neurite outgrowth in mouse cortical neurons ...... 135 Figure 3-14: Co-immunofluorescent staining of LILRA3 mediated neurite outgrowth in mouse cortical neurons by blocking the inhibitory effects of Nogo 66 ...... 136 Figure 3-15: LILRA3 significantly reversed Nogo 66-mediated inhibition of neurite outgrowth in human cortical neurons...... 139 Figure 3-16: LILRA3 increased density of synaptic contacts in mouse cortical neurons cultured for 21 days...... 141 Figure 3-17: LILRA3 increased numbers of synaptic contacts in mouse cortical neurons cultured for 14 days...... 142 Figure 3-18: Regulation of MEK/ERK signalling pathway by recombinant LILRA3 Nogo 66-mediated inhibition of neurite outgrowth ...... 144

viii

Figure 3-19: LILRA3 is expressed in cultured primary human cortical neurons and normal human brain ...... 146 Figure 3-20: Regulation of LILRA3 mRNA in primary human cortical neurons by mediators known to improve the clinical outcomes for MS ...... 148 Figure 3-21: Summary of the proposed mechanisms of LILRA3-mediated promotion of neurite outgrowth and synapse formation...... 151 Figure 4-1: The strategy of generating LILRA3-pMHneo construct ...... 160 Figure 4-2: The strategy of generating LILRA3-pEGFP and LILRA3-pmCherry constructs ...... 161 Figure 4-3: Western blotting analysis of intracellular and extracellular LILRA3 expression in HEK 293T cells over a period of 24-72 hours ...... 168 Figure 4-4: Monitoring the translation and secretion of LILRA3-EGFP in transfected HEK 293T cells under Nikon Biostation IM-Q ...... 169 Figure 4-5: High resolution time-lapse images of HEK 293T live cells transfected with LILRA3-mCherry ...... 170 Figure 4-6: High resolution images of fixed LILRA3-EGFP overexpressed HEK 293T cells ...... 171 Figure 4-7: Determination of secreted LILRA3 as vesicle-free protein ...... 172 Figure 4-8: LILRA3 protein is secreted as monomers ...... 173 Figure 4-9: N&B analysis of monomeric, dimeric and oligomeric forms of intracellular LILRA3 ...... 175 Figure 4-10: N&B analysis of multiple forms of LILRA3 in the cytoplasm and nucleus compartments ...... 176 Figure 4-11: Western blotting analysis of structural forms of LILRA3 ...... 178 Figure 4-12: Detection of LILRA3 protein in the nucleus of transfected HEK 293T cells and primary monocytes ...... 179 Figure 5-1: Schematic illustration of the proposed anti-inflammatory roles of LILRA3 via interactions with its ligands...... 190

ABBREVIATIONS

° C degree Celsius 3D 3-dimensional Ab antibody AD Alzheimer’s disease ANGPTL angiopoietin-like protein ANOVA analysis of variance AP alkaline phosphatase APC antigen presenting cell Arg arginine BBB blood-brain barrier BCR B cell receptor BDNF brain-derived neurotrophic factor BLAST basic local alignment search tool Bmax binding maximum B-NHL B cell-non-Hodgkin’s lymphoma bp base pair BSA bovine serum albumin BST2 bone marrow stromal cell antigen 2 CD cluster of differentiation cDNA complementary deoxyribonucleic acid CK creatine kinase CMV cytomegalovirus CNS central nervous system CNV copy number variation Con A Sepharose Concanavalin A-conjugated Sepharose CSF cerebrospinal fluid Cy2 Cyanine 2 fluorochrome DAPI 4',6'-diamidino-2-phenylindole DC dendritic cell DMEM Dulbecco’s Modified Eagle’s Medium DMSO dimethyl sulfoxide dSTORM direct stochastic optical reconstruction microscopy DTT dithiothreitol E.coli Escherichia coli EAE experimental autoimmune encephalomyelitis EBV Epstein-Barra Virus EDN eosinophil-derived neurotoxin EDSS expanded disability severity scale EDTA ethylenediaminetetraacetic acid EGFP enhanced green fluorescence protein ELISA enzyme-linked immunosorbent assay x

ER endoplasmic reticulum ERK extracellular-signal-regulated kinase FACS fluorescent activated cell sorting FBS foetal bovine serum FcR Fc receptor FcRγ Fc receptor common γ-chain FcαR Fc-alpha receptor FcγRI Fc-gamma receptor I FcεRI Fc-epsilon receptor I FP forward primer g acceleration of gravity GAPDH glyceraldehyde 3-phosphate dehydrogenase h hour HBSS Hanks’ Balanced Salt Solution HDLc high-density lipoprotein cholesterol HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid HIV human immunodeficiency virus HLA human leukocyte antigen HPLC high-performance liquid chromatography HPRT hypoxanthine-guanine phosphoribosyl transferase HRP horseradish peroxidase IFN interferon IL interleukin ILT immunoglobulin-like transcript IMAC immobilised metal affinity chromatography ITAM immunoreceptor tyrosine-based activating motif ITIM immunoreceptor tyrosine-based inhibitory motif kbp kilo base pair KD dissociation constant kDa kilo Dalton KIR killer immunoglobulin-like receptor LAMR1 laminin receptor LAP 2 lamina-associated polypeptide 2 LILR leukocyte immunoglobulin-like receptor LILRA activating leukocyte immunoglobulin-like receptor LILRB inhibitory leukocyte immunoglobulin-like receptor LINGO-1 leucine-rich repeat and immunoglobulin domain-containing Nogo-receptor interacting protein 1 LIR leukocyte immunoglobulin-like receptor LPS lipopolysaccharide LTC4 leukotriene C4 LTD long-term depression LTP long-term potentiation MAG myelin-associated glycoprotein

MAI myelin-associated inhibitory protein MAP 2 microtubule-associated protein 2 MAPK mitogen-activated protein kinases MHC major histocompatibility complex MHC I MHC class I molecules min minute MMP matrix metalloproteinase MOI multiplicity of infection MRI magnetic resonance imaging mRNA messenger ribonucleic acid MS multiple sclerosis N&B number and molecular brightness NgR1 Nogo receptor 1 NK cell natural killer cell NLS nuclear localisation sequence NSCLC non-small cell lung cancer OCB oligoclonal bands OD optical density for absorbance OGD oligodendrocyte OMgp oligodendrocyte myelin glycoprotein OPC oligodendrocyte precursor cell p75NTR p75 neurotrophin receptor PBMC peripheral blood mononuclear cell PBS phosphate-buffered saline PCR polymerase chain reaction PDL poly-D-lysine p-ERK phosphorylated extracellular-signal-regulated kinases pH power of hydrogen PI3K phosphatidylinositol 3-kinases PIR paired immunoglobulin-like receptor PLL poly-L-lysine PNS peripheral nervous system PPMS primary progressive MS PRMS progressive relapsing MS PSD 95 postsynaptic density protein 95 PVDF polyvinylidene difluoride (membrane) RA rheumatoid arthritis RBL rat basophilic leukaemia cell line rh recombinant human ROCK coiled-coil-containing protein kinase ROX reactive oxygen species rpm revolutions per minute RP reverse primer RRMS relapsing remitting MS

xii

RT room temperature RT-PCR reverse transcription-polymerase chain reaction RTN reticulum homology RU response unit S.aureus Staphylococcus aureus SD standard deviation SDS sodium dodecyl sulfate SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis SE shared epitope SEAP secreted placental alkaline phosphatase sec second SEM the standard error of the mean SHP Src homology 2 domain-containing phosphatase shRNA short hairpin RNA siRNA small interfering RNA SLE systemic lupus erythematosus SNP single nucleotide polymorphism SPMS secondary progressive MS SPR surface plasmon resonance SS Sjogren’s syndrome Syk spleen tyrosine kinase TBS tris buffer saline TCR T cell receptor TGF-β transforming growth factor beta TLR toll-like receptor TMB 3,3',5,5'-Tetramethylbenzidine TNFα tumour necrosis factor α Trk tropomyosin receptor kinase V volts vitamin D3 1,25-dihydroxyvitamin D3 (1,25-(OH)2 D3) Zap-70 70 kDa δ-associated protein β2m beta-2-microglobulin

xiii

ACKNOWLEDGEMENTS

I would like to express my warmest and deepest gratitude to many individuals, who have supported and encouraged me throughout my PhD candidature.

To my supervisor, Associate Professor Nicodemus Tedla, thanks for teaching me invaluable research techniques. Your immense knowledge, determination and passion for science are always inspirational. I am forever grateful for all the support and encouragement you have given me. To my co-supervisors, Dr Katherine Bryant and Dr Chai Lim, thank you for insightful comments and continuous support. You have made the completion of my PhD possible.

To all members from Dr Thomas Fath and Professor Gilles J Guillemin research groups, I am very grateful for your assistance in primary cortical neurons. To Professor Carolyn Geczy and Dr Kenneth Hsu, thank you for insightful advice and generously sharing your immense knowledge and laboratory resource.

To Dr Jesse Goyette, thank you for your assistance in thesis proofreading, constructive comments and your invaluable friendship. To Dr Enrico Klotzsch, Dr Alex Macmillan and Mrs Iveta Slapetova, thanks for teaching me various advanced imaging techniques.

To our previous lab members, Ms Ainslie Mitchell, Drs Terry Lee and Pooli Rajasekariah for their contribution to the initial ligand screening experiments and generation of plasmid DNA constructs. To all my friends, especially Drs Mijeong Park, Barry Kane, Hao Lu, Yuka Hiroshima, Yuen Ming Chung, Lincoln Gomes, Esther Lim and Kelly Mai, thanks for your encouragement and support, and most of all, your invaluable friendship in work and in life. Thank you Dr Auda Eltahla for help in the thesis formatting. To rest members of Infection and Inflammation Research, thank you for providing me with a friendly and pleasant work environment.

Last but not the least, I would like to thank my family, especially my parents and grandparents for your unconditional love, support and encouragement not only in these past years but all through my life. I hope I have made you proud. To my husband, Hisato Ando, for everything you do for me, thank you for your patience, understanding and encouragement during the preparation of this thesis.

xiv

PUBLISHED WORK FROM THIS THESIS

Publications

Lee T. H., Mitchell A., Liu Lau S., An H., Rajeaskariah P., Wasinger V., Raftery M., Bryant K., and Tedla N. (2013) Glycosylation in a mammalian expression system is critical for the production of functionally active leukocyte immunoglobulin-like receptor A3 protein. J Biol Chem 288, 32873-32885

An H., Brettle M., Lee T., Heng B., Lim C.K., Guillemin G.J., Lord M.S., Klotzsch E., Geczy C.L., Bryant K., Fath T. and Tedla N. (2016) Soluble LILRA3 promotes neurite outgrowth and synapses formation through high affinity interaction with Nogo 66. Journal of Cell science. doi: 10.1242/jcs.182006

An H., Lim C.K., Guillemin G.J., Vollmer-Conna U., Rawlinson W., Bryant K. and Tedla N. (2016) Serum leukocyte immunoglobulin-like receptor A3 (LILRA3) is increased in patients with multiple sclerosis and is a strong independent indicator of disease severity; 6.7 kbp LILRA3 gene deletion is not associated with diseases susceptibility. PLos ONE. 11:e0149200.

An H., Macmillan A., Klotzsch E., Slapetova I., Bryant K. and Tedla N. (2016) Detection of multiple forms of leukocyte immunoglobulin-like receptor A3 by Western blotting and validated in live cells by the number and brightness analysis. Manuscript in preparation.

Abstracts (as presenting author)

An H., Bryant K., Lim C.K., Guillemin, G.J., Tedla N. Natural deletion of Leukocyte Immunoglobulin-like receptor A3 may be associated with clinical outcomes of Multiple Sclerosis. Poster presented at Australasian Neuroscience Society (ANS) Conference in Melbourne, Australia, February 2013.

An H., Bryant K., Heng B., Lim C.K., Guillemin, G.J., Tedla N. Identification novel regulator of neurite outgrowth: potential implication in Multiple Sclerosis and Neurodegenerative diseases. Poster presented at Progress in MS Research Conference in Sydney, Australia, November 2013.

An H., Lim C.K., Heng B., Guillemin, G.J., Vollmer-Conna U., Bryant K., Tedla N. Increased serum LILRA3 protein is a strong predictor of disease severity in multiple

xv sclerosis. Poster presented at EMBL symposium: Mechanisms of neurodegeneration in Heidelberg, Germany, June 2015.

xvi

ABSTRACT

Leukocyte immunoglobulin-like receptor A3 (LILRA3) is a secreted protein that belongs to a family of highly homologous activating and inhibitory receptors. LILRA3 is mainly expressed by mono-myeloid cells and is increasingly recognised as a key immunoregulatory molecule in the immune system. Interestingly, LILRA3 is the only LILR that exhibits a homozygous 6.7 kbp gene deletion in a subset of populations tested. However, the clinical consequence of this genetic deletion is not well-established, although there are conflicting results with regards to the link between the LILRA3 homozygous genetic deletion and susceptibility to multiple sclerosis (MS) in different European populations. Studies in chapter 2 investigated the association of LILRA3 gene deletion polymorphism with MS in a North American cohort of European ancestry. Results showed that LILRA3 gene deletion is not a risk variant for MS susceptibility and do not affect the age of disease onset, clinical subtype or disease severity. These findings are contrary to previous studies that reported associations between LILRA3 gene deletion and MS susceptibility in German and Spanish populations, but consistent with Polish and Finnish studies, which also did not find a link between LILRA3 deletion and MS susceptibility. Owing to these conflicting genetic study results, serum LILRA3 protein levels were investigated to give a clearer representation of the association with MS. LILRA3 protein level was significantly increased in sera of patients with MS when compared with control subjects, particularly in a more severe form of the disease: primary progressive MS. Furthermore, multiple regression analysis showed that LILRA3 protein is a strong independent marker of disease severity, indicating LILRA3 may potentially be used as a biomarker to predict disease severity in MS. This is the first study to show that serum LILRA3 level is significantly upregulated in patients with severe MS and most importantly, elevated serum LILRA3 is also correlated with better clinical outcomes, suggesting LILRA3 may play a role in the pathogenesis of the disease. Interestingly, there was significant a positive correlation between serum LILRA3 level and one of the most potent anti-inflammatory cytokines, IL-10, but a negative correlation to the a pro- inflammatory cytokine TNFα, albeit weakly, suggesting LILRA3 may have anti- inflammatory functions.

LILRA3 which is the only soluble member of the LILR family, does not have transmembrane and intracellular domains, hence cannot transduce activating or inhibitory xvii signals, but has up to 85% amino acid sequence identity to the extracellular domains of a number of cell surface activating and inhibitory LILRs. Akin to the soluble TNFα and IL- 1β receptors, LILRA3 is predicted to act as an antagonist/agonist to membrane bound LILRs via shared ligands, particularly, the inhibitory LILRB2 with which it shares 81% structural homology. However, its exact functions remain unknown due to the limited knowledge about its ligands. Chapter 3 of this thesis aimed at characterising the biochemical and functional interactions of LILRA3 and Nogo 66, a candidate ligand that has been identified in the laboratory using a combination of proteomics and expression cloning. Nogo 66, a 66 amino acid surface loop of the reticulon 4 family is a potent neurite outgrowth inhibitor through interaction with its inhibitory receptors NgR and paired immunoglobulin-like receptor (PIRB)/LILRB2. Nogo 66 plays key roles in limiting the capacity of the central nervous system (CNS) to regenerate in MS. In-situ staining, biochemical studies, ligand binding assays and surface plasmon resonance confirmed that soluble LILRA3 is a specific high affinity receptor for Nogo 66. Most importantly, LILRA3 significantly reversed Nogo 66-mediated inhibition of neurite outgrowth and promoted synapse formation in both human and mouse primary cortical neurons. Furthermore, this is the first time Nogo 66 has been shown to selectively suppress phosphorylation of growth promoting kinases, MEK and ERK 1/2 in primary neurons. LILRA3 completely reversed these effects, possibly by disrupting the interactions of Nogo 66 with its inhibitory receptor PIRB/LILRB2 that can dephosphorylate the above growth promoting protein tyrosine kinases. These findings suggested new neuroregenerative functions of LILRA3 in the CNS, which are distinct from its anti- inflammatory effects in leukocytes. These dual pro-neuronal regeneration and anti- inflammatory properties of LILRA3 are potentially important in regulating the pathogenesis of MS, a disease characterised by excessive inflammation and neurodegeneration. However, how LILRA3 displays these diverse functions are unknown. Recently, our laboratory discovered that in addition to Nogo 66, LILRA3 interacts with MHC class I (HLA-B) and laminin binding receptor 1 (LAMR1), a multifunctional protein found in multiple intracellular compartments, involved in inflammation, cell proliferation and cell migration. Interestingly, the affinity of Nogo 66 binding to LILRA3 was 2 times lower than LAMR1 and 200 times higher than HLA-B. These suggested that different quaternary structures of LILRA3 may bind multiple

xviii ligands with varying affinities and display tissue/cell-specific functions, hence the rationale for the preliminary studies in chapter 4.

LILRA3 is a heavily glycosylated, cysteine rich protein with 4-5 potential di- sulphide bonds, which are likely to result in protein oligomerisation leading to the formation of various quaternary forms that may affect ligand binding, cellular distribution, secretion and functions. Indeed, binding of LILRA3 to cell surface ligands is dependent on N-glycosylation of the protein in mammalian cells and prevents it from spontaneous aggregation. Chapter 4 investigated the quaternary forms of LILRA3 using a series of advanced live cell imaging techniques including Number and Brightness (N&B) analysis and validated results using standard biochemical assays. Advanced imaging, N&B analysis together with traditional Western blotting showed that intracellular LILRA3 exists as monomeric, dimeric and oligomeric forms and is transported in microvesicles. However, LILRA3 is exclusively secreted as a fully glycosylated monomeric protein without vesicular package. These may indicate that a monomeric form of the protein is required for binding to cell surface ligands, while the intracellular dimeric or oligomeric forms may be present at the different stages of biosynthesis such as pre- and post-glycosylation. Surprisingly, measurable quantity of monomeric, fully glycosylated LILRA3 protein was also detected in the nucleus of transfected and primary monocytes, suggesting a new function of LILRA3 in the nucleus. Although the results in chapter 4 are preliminary requiring extensive future functional and structural studies, they bring a new concept that LILRA3 may have diverse functions dependent on its quaternary structure and its intracellular localisation. Moreover, this thesis provides the first proof of technique, in which confocal live cell imaging together with N&B analysis could be used as a better alternative method to conventional Western blotting to study various structural forms of protein in different compartments, spatiotemporally at a single cell level.

xix

CHAPTER 1: INTRODUCTION

1.1 Overview

The engagement of activating and inhibitory receptors through the same or similar ligand(s) on immune cells enables the immune system to tightly balance the need to effectively respond to immune challenges, such as infection, as well as to prevent excessive unregulated reactions that are detrimental to the host. Leukocyte immunoglobulin-like receptors (LILRs) are one such receptors that are increasingly recognised as key immunoregulatory molecules. Activating and inhibitory LILRs have highly homologous extracellular domains that suggest they may share the same or similar ligands. In contrast, these receptors contain differing transmembrane and intracellular domains that can transduce opposing activating or inhibitory signals. These structural characteristics together with their constitutive co-expression on the surface of immune cells make them ideal molecules for maintaining the balance between immune quiescence and reactivation.

Of particular interest to this project is LILRA3 which is the only LILR that is an exclusively secreted protein, and a proportion of the population has a natural homozygous gene deletion that is predicted to be associated with a lack of the protein. However, the functions of LILRA3 and the clinical consequence of its genetic absence are poorly understood. Interestingly, the extracellular domains of LILRA3 have 50-85% structural homology to the extracellular domains of a number of cell surface activating and inhibitory LILRs, hence it may act as a broad antagonist/agonist to these membrane bound LILRs by competing for shared ligands. However, little is known about the identity of LILRA3 ligand(s) severely hindering our understanding of its functions. Moreover, LILRs are selectively present in humans and primates; there are no LILR homologs in rodents further precluding functional studies using in vivo rodent disease models. Nevertheless, a number of clinical association studies link LILRA3 gene deletion and/or protein expression levels to diseases that are characterised by unregulated inflammation including multiple sclerosis (MS) and rheumatoid arthritis (RA), suggesting important roles in chronic inflammation.

The overall aims of this project are to investigate the link between genetic deletion of LILRA3 and the incidence of MS and determine the potential use of serum LILRA3 protein level as a biomarker of disease severity in MS as well as characterise the cellular, biochemical and functional interactions of LILRA3 with Nogo 66, a new candidate LILRA3 ligand we recently identified. Nogo 66 is a functional domain of Nogo-A, which is one of the most potent inhibitors of neuronal regeneration in the central nervous system (CNS) and is proposed to play key roles in the pathogenesis of MS.

In this chapter, first, the current literature on the structure, expression, function, and regulation of LILRs with special emphasis on LILRA3, will be thoroughly reviewed. Second, the current clinical association studies between LILR expression and diseases, particularly the controversial link between LILRA3 gene deletion and incidence of MS will be discussed. Third, an overview will be provided on the paired immunoglobulin- like receptors (PIRs), the LILR orthologues in rodents. Fourth, the structure, expression, and function of Nogo-A, with particular regards to the CNS in the context of MS, will be extensively reviewed. Fifth, clinical features, genetic links, the pathogenesis and the treatment of MS will be summarised. Finally, an overall conclusion of the reviewed literature will be summarised, leading to the hypothesis and statement of aims of this project.

1.2 Leukocyte immunoglobulin-like receptors (LILRs)

1.2.1 Nomenclature of LILRs

LILRs are a family of 13 proteins discovered by a number of groups more than a decade ago, thus many different names have been used including immunoglobulin-like transcripts (ILTs), leukocyte immunoglobulin-like receptors (LIRs or LILRs) and CD85a-m (1-4). The nomenclature was standardised to LILR by the Human Genome Nomenclature Committee (http://www.genenames.org/genefamilies/LILR) in 2000. LILRs were then classified into activating LILRs (LILRAs), inhibitory LILRs (LILRBs) and soluble LILRs based on their transmembrane and intracellular structures (2,5,6) and two pseudogenes designated as LILRP1 and LILRP2 (Table 1-1).

Table 1-1: Leukocyte immunoglobulin-like receptors nomenclature Types LILRs LIRs ILTs CD85 Others

Soluble LILRA3 LIR4 ILT6 CD85e HM43, HM31

Activating LILRA1 LIR6 CD85i

LILRA2 LIR7 ILT1 CD85h

LILRA4 ILT7 CD85g

LILRA5 LIR9 ILT11 CD85f LILRB7

LILRA6 ILT8 CD85b LILRB6

Inhibitory LILRB1 LIR1 ILT2 CD85j MIR7

LILRB2 LIR2 ILT4 CD85d MIR10

LILRB3 LIR3 ILT5 CD85a HL9

LILRB4 LIR5 ILT3 CD85k HM18

LILRB5 LIR8 CD85c

Pseudogenes LILRP1 ILT9 CD85l LILRA6P

LILRP2 ILT10 CD85m

LILRs: leukocyte immunoglobulin-like receptors; ILT: immunoglobulin-like transcript; CD: cluster of differentiation; HM: monocyte inhibitory receptor; MIR: myeloid inhibitory receptor; Table modified from (7,8).

1.2.2 Extracellular structures of LILRs

LILRs have highly homologous extracellular domains containing either two or four C2-type immunoglobulin-like domains (Figure 1-1) with structural similarities ranging between 50-85% (Table 1-2) (5,6,9). Willcox et al suggested that LILRs can be categorised into 2 groups based on the structural similarities of their extracellular domains (10). Group 1 LILRs which include activating LILRA1 and LILRA2, soluble LILRA3, inhibitory LILRB1 and LILRB2, exhibit over 80% amino acid homology, in contrast to group 2 LILRs, including LILRB3, LILRB4 and LILRB5, which show <50% homology among each other and to group 1 LILRs (10). Although functions are not fully elucidated, studies seem to indicate that group 1 LILRs may share the same or similar ligand(s) such as major histocompatibility complex (MHC) class I molecules (MHC I) (2,6,11-13),

3 while group 2 LILRs are predicted not to bind MHC I molecules (10,14,15). However, this categorisation is solely based on the amino acid sequence similarities without consideration of likely variable post-translational modifications that may impact protein structure and ligand binding properties (16-18). One such modification is protein glycosylation, and the extracellular domains of all LILRs are predicted to be heavily glycosylated, with the exception of LILRB4 (Figure 1-1) (14,19,20).

Glycosylation is one of the most important modifications that enable proteins to preserve their biochemical and functional properties including stabilisation of protein structure (16), prevention of aggregation (21) and most importantly, retaining high affinity ligand binding (17,18,20). Recently, our group demonstrated that recombinant LILRA3 proteins produced either in Escherichia coli (E. coli) or in yeast were unable to bind or display any functions due to the lack of glycosylation or abnormal glycosylation respectively (20). In contrast, mammalian produced, optimally glycosylated recombinant LILRA3 showed high affinity binding to monocytes with some in vitro functions and this interaction was in part dependent on glycosylation (20). It is also worth noting that the prediction for MHC I binding in some LILRs including LILRA2 (22), LILRA3 (13), LILRA5 (14), LILRB1 (10,23,24), LILRB2 (23,25) and LILRB4 (15), was based on the crystal structure of E.coli-produced and truncated recombinant proteins that could alter their protein structure. Thus crystallography studies utilising unglycosylated LILR proteins may not represent the corresponding native proteins. Moreover, Willcox et al’s classification does not include the possibilities of unique interactions of individual LILRs with other non-MHC-ligands. A detailed review of LILR ligands is outlined in Section 1.2.6.

Figure 1-1: Schematic presentation of the structures of soluble LILRA3, activating LILRs (LILRAs) and inhibitory LILRs (LILRBs) Both activating and inhibitory LILRs have immunoglobulin-like extracellular domains that contain multiple potential glycosylation sites (red dots). The transmembrane domain of LILRAs has a positively charged arginine (+Arg), which binds to ITAMs (immunoreceptor tyrosine-based activation motifs)-containing Fc receptor common γ-chain (FcRγ), allowing the transduction of positive signals. In contrast, LILRB contains a long cytoplasmic domain consisting of two to four ITIMs (immunoreceptor tyrosine-based inhibitory motifs), which inhibit activating signalling by recruiting one or more tyrosine or lipid phosphatases. Figure modified from (8,19).

Table 1-2: A comparison of the amino acid sequence homology of the extracellular domain of LILRA3 with other LILRs. Protein of interest Matched against Similarity percentage

LILRA1 85%

LILRA2 81%

LILRA4 67%

LILRA5 56%

LILRA6 67% LILRA3 (100%) LILRB1 83%

LILRB2 81%

LILRB3 68%

LILRB4 50%

LILRB5 63% This table is generated using Align Sequences Nucleotide BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi)

1.2.3 Intracellular structures of LILRs

1.2.3.1 Activating LILRs

Activating LILRs (LILRAs) have very short cytoplasmic domains without signalling motifs, but contain positively charged arginine residues in their transmembrane domains (refer to Figure 1-1) (8,9). This feature allows LILRAs to recruit Fc receptor common γ-chain (FcRγ), which contains a negative charged aspartic residue in its transmembrane domain, to transduce the activating signals (26). FcRγ is a widely expressed adapter carrying an immunoreceptor tyrosine-based activation motif (ITAM) in the cytoplasmic domain to initiate cell activation (26). Several studies have demonstrated that LILRA2 (27), LILRA4 (28) and LILRA5 (29) can activate monocytes and plasmacytoid dendritic cells (DCs) through the recruitment of FcRγ. The FcRγ mediated signalling pathway is summarised in Section 1.2.4. Given that all LILRAs have positively charged arginine residues in their transmembrane domains, it is likely that all LILRAs can utilise FcRγ to conduct activating signals, however, this has yet to be experimentally verified. 6

1.2.3.2 Inhibitory LILRs

Inhibitory LILRs (LILRBs) have long cytoplasmic domains, containing two to four immunoreceptor tyrosine-based inhibitory motifs (ITIMs) (Figure 1-1) (8,9), which recruit tyrosine phosphatases to transmit the inhibitory signals (9,30,31). Details of LILRB mediated inhibitory signalling will be addressed in Section 1.2.4. Interestingly, it has been shown that LILRBs exhibit different strengths of inhibitory signals despite some LILRs containing the same number of ITIMs (32).

1.2.3.3 Soluble LILRs

LILRA3 is a putative soluble protein without signalling motifs due to the absence of a transmembrane region and cytoplasmic domains (Figure 1-1) (33). The sub- classification of LILRA3 within the activating receptors (LILRA) is solely based on its close sequence homology to LILRA1 and LILRA2 (2,5,6), but it cannot transduce activating signals like other LILRAs. Renaming LILRA3 as LILRS (LILR-soluble) or using ILT/CD designation may be an ultimate way to avoid this confusion. Interestingly, increasing evidence from our laboratory and others suggest that LILRA3 may act as a soluble antagonist/agonist through competitively binding the same or similar ligands to cell surface LILRs that have high sequence homology to LILRA3 on their extracellular domains, namely LILRA1 expressed on leukocytes and LILRB2 expressed on neurons (Table 1-2) (5,20,34). Native LILRA3 protein is constitutively present in the serum of a certain proportion of the population with functional LILRA3 allele and is significantly upregulated in the serum of patients with RA comparing to healthy controls (35). However, the relevance of serum LILRA3 level remains unknown due largely to the limited knowledge about its ligand.

Interestingly, according to mRNA transcription analysis, Jones et al suggested that many other LILRs including LILRA1, LILRA2, LILRA5, LILRB1 and LILRB4 could also encode soluble isoforms as a result of the alternative mRNA splicing (36). However, no study has yet detected soluble LILR isoforms in human serum with the exception of LILRB4. Soluble LILRB4 has been only detected in the serum of patients with colorectal carcinoma, but not in healthy controls and it can counteract cell surface LILRB4 mediated inhibitory activity (37). Moreover, some in vitro overexpression studies demonstrated that soluble LILRB1 and LILRB2 have been detected in the supernatant of LILRB1 or

LILRB2 overexpressing dendritic cells and recombinant soluble LILRB1 can block the binding of MHC I to membrane bound LILRB1 (36,38). These results are in agreement with the theory of soluble LILRs acting as antagonist/agonist to cell surface LILRs.

1.2.4 LILR-mediated activating or inhibitory signal transduction

LILRAs lack signalling motifs, but can recruit the FcRγ adapter molecule to transduce activating signals (Figure 1-2) (27-29). It has been shown that LILRAs only associate with FcRγ and not with other adapter molecules such as DAP12, an adapter molecule mainly utilised by killer-cell immunoglobulin-like receptors (KIRs) to transduce signals (27-29), indicating that there is a specific activation pathway for LILRAs. The mechanisms of FcRγ-mediated cell activation are well studied (see reviews (26,39)). In brief, activated FcRγ can recruit Src family tyrosine kinase to phosphorylate both tyrosine residues in its ITAMs (Figure 1-2) (see review (40)), which then becomes the docking site for the recruitment and activation of spleen tyrosine kinase (Syk) in myeloid cells or 70 kDa δ-associated protein (Zap-70) in lymphocytes (41-43). Activated Syk or Zap-70 subsequently triggers a range of downstream signalling proteins, which result in cytokine production, calcium mobilisation, phagocytosis, migration and proliferation (41,44). A full description of FcRγ-mediated activating pathways is beyond the scope of this literature review. Beyond these general signaling mechanisms little is known about the specific mechanisms involved in LILRA-mediated signalling pathway, for example, whether all LILRAs have similar activating capability or threshold remains unknown. Further investigation in this field is required.

Figure 1-2: Schematic diagram of signalling pathways initiated by activating and inhibitory LILRs in myeloid cells Ligation of activating LILRs can recruit FcRγ to transduce activating signals. Activated FcRγ can recruit Src family tyrosine kinase to phosphorylate both tyrosine residues in its ITAMs, which become docking sites for the recruitment and activation of spleen tyrosine kinase (Syk). Phosphorylated Syk subsequently activates a range of downstream signalling proteins to promote cytokine production, calcium mobilisation, phagocytosis, migration and proliferation. At the same time, ITIMs within inhibitory LILRs are also tyrosine phosphorylated by Src, allowing the recruitment and activation of SH2-domian-containing protein tyrosine phosphatase 1 (SHP-1), which leads to deactivation of Syk and blockade of downstream activating signalling, thus attenuating the ITAM mediated activation. The balance between activating and inhibitory signals is crucial for manipulating homeostasis in myeloid cells.

LILRBs have two to four ITIMs in their cytoplasmic domains (8,9). Studies showed that LILRBs can attenuate cell activation through the recruitment of protein tyrosine phosphatases such as Src Homology 2 (SH2) domain containing protein tyrosine phosphatases (SHP-1) to their ITIMs (Figure 1-2) (6,11,32). SHP-1 can dephosphorylate various phosphorylated tyrosine kinases including Syk or Zap-70 and their substrates, thereby terminating some of the earliest ITAMs meditated downstream signalling (45). An interesting study using site-targeted mutagenesis of tyrosine residues within the ITIMs of LILRB1 demonstrated that each tyrosine residue has a differential affinity to SHP-1 and three out of four are needed for SHP-1 recruitment and cellular inhibition (32). Given that LILRBs contain different number of ITIMs in their cytoplasmic domains, it is likely that individual inhibitory LILR may recruit different types and numbers of phosphatases to the ITIMs, and thus exhibiting different inhibitory capacity.

The long considered paradigm of LILR-mediated signalling is LILRAs lead to cell activation via ITAMs and LILRBs lead to cell inhibition via ITIMs. However, this paradigm has been challenged by recent studies showing that ITAMs or ITIMs may exhibit dual activating and inhibitory functions (See review (46)). Despite the well- established activation functions of LILRAs, some studies demonstrated that cross-linking leukocytes with activating LILRA2 (47,48) or LILRA4 (28,49) profoundly inhibit pro- inflammatory mediator production in response to the Toll-like receptor (TLR) ligation in monocytes or DCs, respectively. However, the underlying mechanisms are unknown. Studying the similar ITAM-bearing receptor FcαR1 suggested that the nature of the ligand and its binding affinity may have consequences for downstream signalling. For instance, ligation of FcαR1 with monomeric IgA exerts anti-inflammatory effects, but ligation with oligomeric IgA initiates strong pro-inflammatory effects (50,51). Similar to activating LILRs, FcαR1 associates with the FcRγ adapter molecule to transduce signals, therefore, it is possible that LILRAs may also mediate dual activating and inhibitory functions through a similar process. However, this hypothesis is difficult to test, owing to the inadequate knowledge of LILR ligands, and thus it is imperative to expand this field of knowledge and further characterise the native ligands and binding affinity. Although little is known about specific LILRB-mediated activating effects via ITIMs; some similar ITIM-bearing receptors such as TREM-like transcript 1 (52), signal regulatory protein-α (53), and paired immunoglobulin-like receptor B (PIRB) (54) have shown some capacity to transduce activating signals, indicating the potential activating capability of LILRBs. 10

It seems that LILR-mediated signal transduction is much more complicated than our expectation. This is not only because of the complex dual functions of ITIMs and ITAMs, but many other signalling motifs and intracellular domains such as ITIM-like motifs (55), immunoreceptor tyrosine-based switch motifs (56) and SH3 binding domains (57,58), may also impact on the outcomes of LILR-mediated signalling transduction. A more complete overview of mechanisms involved in the intracellular signalling is reviewed by Kane and colleagues (46).

1.2.5 Expression and regulation of LILR mRNA and/or protein

LILR expression has been extensively studied at both mRNA and protein levels. LILRs are mainly expressed on monocytes, macrophages, DCs and to a lesser extent on subsets of NK cells, B lymphocytes and T lymphocytes (refer to Table 1-3) (8,11,59-63). This ubiquitous expression of LILRs suggests a diversity of functions in both innate and adaptive immune systems. Interestingly, recent studies suggested the expression of LILRB2 in human brain (64,65), reflecting a new role of LILRB2 in the CNS. Whether other LILRs are also expressed in CNS remains unknown.

Tedla et al have shown that loss of cell-surface expression of LILRB1-B4 and LILRA2 occurs with the maturation of progenitor mast cells, which indicate LILRs may be involved in mast cell development (59). However, the mediators that regulate the expression of LILRs are not fully understood. Beinhauer et al showed that cell surface LILRB2 is specifically upregulated by the anti-inflammatory cytokine interleukin-10 (IL- 10) on mature human DCs, while the soluble isoform of LILRB2 is downregulated by IL- 10 (38), suggesting that LILRs might be tightly regulated by immunoregulatory cytokines. Similarly, LILRA3 is upregulated in monocytes treated with immunosuppressive cytokine IL-10 and the immunoregulatory cytokine interferon γ (IFN-γ) in vitro but not the pro-inflammatory cytokine tumour necrosis factor α (TNFα) (35). Consistent with this, the upregulated LILRA3 mRNA is detected in monocytes from patients with psoriasis after IL-10 injection in vivo (66) and also in PBMCs from healthy subjects with endotoxin challenge in vivo (67). All these results confirm a potential role of LILRA3 in immune regulation. Notably, increasing expression of LILRs has been observed in some chronic diseases and cancers based on association studies (this will be reviewed in more detail in Section 1.2.9). Although the underlying mechanisms are

unknown, it is likely that the elevated immunoregulatory cytokines present in these inflammation conditions are responsible for the enhanced LILR expression.

Table 1-3: Expression pattern of mRNA (m) and Protein (P) of LILRs Activating LILRs Inhibitory LILRs References

Cell types A1 A2 A3 A4 A5 A6 B1 B2 B3 B4 B5

Monocytes mP P mP P mP mP mP mP mP mP (2,5,27,68-72)

Macrophages P mP P mP P m (6,27,36,68,69)

Dendritic cells P mP mP mP m mP (5,31,68,69,73)

NK cells mP mP mP mP mP mP (4-6,27)

T cells P mP (35)

B cells mP mP mP m mP m (2,4,5,35,69)

Neutrophils P mP P P mP (72,74)

Eosinophils P P P P (75)

Basophils P mP P (61)

Monocytes derived m m m P mP mP mP m m (36,76) Osteoclasts Placental stromal P (77) cells Mast cells mP m mP (59)

Bone marrow cells m (69)

1.2.6 LILR ligands

1.2.6.1 MHC I molecules as LILR ligands

LILRs attracted a lot of attention since they have been shown to bind various classical and non-classical MHC I molecules (Table 1-4) (78). MHC I molecules are a set of cell surface receptors abundantly expressed on all nucleated cells and play a crucial role in immune activation and the development of autoimmune diseases via their antigen presenting properties (79). MHC I molecules are heterodimers that consist of three polymorphic α domains (α1, α2 and α3) encoded by human leukocyte antigen (HLA) gene and a non-covalently associated soluble protein called beta-2-microglobulin (β2m) encoded β2m gene (80). MHC I molecules are classified based on the polymorphisms of α domains which includes human classical MHC I molecules HLA-A, -B and -C and non- classical MHC molecules HLA-E, -F and -G (80). These various MHC I molecules allow presentation of different self or foreign antigens to T cells leading to different immune response. Therefore, it is speculated that the engagement of LILRs with various MHC I molecules may play a role in inflammatory diseases.

The interaction of LILRB1 or LILRB2 with MHC I is well studied compared to the other LILRs. LILRB1 and LILRB2 are shown to bind most classical and non-classical MHC I molecules with diverse affinities (listed in Table 1-4). An in vitro study by Shiroishi and colleagues showed that LILRB1 and LILRB2 can interfere with the interaction between CD8 on T cells and MHC I molecules, thus preventing the activation of CD8+ T lymphocytes (12). There is a discrepancy regarding the binding affinity between LILRB1 and MHC I as reported by two groups (Table 1-4), despite the fact of both groups used surface plasmon resonance (SPR). This discrepancy is most likely caused by the recombinant LILRB1 protein used in the experiments, in which Chapman et al produced LILRB1 containing full extracellular domains D1-D4 in an insect cell line (81), whereas Shiroishi et al produced the truncated formed of LILRB1 containing only D1 and D2 domains in a bacteria system (E.coli) (12). The glycosylation sites of recombinant LILRB1 produced in these two experiments have not been characterised and given that the proper glycosylation is crucial for high affinity ligand binding (20), future studies using full length LILR with optimal glycosylation is imperative to confirm the ligand binding affinities.

Table 1-4: A summary of LILR ligands and their binding affinities

LILR Ligands Binding affinity References LILRA1 HLA-B27 - (82) HLA-C - (83)

LILRA2 Unknown - - LILRA3 HLA-A 20-40 µM (13) HLA-B - (83) HLA-C - (83) HLA-G1 20-40 µM (13) LILRA4 BST2 6 µM (28,49,84) LILRA5 Unknown - - LILRA6 Unknown - - LILRB1 HLA-A - (6,63) HLA-B 8.8 µM# ; 80 µM* (6,12,63,81,82) HLA-C 6.5 µM# ; 20-90 µM* (12,63,81) HLA-E 40 µM* (81) HLA-F - (85) HLA-G 8.8 µM# ; 100 µM* (6,12,63,81) UL18 2-8 nM (2,81) S.aureus - (86) E. coli - (86) LILRB2 HLA-A 9.74-45 µM# (6,11,12,69,83) HLA-B 26 µM# (11,12,82,83,87) HLA-C 14 -26 µM# (11,12,83) HLA-F - (85) HLA-G 4.8 µM# (12,14,69) UL18 12 nM (81) CD1d - (88,89) Nogo 66, - (65) Aβ oligomers 206-250 nM (64) ANGPTLs 5.5 nM (90,91)

LILRB3 S.aureus - (86) LILRB4 Unknown - - LILRB5 HLA-B - (70)

HLA: human leukocyte antigen; BST2: bone marrow stromal cell antigen 2; S.aureus: Staphylococcus aureus; E. coli: Escherichia coli; ANGPTLs: angiopoietin-like proteins; Aβ: β- amyloid; -: N/A; # results obtained from Shiroishi et al (12); * results obtained from Chapman et al (81).

LILRB2 has a much higher binding affinity to HLA-G, when compared to other classical MHC molecules (Table 1-4) (12). HLA-G is specifically expressed by foetal trophoblast and certain tumours, indicating specific functions of LILRB2 in foetal tolerance and tumour escape from immune attack (92-94). Interestingly, UL18, the human MHC I homologous protein produced by human cytomegalovirus (CMV) infected cells, was identified as a ligand for LILRB1 and LILRB2 (81). However, the binding affinity between UL18 and LILRB1 is a thousand times greater (nM range) than the interaction between UL18 and LILRB2 as well as LILRB1/B2 and MHC I (µM range) (10,81). These results suggest that CMV may utilise this high affinity interaction with LILRB1 to escape the immune attack by constantly sending inhibitory signals.

Although LILRB1 and LILRB2 have similar ligands, LILRB1 usually has 2-3 times higher binding affinity compared with LILRB2 (12,81). This binding affinity difference is likely due to variation of the amino acid sequence in the binding domains. Studies have showed that the binding sites of LILRB1 to MHC I are located in the distal extracellular immunoglobulin-like domain 1 and 2 (D1 and D2), in which the D1 domain engages the nonpolymorphic α3 domain of MHC, whereas the D2 domain interacts with β2m (10,81). In contrast, the crystal structure for the D1 and D2 domains of LILRB2 suggested that some predicted binding residues to MHC I would be rotated away due to different structure (95). In addition, studies using free heavy chains of HLA-B27 indicate that LILRB2, but not LILRB1, recognises the free heavy chain of HLA-B27, possibly as a result of the higher affinity interaction between LILRB1 and β2m (82). Recently, the crystal structures of the D3 and D4 domains of both LILRB1 and LILRB2 have been reported and confirm that D3 and D4 domains contain no binding sites to engage with MHC I (23), but possibly have a role in structural stabilisation.

The other LILRs shown to bind to MHC I molecules are activating LILRA1, soluble LILRA3 and inhibitory LILRB5 (Table 1-4), however, these interactions are not well characterised and little is known about underlying functions. Similarly to LILRB1 and

LILRB2, LILRA1, LILRA3 and LILRB5 also bind to HLA-B27, a subtype of MHC I molecules that is strongly associated with ankylosing spondylitis (96). LILRA1and LILRA3 binds to HLA-B27 as both the classic MHC complex and to the isolated heavy chain, whereas LILRB5 only binds to the heavy chain dimers, but not β2m-associated classic complex (70,82,83). This wide range of interactions of LILRs with multiple forms of HLA-B27 may differentially contribute to the pathogenesis of ankylosing spondylitis. In addition, limited studies have shown that LILRA1 and LILRB5 also bind to the free heavy chain of HLA-C (82,83) and HLA-B7 (70), respectively. Furthermore, LILRA3 binds both classical HLA-A*0201, HLA-C free heavy chain and non-classical HLA-G1 (13,83). Rye et al demonstrated that the binding affinities of LILRA3 D1 and D2 domains to both classical HLA-A*0201 and non-classical HLA-G1 are around 20-40 µM (13), which is much lower than LILRB1 or LILRB2 demonstrated by Shiroishi et al (~10 µM) (12). However, no functional studies have been done to elucidate the underlying mechanisms of these ligand interactions of LILRA3. Surprisingly, activating LILRA2 cannot bind to HLA class I molecules, even though it is highly homologous to the extracellular domain of LILRA1, LILRA3, LILRB1 and LILRB2 (see Table 1-2) (82). A crystal structure study using LILRA2 extracellular D1 and D2 domains has demonstrated that this may be due in part to the structural shift of the MHC-binding amino acid residues in LILRA2 (22). It is also possibly due to the use of truncated and not optimally glycosylated recombinant LILRA2 produced in E.coli for ligand binding.

1.2.6.2 Non-MHC molecules as ligands

More recently, some LILRs have been reported to interact with heterogeneous non- MHC ligands including bacteria, glycoproteins and amyloid peptides (Table 1-4). LILRA4 has been shown to bind to bone marrow stromal cell antigen 2 (BST2) (28,49,84). Despite the fact LILRA4 is an activating LILR, this interaction can inhibit TLR7 and TLR9 induced interferon production from plasmacytoid DCs (28,49,84), suggesting a dual function of LILRA4. Even though both LILRB1 and LILRB2 are shown to bind similar types of MHC I molecules due to the high similarity of their extracellular domains, they also have unique non-MHC ligands. Nakayama et al demonstrated that LILRB1, but not LILRB2, can bind to bacteria such as Staphylococcus aureus (S.aureus) and E.coli (86), while LILRB2 can uniquely bind to Nogo 66 (65), β-amyloid (64) and angiopoietin-like proteins (ANGPTLs) (90,91). Atwal et al first demonstrated that 16

LILRB2 is able to bind to Nogo 66, a neurite outgrowth inhibitor presented in the CNS (65); however, the physiological role of the LILRB2-Nogo interaction in human CNS is unknown due to the limitation of in vivo studies in human brain. Therefore, many studies have focused on the functional interaction between Nogo 66 and PIRB, the mouse orthologue of LILRB2, to gain insight into the function of LILRB2 in human CNS. A detailed review of the PIRB-Nogo 66 interaction will be outlined in Section 1.3.3.2. In support of potential novel functions of LILRB2 in the CNS, Kim et al demonstrated that LILRB2 is also the receptor for β -amyloid oligomers and is strongly associated with Alzheimer’s disease (AD) (64). Moreover, it has been shown that co-expression of LILRB2 and ANGPTLS is detected in haematopoietic stem cells and non-small cell lung cancer (NSCLC) and LILRB2/PIRB has been implied in the cancer development such as leukaemia and NSCLC through interaction with ANGPTLs (90,91). All these findings suggest that LILRB2 may have diverse roles apart from immunoregulatory function.

1.2.6.3 Shortcomings of currently identified LILR ligands

Large numbers of classical and non-classical MHC I molecules and increasing numbers of non-MHC molecules have been shown to bind various activating and inhibitory LILRs (Table 1-4), although limited studies have characterised the binding affinities and the underlying mechanisms of the functional interaction in vivo. To date, most of the ligand affinities have been characterised based on recombinant protein to protein interaction using SPR, but extensive variabilities of methodologies used for protein production cause inconsistent and varying binding affinities ranging from nanomolar to micromolar. These binding affinities are also quite low comparing with high affinity ligand-receptor interactions, which are normally within picomolar or nanomolar range. The reasons for these low binding affinities and limited functional data are in part due to using truncated and unsuitably glycosylated recombinant LILRs produced in E.coli system (12,13), or due to the alternate high affinity ligands that have not yet been identified. Moreover, it is also not clear whether LILRs require multiple ligands engaging as a complex to enhance or stabilise the ligand binding. Therefore, it is imperative to use properly glycosylated, full-length recombinant LILR proteins produced in mammalian system to identify high affinity ligands and define functions.

1.2.7 In vitro functions of LILRs

At the moment, the most common method to study the functions of LILRs is through in vitro studies with antibody cross-linking or co-ligation due to the inadequate knowledge of their ligands. Given that LILRs are only expressed by human and primates with no homologues in rodents, a lack of appropriate animal models severely hinders the progress into studying in vivo functions of LILRs. To date, more studies have been focused on inhibitory LILRs than activating LILRs due to more knowledge about inhibitory LILR ligands. The functions of activating LILRs and inhibitory LILRs are outlined in detail in Table 1-5 and Table 1-6 respectively.

Table 1-5: Summary of LILRA functions LILR Functions References

LILRA1 -Unknown

LILRA2 -Induces  monocyte calcium influx (27)  macrophage TNFα production (60)  eosinophil EDN, LTC4 and IL-12 release (75)  basophilic histamine, LTC4 and IL-4 secretion (61)  RBL cell serotonin release (27) LILRA3 -Stimulates (97)  lymphocyte proliferation  lymphocyte IL-6, IL-8, IL-1β and IL-10 production -Inhibit LPS-mediated TNFα production (20) -Potentially acts as a soluble antagonist to LILRA1, LILRA2, (20) LILRB1 and LILRB2 LILRA4 -Induces calcium influx and IFN-α production in pDCs (28) -Inhibits IFN-α and TNFα production upon co-stimulation of (49) LILRA4 with TLR7 or TLR9 on pDCs

LILRA5 -Promotes secretion of pro-inflammatory cytokines including (29,72) TNFα, IL-1β and IL-6, as well as anti-inflammatory cytokine IL- 10 in monocytes

LILRA6 -Unknown

EDN: eosinophil-derived neurotoxin; LTC4: leukotriene C4; IL: interleukin; LPS: lipopolysaccharide; RBL: rat basophilic leukaemia cell line; pDCs: plasmacytoid dendritic cells; IFN: interferon; TLR: Toll-like receptor; TNF: tumour necrosis factor

Table 1-6: Summary of LILRB functions LILR Functions References

LILRB1 -Inhibits the killing signal by engaging with MHC-I molecules on (62) NK and T cells -Inhibits T cell proliferation and reduces inflammatory cytokines (98-100) IL-2 and IFN-γ production upon co-ligation with antibodies, but upregulate anti-inflammatory cytokines such as IL-10 and TGF-β -Inhibits B cell activation upon ligation and reduces the antibody (101) production (IgG and IgE), as well as cytokine production (IL-8, IL-10, and TNFα) -Inhibits FcγRI mediated intracellular protein tyrosine (11,98) phosphorylation and reduces the pro-inflammatory cytokine production upon co-ligation with FcγRI on monocytes. LILRB2 -Inhibits FcγRI mediated monocyte signalling and cellular (11) calcium influx upon co-ligation with FcγRI on monocytes -Reduces phosphorylation and T cell activation upon co-ligation (69,102) with TCR on T cells -Reduces RBL cell serotonin release (69) LILRB3 -Reduces the secretion of histamine, LTC4 and IL-4 upon co- (61) ligation with FcεRI or LILRA2 on basophils

LILRB4 -Reduces the cellular calcium influx or cytokine production after (68) co-ligation with CD64, CD11b, HLA-DR or FcγRIII on antigen- presenting cells; -Inhibits monocyte activation and reduces TNFα production after (103) co-ligation with CD64 LILRB5 -Unknown

MHC: major histocompatibility complex; NK: nature killer; IL: interleukin; IFN: interferon; TGF-β: transforming growth factor beta; TLR: Toll-like receptor; FcγRI: Fc-gamma receptor I; TCR: T cell receptor; LTC4: Leukotriene C4; FcεRI: Fc-epsilon receptor I; CD: cluster of differentiation

1.2.8 Genetic diversity of LILRs and their associated diseases

LILR genes are located in the leukocyte receptor complex in chromosome 19q13.4, which encodes a large number of immunoglobulin superfamily proteins that have been shown to have similar structures and functions with LILRs such as killer immunoglobulin receptors (KIRs), leukocyte-associated immunoglobulin-like receptors and FcαR (104,105). A number of studies have shown that LILR genes are much more conserved compared with the other receptors in leukocyte receptor complex (34,106), thus the genetic polymorphisms within the LILR family likely cause the alteration of protein structure and expression, which may contribute to the variation of individual immune response to inflammatory diseases. Recently, polymorphisms of LILRs have been implicated in a variety of diseases including autoimmune diseases and aggressive carcinoma (Figure 1-3) (see review (107)).

Figure 1-3: Gene organisation of LILRs and their genetic polymorphisms shown to link to certain diseases Activating LILRs (white box on the left hand side) and inhibitory LILRs (green box on the left side) are distributed in centromeric and telomeric clusters with certain transcription direction (vertical arrows). The text boxes listed on the right hand side are their corresponding genetic polymorphisms that have been associated with types of diseases in corresponding populations. SNP: single nucleotide polymorphism; CK: creatine kinase; HDLc: high-density lipoprotein cholesterol; MS: multiple sclerosis; SS: Sjogren’s syndrome; B-NHL: B cell-non-Hodgkin’s lymphoma; RA: rheumatoid arthritis; SLE: Systemic Lupus Erythematosus; MPA: microscopic polyanglitis; NSCLC: nonsmall cell lung cancer. Figure modified from (107). 22

1.2.8.1 Single nucleotide polymorphism of LILRs

Single nucleotide polymorphism (SNP) is the most common type of genetic variation among people and most of SNPs have no effect on human health. However, some SNPs, known as nonsynonymous SNPs, can change the amino acid sequence of a protein, which may lead to the alteration of the protein structure and/or production, thus subsequently affecting the protein normal functions (108).

LILRB1 gene exhibits a high level of polymorphisms (8). Two studies have shown that three linked SNPs located in the promoter region of LILRB1 can lead to a differential expression of LILRB1 on the surface of human NK cells, B and T lymphocytes and monocytes (109,110). Interestingly, two SNPs have been implicated in the susceptibility to RA (109) and NSCLC (111). Kuroki et al showed that LILRB1-PE-01/01 genotype is positively associated with susceptibility to RA in a cohort of Japanese individuals who are HLA-DRB1 shared epitope (SE) negative (109), in which HLA-DRB1 SE is a risk variant located in HLA-DRB1 alleles that are associated with severe RA (109). However, LILRB1-PE-01/01 genotype was significant lower in patients with RA SE negative comparing to healthy controls in a Southwestern Europe cohort (112). This discrepancy indicates that the genetic variations of different races and ethnic groups likely contribute to the variation of disease susceptibility. Moreover, one nonsynonymous SNP (rs16985478) that changes nucleotide 5724G to 5724A leading to an amino acid change (glutamic acid to lysine), is significantly associated with susceptibility to NSCLC as well as lung cancer cell infiltration rate in a European cohort (111). Specifically, the 5724A allele was shown to play a protective role since patients with the 5724A polymorphism had less tumour cell infiltration into the lymph nodes (111).

Two nonsynonymous SNPs have been reported within the D1 domain of LILRB2 (113), however, whether these nonsynonymous SNPs affect protein structure and the binding affinity with MHC I remains unknown. Recently, four LILRB2 SNPs have been reported to have a remarkable difference between Northeast Asians (Japanese and Han Chinese) and Non-Northeast Asians (Europeans and Africans) (114), in which the nonsynonymous 59G allele commonly presented in Northeast Asians, but not in European or African populations and was strongly associated with low expression levels of LILRB2 on PBMCs (114). Moreover, LILRB2 alleles associated with low protein-expression were in strong linkage disequilibrium with LILRA3 gene deletion in Northeast Asians (114).

It is interesting that the natural selection of LILRB2 and LILRA3 genes is evolving simultaneously in Northeast Asians, suggesting LILRB2 and LILRA3 may be functional related.

LILRB3 exhibits more extensive polymorphisms than LILRB1 and LILRB2. Colonna et al have identified 15 LILRB3 variants in the bone marrow cells from 51 donors (6). In support of this, allogenic antibodies targeting LILRB3 were detected in 5.4% of patients with hematopoietic stem cell transplant, most likely due to the sequence variations between donors and recipients (115). Recently, a genome-wide association study identified that one SNP (rs11666534) in the LILRB3 gene was strongly associated with Takayasu arteritis in Turkish and North American cohorts (116), but no functional data has been shown yet.

Chang et al showed that LILRB4 is also highly polymorphic in an American cohort (117). Recently, one nonsynonymous SNP (rs1154076) in the extracellular portion of LILRB4 has been shown to alter the cell surface expression level of LILRB4 on monocytoid DCs in patients with systemic lupus erythematosus (SLE) from European- derived and Hispanic-American (118). However, another SNP (rs1048801) located in the cytoplasmic region did not affect the surface expression level on DCs (118). Interestingly, both SNPs significantly and independently increased with high levels of serum type I interferon activity in patients with SLE, but only the cytoplasmic SNP was also associated with increased serum levels of TNFα (118), suggesting that these LILRB4 polymorphisms may differentially manipulate the immune response.

LILRB5 is the least well characterized inhibitory LILR in term of the expression, functions and potential ligands, as well as the genomic polymorphism. Recently a genome wide association study conducted in a cohort of Canadians has been shown that a SNP (rs2361797) located upstream of the LILRB5 gene is significantly associated with serum levels of creatine kinase (CK) in statin users, suggesting a potential role of LILRB5 in the clearance of CK through regulating the endocytosis of immune system (119).

The polymorphisms of LILRA1 and LILRA2 have been extensively studied by Mamegano et al. They showed that LILRA2 SNP (rs2241524), but none of LILRA1 SNPs, is associated with susceptibility of SLE and microscopic polyangiitis in a group of Japanese patients (120). They also confirmed that this LILRA2 SNP has no effect on the protein structure and expression, but since it is located in the cryptic splice acceptor site, 24 this may contribute to the uncontrolled production of this LILRA2 isoform, thus potentially cause the excessive activation of immune response in inflammatory diseases (120).

Recently, SNP (rs386000) and mutation (IVS1+0T>C) in LILRA3 have been strongly associated with elevated plasma HDL cholesterol level in European populations (121-123). However, it is unclear how LILRA3 is functionally related to plasma HDL cholesterol. Moreover, a recent genome-wide association study into prostate cancer showed that a single SNP located in the LILRA3 gene has been significantly associated with benign prostatic hyperplasia in a Chinese population, particularly in patients who are less than 72 years old (124).

LILRA6 exhibits high homology with the extracellular domains of LILRB3 (around 96% in similarity). Therefore, It is not surprising that LILRA6 also exhibits comparable level of allelic polymorphisms with LILRB3 (33,71,125). To date, the polymorphisms of LILRA6 have not been linked with any disease.

1.2.8.2 Copy number variation of LILRA3 and LILRA6

Most LILR genes are well conserved among individuals. However, only LILRA3 and LILRA6 exhibit full or partial gene deletion, in which the frequency of LILRA3 gene deletion is varies among different populations.

Even though LILRA6 and LILRB3 have similar level of SNP polymorphisms, only the LILRA6 gene exhibits copy number variation (CNV) due to duplication or deletion which has been detected in some individuals from UK and Europe (Figure 1-3) (71,125). The relative level of LILRA6/LILRB3 mRNA expression is positively correlated with LILRA6 CNV genotype (71). So far, LILRA6 CNV genotype has not been linked with any clinical condition.

LILRA3 is the only LILR with a non-functional allele, which is due to a natural 6.7 kbp gene deletion, and has a varied geographic distribution among different populations. The allelic deletion frequency of LILRA3 is approximately 17% of Caucasian Western European populations, while much more extensively widespread in East Asians ranging from 70% to 85% (Table 1-7) (33,114,126-128). Interestingly, the splice-acceptor mutation of intron 1 which alternatively results in a premature-termination codon was only widely present in Northeast Asian populations (5-20%), but not detected in European

25 and African populations (114) (Table 1-7). All these result suggested that natural selection of LILRA3 gene has more impact on Northeast Asian population than European and African populations, however, the mechanisms involved remains unclear. Furthermore, there are some ambiguous results regarding the association between LILRA3 gene deletion polymorphism and diseases characterised by immune dysregulation. LILRA3 gene deletion has been shown to strongly associate with MS in German and Spanish populations (127,129) and also has been linked to Sjogren’s syndrome (SS) (130) and B cell non-Hodgkin’s lymphoma (B-NHL) (97) in German population. In comparison, studies have also suggested that the functional LILRA3 allele is the risk factor for RA (131) and benign prostatic hyperplasia (124) in some Chinese populations. Meanwhile, some studies failed to find any association between LILRA3 gene deletion and MS in Polish and Finnish populations (128,132) or psoriasis vulgaris (133), coeliac disease (134), SLE (135) in Polish, UK or South Indian populations, respectively. These discrepancies may be due to the diversity of the genetic background in different populations as well as the limited sample size. Therefore, internationally collaborated genome-wild studying with a larger sample size is crucial to fully understand the genetic association of LILRA3 with diseases. Recently, multicentre genome-wide association studies that included over 80,000 individuals of European ancestry suggested that LILRA3 gene polymorphism is not one of the more than 110 risk variants identified for MS (136-139), but these results cannot reflect the genetic association between LILRA3 and MS in Asian populations. Up to now, no study has been done to investigate the expression of LILRA3 protein in MS, which may be beneficial to understand the underlying molecular association with MS.

Table 1-7: LILRA3 gene allelic frequencies in various populations

Population Sample Allelic Premature- Functional References number deletion (%) termination allele (%) codon (%) Korean 49 84 13 3 (114)

Man in China 47 79 5 16 (114)

Japanese in Tokyo 44 78 11 11 (114)

Buryat 48 76 2 22 (114)

Japanese 119 71 19 10 (126)

Chinese Han in Beijing 45 70 11 19 (114)

Mongolian 47 56 14 30 (114)

Caucasoid (UK) 172 23 0 74 (140)

Thai 119 21 0 79 (140)

South Indian 192 18 0 82 (135)

European 59 17 0 83 (114)

German 792 17 0 83 (97)

Polish 309 16 0 84 (128)

Spanish 331 13 0 87 (127)

Palestinian 100 10 0 90 (140)

Pakistani 92 10 0 90 (140)

Nigeria 58 7 0 93 (114)

African in UK 50 6 0 94 (140)

This table is modified from (114).

1.2.9 The expression of LILR protein in diseases

Given that LILRs are potent immunoregulatory molecules that can fine tune the immune response when facing immune challenges, it is not surprising that aberrant LILR expression, in particular, those that abrogate the excessive inflammatory activation, such as inhibitory LILRs and soluble LILRA3, have been associated with a wide range of

27 diseases. However, whether this aberrant expression is contributing to disease progression or disease remission still remains unclear.

The aberrant expression of inhibitory LILRs has implied various roles in immune tolerance and infection. Chang et al demonstrated that upregulation of LILRB2 and LILRB4 expression on donor’s antigen presenting cells (APCs) is beneficial for better cardiac transplantation outcomes by rendering APC tolerogenic (102). However, the overexpression of inhibitory LILRs may be problematic for certain bacterial or viral infections since overexpression of inhibitory LILRs on APCs may decrease the antigen- presenting property and consequently influence the T-cell tolerance, thus slowing down the antigen clearance and enhancing the disease progression (7,8). For example, upregulation of LILRB1 on APCs has been observed in patients with persistent and severe Epstein-Barra Virus (EBV) or malaria (141,142) infections. Similarly, significantly increased LILRB2 on APCs has been detected in patients with severe sepsis and HIV infection comparing to healthy controls (143,144). Recently, one interesting study suggested increased expression of LILRB1 and LILRB3, but not LILRB2 is beneficial for HIV viral clearance via enhanced antigen-presenting capabilities (145). They showed that the expression of LILRB1 and LILRB3 on DCs is much higher in elite controllers (HIV patients with undetectable levels of viral load) than in progressors (HIV patients with more disease severity) and healthy controls, whereas LILRB2 expression is similar between elite controllers and progressors (145). These results indicate that inhibitory LILRs have differential roles in regulating antigen-presenting properties and thus result in different disease outcomes.

Interestingly, an increasing number of studies have linked the overexpression of LILR with various malignancies. Wisniewski et al have shown a high level of LILRB1 expression in tumour specimens from patients with lung cancer and the expression level is significantly correlated with tumour stage (111). In addition, overexpression of LILRB2 and LILRB4 have been shown in tissues from patients with human breast cancer (146) and chronic lymphocytic leukaemia (147) respectively. Furthermore, soluble LILRB4 has only been detected in sera of patients with colorectal carcinoma, but not in healthy controls (37). All these results indicate that LILRs may play an important role in tumorigenesis. Given that inhibitory LILRs can alter antigen-presentation in DCs, this

28 may enable tumour cells to evade the host immune attack by suppressing T cell activation, thus favouring tumorigenesis.

The aberrant LILR expression has also been reported in autoimmune diseases such as RA. Abundant expression of LILRB2, LILRB3 and LILRA2 are detected in the synovial biopsies from patients with active RA (60) and LILR expression is remarkably decreased in patients with better response to treatments (60). More recently, some correlation studies have also shown that the expression levels of LILRA3 and LILRA5 are increased in patients with RA and strongly correlated with RA activity (35,148); in particularly, serum LILRA3 can be significantly decreased after treatment (35). However, the mechanisms upregulating the expression of LILRs in context of autoimmune diseases remain unknown. This is partially due to the limited knowledge of their ligands.

1.3 Rodent orthologues of LILRs: Paired immunoglobulin- like receptors (PIRs)

LILR proteins are only expressed in human and primates with no homologues in rodents. This has severely hindered the process of studying LILR in vivo functions. However, PIRs and gp49 (mouse LILRB4) on chromosome 3 are considered the rodent orthologues to human LILRs and have been shown to have similar immunoregulatory functions (149,150). Unlike LILRs which have multiple members, PIRs contain two members, PIRA and PIRB. These receptors are co-expressed on various murine hematopoietic cell lineages including B cells, mast cells, macrophages, granulocyte and dendritic cells and tightly regulate the murine immune system (151-153). Recently, PIRs have been found to be expressed on mouse neurons (154,155), indicating a new role in the CNS. PIRA has not been well studied, but it has been shown to functionally resemble activating LILRs. Similar to LILRAs, PIRA also recruits the ITAM-containing FcRγ adapter to transduce activation signals. Cross-linking PIRA with anti-PIRA antibody can induce calcium flux and a degranulation response on the rat mast cell line (RBL-2H3) (150,156-158). On the other hand, PIRB has been more extensively studied and have been shown to be involved in various functions in both the immune system and the CNS. The following sections will review the structure, ligands and functions of PIRB in detail.

1.3.1 The structure of PIRB

PIRB contains six immunoglobulin-like extracellular domains (159) and similar to inhibitory LILRB1 and LILRB2, PIRB contains four intracellular ITIMs that can recruit SHP-1/2 to conduct inhibitory signals (160). Each of these four ITIM motifs exhibits different inhibitory effects. For example, the third and fourth ITIM motifs are crucial for maximising the inhibition of cell degranulation and calcium mobilisation in RBL-2H3 cells (150) and play a critical role in inhibiting the B cell receptor (BCR)-induced calcium mobilisation (160) in a B cell line (DT40 cells), in contrast, first and second ITIMs have the least inhibitory effect in those cell lines (160).

1.3.2 PIRB ligands

Similar to LILRB, PIRB has been shown to bind various MHC I molecules (Table 1-8), also known as H-2 molecules in mice. SPR analysis of the interaction between MHC I molecules and recombinant PIRB ectodomains indicated that PIRB binds to a broad range of MHC I molecules with different binding affinities (161,162). Similar to LILRB1, it has been shown that recombinant PIRB also binds to β2m (12,161) and this interaction is important for conducting inhibitory signals since β2m knockout mice had a significant reduction in PIRB-mediated tyrosine phosphorylation (163).

Recently, PIRB has been shown to bind several non-MHC ligands such as S.aureus, ANGPTLs, Nogo 66 and myelin-associated glycoprotein (MAG) (Table 1-8), which is similar to what has been shown in some inhibitory LILRs (refer to Section 1.2.6). Two studies have characterised the binding affinities of PIRB with Nogo 66 or MAG, but showed large differences (65,162). This discrepancy is likely due to the different methodologies; Atwal et al calculated the binding affinity based on the plate-based alkaline phosphatase binding assay, while Matsushita et al use the gold standard method of SPR. Matsushita et al further compared the binding affinities of PIRB with MHC and non-MHC molecules, showing that PIRB has much stronger binding affinities to some of H-2 molecules (for example, H-2Ld 290 nM) than Nogo 66 (0.57 µM) or MAG (33 µM), indicating that PIRB has a hierarchical interaction to its ligands.

Table 1-8: A summary of PIRB ligands including MHC and non-MHC molecules Ligand(s) Binding affinity References

MHC I /H-2 H-2Ld 290 nM (161) H-2Dd 190 nM (161) H-2Db 4.8 µM (162) H-2Kb 320 nM (161) H-2Kk 200 nM (161) H-2Kd 560 nM (161) Non-MHC S.aureus - (86) ANGPTLs - (90) Nogo 66 45 nM#; 0.57 µM* (65,162) MAG 14 nM#; 33 µM* (65,162) Aβ oligomers 110-180 nM (64) S.aureus: Staphylococcus aureus; ANGPTLs: angiopoietin-like proteins; MAG, myelin- associated glycoprotein; Aβ oligomers: β-amyloid oligomers. # Results obtained from (65); *Results obtained from (162).

1.3.3 In vitro and in vivo functions of PIRB

1.3.3.1 Role in the immune system

During the past 10 years, the physiological roles of PIRB in the immune system have been extensively studied using PIRB knockout mice. Considering the ubiquitous expression of MHC I molecules on immune cells, the interaction between PIRB and MHC I plays a major role in immune homeostasis. Table 1-9 outlines the phenotypes of various immune cells observed in PIRB knockout mice, suggesting that PIRB is involved in a wide range of immunoregulatory roles in the immune system via interaction with MHC I. As this field of work has been extensively reviewed (156,159,164), it will be not explained in detail.

Table 1-9: Summary of phenotypes observed in various immune cells in PIRB knockout mice Cell types Functions References B cells -Enhanced proliferation upon BCR stimulation (165) -Enhanced proliferation and autoantibody production upon (166) stimulation Macrophages -Enhanced activation and migration (167) -Sensitive to Salmonella infection (168) -Reduced binding of S.aureus and enhanced pro- (86) inflammatory cytokine production DCs -Impaired maturation (165) CD8+ T cells -Augmented activation (169) Mast cells -Augmented anaphylaxis (170) Neutrophils -Augmented integrin signalling (167,171) Eosinophils -Enhanced recruitment in Th2 response (54) Table modified from (164)

In addition to MHC I, PIRB also recognise several other ligands such as bacterial cell surface components and ANGPTLs to influence the immune response (Table 1-8). Nakayama et al demonstrated that interaction between S.aureus and PIRB suppressed macrophage activation and PIRB knockout mice experienced enhanced inflammation after S.aureus infection but were more effective at clearing the bacteria (172). This study suggested that bacteria can utilise the inhibitory functions of PIRB to dampen the TLR- induced inflammatory activation in macrophages in order to evade the immune attack. Similar to the interaction between LILRB2 and ANGPTLs, binding PIRB to ANGPTLs can inhibit leukaemia cell differentiation and support haematopoietic stem cell repopulation, thus influencing leukaemia development (90).

1.3.3.2 Role in the central nervous system

Some intriguing studies demonstrated that PIRB and one of its human orthologue LILRB2, are expressed on neural cells and potentially act as a negative regulator to suppress the axonal regeneration and synaptic plasticity (64,65). The mechanism is thought to involve interaction with neuronal ligands such as neuronal expressed MHC I and three myelin-associated inhibitory proteins (MAIs) (reviewed in (154,155)). 32

Recent studies demonstrated that MHC I molecules such as H-2Kb and H-2Db are expressed in neurons in both healthy and pathological conditions and the expression level is associated with the neuronal differentiation and neuronal plasticity (173-175). Despite the potential functions in neuroinflammation, the interaction between PIRB and MHC I has been implicated in regulating synaptic plasticity and motor learning in healthy brains as high expression of MHC I is detected in pre- and post-synapses of neurons (see review (173)). Syken et al were first to show that PIRB binds to cortical neurons in an MHC I- dependent manner (176). Moreover, mutant mice lacking either PIRB or MHC I display a similar phenotype, which have more robust cortical ocular dominance (visual cortex) plasticity after monocular deprivation (177), suggesting that PIRB may be involved in MHC I-mediated neuronal plasticity. Intriguingly, Adelson et al suggested that targeting PIRB and MHC I also can promote motor neuron recovery after stroke (178). They showed that the neuronal expression of MHC I including H-2Kb and H-2Db as well as PIRB and its downstream signalling are greatly elevated in mouse stroke model and either H-2Db or PIRB knockout mice can enhance motor recovery after stroke compared to the wild type mice (178).

In addition to MHC I, PIRB also binds to three MAIs including Nogo, oligodendrocyte myelin glycoprotein (OMgp) and myelin-associated glycoprotein (MAG) to negatively regulate neurite outgrowth and plasticity, which are unfavourable for neuroregenertaion after CNS injury (65,154,155). Studying single, double and triple MAI-knockdown mice indicated that Nogo is the primary inhibitory protein to suppress neuroregeneration, while MAG and OMgp contribute synergistic effects (179). Atwal et al’s initial study showed that the interaction of PIRB with Nogo 66 functionally inhibits neurite outgrowth on neuronal cells (65). This result was further confirmed by various in vitro studies demonstrating that diminished PIRB function using either neutralising antibody or RNA interference can prevent the Nogo-mediated inhibition of neurite outgrowth and promote axonal regeneration in cortical neurons (65,180). Similarly, cortical neurons treated with PIRB antibodies are capable of axonal regeneration after oxygen and glucose deprivation (181). Consistent with in vitro studies, PIRB knockdown mice demonstrated greater visual cortical plasticity and higher dendritic spine density than control mice after a period of monocular deprivation, which is an experimental technique to delay the development of cortical plasticity (176,182). These results indicate

33 that PIRB plays a potent role in the formation of synaptic plasticity that is crucial for learning process and memory. However, some studies failed to demonstrate axonal regeneration in PIRB knockout mice after spinal cord injury (183,184), suggesting that alternative binding receptor for MAIs is available to inhibit neurite outgrowth. Indeed, in addition to PIRB, Nogo also binds to Nogo receptor complex to regulate neurite outgrowth and synaptic plasticity (refer to Section 1.4.1.2) (185). Mice with knockout Nogo receptors alone also failed to regenerate axons after spinal cord injury (186), however, blocking both PIRB and Nogo receptor activities leads to near-complete reversal of the MAI-mediated inhibition in cultured neurons (65), suggesting that PIRB and Nogo receptor have synergistic effects on MAI-mediated inhibition.

The downstream mechanisms of PIRB-mediated inhibitory signalling in neurons remain unknown. It is speculated that it may trigger a similar inhibitory pathway as reported in the immune system (refer to Section 1.2.4), which involves the recruitment and activation of SHP-1/2 phosphatase to dephosphorylate a wide spectrum of growth- promoting protein tyrosine kinases that are involved in the downstream signalling of neuroplasticity and neurite outgrowth in neurons (176,187). One study showed that ligation of PIRB with MAG on the surface of neurons can recruit SHP-1/2 to dephosphorylate tropomyosin receptor kinase (Trk) receptor (187), a brain-derived neurotrophic factor (BDNF) receptor that can promote neurite growth through activation of MAPK pathway (188). Further study in mice with SHP-1/2 protein knockdown demonstrated significant optic nerve regeneration (187), indicating that PIR-mediated SHP recruitment is an important mechanism for neurite outgrowth. However, no study has investigated the specific signalling mechanism of PIRB interaction with neuronal MHC I or Nogo 66. We speculate that this interaction will trigger a similar mechanism to the PIRB-MAG interaction, which involves the recruitment of SHP-1/2 phosphatase to inhibit Trk-mediated MAPK signalling pathway (Figure 1-4).

Figure 1-4: Schematic presentation of the speculated PIRB-mediated inhibition of neuroplasticity and neuroregeneration via the interaction with Nogo 66 or MHC class I molecule (MHC I) After ligation, PIRB ITIMs recruit SHP-1/2 phosphatases to dephosphorylate tropomyosin receptor kinase (Trk) mediated downstream MAPK signalling such as downregulation of phosphorylated MEK, ERK and AKT, thus inhibiting the neuroplasticity and neurite outgrowth.

In summary, PIRB has been shown to have pivotal roles in neuroregeneration and synaptic plasticity through the interaction with MHC I and Nogo in the CNS, which may imply the potential functions of human LILRB2 in CNS. Given that soluble LILRA3 exhibits 81% homology with the extracellular domains of LILRB2 (Table 1-2), it is therefore possible that LILRA3 also interacts with Nogo protein, which may interfere with the interaction between Nogo and PIRB/LILRB2 reversing Nogo mediated inhibitory functions. However, this requires further investigation. It is clear that PIRB interacts with MHC I in both the immune system and the CNS, but it is unclear whether PIRB-MHC I mediated inhibition of neurite outgrowth and synaptic plasticity in vivo is due to the changes in the immune response, direct effects on neural plasticity or both. Further study using cell-type-specific knockout mice is imperative to dissect the relative contribution of peripheral immune cells, neurons, and neuronal glia to damage and impaired recovery.

1.4 Nogo

Nogo, also known as reticulon-4, belongs to the reticulon protein family that is predominantly expressed in the endoplasmic reticulum (ER) (189,190). However, Nogo is found both in the ER and on the cell surface (191-193), suggesting that Nogo may have both intracellular and extracellular functions. Compared to the intracellular functions, the extracellular functions of Nogo have been extensively studied. The following sections will focus on cell surface Nogo and discuss its expression, potential ligands and extracellular functions in detail.

Nogo exists in three isoforms, Nogo-A, -B and -C due to the alternative gene transcription (Figure 1-5) (193,194) and their molecular weights are ~200 kDa, ~55 kDa and ~25 kDa respectively. The N-terminal region of Nogo exhibits great difference among the three isoforms (Figure 1-5); Nogo-A and Nogo-B have an identical N-terminal region, but Nogo-A has a much longer exon 3 than Nogo-B containing an extra 800 amino acids (191,195). In contrast, Nogo-C has a much shorter N-terminal region consisting of just a few amino acids. Despite these differences in the N-terminal region, all three Nogo isoforms share a common carboxyl region (191,195), known as reticulum homology (RTN) domain, which consists of two transmembrane domains and a highly conserved 66 amino acid extracellular loop called Nogo 66 (Figure 1-5) (189,194). Nogo 66 is the

36 interaction region for ligand binding and consequently triggers the inhibitory signalling pathway on neurons and oligodendrocytes (194). The three Nogo isoforms have very different distribution patterns throughout the body and the nervous system, indicating that Nogo has multiple independent functions according to its location.

Figure 1-5: Schematic diagram of Nogo isoforms and structures (A) Alternatively spliced isoforms of Nogo include Nogo-A (200 kDa), Nogo-B (55 kDa), and Nogo-C (25 kDa). All Nogo isoforms contain the inhibitory Nogo 66 domain (red) located between the two transmembrane domains (green). The N-terminus (purple) is similar between Nogo-A and Nogo-B, but is much shorter in Nogo-C. (B) The C-terminus of Nogo is located in the cytoplasm, while the Nogo 66 domain is extracellular. Nogo-A has a distinctive N-terminal region (amino-Nogo) that has alternatively been reported to be either intracellular or extracellular. Amino-Nogo can induce its independent inhibitory mechanisms. This figure is summarised and modified from (189,196)

1.4.1 Nogo-A

Nogo-A attracted a lot of attention since a critical role in neuronal regeneration and plasticity in the adult CNS has been implied. Under normal physiological conditions, Nogo is crucial for guiding neuron development and maintaining CNS structure and functions. However, the inhibitory properties of Nogo also greatly restrict the neuronal regeneration after brain injury or disease. Two functional domains have been identified in Nogo-A including amino-Nogo and Nogo 66, both of which can induce growth cone collapse via the same intracellular signalling pathway but via different binding receptors (194,197). It has been shown that Nogo 66 interacts with Nogo receptor 1 (NgR1) (refer to Section 1.4.1.2) and PIRB (refer to Section 1.3.3.2) to conduct the inhibitory signals (65,185), however, the specific receptor for amino-Nogo is unclear, but it seems to indirectly interact with αv and α5 integrins to manipulate the inhibitory function (185,198). Although amino-Nogo does not strongly interact with NgR1, it can enhance the binding affinity between Nogo 66 and NgR1 (199,200). Interestingly, the topology of cell surface Nogo-A exhibits some variation, in which amino-Nogo may present either inside or outside the cell, but Nogo 66 region is always outside the cell (201).

1.4.1.1 Nogo-A expression

Nogo-A is mainly expressed in the CNS specifically in oligodendrocytes and neurons, but not in astrocytes (202-204). The expression of Nogo-A is increased with the process of neuron maturation. There has been shown to be little or often undetectable Nogo-A in neurons after birth (203,205), however, large amounts of Nogo-A are detected in the mature central and peripheral neurons, particularly in those with long axons (202,203,205,206), suggesting a potential role in neuronal development. Certain types of neurons express high levels of Nogo-A, particularly those neurons that have been characterised with high plasticity in their connections such as olfactory bulb, pyramidal cells and interneurons in the hippocampus, spinal motor neurons and dorsal root ganglion cells (203,207-210). These expression patterns suggested that Nogo-A plays a role in the regulation of synaptic plasticity. Moreover, upregulation of Nogo-A was observed in oligodendrocytes in tissue surrounding chronic active demyelinating multiple sclerosis lesions (211), in oligodendrocytes and neurons of a rat spinal cord weight drop model (212) and in injured spinal cord tissue (213), suggesting aberrant Nogo-A expression is associated with the pathogenesis of neuronal diseases. 38

Interestingly, Schwann cells, peripheral nervous system (PNS) cells analogous to the oligodendrocytes of the CNS do not express Nogo-A (214). This finding may explain the reason why axonal regeneration after injury is harder to achieve in CNS compared with the PNS. In support of this, Pot’s group demonstrated that overexpressing Nogo-A in Schwann cells significantly reduces the ability of axonal regeneration after injury (214), which is in a good agreement with the inhibitory role of Nogo-A in the CNS.

1.4.1.2 Nogo 66 Receptors

To date, two receptors have been demonstrated to interact with Nogo 66 to inhibit neurite outgrowth and neuroplasticity in the CNS: NgR1 and PIRB. The functional interaction between Nogo 66 and PIRB has been reviewed in detail in Section 1.3.3.2. Interaction of Nogo 66 with NgR1 (Figure 1-6) has been extensively studied and a comparison to the Nogo 66-PIRB interaction will be the main focus in the following section.

Figure 1-6: Schematic representation of Nogo 66-mediated inhibition of neurite outgrowth and neuroplasticity Interaction of Nogo 66 with NgR1 complex leads to the activation of RhoA-GTPase, coiled-coil- containing protein kinase (ROCK) pathway, which causes growth cone collapse and inhibits neurite outgrowth. In comparison, PIRB-mediated downstream signalling upon Nogo 66 ligation remains unknown. It is speculated that the binding of Nogo 66 to PIRB may recruit SHP-1/2 to deactivate the Trk mediated MAPK signalling pathway, which is important for neurite outgrowth and formatting synaptic plasticity in neurons, thus leading to the inhibition of neuroplasticity and neurite outgrowth. However, this requires further investigation.

NgR1 belongs to the NgR family that also consists of NgR2 and NgR3. NgR1 was the first documented receptor for Nogo 66 (185); NgR2 and NgR3, although structurally similar to NgR1 with comparable expression patterns in the CNS, do not bind to Nogo 66 (215,216). NgR1 lacks an intracellular signalling domain, but can interact with co- receptors to conduct inhibitory signals (Figure 1-6). The co-receptors include LINGO-1 (leucine-rich repeat and immunoglobulin domain-containing Nogo-receptor interacting protein 1) (217) and p75 neurotrophin receptor (p75NTR or p75) (218) or TROY (TNF- Receptor Super family member 19) (219). NgR1 is a GPI-linked protein and strongly expressed in cortical neurons (218,220). It consists of ten leucine-rich repeat domains (216,221,222), which are required for Nogo 66 binding and the C-terminal domain is essential for p75 binding to conduct inhibitory signalling (218,220,223).

The downstream signalling pathway of Nogo 66 engagement to NgR1 involves the initial activation of small GTPase RhoA and subsequent activation of Rho-associated coiled-coil-containing protein kinase (ROCK) (188,197,224), which eventually results in the rearrangement of cytoskeleton and growth cone collapse (Figure 1-6). This pathway is confirmed by several studies showing that inactivation of RhoA or ROCK by an inhibitory myelin substrate promotes regeneration of injured axons (197,225,226). Apart from the RhoA-ROCK signalling pathway, Nogo-A induced cellular and transcriptional changes remain unknown. A comprehensive study involving both genetic and proteomic analysis would be helpful to gain more knowledge about the downstream signalling pathways of NgR1.

Interestingly, a number of studies suggested that NgR1 has a role in embryo development and cell migration. For example, during embryo development NgR1 is expressed on neural precursor cell and plays a role in the interplay of cell adhesive and repulsive interactions which affects cell radial migration (227). Cell migration function is also regulated by NgR1 expressed on glioblastoma (228), T cells (229), olfactory ensheathing cells (230), macrophage (231), microglia and astrocyte (211,232), implying that Nogo 66 potentially modulates all above functions via interaction with NgR1.

1.4.1.3 In vitro and in vivo functions of Nogo-A

1.4.1.3.1 Roles in the development of nervous system

Despite the initial role identified as a myelin-associated inhibitor of neurite outgrowth in the adult CNS, increasing evidence indicates Nogo-A is crucial for regulating numerous developmental processes including cell adhesion and migration, axon guidance and fasciculation, dendritic branching as well as oligodendrocyte differentiation and myelination (196,233).

In the early development, Nogo-A is expressed in neural precursors during neural plate formation (206) and increasing Nogo-A expression is observed during cerebral cortex maturation, particularly in those neurons with longer neurites (202,203,234). In vivo studies in mice lacking Nogo-A showed aberrant migration patterns in interneurons and cerebellar granule neurons compared with wild type mice (227,235,236). All these results indicate that Nogo-A plays an important role in cell migration during the CNS development. In addition, Nogo-A is also involved in dendritic branching in the developing CNS as embryonic cortical neurons lacking Nogo-A showed increased branching in vitro (235). Similar results can be seen in the developing cerebellum where genetic deletion of Nogo-A in Purkinje cells resulted in larger, more complex dendritic branching than Nogo-A overexpressing cells (237). However, Nogo-A expressed in developing PNS neurons such as dorsal root ganglion neurons and motor neurons seems to have opposite effects, in which Nogo-A facilitates the branching but restricts neuron fasciculation. Petrinovi et al showed that an increase in fasciculation and a decrease in branching of peripheral neurites were detected both in vitro and in chicken embryos after treating with anti-Nogo-A antibodies, or in embryos from Nogo-A null mice (238). Furthermore, functions in axon guidance were demonstrated in the mouse embryo studies performed by Chan’s group, who showed that growing optic nerve axons and spinal cord commissural axons have axonal misprojections after blocking Nogo function (239,240).

In late development of the CNS, Nogo-A is involved in the process of oligodendrocyte differentiation and myelination, which is important for the refinement of neuronal connection and plasticity. Nogo knockout mice had a significant decrease in cortical oligodendrocyte number but an increased number of oligodendrocyte precursor cells compared with wild type mice (241), indicating Nogo-A is involving in the process of oligodendrocyte differentiation. Furthermore, Nogo-A and MAG double knockout mice showed a delay in myelin formation and had myelin malformations (242).

Collectively, these findings suggest that Nogo-A is an important regulator for guiding development of the nervous system in a controlled manner.

1.4.1.3.2 Roles in the adult CNS The most recognised functions of Nogo-A in the adult CNS are to inhibit neurite outgrowth and plasticity (191,194,233,243). Neurons in Nogo-A knockout adult mice showed larger, more motile growth cones than neurons in wild type mice, due to the upregulation of cytoskeletal and growth-related mRNAs and proteins (244). Similarly, functional blocking of Nogo-A expressed on hippocampal neurons isolated from adult mice using specific anti-Nogo-A antibodies upregulates GTPase-related regulatory genes such as Arhgap21 and Iqgap3 as well as growth specific genes and proteins such as tissue inhibitors of metalloproteinases-1 and SLP1, thus leads to pronounced neurite sprouting (245). All these results indicate that Nogo-A may act as a potent regulator to restrict neurite outgrowth in order to stabilise the mature CNS wiring and branching.

The high expression of Nogo-A in neurons with high plasticity indicates a potential role in regulating CNS synaptic plasticity. Blocking Nogo-A or NgR1 with specific antibodies enhanced hippocampal slice cultures to exhibit long-term potentiation (LTP) in vitro (246), whereas stimulation of NgR1 with Nogo 66 suppressed LTP (247). However, both experiments showed no effect on long-term depression (LTD), short-term plasticity, or basal synaptic transmission (246,247), implying Nogo-A has a unique and specific role in regulating signal transmission. Interestingly, no significant change of hippocampal LTP was observed in Nogo-A, NgR1 or PIRB knockout mice (246-248), possibly owing to compensatory mechanisms during development or functional redundancy with the remaining expression of other myelin associated inhibitors such as OMgp and MAG. Furthermore, overexpressing Nogo-A or NgR1 in neurons induced synapse disassembly and impaired long-term memory, respectively (248,249). Together, these results suggest that interaction between Nogo-A and its receptors could modulate the synaptic stability, which may subsequently influence learning and memory-forming processes.

1.4.1.3.3 Roles in CNS diseases, particular in multiple sclerosis (MS) Under normal physiological conditions, Nogo-A acts as a negative regulator in shaping and maintaining CNS structure and function, however, this inhibitory property

43 can restrict neuroregeneration after injury or disease. Recently Nogo-A has been implicated in various CNS diseases, including trauma such as spinal cord injury or stroke and neurodegenerative diseases such as AD or MS. Extensive studies have demonstrated that blockade of functional Nogo-A and its receptors by neutralising antibodies, antagonistic peptides or gene knockdown can promote a certain degree of neuroregeneration and enhance behavioural recovery from lost functions in different mouse models (reviewed in (188,233,250,251)). The following section will focus on Nogo-A functions in MS.

It has been reported that Nogo-A expression is upregulated in surviving oligodendrocytes at active demyelinating lesions in patients with MS (211) and soluble Nogo-A protein can be detected only in cerebrospinal fluid (CSF) from patients with MS but not in other neurological diseases or autoimmune diseases (252), possibly owing to the unwanted damage of neurons or oligodendrocytes. The functions of Nogo-A in MS has been extensively studied in the experimental autoimmune encephalomyelitis (EAE) mouse model. Several approaches including blocking with Nogo-A peptides, deletion of the Nogo-A gene, or silencing Nogo-A by small interfering RNA (siRNA) techniques can significantly reduce demyelinating lesions and axonal degeneration in this model, subsequently promoting functional recovery in EAE mice (253-256). These results support a model in which the interaction between Nogo-A and NgR1 or PIRB may contribute to the pathogenesis of MS through inhibition of neurite outgrowth and plasticity after neuron demyelination. Considering the various functions of Nogo-A in the CNS, Nogo-A may influence disease progression in many different aspects. For example, Nogo-A’s involvement in oligodendrocyte differentiation and myelination (241,242), may provide one explanation for how Nogo-A contributes to a demyelination disease like MS. Moreover, it has been shown that NgR1 is expressed on microglia cells in demyelinating lesions of MS (211,232) and Nogo 66 can trigger microglia adhesion and inhibit their migration in vitro through binding to NgR1 (232), causing increased microglia retention at the injury site. Phagocytosis by microglia is a hallmark of the MS lesion and thought to contribute directly to CNS damage in MS and EAE model (reviewed in (257,258)), thus the clearance of microglia from injury sites ultimately results in the termination of the inflammatory response, which benefits tissue repair. All these results

44 suggest that the development of therapies to block Nogo-A-mediated inhibitory effects may be beneficial for patients suffering MS.

1.4.2 Nogo-B

Nogo-B is found to be expressed in the CNS and PNS (203,259), but the specific role of Nogo-B in the nervous system has not been well studied due to lack of specific antibodies to distinguish between Nogo isoforms. However, the protein expression of Nogo isoforms can be distinguished using western blotting based on their differential molecular weights. Murphy et al showed that upregulation of Nogo-B, but not Nogo-A, is detected in hippocampal tissue in aged rats and rats treated with an intracerebroventricular infusion of β-amyloid (260), suggesting an association of Nogo- B with neurodegenerative disease. In addition, they showed that Nogo-B is able to trigger microglia activation in vitro, which results in the inflammatory-mediated synaptic dysfunction in those models (260). These results suggested that Nogo-B also plays a role in regulating synaptic plasticity, although whether this activation was achieved through binding NgR1 or PIRB or other specific Nogo-B binding receptors in the hippocampus still remains unknown.

Nogo-B is also ubiquitously expressed in many tissues and various non-neuronal cells such as vascular smooth muscles (261), airway epithelium of the lungs, airway smooth muscles (262,263), monocytes and macrophages (264,265), indicating that Nogo- B may exert various functions other than neurological functions in the nervous system. Indeed, It has been shown that Nogo-B is crucial to promote monocyte migration or macrophage infiltration and tissue repair after ischemia by increasing blood flow and promoting arteriogenesis and angiogenesis (265,266). Furthermore, it has been implicated in the modulation of inflammatory responses in the lung (262,263) and cancer cell survival (192), which will not be reviewed here since it is beyond the scope of this thesis.

1.4.3 Nogo-C

The expression and function of Nogo-C are poorly described and as with Nogo-B, this is primarily due to a lack of specific antibodies. The expression of Nogo-C has been detected in some types of neurons in the rat (203) and it has been shown to restrict axonal regeneration in Nogo-C overexpressing transgenic mice compared to wild type mice after

45 injury (267), possibly as a result of the inhibitory function of Nogo 66. Similar to Nogo- B, Nogo-C is also abundantly expressed in muscle (195,196,202). Muscle biopsies from patients with amyotrophic lateral sclerosis were shown to have increased Nogo-C expression in the early stages of this disease (268), which has led to a proposal for its use as a diagnostic marker for amyotrophic lateral sclerosis.

1.5 Multiple Sclerosis

MS is an inflammatory-mediated demyelinating disease of the human CNS with over two million patients diagnosed worldwide and is the most common cause of disability among young adults (269,270). MS is 2-3 times more prevalence in women than in men and the incidence also varies in geographic locations, where it is more common in higher latitudes in both the northern and the southern hemispheres and is almost unknown in sub-Saharan Africa and extremely rare in East Asia (269,270). It is noteworthy that MS in Asian populations has different characteristics from conventional MS in Caucasian populations with more selective and severe involvements of the optic nerve and spinal cord, which is normally referred as opticospinal MS (271). However, the factors causing the clinical variation among different ethnic backgrounds are not fully understood. It is speculated that genetic polymorphism among different populations is likely to contribute to this variation. The aetiology of MS remains unknown, but migration and family genetic association studies indicate that both environmental and genetic factors contribute to the disease onset.

1.5.1 Environmental factors

How environment impacts on the pathogenesis of MS still remains unknown. Numerous meta-analysis and systematic reviews have identified a variety of risk factors associated with disease susceptibility and two risk factors have been extensively studied including insufficient sunlight exposure and EBV infections (see reviews (272-274). Some other factors have also been linked to trigger MS such as vaccination, co-morbid diseases and exposure to toxic agents including smoking and air pollutants (272,273), although these factors will be not reviewed in detail.

Insufficient sunlight exposure was the first identified risk factor for MS in an attempt to explain the association of geography and altitude with MS incidence. This 46 correlation was further confirmed by several correlative studies performed across different countries such as America, Australia and the UK (275-278). It has been shown that low ultraviolet light exposure is capable of depleting vitamin D3 stores, which subsequently affect the production of 1,25-dihydroxyvitamin D3 (1,25-(OH)2 D3), a biologically active hormone with anti-inflammatory and neuroprotective functions in the CNS (279). Recently increasing data indicates that low vitamin D3 levels are strongly associated with high susceptibility to MS (279-282).

Herpes virus infection, in particular EBV has also been implicated in the pathogenesis of MS due to the high frequency of EBV seropositivity and higher serum anti-EBV antibody titres detected in patients with MS comparing to controls (283-285). However, its exact role in MS is incompletely understood. Some studies indicated that the effects of vitamin D3 deficiency and EBV infection on MS may be through the alteration the function of IL-10-producing regulatory lymphocyte, which undermines self-tolerance mechanisms and triggers a pathogenic autoimmune response to neural proteins (reviewed in (279)).

1.5.2 Genetic factors

Studying the genomic linkage between twins and sibling pairs has revealed a 40- fold increased susceptibility among first degree relatives of MS patients, suggesting that genetic factors likely contribute to MS susceptibility (286). Variants in MHC genes located in chromosome 6p21 have been consistently linked with MS susceptibility (see review (287)), possibly due to the stimulation of an autoimmune response in MS. Interestingly, LILRA3 deletion polymorphism has been reported to associate with MS susceptibility in German and Spanish populations (127-129), however, no association has been found in in Polish and Finnish populations (128,132). This discrepancy is possibly due to differences in genetic background among the different populations as well as sample sizes. Recently, a series of genome-wide studies that included over 80,000 individuals of European ancestry expanded the field of knowledge by identifying 110 MS risk variants at 103 discrete loci outside of the MHC (136-138,288). Most of these established MS risk genes are shown to have some immunological functions, supporting that MS is an inflammatory-mediated disease. However, each individual variant confers a small increase in disease risk suggesting that MS may be caused by complex interactions

47 of multiple variants or undefined molecular complications. So far limited studies have evaluated the contribution of risk variants to the pathogenesis of MS at the molecular level. Although LILRA3 is not one of 110 confirmed risk variants for MS susceptibility, considering the possible interaction of LILRA3 with MHC I molecules, it is likely that LILRA3 protein may influence the disease progression of MS. This however requires further investigation.

1.5.3 Diagnosis and clinical outcomes of MS

The gold standard for the diagnosis of MS is the McDonald criteria, which consist of a combination of clinical, magnetic resonance imaging (MRI) and paraclinical tests (289). The clinical outcomes of MS are tremendously varied among patients, which primarily depend on the lesion’s location and severity. In general, patients typically develop a relapsing or progressive disease course, commonly defined by four clinical outcomes (Figure 1-7). Approximately 85% of patients initially develop a relapsing remitting MS (RRMS), which is characterised by recurrent and reversible neurological deficits (290,291). Eventually with time, the majority of RRMS patients will develop to the secondary progressive MS (SPMS) characterised with continuous, irreversible neurological decline (290,291). Approximately 15% of patients develop primary progressive MS (PPMS), which is characterised by severe progression of disability with no relapse (290,291). Progressive relapsing MS (PRMS) is rare, affecting less than 5% of patients with MS. These patients experience several recurrent attacks from disease onset but with little or no improvements, which cause continuous progression of disability (290). Factors regulating the complexity of clinical outcomes are not fully understood and set great challenges for clinicians to measure the disease progression.

Figure 1-7: Schematic diagram showing four distinct clinical outcomes in MS Clinical outcomes are relapsing remitting MS (RRMS), secondary progressive MS (SPMS), primary progressive MS (PPMS) and progressive relapsing MS (PSMS). This figure is modified from (292).

Currently the Expanded Disability Severity Scale (EDSS) is the most widely used measure to determine the disease progression and severity in MS. EDSS is a 10-point scale of disease severity ranging from 0 (no disability) to 10 (death from MS) (293,294). Low range EDSS scores (0–3.5) are based on modest-to-moderate change in one or more of the functional systems. Scoring above 4.0 is based primarily on gait dysfunction. EDSS 6.0–7.5 is given to patients who present walking dysfunction with the need of a walking aid. Scoring above 8.0, patients are essentially restricted to bed with limited movement and gradually deteriorate to death. While the EDSS is the current gold standard to determine disease severity, this scale has a lack of sensitivity and does not always reflect the clinical outcomes. Thus, seeking effective biomarkers for identifying MS diagnosis, disease progression or clinical outcomes are imperative, but challenging. To date, many potential biomarkers for MS have been proposed such as neuroimaging MRI, genetic biomarkers, neurodegenerative biomarkers and inflammatory biomarkers (see reviews (295,296)), however, only serial MRIs have appeared to be clinical relevant in longitudinal or prospective studies (295).

1.5.4 The pathogenesis of MS

The formation of multifocal lesions or MS plaques within the brain and spinal cord is the histopathological hallmark for MS. This is thought to be initiated by the infiltration of inflammatory mononuclear leukocytes such as T and B cells due an immune activation subsequently resulting in inflammatory-mediated demyelination, axonal loss and glial scars in the CNS (297). Inflammation is present at all stages of MS and both innate and adaptive immune systems as well as dysfunctional glia cells orchestrate the demyelination and cause the subsequent axonal loss (Figure 1-8) (298,299). Demyelination can be partially repaired by the process of remyelination during the early stages of MS. As disease progresses, repeated inflammatory attacks and the neuronal deficit as well as accumulation of an inhibitory microenvironment lead to less effective remyelination and to a neurodegeneration that eventually results in gradual neuroaxonal loss causing irreversible neurological damage in the CNS.

1.5.4.1 The adaptive immune response

The CNS is considered to be an immunologically privileged organ (300) owing to the protection offered by the blood-brain barrier, which can restrict peripheral leukocytes 50 infiltrating into the CNS (301). However, it is speculated that peripheral T cells stimulated by molecular mimicry of a component of myelin can disrupt the blood-brain barrier to gain access to the CNS (Figure 1-8) (302,303). The proposal that myelin protein acts as an antigen has support from the induction method for the mouse model of MS, EAE, in which disease is induced with several myelin derivatives in rodents and exhibits similar histopathological characteristics with MS (304).

Infiltrated T cells contribute to inflammatory demyelination in the CNS by producing various immunoregulatory cytokines (Figure 1-8). Myelin-reactive T cells from patients with MS produce more pro-inflammatory cytokines such as IFN-γ and IL- 17, in contrast to myelin-reactive T cells from healthy persons which are more likely to produce anti-inflammatory cytokines such as IL-10 and IL-13 (305). Furthermore, dysfunction of regulatory T cells, a subset of T cells that is known to direct T cell differentiation and suppress inflammation through production of immunosuppressive cytokines including IL-10, is also detected in patients with MS (306). All these results indicate that the reduction of pro-inflammatory response and promotion of anti- inflammatory response may be an effective target to control the inflammation response in the CNS and possibly delay disease progress. In addition to T cells, B cells and the immunoglobulins are shown to be involved in the pathogenesis of MS (Figure 1-8). High levels of polyclonal antibodies (oligoclonal bands) produced by B cells/plasma cells are detected in the CSF of patients with MS (307), however, the target of these antibodies has not yet been elucidated.

: Figure has been removed due to Copyright restrictions

Figure 1-8: Schematic presentation of complex cells and mediators that orchestrate the forming of the MS lesions Activated peripheral mononuclear cells including T cells, B cells and macrophages can infiltrate through compromised blood-brain barrier (BBB) to the CNS, owing to upregulation of adhesion molecules and matrix metalloproteinase (MMPs). B cells secrete immunoglobulins which attack the myelin sheath and activated T cells produce a series of inflammatory cytokines and chemokines to manipulate the immune response. Microglia can provoke T cells to enhance the inflammatory response. Macrophages engulf myelin protein and release neurotoxic mediators including pro-inflammatory cytokines and reactive oxygen species (ROX). The differentiation of oligodendrocyte precursor cells (OPCs) to oligodendrocytes potentially repairs the damaged myelin sheath. Astrocytes have complex roles in MS lesions including activating T cells and inhibiting OPC differentiation as well as forming a physical barrier to inhibit the remyelination process. The interaction between Nogo 66 and NgR1 and PIRB can also potentially contribute by inhibiting neurite outgrowth after axonal injury. Figure modified from (297).

1.5.4.2 The innate immune response

MS is a chronic demyelinating disease and if infiltrating adaptive immune cells such as T cells and B cells are considered to be the initiator of autoimmune response in MS, then the disturbance of innate immune cells microglia or macrophages may contribute to the ongoing demyelination, neuroaxonal damage and neurodegeneration (Figure 1-8). However, there is increasing evidence to show that activated microglia/macrophages exhibit both protective and detrimental roles (see reviews (257,298,308)). The main role of microglia/macrophages is phagocytosis which is involved in the process of myelin debris clearing during demyelination (309). Myelin debris are identified as an inhibitor for oligodendrocyte precursor cell (OPC) differentiation and efficient myelin debris clearance is crucial for initiation of remyelination and preventing the release of pro-inflammatory intracellular components. Thus clearance of myelin debris contributes to the resolution of inflammation (309-311). In addition, a recent study has implicated a role of microglia/macrophages in maintaining CNS homeostasis by producing neurotrophic factors such as BDNF to repair the neuroaxonal damage (312). Conversely, uncontrolled phagocytic mechanisms of microglia/macrophages may cause continuous scavenging of myelin and lead to demyelination and neurodegeneration (313), possibly due to the loss of inhibitors that are normally expressed on healthy neurons to block microglia phagocytic functions. Moreover, activated microglia can produce a range of neurotoxic inflammatory mediators such as pro-inflammatory cytokines and reactive oxygen species, which will enhance neuroinflammation and neurodegeneration (Figure 1-8) (see reviews (257,298)). Furthermore, the disease-enhancing role of microglia has been reinforced by results in the EAE model where specific transgenic targeting of microglia reduced EAE-associated CNS inflammation (314).

1.5.4.3 Other cells and factors contributing to the disease progression

Apart from a potent role of immune cells in the pathogenesis of MS, other cell types such as astrocytes and oligodendrocytes are shown to be involved in the disease progression (Figure 1-8). Astrocytes are the most abundant cells in the CNS and have been implicated in a range of key neurological functions such as support of neural transmission, maintenance of CNS homeostasis and regulation of immune response (see reviews (315-317)). Studies indicated that astrocytes may promote the pathogenesis of 53

MS by activating autoreactive T cells through presentation of autoantigens on MHC class I and class II molecules (318-320) or secreting pro-inflammatory cytokines or chemokines to activate or recruit T cells towards MS lesions (315,321,322). In addition, activated astrocytes form glial scars around the lesions, which create a physical barrier to inhibit remyelination. These glial scars can be observed surrounding areas of demyelination in EAE model and tissue from patients with MS (323,324). Astrocytes also inhibit the differentiation of OPCs to oligodendrocytes, which are responsible for myelination in the CNS (325). A pool of oligodendrocytes and OPCs is detected surrounding lesions in the early stages of MS, whereas few oligodendrocytes and OPCs as well as oligodendrocyte apoptosis are commonly observed in chronic lesions of MS, suggesting oligodendrocytes are crucial for remyelination (297).

Without myelin protection, neurons are vulnerable and easily damaged by immune cells and their secreted neurotoxic products including oxidative products, glutamate, cytokines and chemokines (see reviews (291,326)). The death of oligodendrocytes and neurons not only release fragmented myelin protein potentially acting as autoantigens, but also release a number of inhibitory molecules to create an inhibitory environment for neuroregeneration. Nogo-A is one of these inhibitory molecules that are not only involved in preventing OPC differentiation but also inhibiting axonal growth (see Section 1.4.1.3). Nogo-A is primarily expressed on neurons and oligodendrocytes and has been well studied in the EAE model, where blocking Nogo-A can promote neurite outgrowth and neuroregeneration (refer to 1.4.1.3.3). Interestingly, in addition to neurons, NgR1 has been shown to be expressed on astrocytes and microglia, indicating Nogo-A may interact with NgR1 expressed on these cells to inhibit their activation, thus potentially contributing to the pathogenesis of MS.

1.5.5 Treatments for MS

Currently there is no cure for MS. Most treatments are only effective for RRMS and utilising immunosuppressive and immunomodulating therapy such as IFN-β and glatiramer acetate (327). These drugs attenuate the inflammatory-mediated neuron damage by upregulation of anti-inflammatory cytokines such as IL-10, thus reducing the relapse rate and delaying disease progression (291,328,329). However, many patients develop drug resistance after long-term use due to the production of neutralizing

54 antibodies. To date, there is no effective way to treat patients with progressive forms of MS such as SPMS and PPMS. Immunomodulatory treatment is ineffective for patients with progressive MS, indicating factors contributing to neurodegeneration but not inflammation should be the therapeutic target. Many studies are currently focusing on controlling the long-term neural damage caused by microglia/macrophage as well as investigating new therapies in areas of stem cell transplantation (330,331), axonal growth factors (332), remyelination and neuroregeneration (333,334). Of particular interest is targeting Nogo-A-mediated inhibition, which has been shown to have positive effects on promoting neuroregeneration after neuronal injuries in vivo (253-256). Currently an antibody treatment named Ozanezumab is undergoing clinical trials (233). However, use of an antibody to block Nogo-A-mediated inhibition has raised concerns regarding the likelihood of developing drug resistance after long-term use. Therefore, it is imperative to seek alternative options for Nogo-A blockers.

1.6 The potential relationship between LILRA3, Nogo 66 and MS

LILRs are potent immune regulatory molecules constitutively expressed on immune cells to modulate immune homeostasis. LILRA3 is unique among LILRs as it is a naturally secreted protein and has high homology with the extracellular domains of other LILRs and thus it is thought to competitively bind to the same or similar ligands of cell surface LILRs to modulate LILR-mediated immune response. Recently, LILRA3 gene deletion polymorphism has been associated with MS susceptibility, however, the underling association is not clear. In addition to the potent interaction with MHC molecules, we showed that Nogo 66, one of the most potent inhibitors for neuroregeneration in the CNS, is a potential new ligand for LILRA3. Knowing that Nogo 66 plays an important role in the pathogenesis and clinical outcome of MS, the interaction of LILRA3 with Nogo 66 may modulate Nogo-mediated inhibitory effects in MS. Furthermore, some recent studies suggested that LILRB2/PIRB also can bind to Nogo 66 to inhibit neurite outgrowth and reduce neuroplasticity after CNS injury. All these results suggest that soluble LILRA3 may interfere with the interaction between LILRB2 and Nogo 66 and thus reverse Nogo 66-mediated inhibitory effects, promoting neurite outgrowth and neuroplasticity (Figure 1-9). Considering blocking Nogo inhibitory 55 function can reduce the demyelinating lesions and promoting functional recovery in EAE mice, soluble LILRA3 may potentially be a new therapeutic approach for treating patients with MS.

Figure 1-9: Schematic diagram of the potential relationship between LILRA3, Nogo 66 and MS In MS, damaged neurons release large amount of soluble myelin-associated inhibitory proteins such as Nogo 66 into the CNS due to inflammatory mediated demyelination (top). The interaction between the Nogo 66 and its receptor LILRB2 leads to the inhibition of neurite outgrowth and suppressing of neuronal regeneration (bottom-left); whereas the presence of soluble LILRA3 may competitively bind Nogo 66 and block the Nogo 66-LILRB2 interaction leading recovery (regeneration) of the injured CNS neurons (bottom-right).

1.7 Hypothesises

The hypothesises of this thesis are

1. Nogo 66 which is upregulated in multiple sclerosis suppresses neuronal regeneration in CNS through interaction with its inhibitory receptors NgR1 and LILRB2 and this is competitively blocked by soluble LILRA3-Nogo 66 interaction. 2. Optimal glycosylation and formation of regulated quaternary structures are essential for the production and secretion of functionally active LILRA3.

1.8 Statement of and aims

LILRA3 located in chromosome 19q13.4, is the only LILR to show loss of gene deletions in human populations, with one or two LILRA3 allelic deletions of 6.7 kbp removing the first seven of its eight exons. This deletion is found in different populations worldwide at different rates. The deletion occurs at extremely high frequency in Northeast Asians such as Japanese (71%), Chinese (79%) and Korean (84%) compared to European (15-25%), Middle Eastern (10%) or African (7%) populations. The occurrence of homozygous LILRA3 gene deletion “null allele” that predicts loss of gene expression in these populations ranges from 1.6% to 45%. There are some conflicting results regarding the association between homozygous LILRA3 gene deletion and MS susceptibility. LILRA3 deletion polymorphism has been reported to be a risk variant in German and Spanish populations. This is consistent with the anti-inflammatory functions of LILRA3 in which lack of the protein may contribute to the excessive chronic inflammation in MS, however studies in Polish and Finnish population found no genetic link between LILRA3 deletion and MS. Moreover, the incidence of MS in populations with very high frequency of LILRA3 deletion is lower or similar to populations with low frequency of deletion.

The proposal in the first part of this thesis was that differences in genetic background among the different populations and sample sizes may explain whether the presence or lack of LILRA3 deletion contributes to MS susceptibility. The aim was therefore to investigate the association of LILRA3 gene deletion with MS susceptibility in a North American cohort; additional aims were to assess whether LILRA3 null allele leads to lack of LILRA3 protein expression as predicted, determine LILRA3 protein

57 levels in patients with MS and healthy controls and investigate if LILRA3 protein levels correlate with clinical subtype, and/or disease severity in MS.

LILRA3 is soluble and so cannot transduce intracellular signals and its functions in vivo are unknown, despite its ubiquitous presence in normal sera, and its strong clinical associations with chronic inflammatory diseases. This is primarily due to insufficient knowledge of its ligands due to difficulties in producing biologically-active full-length LILRA3. Moreover, methods used to date have not addressed the possibilities that it has more than one native ligand. Our laboratory recently overcame this by producing full- length recombinant LILRA3 protein that closely matches the structure of the native protein and used an innovative, unbiased proteomic approach that can concurrently identify multiple ligands. Of particular interest to this thesis was the unexpected identification of Nogo 66, one of the most potent inhibitors of neurite outgrowth and axonal regeneration in the CNS and a key player in the pathogenesis of MS, as a candidate ligand for LILRA3. Thus the aims in the second part of this thesis were to characterise the binding affinity and kinetics between LILRA3 and Nogo 66 and define their functional interactions in primary human and mouse cortical neurons.

LILRA3 is a highly glycosylated protein with 12 cysteine residues and 4-5 potential di-sulphide bonds. These properties are likely to affect its quaternary structure and subsequent ligand binding, cellular distribution and functions. The aim of the third part of the thesis was to utilise advanced imaging to spatiotemporally detect and quantify the quaternary structure of LILRA3 in different compartments of live cells at single cell level and corroborate results with conventional immuno-biochemical assays, as a prelude to future functional and structural studies of the protein.

CHAPTER 2: INVESTIGATION OF THE LINK BETWEEN LILRA3 GENE AND PROTEIN EXPRESSION AND MULTIPLE SCLEROSIS

2.1 Introduction

Multiple sclerosis (MS) is a complex autoimmune disorder directed against components of CNS myelin or oligodendrocytes (OGD), probably initiated by environmental factors such as infections in genetically susceptible individuals (287,335- 338). Genetically, variants in major histocompatibility complex (MHC) genes located in chromosome 6p21 have been consistently linked to MS susceptibility (reviewed in (287)). In some studies chromosome 19q13 has been found to be linked to MS (132,339) and recent genome wide association studies have identified 110 MS risk variants in 103 discrete loci outside of the MHC gene (136-139,287,340). However, how these risk variants contribute to the pathogenesis of this disease remain to be systematically investigated. Clinically, about 85% of patients initially present with relapsing remitting disease (RRMS), which is characterised by recurrent and reversible neurological deficits (290,291). With time, the majority of these patients will progress to secondary progressive phase (SPMS) with continuous neurological decline (290,291). 15% of patients are diagnosed with primary progressive MS (PPMS) and show severe progression of disability with no remission phase(s) (290,291). Progressive relapsing MS (PRMS) is a rare clinical pattern (<5% of patients) characterised by several recurrent attacks from onset with little or no improvement (290). However, factors regulating clinical variability and/or disease severity are not fully elucidated.

The formation of multifocal lesions or the MS plaques within the brain and spinal cord are the histopathological hallmark for MS. This is thought to be caused by infiltration of inflammatory mononuclear leukocytes such as T and B cells following inappropriate immune activation leading to inflammatory-mediated demyelination, axonal loss and glial scarring (297,298) (Section 1.5.4). Interestingly, recent histopathological studies of very early MS lesions showed apoptosis of OGDs and activation of microglia preceding infiltration of T and B cells or demyelination suggesting an early neurodegenerative component that may contribute to the initial immune dysregulation such as generation of

59 myelin-derived antigenic neo-peptides (291,341). Although inflammatory-mediated by both innate and adaptive immune systems is evident at all the stages of MS, myelin sheaths can partially regenerate during early stages of MS (298,299). However, repeated inflammatory attacks lead to progressive damage and limit regeneration due to the unfavourable microenvironment surrounding the lesion such as glial scarring and the release of intrinsic myelin-associated inhibitory factors such as Nogo-A (233,253,323,324). Identifying mediators that create a favourable microenvironment for neuronal regeneration by regulating these intrinsic and extrinsic inhibitory factors may provide new insight into the pathogenesis and clinical progression of the disease.

Disease severity in MS is difficult to quantify due to the complex heterogeneous nature of the disease and variable multifocal CNS lesions in which the size of the lesion does not necessarily correlate to disease severity (297,342). Currently the Expanded Disability Severity Scale (EDSS) which is a 10-piont scale of disease severity ranging from 0 (no disability) to 10 (death from MS) (293,294) is the most widely used measure to determine the disease progression and severity in MS (Section 1.5.3). EDSS is based on a neurologist’s observation of the impairment of eight functional systems including pyramidal, cerebellar, brainstem, visual, sensory, bowel and bladder, cerebral and other (294). High inter-observer variability and a non-linear scale of EDSS may contribute to the insensitivity of outlining the clinical progression and outcomes (343), thus new validating methods are required in the future. Currently there is a lack of effective biomarkers to predict MS progression and clinical outcomes. Magnetic resonance imaging (MRI) and oligoclonal bands (OCBs) in cerebrospinal fluid (CSF) are the most common biomarkers used in clinics (295,296,344). However, these markers lack an adequate correlation with neurodegeneration and disability progression. Other suggested biomarkers including neurofilaments proteins, autoantibodies and miRNAs in CSF or sera, are correlative, but the relation of these factors to underlying mechanisms remains unknown (295,296,344).

LILRA3 is a secreted protein that belongs to a family of highly homologous activating and inhibitory cell surface receptors (8,104), primarily expressed by mono- myeloid cells (8,46). LILRs are increasingly recognised as critical regulators of immune responses through modulation of the threshold and amplitude of leukocyte activation (7,8,34,46). Functions of soluble LILRA3 are not fully elucidated due to the limited

60 knowledge about its ligands; however, its high homology to the extracellular domains of activating LILRA1 and LILRA2 and inhibitory LILRB1 and LILRB2 (8,9), suggests that it may act as a soluble antagonist/agonist to these receptors via shared ligands. Interestingly, LILRA3 located in chromosome 19q13.4, is the only LILR showing genetic diversity with one or two LILRA3 allelic deletions (6.7 kbp) that naturally remove the first seven of its eight exons (33). Interestingly, different populations have been shown to have different deletion rate (Section 1.2.8.2). The deletion occurs at extremely high frequency in Northeast Asians such as Japanese (71%), Chinese (79%) and Korean (84%) compared to European (15-25%), Middle Eastern (10%) or African (7%) populations (33,114,126-128,131,140). The occurrence of homozygous LILRA3 gene deletion that predicts complete loss of gene expression in these populations ranges from 1.6% to 45% (33,114). There are several reports linking LILRA3 deletion polymorphism to various autoimmune diseases (Section 1.2.8.2 and reviewed in (107)). Of particular interest, there are some conflicting results regarding the link between homozygous LILRA3 gene deletion and the susceptibility to MS. Lack of LILRA3 gene has been reported to be a risk variant in German (129) and Spanish populations (127) but not in Polish (128) and Finnish populations (132), despite all having comparable frequencies of LILRA3 gene deletion. The aim of this study was to investigate whether LILRA3 gene and protein are associated with MS in a North American cohort.

LILRA3 expression is tightly regulated by immunoregulatory cytokines. It has been shown to be upregulated by IL-10 and downregulated by TNFα in monocytes in vitro (35). Similarly, LILRA3 is elevated in primary monocytes of patients with psoriasis who were undergoing IL-10 treatment (66). IL-10 is a potent anti-inflammatory cytokine involving in a wide range of immune suppressive functions including inhibiting T cell activation, suppressing pro-inflammatory cytokine production such as TNFα and IFN-γ and suppressing the antigen-presenting capacity of monocytes/macrophages (345,346). The low level of IL-10 is detected in untreated patients with MS, but it is augmented during IFN-β (347-350) and vitamin D treatments (351,352). Importantly, the elevated IL-10 is associated with disease remission in MS (353-356), possibly owing to the anti- inflammatory property of IL-10 by suppressing excessive inflammation in MS. TNFα is a pro-inflammatory cytokine and its elevated level in serum and CSF is associated with onset of MS relapse (357). Similar to IL-10, LILRA3 is able to abrogate TNFα production

61 in monocytes upon lipopolysaccharide (LPS) stimulation (20). All these results indicate that the interplay of LILRA3 and LILRA3 related immunoregulatory cytokines may impact on disease progression.

This chapter provides evidence that LILRA3 gene deletion is not associated with MS susceptibility and disease severity in North American population. However, serum LILRA3 protein level is significantly upregulated in patients with MS and most importantly, it is positively correlated with disease severity, suggesting it may play key roles in the pathogenesis of the disease. There was also a positive correlation between levels of LILRA3 and one of the most potent anti-inflammatory cytokines IL-10, suggesting a new IL-10-LILRA3 mediated anti-inflammatory feedback loop. Furthermore, multiple regression analysis indicated that the level of LILRA3 is a strong independent predictor for disease severity, and may therefore be potentially useful as a clinical biomarker.

2.2 Methods

2.2.1 Study cohort

Archival sera from 456 patients with MS manifesting different clinical patterns of the disease and 99 age, sex and race-matched unrelated healthy controls were obtained from The Accelerated Cure Project for MS, USA. The patient cohort included 272 patients with RRMS, 133 with SPMS and 51 with PPMS. Two sets of sera (12 months apart) were available for 18 patients with RRMS; 6 of these patients had no change in disease severity, 6 had improvement and 6 had worsening disease as measured by EDSS. These sera were used to investigate the fluctuation of LILRA3 protein levels with changing disease severity. CSF acquired from 30 patients with MS and 20 patients with headache but no MS were used to investigate the presence of LILRA3 protein in CSF.

All healthy subjects and patients were Caucasian. Diagnosis of MS was according to the McDonald classification (289), and all patients were on one or more clinically- approved treatment prior to and at the time of this study. This study was approved by institutional human ethics committees and informed consent was obtained from each subject.

2.2.2 Genomic DNA isolation from human sera

Genomic DNA was purified from 100 l of serum using QIAamp DNA Blood mini kit (QIAGEN, Life Technologies) according to the manufacture’s instruction. In brief, 100 l serum was mixed with 100 l phosphate-buffered saline (PBS), 20 μl QIAGEN Protease and 4 μl RNAse A stock solution (100 mg/ml), followed by addition of 200 μl Buffer AL to the sample. The mixture was then pulse-vortexed for 15 sec, incubated at 56°C for 10 min and 200 μl ethanol was then added into sample and mixed again by pulse- vortexing for 15 sec. After mixing, tubes were briefly centrifuged to collect liquid from the inside of the lid. The mixture was carefully transferred into the QIAamp Mini spin column (in a 2 ml collection tube) and then centrifuged at 6,000 x g for 1 min and the flow-through discarded. The QIAamp Mini spin column was washed sequentially with 500 μl Buffer AW1 and 500 μl Buffer AW2, 2 ml collection tube was changed after every wash. At the end, an extra 3 min spin at full speed was applied to completely remove the

Buffer AW2. After washing, the QIAamp Mini spin column was placed in a clean 1.5 ml eppendorf tube and genomic DNA was eluted from the column by adding 200 μl of DNAse and RNAse free water (GIBCO, Life Technologies) and spinning at 6,000 x g for 1 min. The eluted DNA was then concentrated using SpeedVac concentrator (Savant Instruments, NY, USA). The final concentration was determined using Nanodrop ND- 1000 Spectrophotometer (Thermo Fisher Scientific, MA, USA).

2.2.3 LILRA3 genotyping

A PCR-based genotyping for wild type, heterozygous or homozygous LILRA3 gene deletion was performed as previously described (127). The following three LILRA3 primers (Sigma-Aldrich, NSW, Australia) were used in a single PCR reaction: a forward primer upstream from the 6.7 kbp deletion FP1 (5'- GAC TTG TAA GGG TTA AAA AGC CAA-3'), an internal forward primer within the deletion FP2 (5'- CAT CTC GAT CTG CCA CTG ACA C-3') and a reverse primer RP (5'- GAC AGC AGA TTC TAA AAC AGT GG-3') (Figure 2-1A). In brief, a 20 µl PCR reaction mix containing 100 ng of genomic DNA as template, 0.2 mM dNTP, 2.5 mM MgCl2, 0.3 M of each primer and 0.5 l AmpliTaq Gold® DNA polymerase (Life Technologies, VIC, Australia) was amplified using the following conditions: 95C for 5 min initial annealing, 35 cycles of 95C for 30 sec annealing, 60C for 45 sec and 72C for 45 sec extension, and a final 10 min extension at 72C. Reactions with no template were used as negative controls. The PCR products were separated by electrophoresis in 2% agarose gels and analysed using in a gel doc XR system (Bio-Rad, NSW, Australia). A single 150 bp PCR product amplified by FP2 and RP is expected in subjects with intact LILRA3 gene in both alleles (LILRA3+/+) and a single 241 bp PCR product amplified by FP1 and RP is expected in subjects with homozygous gene deletion (LILRA3-/-); subjects with a single gene deletion are expected to have both products (LILRA3+/-) (Figure 2-1B).

Figure 2-1: LILRA3 genotyping schematic diagram and representative results (A) Schematic illustration of LILRA3 genotyping strategy used to distinguish LILRA3 gene deletion polymorphisms (adapted from (127)). Two forward (FP1 and FP2), and one reverse primers (RP) were used in a single PCR reaction. In subjects with two intact LILRA3 alleles, FP1 primer which is upstream from the 6.7 kbp deletion together with the RP will poorly amplify the very large size product spanning the entire 8 LILRA3 exons; instead a single 150 bp product will be efficiently amplified by the downstream FP2 primer. Subjects who are heterozygous will show a 241 bp product from the deleted allele and a 150 bp product from the intact allele, and subjects with homozygous gene deletion will preferentially amplify the 241 bp product. (B) A representative 2% agarose gel for LILRA3 PCR products showing two patients with MS having heterozygous gene deletion (LILRA3+/-; lane 1, 2), one patient showing two intact LILRA3 alleles “wild type” (LILRA3+/+; lane 3) and one patient showing a homozygous deletion “null allele” (LILRA3 -/-; lane 6). Lane 4 is a no template control and lane 5 is the molecular weight marker. 65

2.2.4 LILRA3 Sandwich ELISA

LILRA3 sandwich ELISA that was developed in-house was further optimised in this project to improve detection sensitivity. In brief, flat-bottom 96-well Nunc Maxisorp plates (Thermo Fisher Scientific, VIC, Australia) were coated with 100 μl/well of 0.5 μg/ml anti-LILRA3 monoclonal Ab clone 2E9 (M01; Abnova, Taipei, Taiwan) in PBS at room temperature (RT) overnight. Plates were then washed 3 times with wash buffer (0.05% Tween 20 in PBS, pH 7.2) and blocked with blocking buffer (1% BSA in PBS) for 2 h at RT. This was followed by incubating 100 μl/well of serially diluted recombinant LILRA3 standards (7 serial dilutions from 12.5 ng/ml to 0.195 ng/ml) and test samples (sera 1:10 dilution in blocking buffer; CSF undiluted) at 4C overnight. Next day after 3 times washes, plates were incubated with 100 μl/well of 0.5 μg/ml anti-LILRA3 purified MaxPab rabbit polyclonal Ab (D01P; Abnova, Taipei, Taiwan) in blocking buffer at 4C overnight. After 4 stringent washes, plates were incubated with 100 μl/well of Horse radish peroxidase (HRP)-conjugated goat anti-rabbit Ab (1:2000 dilution in blocking buffer; Bio-Rad) for 1.5 h at RT followed by an additional 4 washes. Finally, 100 μl/well of 3,3',5,5'-tetramethylbenzidine (TMB) chromogenic HRP substrate (Thermo Fisher Scientific) was added and incubated for 30 min in the dark and reaction was stopped by adding 50 μl/well of 1 N H2SO4. Optical density (OD) was measured at 450/540 nm wavelength using the Spectramax-M3 plate reader (Molecular Devices, CA, USA).

2.2.5 Multiplex bead cytokine assay

Bio-Plex ProTM Human Cytokine 27-Plex Immunoassay was used to simultaneously measure levels of IL-10, IFN-γ and TNFα in sera according to the manufacturer’s instructions (Bio-Rad Laboratories, CA, USA). This assay was performed by Dr Edwin Lim. In brief, each well of the assay plate was loaded with 50 μl 1x beads and then washed twice with 100 μl Bio-Plex wash buffer. 50 μl/well sera, standards, blank and controls were added to the assay plate and then incubated for 1 h at RT with shaking at 850 rpm. After the incubation, the assay plate was washed 3 times with 100 μl wash buffer and incubated with 25 μl/well detection antibodies on shaker at 850 rpm for 30 min at RT. After 3 washes with 100 μl wash buffer, 50 μl 1x streptavidin-PE was added to each well and incubated on shaker for 10 min at RT following additional 3 washes.

Finally, 125 μl assay buffer were added to each well and shaken for 30 sec at RT. The data was acquired using Bio-Plex 200 system (Bio-Rad).

2.2.6 Detection of LILRA3 in CSF by SDS-PAGE and Western blotting

CSF samples (10 µl) were mixed with an equal volume of 1 x Tricine sample buffer (Bio-Rad) containing 20 mM Dithiothreitol (DTT) (Bio-Rad) and denatured at 100°C for 5 min. Proteins were then loaded into 10% (w/v) SDS-PAGE gel and separated at constant 40 volts (V) for 30 min, followed by 100 V for 70 min using the Bio-Rad Mini-Protean II electrophoresis apparatus (Bio-Rad). Proteins were transferred to methanol-activated 0.22 µm PVDF membranes (Merck Millipore, VIC, Australia) at 75 V for 45 min. Following transfer, membranes were blocked with 5% skim milk (w/v) in TBST (Tris- buffer saline (TBS), pH 7.2 with 0.1% tween-20; Sigma) for 2 h at RT and then incubated with 1 µg/ml primary anti-LILRA3 monoclonal Ab clone2E9 (Abnova) diluted in 2% Bovine Serum Albumin (BSA; Sigma) in TBS at 4°C overnight. Membranes were washed 3 times with TBST then incubated with HRP conjugated goat anti-mouse Ab (1:4000 v/v; diluted in TBST; Bio-Rad) for 1.5 h at RT, followed by 3 washes in TBST. The immunoreactive bands were detected using chemiluminescent substrate (Perkin Elmer, NSW, Australia) and images were acquired using ImageQuant™ LAS4000 (GE Healthcare Life Sciences).

2.2.7 Statistical analysis

All analyses were performed in SPSS Statistics Software for Windows, Version 21.0 (IBM Corp., NY, USA) and GraphPad InStat software version 6.05 (CA, USA). Retrospective power analyses were performed for available controls and patients using a fixed minor allele frequency of 25%, a type I error p value of 0.05, and an odds ratio of 1.25.

Deviation of LILRA3 genotype counts from the Hardy-Weinberg equilibrium was tested using Pearson’s goodness-of fit chi-square test. Two-sided Fisher’s exact test was used to analyse differences in allelic frequencies, genotype distribution and phenotype distribution of the 6.7kbp LILRA3 deletion between patients with MS and control subjects.

Mann-Whitney test was used to compare serum LILRA3 levels in controls among the different LILRA3 genotypes and to compare levels between patients with MS and controls. The difference in LILRA3 protein among the different clinical subtypes of MS or EDSS was analysed by one way ANOVA with Dunn’s post-test for multiple comparisons. Spearman r was used to correlate serum LILRA3 level to EDSS or serum cytokine levels. Paired t test was used to assess change in LILRA3 levels in patients that improved, worsened or not changed their EDSS over 12 months. P values <0.05 were considered statistically significant.

Multiple regression analysis using the SPSS was employed to evaluate predictors of disease severity using LILRA3 protein levels, age of disease onset, sex, recent disease exacerbation and age at the time of blood collection as covariates. Collinearity statistics were very acceptable. The mean variance inflation factor was 1.33 (range: 1.01– 1.88); and mean tolerance values were 0.80 (range: 0.53 – 0.99). The model was highly significant [F (5,166) = 10.1; p<0.001] and predicted approximately 23% (R2) of the variance in the outcome variable.

2.3 Results

2.3.1 Demography of study cohort

The median age of patients at the time of the blood collection was 48 ± 11.0 (median ± SD) years, which was comparable to control subjects (46 ± 10.8 years) (Table 2-1). The female to male ratios of patients and control subjects were 3.1 and 3.3 respectively. The median age of disease onset for patients with primary progressive disease (PPMS) was 46 ± 9.8 years, which was older than patients with relapsing remitting disease (RRMS; 37 ± 10.2 years) or patients with secondary progressive disease (SPMS; 39 ± 10.3 years), but this difference was not statistically significant. Disease duration for all patients ranged from 3 months to 38 years and patients with SPMS had the longest disease duration (median 13 ± 8.7 years) when compared to all other clinical subtypes. The mean disease severity score according to the EDSS was 2.8 ± 1.8 for patients with RRMS, 5.3 ± 2.0 for SPMS and 4.7 ± 2.1 for PPMS.

Table 2-1: Demography of study cohort

Controls All MS RRMS SPMS PPMS

(n=99) (n=456) (n=272) (n=133) (n=51)

Female to Male ratio 3.3:1 3.1:1 4.1:1 2.1:1 2.2:1

Median age ± SD 46 ± 10.8 48 ± 11.0 43 ± 10.6 53 ± 9.3 52 ± 9.9

Median age of disease onset ± SD N/A 39 ± 10.5 37 ± 10.2 39 ± 10.3 46 ± 9.8

Median disease duration ± SD (years) N/A 6 ± 7.9 5 ± 6.7 13 ± 8.7 5 ± 5.2

Mean EDSS ± SD* N/A 3.8 ± 2.1 2.8 ± 1.8 5.3 ± 2.0 4.7 ± 2.1 EDSS: Expanded Disability Status Scale, MS: multiple sclerosis, RRMS= relapsing remitting MS, SPMS= secondary progressive MS, PPMS= primary progressive MS *EDSS at the time of blood collection was available from 192 patients with MS; RRMS (116), SPMS (52), PPMS (24)

2.3.2 LILRA3 genotyping in patients with MS and healthy controls

The distribution of LILRA3 genotypes in control subjects and patients with MS was in conformity with Hardy Weinberg equilibrium (X2=0.11 and 0.18 respectively, p>0.05). Table 2-2 shows the allelic, genotypic and phenotypic frequencies of LILRA3 gene deletion in control subjects and patients with MS in a cohort of American population. The odds ratio of LILRA3 allelic frequencies and phenotypes for MS susceptibility were 1.35 (95% CI=0.93-1.96; p=0.131) and 2.42 (95% CI=1.00-5.82; p=0.055) respectively. The proportion of control subjects with homozygous LILRA3 gene deletion were higher (8.1%) than patients with MS (3.6%), and both groups had similar proportions of heterozygous deletion. There was no statistically significant difference in the distribution of LILRA3 gene deletion between controls and patients. Although not statistically significant, it was notable that homozygous LILRA3 gene deletion was higher in male controls and patients when compared to their corresponding female counterparts (Table 2-3). There was no significant association between LILRA3 gene deletion and MS susceptibility when analysed using sex as a covariant.

Table 2-2: Distribution of allelic frequency, genotypes and phenotypes of LILRA3 deletion in control subjects and patients with MS Allelic Controls (n=99) Patients (n=456) *P value Odd ratio 95% CI frequency

LILRA3+ 153 (77.3%) 749 (82.1%) 0.131 1.35 0.93-1.96

LILRA3- 45 (22.7%) 163 (17.9%)

Genotypic frequency LILRA3+/+ 62 (62.6%) 309 (67.7%) 0.347 0.80 0.51-1.25

LILRA3+/- 29 (29.3%) 131 (28.7%) 0.903 1.03 0.64-1.66

LILRA3-/- 8 (8.1%) 16 (3.6%) 0.055 2.42 1.00-5.82

Phenotypic frequency LILRA3+ 91 (91.9%) 440 (96.4%) 0.055 2.42 1.00-5.82

LILRA3- 8 (8.1%) 16 (3.6%) *Fisher’s exact test CI: Confidence interval

Table 2-3: Distribution of genotypes of LILRA3 deletion in female and male control subjects and patients with MS Controls (n=99) Patients (n=456)

Genotypic female female (n=76) male (n=23) male (n=112) frequency (n=344) LILRA3+/+ 46 (60.5%) 16 (69.6%) 235 (68.3%) 74 (66.0%)

LILRA3+/- 24 (31.6%) 5 (21.7%) 99 (28.8%) 32 (28.6%)

LILRA3-/- 6 (7.9%) 2 (8.7%) 10 (2.9%) 6 (5.4%)

Logistic regression analyses (Table 2-4) showed no significant association between LILRA3 deletion (-/- and -/+) and clinical subtype; RRMS (n=272, p=0.69), SPMS (n=133, p=0.28) or PPMS (n=51, p=0.33). Similarly, linear regression analyses (Table 2- 4) revealed no significant link between LILRA3 gene deletion and age of disease onset (p=0.80) or disease severity (p=0.79).

Table 2-4: Logistic and linear regression analysis to investigate the association of LILRA3 gene deletion (-/- and -/+) to clinical subtypes, age of disease onset and disease severity Dependent Variables p value Standardised Coefficients B

RRMS 0.69 -0.071

SPMS 0.28 -0.232

PPMS 0.33 0.291

Age of disease onset 0.80 -0.272

Disease severity (EDSS) 0.79 -0.082

2.3.3 Links between 6.7 kbp LILRA3 gene deletion and LILRA3 protein production

The 6.7 kbp LILRA3 gene deletion is expected to cause a lack of LILRA3 protein as predicted by the putative loss of the coding region but this was not experimentally confirmed. To address this, LILRA3 in sera of all healthy controls was determined and levels compared to their matching LILRA3 genotype. All eight subjects with homozygous gene deletion (LILRA3-/-) had very little detectable LILRA3 protein (0.36 ± 0.1 ng/ml) (Figure 2-2). In contrast, abundant protein was detected in sera of subjects with wild type LILRA3 (+/+; n=62) and heterozygous LILRA3 gene deletion (+/-; n=29) (Figure 2-2). Surprisingly, mean LILRA3 protein levels in subjects with LILRA3+/- genotype was higher (6.9 ± 3.2 ng/ml) than individuals with wild type LILRA3+/+ genotype (3.6 ± 2.0 ng/ml), although this was not statistically significant.

p<0.01

p<0.01 NS 10

5 LILRA3 ng/ml (± SEM) (± LILRA3ng/ml

0 -/- +/- +/+ (n=8) (n=29) (n=62)

Figure 2-2: Links between LILRA3 genotype and protein expression Detection of LILRA3 protein in sera of healthy subjects using an in-house sandwich ELISA showing no or little protein in subjects with LILRA3 gene null alleles (-/-) as contrasted to constitutive expression in subjects with heterozygous gene deletion (+/-) or wild type gene (+/+).

2.3.4 Comparisons of LILRA3 protein levels in sera of patients with MS and healthy controls

LILRA3 levels in sera of patients with MS were compared with sex, age, and race- matched healthy subjects. The small number of controls (n=8; 8.1%) and patients (n=16; 3%) with homozygous LILRA3 gene deletion was excluded. The average quantities of LILRA3 in sera of patients with MS was 9.98 ± 0.7 ng/ml (n=440), which was significantly higher than the levels in healthy controls (4.7 ± 1.7 ng/ml; n=91) (p<0.0001; Figure 2-3A). Stratification based on LILRA3 genotype confirmed similar significant increase in LILRA3 protein in patients as compared to the corresponding controls for both LILRA3+/+ (9.97 ± 0.8 ng/ml versus 3.6 ± 2.0 ng/ml; p<0.0001; Figure 2-3B) and LILRA3+/- subjects (9.9 ± 1.3 ng/ml versus 6.9 ± 3.2 ng/ml; p<0.002; Figure 2-3C).

Analysis of serum LILRA3 in patients with the different clinical subtypes showed that patients with primary progressive disease (PPMS) showed ~3 times more LILRA3 (20.7 ± 3.1 ng/ml; n=49) when compared to patients with relapsing remitting disease (RRMS) (7.6 ± 0.8 ng/ml; n=261) and had ~2 times more than patients with secondary progressive disease (SPMS) (10.7 ± 1.1 ng/ml; n=130) (Figure 2-4A). LILRA3 levels in PPMS were significantly greater compared to RRMS (p<0.0001) and SPMS (p<0.05) (Figure 2-4A). These results were consistent when patients were further stratified on the basis of their LILRA3+/+ (Figure 2-4B) or LILRA3+/- (Figure 2-4C) genotype, although some did not reach statistical significance.

A B C

15 LILRA3+/+ and +/- 15 LILRA3+/+ 15 LILRA3+/- p<0.0001 p<0.0001 p<0.002

10 10 10

5 5 5

LILRA3 ng/ml (± SEM) (± LILRA3ng/ml SEM) (± LILRA3ng/ml LILRA3 ng/ml (± SEM) (± LILRA3ng/ml

0 0 0 Controls Patients Controls Patients Controls Patients (n=91) (n=440) (n=62) (n=309) (n=29) (n=131) Figure 2-3: Comparison of serum LILRA3 level between patients with MS and healthy controls (A) Serum LILRA3 level was significantly higher in patients with MS as compared to healthy control subjects. This significant difference was consistent when comparing levels in patients and control subjects with wild type (+/+) (B) or heterozygous LILRA3 gene deletion (+/-) (C). Data are presented as mean ± SEM and analysed using Mann Whitney test.

A B C LILRA3+/+ and +/- LILRA3+/+ LILRA3+/- p<0.0001 p<0.0001 25 40

p<0.0001 p<0.0001 p<0.0001 p<0.001 p<0.01 p<0.0001 NS NS 20 20 p<0.0001 p<0.001 p<0.0001 30 p<0.0001 NS 15 p<0.001 15 g/ml (± SEM) (± g/ml NS 20 p<0.01 10 10 10

5 5

LILRA3SEM) (± ng/ml

LILRA3 ng/ml (± SEM) (± LILRA3ng/ml LILRA3 n LILRA3

0 0 0 Controls RRMS SPMS PPMS Controls RRMS SPMS PPMS Controls RRMS SPMS PPMS (n=91) (n=261) (n=130) (n=49) (n=62) (n=184) (n=94) (n=31) (n=29) (n=77) (n=36) (n=18) Figure 2-4: Comparison of serum LILRA3 level among different subtypes of MS (A) Expression of LILRA3 in sera of patients with different clinical subtypes of MS showing progressive and significant increase in the amount of LILRA3 in sera of patients with RRMS, SPMS and PPMS when compared to control subjects. Similar results were obtained when patients with different clinical subtypes and the control subjects were stratified based on their LILRA3 genotype to wild type (B) and heterozygous deleted subgroups (C). Data are presented as mean ± SEM and analysed using one way ANOVA with Dunn’s post-test for multiple comparisons.

2.3.5 Relationship between serum LILRA3 levels and EDSS in MS

The possible impact of LILRA3 levels on disease severity (reflected in EDSS at the time of sera collection) was determined in LILRA3+/+ and +/- patients (n=192). Patients with low disease activity (EDSS=0.5-2.0; n=65) showed significantly lower levels of

LILRA3 when compared to patients with intermediate disease activity (EDSS=2.5-5.5; n=65; p<0.05) and to patients with high disease activity (EDSS=6.0-8.0; n=62; p<0.001)

(Figure 2-5A). Consistent with this, there was significant positive correlation between increasing concentrations of serum LILRA3 and higher disease severity scores (Spearman r=0.29, p=0.002; n=192) (Figure 2-5B).

A B 15 p<0.001 NS 20 Spearman r = 0.29

p<0.05 p<0.002

SEM) SEM)

± 10 15 ±

10 5

n=65 n=65 n=62 5

LILRA3 ng/ml ( ng/ml LILRA3 LILRA3 ng/ml ( ng/ml LILRA3 0 0 0.5-2.0 2.5-5.5 6.0-8.0 0 2 4 6 8 EDSS EDSS

Figure 2-5: Association of serum LILRA3 with disease severity (EDSS) (A) Patients with MS with low disease severity (EDSS scores 0.5-2) had significantly lower levels of serum LILRA3 when compared to patients with moderate disease severity (EDSS 2.5-5.5) and patients with severe disease (EDSS 6.0-8.0); Data are presented as mean ± SEM and analysed using one way ANOVA with Dunn’s post-test for multiple comparisons. (B) Spearman analysis confirming significant positive correlation between increasing levels of LILRA3 in serum and EDSS scores in patients with MS (r=0.29, p<0.002).

Multiple regression analysis showed that LILRA3 protein level and age of disease onset were highly significant independent indicators of disease severity as determined by EDSS (Table 2-5). In brief, one standard deviation (SD) increase in LILRA3 protein level predicted 0.19 SD increase in disease severity (β=0.19, p=0.006) and 1 SD increase in the median age of disease onset was linked to a 0.43 SD decrease in disease severity (β=- 0.43, p=0.001) (i.e. higher LILRA3 levels or younger age of disease onset were linked to more severe disease). Age at the time of blood collection was also positively associated with more severe disease, although less significant (Table 2-5). By contrast, sex or recent disease recurrence did not significantly contribute to EDSS (Table 2-5).

Table 2-5: Multiple regression analysis to evaluate the independent contribution LILRA3 to EDSS in context of other relevant covariates (n=440) Variable* p value Standardised Coefficients β

LILRA3_log 0.006 0.192

Age of disease onset 0.001 -0.434

Sex 0.238 -0.081 Age at the time of blood 0.01 0.539 collection Recent disease recurrence 0.250 -0.079 *Dependent variable: EDSS at the time of sera collection

2.3.6 Associations between alteration in serum LILRA3 levels and changes in EDSS over time

To investigate whether LILRA3 levels change with fluctuations in clinical status, LILRA3 levels were measured at two time points (12 months apart) in 18 patients with RRMS who had sequential EDSS scores and corresponding serum samples. In patients showing clinical improvement, there was a significant increase in LILRA3 levels during the 12 month follow-up (n=6, p=0.04) (Figure 2-6A). By contrast, patients with worsening clinical disease had markedly lower serum LILRA3 during the 12 month follow-up compared with initial levels (n=6, p=0.06) (Figure 2-6B). There was no change in serum LILRA3 levels in patients with stable clinical scores (n=6, p=0.2) (Figure 2-6C).

A B C Patients with decrease in EDSS Patients with increase in EDSS Patients with no change in EDSS

20 25 15

p=0.04 p=0.06 p=0.2 20 15 10 15 10 10 5 5

LILRA3 ng/ml (± SEM) (± LILRA3ng/ml

LILRA3 ng/ml (± SEM) (± LILRA3ng/ml LILRA3 ng/ml (± SEM) (± LILRA3ng/ml 0 0 0 0 month 12 months 0 month 12 months 0 month 12 months

Figure 2-6: Association between altered serum LILRA3 levels and fluctuated EDSS over time (A) Patients with RRMS that showed clinical improvement (decrease in EDSS score) at a 12 month follow-up had marked increase in LILRA3 levels in serum when compared to levels measured 12 months earlier (n=6, paired t test, p=0.04). (B) By contrast, patients that had worsening disease (increase in EDSS score) had markedly lower serum LILRA3 at the 12 month follow-up (n=6, p=0.06). (C) LILRA3 level remained steady in most patients with stable clinical scores (no change in EDSS score) (n=6, p=0.2).

2.3.7 Correlations between LILRA3 and serum IL-10, IFN-γ and TNFα levels in patients with MS

LILRA3 is upregulated in monocytes treated with recombinant IL-10 or IFN-γ in vitro (35) and in psoriatic patients injected with IL-10 in vivo (66), however, it is downregulated by TNFα in vitro (35). Thus, we proposed that IL-10, IFN-γ and/or TNFα levels in sera of patients may regulate LILRA3 expression. To address this, serum IL-10, IFN-γ and/or TNFα in 80 randomly selected patients were measured using a multiplex immunoassay, showing 7.9 ± 0.5 pg/ml, 28.9 ± 1.4 pg/ml and 18.6 ± 1.0 pg/ml respectively. These results are comparable with previous study that was performed on a larger cohort of MS population using same method, in which serum IL-10, IFN-γ and/or TNFα were 16.8 pg/m, 7.5 pg/m and 4.1 pg/ml respectively (358).

Spearman correlation studies were used to correlate the serum IL-10, IFN-γ and/or TNFα to the corresponding serum LILRA3. Figure 2-7 showed that serum LILRA3 levels positively correlated with IL-10 (Spearman r=0.24) and this was statistically significant (p=0.03) (Figure 2-7A). Positive correlation was also found with IFN-γ (Spearman r=0.20) but this was not statistically significant (p=0.06) (Figure 2-7B). In contrast, there was statistically non-significant (p=0.27) weak negative correlation between TNFα and LILRA3 (Spearman r=-0.12) (Figure 2-7C), as opposed to the positive correlation observed with IL-10 and IFN-γ.

A B C 60 60 60 Spearman r = 0.024 Spearman r = 0.20 Spearman r = -0.12 P = 0.03 p= 0.06 p=0.27 40 40 40

20 20 20

LILRA3 (ng/ml) LILRA3

LILRA3 (ng/ml) LILRA3 LILRA3 (ng/ml) LILRA3

0 0 0 0 5 10 15 20 25 0 20 40 60 80 0 20 40 60 IL-10 (pg/ml) IFN-γ (pg/ml) TNF-α (pg/ml)

Figure 2-7:Correlations between LILRA3 and serum IL-10, IFN-γ and TNFα levels in 80 patients with MS (A) Serum IL-10 concentrations in patients with MS showed significant positive correlation to LILRA3 levels in the corresponding sera (Spearman r=0.24; p=0.03). (B) Similarly, serum IFNγ in the same patients positively correlated to their LILRA3 levels but this was not statistically significant (Spearman r=0.20; p=0.06). (C) By contrast, there was negative association between serum TNFα and LILRA3, although the correlation was weak and did not reach statistical significance (Spearman r=-0.12; p=0.27).

2.3.8 The expression of LILRA3 protein in human CSF

To investigate the expression of LILRA3 protein in CSF, 10 µl CSF from patients with MS and relevant controls were analysed by Western blotting. Figure 2-8A and B showed that LILRA3 is detectable in CSF samples from patients and controls with expected molecular mass (~70 kDa) (Figure 2-8). It seems that different CSF samples contained various amounts of LILRA3 according to reactivity. However, the amount of the immune-reactive LILRA3 cannot be semi-quantified due to lack of house-keeping protein as relevant controls. Quantification of LILRA3 in CSF was attempted using an in-house LILRA3 sandwich ELISA; however, levels were found to be lower than the detection range, suggesting that the concentration of LILRA3 in CSF is less than 195 pg/ml.

A B 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 250 250 150 150 100 100 75 LILRA3 75 LILRA3 50 50 37 37 25 25 20 10 20 10

Figure 2-8: Detection of LILRA3 protein in human CSF (A) (B) Representative Western blotting showing the expression of LILRA3 protein in CSF. Lane 1 and 2 are CSF from relevant controls and lanes 3 to 8 are CSF from patients with MS. LILRA3 is around 70 kDa.

2.4 Discussion

A LILRA3 gene deletion polymorphism has been reported to be associated with several autoimmune diseases (reviewed in (107)). However, there are some inconsistent results with regards to the association of LILRA3 gene deletion to the susceptibility of MS. Here a total of 456 patients with MS and 99 age sex and race-matched heathy controls was recruited from a North American cohort. The female to male ratio was around 3, which reflected the fact that there is a higher prevalence of MS in women than in men (269,270). The demography results showing the longest disease duration of SPMS comparing to RRMS and PPMS, the later disease onset of PPMS than RRMS, as well as the higher disease severity (EDSS) of SPMS and PPMS than RRMS are consistent with the natural history of clinical subtypes of MS (287,288). It is notable that the mean age at disease onset and EDSS for this study were slightly higher compared with previous studies on Spanish (127) and Polish (128) populations. This is because our study included an additional clinical subtype of PPMS, which is known to have later disease onset and more severe progression of disability (a higher EDSS) than RRMS and SPMS (290,291). This is beneficial for thoroughly studying the association of LILRA3 gene deletion polymorphism with different clinical outcomes. This study found no association between LILRA3 deletion and the susceptibility of MS in a North American cohort. Genotypic and allelic frequencies of LILRA3 gene deletion in control subjects were measurably but not significantly higher than in patients. These findings are contrary to previous studies that reported associations between LILRA3 gene deletion and MS susceptibility in German (129) and Spanish (127) populations, but consistent with Polish (128) and Finnish (132) studies, which also did not find a link between LILRA3 deletion and MS susceptibility. Considering similar PCR-based LILRA3 genotyping methods were used across these studies, differences in genetic background among the different populations and sample sizes may partially explain the contradicting results regarding the association of LILRA3 deletion to MS susceptibility.

Interestingly, recent multicentre genome-wide association studies that included over 80,000 individuals of European ancestry also failed to reveal LILRA3 gene polymorphism as one of the more than 110 MS risk variants identified (136-139). It is also important to note that the difference in the distribution of homozygous LILRA3

85 deletion between patients and controls in the German study was very small (3.3%), despite reaching statistical significance due to a large sample size (129). Similarly, the result in one of the two Spanish cohorts (Hospital del Mar, Barcelona) was not significant and required pooling of two cohorts to achieve statistically significant effects (127). Interestingly, a recent meta-analysis in another Spanish group indicated no link between LILRA3 gene deletion and MS risk (359). Results in this study do not support an association between LILRA3 gene deletion polymorphism and MS susceptibility. Moreover, further logistic and linear regression analysis indicated that there was no link between LILRA3 gene deletion (+/- and -/-) with clinical severity, clinical subtype or age of disease onset in a North American cohort. These results contradict the Polish study, which suggested that LILRA3 gene deletion was associated with later disease of MS (128) regardless of the small gap of median age of the disease onset (4 years).

MHC variants are consistently associated with MS susceptibility and early disease onset (reviewed in (287)). In Particular, one study in a Spanish population indicated that having both LILRA3 gene deletion and HLA-DRB1*1501 allele may have synergistic effects to increase the risk of suffering RRMS (127). Further study on the MHC variants in my study cohort would be helpful to understand the interplay of the LILRA3 gene and MHC risk variants on MS.

Owing to these conflicting genetic study results, here it was proposed that measurement of serum LILRA3 protein may provide a clearer representation with regards to its association with MS. This is the first study to show that serum LILRA3 protein was significantly upregulated in patients with MS compared to the healthy controls. Analysis in patients with the different clinical subtypes showed that patients with PPMS had the highest amounts of serum LILRA3 followed by patients with SPMS that had intermediate amounts and patients with RRMS that had the least amount. Importantly, correlation studies showed that increasing amount of LILRA3 in patient sera was positively correlated with more sever disease (high EDSS). These results are in good agreement with the detection of highest serum LILRA3 in PPMS since PPMS patients typically have more severe disease. Moreover, multiple regression analysis using LILRA3 protein levels, age of disease onset, sex, recent disease exacerbation and age at the time of blood collection as independent variables to predict the disease severity (reflected in EDSS) showed that serum LILRA3 level is one of the strongest positive predictors of disease

86 severity in MS. Simultaneously, other tested independent variables including age of disease onset and age at the time of blood collection are also strong predictors for disease severity. These results are consistent with the current knowledge about the correlation of early disease onset or older age with more sever disease (290,291), indicating that this regression analysis is effective and reliable. All these results suggest that serum LILRA3 might potentially be used as a biomarker for disease severity and/or as an additional objective indicator of clinical subtype in MS.

To date, there is lack of established effective biomarkers for predicting the disease progression or clinical outcomes due to the clinical and pathophysiological complexities of MS. MRI and OCBs in CSF are the common imaging and laboratorial biomarkers that are currently used to assist with the diagnosis (295,296,344), but they are not specific for disease progression. MRI is an expensive procedure requiring specialist personnel and equipment. Moreover, MRI and OCBs in CSF cannot accurately reflect the neurodegeneration and disability progression and must be used in combination with other biomarkers and EDSS score. The majority of reported potential biomarkers that have shown strong association with neurodegeneration and disease progression, for example, neurofilaments proteins, Nogo-A and Tau protein are detected within the CSF (295,296), which is collected using an invasive method that is not ideal for multiple measurements. In comparison, serum LILRA3 is an attractive potential biomarker for disease severity as serum levels are more accessible to repeated measures. Considering the elevated LILRA3 in serum is also associated with more severe rheumatoid arthritis (RA) (35), LILRA3 may be used as an additional objective biomarker for disease severity together with other established methods.

Increasing amounts of LILRA3 with increasing disease activity scores are detected in MS and RA (35), indicating that LILRA3 may play a role in the pathogenesis of diseases characterised by excessive unregulated chronic inflammation. Limited in vivo clinical association studies demonstrated that LILRA3 protein/mRNA are significantly upregulated during inflammation (35,67). Moreover, LILRA3 gene and/or protein is significantly increased in response to in vivo and in vitro treatment of monocytes with the anti-inflammatory cytokine, IL-10 (35,66), but not in response to in vitro treatment with the pro-inflammatory mediator, TNFα (35). Here we showed a significant positive correlation between the serum level of LILRA3 and one of the most potent anti-

87 inflammatory cytokines, IL-10 and a negative correlation to the protypical pro- inflammatory cytokine TNFα, albeit weakly. These new in vivo results are consistent with our previous in vitro observation (35), suggesting that the elevated LILRA3 in MS is tightly regulated by the levels of immunoregulatory cytokines TNFα and IL-10. There is evidence that pro-inflammatory cytokine TNFα is elevated in patients with onset of MS relapse and play a pathogenic role to promote disease progression and tissue damage (357,360), whereas the elevated anti-inflammatory cytokine, IL-10, is associated with disease remission in MS partially by suppressing pro-inflammatory cytokine production such as TNFα in macrophages (353-356). IL-10 is produced by a variety of leukocytes including T cells, B cells and monocytes/macrophages and it is significantly upregulated in monocytes upon stimulations such as TLR or Fc receptor (360,361). IL-10 inhibits TNFα bioactivity through stimulating the production of soluble TNF receptors in activated monocytes (361,362) and the underlying mechanisms has been extensively studied such as inhibition of TNFα transcription, NF-kB and p38 MAPK pathways (see review (363)). Interestingly, in vitro evidence shows that LILRA3 can suppress TNFα production in monocytes upon LPS stimulation (20). All these results may indicate a new IL-10-LILRA3 counter-regulatory feedback mechanism that downregulates the TNFα production during MS inflammation, however, this requires further investigation.

LILRA3 is soluble and does not have membrane-bound counterpart, but its “ligand binding” extracellular domains are highly homologous to some activating LILRs (9), thus it may exert anti-inflammatory properties by acting as a soluble antagonist to these activating receptors, analogous to the soluble TNFα and IL-1 receptors (364). In agreement to this proposal, substantial increase in LILRA3 levels was found in patients that showed clinical improvement over a 12 month period contrasted with patients that had worsening clinical scores had substantial decrease in LILRA3 levels. Similar expression patterns have been shown in some key molecules that are known to improve disease outcome in MS (353-356). Particularly, elevated IL-10 was associated with disease remission in MS (353-356), and higher blood levels of vitamin D correlated with better clinical outcomes (282). Moreover, it has been shown that patients that responded to treatment with IFN-β had substantially increased serum IL-10 (347-349), and vitamin D is proposed to modulate inflammation through upregulation of IL-10 (351,352). It is intriguing to speculate whether the anti-inflammatory effects of IL-10 in this setting might

88 be explained by its ability to induce mediators such as LILRA3 (35,66) and failure to respond to IFN-β treatment in a subset of patients with MS might in part be due to deficiencies in secondary messengers such as LILRA3. Interestingly, we found elevated LILRA3 levels at 12 months follow-up that were higher than the initial levels in a subset of patients despite their clinical improvement. This is likely due to ongoing subclinical inflammation and/or that the LILRA3 protein that was highly elevated in response to the initial disease reactivation may have persisted in circulation beyond the 12 months follow-up due to long half-life of the protein. Moreover, these patients might have continued with treatments that are known to directly or indirectly increase IL-10 including IFN-β (348) or vitamin D (351,352). It is also noteworthy that this study was performed in small number of patients requiring cautious interpretation of the data and warranting further investigations.

This study showed that homozygous 6.7 kbp LILRA3 gene deletion results in undetectable amounts of LILRA3 protein in sera. This is the first experimental confirmation of the predicted lack of LILRA3 translation in healthy subjects with homozygous LILRA3 gene deletion. The physiological significance of the absence of LILRA3 protein in a subset of healthy subjects remains to be elucidated. Moreover, this study is also the first to detect the expression of soluble LILRA3 in CSF. Whether LILRA3 is expressed in the CNS requires further investigation.

Taken together, the results presented here indicate that LILRA3 is not a risk variant in MS susceptibility but may be involved in modulating inflammation thereby contributing to the variability in disease severity and/or clinical outcomes. LILRA3 also represents a new biomarker that indicates disease severity and possibly disease progression. The exact functions of LILRA3 in MS require further investigation.

CHAPTER 3: CHARACTERISATION OF FUNCTIONAL INTERACTION BETWEEN LILRA3 AND NOGO 66

3.1 Introduction

LILRA3 is an exclusively secreted protein without a transmembrane domain and signalling motifs, but it shares high structural homology to the extracellular domains of cell surface LILRs including the activating LILRA1 and LILRA2, inhibitory LILRB1 and LILRB2 (Section 1.2.2) (8,9), therefore LILRA3 may act as a soluble antagonist/agonist via shared ligands. However, LILRA3 functions are not fully elucidated, primarily due to a lack of knowledge about its natural ligands, despite convincing clinical association with MS (Chapter 2) and its potent anti-inflammatory properties in vitro (20,35). Moreover, the lack of mouse models also severely hinder progress in understanding LILRA3 functions in vivo because LILRs do not have rodent homologues, although PIRB is considered the murine orthologue of human cell surface inhibitory LILRs (365).

Limited number of studies show that LILRA3 interacts with some MHC I molecules, but the binding affinities are low (µM range), results are inconsistent and there is a lack of functional readouts (83). These deficiencies may in part be due to the existence of alternate high affinity LILRA3 ligand(s) and/or were caused by the use of non- glycosylated E.coli produced truncated proteins or due to the use of Fc fusion LILRA3 proteins that may alter interactions (13,83). Putting all of the above into consideration, our group produced correctly glycosylated, full-length recombinant LILRA3 in a mammalian expression system and used this protein for high throughput screening of LILRA3 binding to cell surface proteins on >40 cell lines of various lineages as well as on primary peripheral blood mononuclear cells (20). Primary peripheral blood monocytes consistently exhibited specific high affinity binding to LILRA3 (20) and plasma membranes extracted from these cells were used in a new proteomic based method to identify two new (Nogo 66 and 67 kDa laminin receptor) and one known MHC-class I (HLA-B2705) molecules as candidate high affinity LILRA3 binding proteins. The aim of this part of the project was therefore to further validate binding and systematically characterise the binding affinity of LILRA3 with one of the candidate ligands, Nogo 66 and determine the functional consequences of their interaction in vitro. 91

Nogo 66 is a highly conserved 66 amino acid surface membrane loop of the reticulon family of proteins that include Nogo-A, -B and -C, and is critical for several vital inhibitory roles of Nogo proteins via interaction with its traditional receptor Nogo receptor (NgR1) and the newly discovered receptor PIRB (191,193,194,196,231,262,366-368). Nogo-A is mainly expressed by neurons with high plasticity and oligodendrocytes in the CNS (202-204) and is involved in various developmental and maturation processes in the CNS (see reviews (196,233) and Section 1.4.1.3). In the development of the nervous system, Nogo-A inhibits neuron migration (227,235,236) and branching (237) as well as oligodendrocyte differentiation and myelination (241). Nogo-A also has inhibitory functions in the adult CNS, where it downregulates neuronal growth, stabilizes wiring and restricts neuronal plasticity (191,194,233,243). These inhibitory properties in the adult CNS greatly hinder the neuronal regeneration once the CNS is damaged or injured. Furthermore, aberrant expression levels have been linked with various CNS diseases including MS (233,255,369). The upregulation of Nogo-A and NgR1 are detected in oligodendrocytes around chronic active lesions in the brain tissues of patients with MS (211), suggesting that Nogo-mediated inhibitory signalling may play a role in the disease progression. Consistent with this, Jurewicz et al have shown that soluble Nogo-A is only detectable in CSF of patients with MS but not in other neurological diseases and thus it has been considered as a MS biomarker to predict neurodegeneration of the CNS (252). Furthermore, Nogo-A has been shown to inhibit the maturation of oligodendrocytes (241). These results suggest that the increased amount of Nogo-A in MS lesions may restrict the remyelination and thus contributing to neurodegeneration. Extensive studies on experimental autoimmune encephalomyelitis (EAE), mouse model for MS, demonstrate that diminishing functional Nogo-A by neutralisation antibodies (253) or siRNA (254), or blocking NgR1 or its downstream signalling protein, collapsin response mediator protein 2 (256), can promote axonal regeneration and functional recovery in EAE mice. Consistently, immunisation of Nogo-knockdown EAE- susceptible mice with Nogo 66 peptides induced a CNS immune response with clinical and pathological similarities to EAE (370). All these results suggest that Nogo-A/Nogo 66 plays a critical role in regulating the neurodegeneration of MS and targeting of Nogo mediated inhibitory signalling may be a therapeutic approach to treat patients with MS.

The first identified Nogo 66 signalling receptor is NgR1 (185,196). There is strong evidence showing that Nogo 66 binds to NgR1 and forms a complex with transmembrane proteins LINGO1, and p75 or TROY to activate the small GTPase, RhoA and subsequently activate Rho-associated, coiled-coil containing protein kinase 1 (ROCK), eventually leading to the rearrangement of the cytoskeleton and growth cone collapse (188,196,226). Blocking or inactivation of RhoA or the ROCK signalling pathway allows injured axons cultured on an inhibitory myelin substrate to regrow in vitro (197,225,226). Recently, Nogo 66 has been shown to also interact with PIRB to inhibit neurite outgrowth (65,178) and neuroplasticity (176), however, PIRB-mediated signalling events in neurons remain unknown. Studies have shown that upon ligation PIRB inhibits leukocyte activation through the recruitment of Src homology 2 domain-containing protein tyrosine phosphatases (SHP-1 and/or SHP-2) which dephosphorylate protein tyrosine kinase substrates, thereby antagonising cell activation. Interestingly, one recent study shows that binding of myelin-associated protein (MAG) to PIRB can recruit SHP-1/2 to dephosphorylate tropomyosin receptor kinase (Trk) receptor, a nerve growth factor receptor known to promote neurite growth in neurons, eventually leading to the inhibition of axonal regeneration after CNS injury (187). Therefore, it is reasonable to speculate that the engagement of Nogo 66 with PIRB may promote recruitment of SHP-1/2 to dephosphorylate growth-promoting protein tyrosine kinases. Although limited, studies show that the more ubiquitously expressed Nogo-B is involved in regulation of lung inflammation (262,263) and in prevention of degenerative vascular injury (367,368). Nogo-C is selectively expressed in the CNS and skeletal muscle but its functional role remains unknown, although decreased expression of mRNA and protein in muscle is associated with amyotrophic lateral sclerosis (268). This study will focus on the characterisation of the functional interaction between LILRA3 and Nogo 66 in the context of the CNS (194,196) and MS (253,255,369) (Chapter 2). The interaction between LILRA3 and Nogo 66 was confirmed by several independent methods including surface plasmon resonance (SPR), co- immunoprecipitation studies and biochemical assays. Results were shown that LILRA3 binding to Nogo 66 was high affinity, saturable and specific. Importantly, LILRA3 potently reversed Nogo 66-mediated inhibition of neurite outgrowth in human and mouse primary cortical neurons in vitro and increased numbers of synaptic contacts, likely via regulation of the MEK/ERK pathway. This tantalising discovery points to novel LILRA3 93 functions in the CNS, distinct from its proposed regulatory role in leukocytes. It is speculated that soluble LILRA3 may act as an antagonist against closely related cell surface inhibitory receptors, LILRB2/PIRB as well as NgR1 by competitively binding to a shared Nogo 66 ligand. Reversal of Nogo-mediated inhibition of neurite outgrowth by endogenous LILRA3 may have implications in CNS disease states where Nogo-A is a major contributor to the inhibitory microenvironment leading to failed regeneration after neuroaxonal damage including MS.

3.2 Methods

3.2.1 Cell lines culture

HEK 293T cells (human embryonic kidney epithelial cell transformed with SV40 large T antigen) were used for production of recombinant LILRA3 protein; HEK 293FT cells (fast-growing variant of 293T) were used for production of Nogo shRNA lentivirus; HT1080 cells (human fibrosarcoma epithelial cell) were used to estimate the lentivirus titer. SK-N-SH cells (human neuroblastoma cell line) were used for co- immunoprecipitation of native Nogo 66 with native LILRA3 isolated from monocytes. All above cell lines were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) complete media supplemented with 10% fetal bovine serum (FBS), penicillin (100 U/ml)/streptomycin (100 μg/ml), 1 mM sodium pyruvate and 10 mM HEPES. Since they are adherent cells, cells were detached using 0.25% Trypsin-EDTA solution at 37°C for 3 min and neutralised with 10 x volumes of complete DMEM media. Cells were pelleted by centrifugation at 300 g for 5 min and washed once in PBS, followed by cell counting using a hemocytometer. Cells were seeded at low density (0.5-1 x 105 cells/ml) at 37°C in 5% CO2 air and passaged 2-3 times per week. All the culture reagents were purchased from Life Technologies, VIC, Australia.

3.2.2 Production of recombinant LILRA3 proteins

The plasmid DNA constructs of LILRA3 immunoglobulin-like domains (D1-D4) with C-terminal tagged heat resistant placental alkaline phosphatase (AP) (LILRA3- APtag) or 6x histidine tags (LILRA3-His) were generated by Ainslie Mitchell and Dr Terry Lee respectively (School of Medical Sciences, UNSW). Recombinant LILRA3- APtag and LILRA3-His proteins as well as APtag alone protein (control) were purified as previously described (20). In brief, HEK 293T cells overexpressed with LILRA3- APtag, LILRA3-His or Aptag alone proteins were gradually adapted to DMEM media containing 2% FBS. A total of 500 ml of serum minimised culture media was collected, then buffer exchanged and concentrated to 50 ml in binding buffer (20 mM Tris pH 7.4, 150 mM NaCl and 5 mM imidazole) using a Amicon ultrafiltration system (Amicon, USA) with a 30 kDa cut off membrane (Merck Millipore). The concentrated protein was

95 loaded onto a 1 ml TALON cobalt immobilised metal affinity resin (Clontech, USA) using gravity feed and recycled through the column 3 times. The column was then stringently washed with 20 ml of washing buffer (20 mM Tris pH 7.4 and 150 mM NaCl) and then eluted with 15 ml elution buffer (20 mM Tris pH 7.4, 150 mM NaCl and 50 mM imidazole). Fractions of the eluted purified protein were collected and stored in 15 x 1 ml fractions at 4°C. Recombinant LILRA3-AP and APtag protein were quantified using an AP assay (Section 3.2.11.2 and (371)). The quality of purified protein were further assessed using SDS-PAGE and visualisation by silver staining (see Method Section 2.2.6).

Large scale therapeutic grade LILRA3-His recombinant protein in PBS was custom-made in HEK 293FT cells in collaboration with Commonwealth Scientific and Industrial Research Organisation (CSIRO, VIC, Australia). Purified human IgG1 purchased from Jackson ImmunoResearch (PA, USA) was used as a negative control to LILRA3.

3.2.3 Production and purification of recombinant Nogo 66-His

Human C-terminal 6xHis tagged Nogo 66 (Nogo 66-His) was subcloned from Nogo 66 in pGEX2 (kindly donated by Pei-hua Lu, Shanghai University) into pET30 EK/LIC (Novagen, Darmstadt, Germany) by Dr Terry Lee using forward primer 5’- GACGACGACAAGATGAGGATATACAAGGGT-3’ and reverse primer 5’- GAGGAGAAGCCCGGTTCACTTCAGAGAATC-3’ and protein expressed in BL21 DE3 E.coli. Soluble recombinant Nogo 66-His protein was purified using an established method with minor modifications. In general, 5 µl of pET30 EK/LIC-Nogo 66 glycerol stock was inoculated in 50 ml LB media containing 50 µg/ml Kanamycin, shaking (200 rpm) at 37°C overnight. The bacteria culture was transferred into 1 L LB media containing 50 µg/ml Kanamycin and incubated at 37°C for 1.5-3 h with shaking until the bacteria OD was approximately 0.5 at absorbance 600 nm, then 0.5 mM Isopropyl-β- thiogalactosidase (Sigma) was added to initiate Nogo 66-His transcription in E.coli, following another 4 h incubation with shaking at 37°C.

Bacteria were pelleted by centrifugation at 5,000 x g for 20 min at 4°C and washed once with 40 ml cold TBS, and then resuspended thoroughly in 10 ml lysis buffer (TBS + 1% Triton X-100, 1 mg/ml protease inhibitor (Complete Protease Inhibitor Cocktail

Tablets, Roche), 2 mg/ml lysozyme (Sigma), and 50 mU/ml Benzonase® Nuclease (Sigma)) and incubated at 37°C for 30 min with shaking. The resuspended bacteria were sonicated at 50% power cycle for 6 cycles at 40 sec with 1 min rest on ice (Branson Ultrasonic, Danbury, CT, USA). The lysed bacteria were centrifuged at 16,000 x g at 4°C for 20 min and the supernatant (cell lysate) was collected, then filtered through a 0.22 µm filter. Cell lysate contained a relative small amounts of Nogo-His protein compared with the pelleted inclusion bodies, thus the inclusion body pellet was washed twice with washing buffer (1% Triton X-100 in TBS) and then resuspended in 10 ml of 8 M urea (Sigma) in TBS, followed by overnight incubation at 4°C with constant mixing. The denatured inclusion body protein was collected from the supernatant by centrifugation at 16,000 x g at 4°C for 20 min and then gradually refolded by dialysing sequentially against 4 M then 2 M urea in TBS at 4°C overnight using 10 K MWCO SnakeSkin Dialysis Tubing (Thermo Fisher Scientific). The supernatant was filtered with 0.22 µm filter and stored at -20°C until further purification.

Supernatant containing Nogo 66-His isolated from inclusion body was further purified using Profinity Immobilised metal affinity chromatography (IMAC) Nickel charged resin (Bio-Rad) according to the manufacture’s instruction. In general, a 0.7 x 15 cm Econo-Column Chromatography Column (Bio-Rad) was packed with 1.5 ml Nickel (Nic-) charged resin and washed with 3 column volumes of distilled water, followed by 5 column volumes of binding buffer (2 M urea in TBS). Nogo 66-His supernatant was loaded into the column using gravity feed. The flow-through was collected. In order to maximise Nogo 66-His binding to resin, the Nogo 66-His supernatant was reloaded 3 more times. The column was then washed with 5 column volumes of washing buffer (2 M urea and 10 mM Imidazole in TBS). Nogo-His protein was eluted with 15 ml of elution buffer (TBS + 2 M urea, 500 mM Imidazole and 1 mM DTT). Protein fractions (1 ml/tube) were collected using gravity feed and then stored at 4°C. The purity and quantity of eluted protein were analysed by running 10 μl of elution fraction on a SDS-PAGE gel, which was then visualised by silver staining (see Method Section 2.2.6).

To obtain pure Nogo 66-His protein without salt and lipopolysaccharide (LPS) contamination, the eluted protein was further purified using reverse phase high pressure liquid chromatography 600S HPLC (Waters Corporation, MA, USA) and a C8 hydrophobic column (Sigma, MO, USA). UV absorbance was monitored at 214 nm and

280 nm with a Waters 996 photodiode array detector. IMAC-purified protein was injected onto the column and separated using a gradient of 35–65% acetonitrile (0.1% trifluoroacetic acid) at 3 ml/min over 30 min. Nogo 66-His was eluted approximately 15- 20 min from the start of the gradient and fractions were collected and analysed using SDS-PAGE gel followed by silver staining and/or Western blotting (refer to Section 2.2.6) with mouse anti-His mAb (Novagen, CA, USA)

Nogo 66-His protein was stored in HPLC eluate (~45% acetonitrile, 0.1% trifluoroacetic acid) in NUNC-Immuno tubes (NUNC) at -80°C, purged with argon. For use, protein was dried in a SVC 200H Speed-Vac concentrator (Savant Instruments, Farmingdale, NY, USA) and reconstituted in water (1 mg/ml), tested for LPS and used within 1 week. 6xHis-tag peptide in pET30 EK/LIC was expressed in BL21 DES E.coli, purified as above and used as a relevant control.

3.2.4 Peripheral blood mononuclear cells isolation

Blood samples were collected with anti-coagulant, acid citrate dextrose tubes (BD Bioscience, NSW, Australia) and peripheral blood mononuclear cells (PBMCs) were isolated by Ficoll density-gradient centrifugation. In brief, 15 ml blood samples were mixed with 15 ml PBS and then gently over-layed on top of 15 ml of Ficoll-Paque Plus (GE Healthcare, Australia) without disturbing the intermediate layer. Samples were centrifuged at 700  g for 25 min at RT with the centrifuge break off. The white cloudy interphase, containing PBMCs were carefully transferred to a new tube and washed twice with PBS. Cells were then resuspended in RPMI media (GIBCO, Life Technologies) supplemented with L-glutamine, penicillin/streptomycin. Cell numbers were determined using the Beckman Coulter counter (Beckman Coulter Inc., NSW, Australia).

3.2.5 Identification of LILRA3 binding proteins from PBMCs by Mass Spectrometry

Identification of candidate LILRA3 binding proteins from PBMCs was performed by Ms Ainslie Mitchell and Dr Nicodemus Tedla. In general, PBMCs were obtained according to the method described in Section 3.2.4. PBMCs from healthy donors were lysed in a non-detergent lysis buffer using Nitrogen cavitation (372). In brief, 1 x 108 PBMCs were washed once in H-buffer (10 mM HEPES, pH 7.2, 250 mM sucrose, 2 mM

MgCl2, 10 mM NaF, 1 mM vanadate) and suspended in 3 ml H-buffer containing protease

98 inhibitor cocktail, then dissociated using a Nitrogen cavitation chamber at 50 bar for 10 min (Parr Instrument Company, IL, USA). Plasma membrane from cell homogenates were separated by sucrose gradient ultracentrifugation (373). Protein concentrations were adjusted to 5 mg/ml in HBHA ligand-binding buffer (HBSS + 0.5 mg/ml BSA, 0.1%

NaN3, 20 mM HEPES and protease inhibitors, pH 7.0). membrane protein (5 mg/ml) was incubated with 500 nM LILRA3-APtag (experimental) or APtag (control) protein for 90 min at RT and LILRA3-APtag bait was co-immunoprecipitated with LILRA3 binding proteins by incubating samples with 20 µg (20 µl) Sepharose-conjugated anti-placental AP mAb (GenHunter, TN, USA) for 2 h at 4°C. Sepharose-bound proteins were precipitated by centrifugation and washed twice with Tris buffer (10 mM Tris-HCl, pH

8, 140 mM NaCl and 0.025% NaN3) containing 0.1% Triton X-100 and 0.1% bovine haemoglobin (Sigma, NSW, Australia), followed by 4 washes with Tris buffer and a final wash with 50 mM Tris-HCl, pH 6.8. Sepharose bead pellets from experimental and control samples were resuspended in 30 µl SDS-PAGE gel loading buffer containing 20 mM DTT, boiled at 100°C for 5 min and loaded onto a 10% one-dimensional SDS-PAGE gel and run under reducing conditions. Gels were washed 3 times with TBS then silver stained and excised bands sent to the Bioanalytical Mass Spectrometry Facility at University of New South Wales for tryptic digest and peptide mass sequencing using Nano LC-MS/MS. Comparisons of experimental and theoretical tandem mass spectra were automatically performed by Mascot version 2.0 (http://www.matrixscience.com), which scored peptide matches and correlated with protein identifications against Homo sapiens proteins in the Swissprot database. Precursor tolerances were 4.0 ppm and product ion tolerances ± 0.4 Da; acceptable cut-off scores for individual MS/MS spectra were set to 20 (20).

3.2.6 Surface plasmon resonance (SPR)

SPR experiments were performed using a BIAcore 2000 instrument (BIAcore,

Uppsala, Sweden) to determine the equilibrium dissociation constant (KD) between Nogo 66 and LILRA3. Recombinant Nogo 66-His (100 µl at 10 µg/ml) was immobilised onto research-grade Biacore sensor chips AU (GE Healthcare, NSW, Australia) at 5 μl/min flow rate to obtain 1000-1300 response units (RU). BSA (100 µl at 1 mg/ml) was used to block sensor chips at a flow rate of 20 μl/min and then chips were equilibrated in running buffer (PBS). Serially diluted recombinant LILRA3-His (50 µl at 20-200 nM) in PBS was 99 injected over the immobilised flow cells at a rate of 20 μl/min at RT. Binding responses with various concentrations were subtracted from the nonspecific responses to an empty flow cell. Kinetic constants were calculated with the BIA evaluation program (version 3.0.2; BIAcore).

3.2.7 Co-immunoprecipitation of Nogo 66 with LILRA3

3.2.7.1 Co-immunoprecipitation of recombinant Nogo 66 with recombinant LILRA3

Recombinant LILRA3-His (10 µg in 100 µl PBS) was immobilised onto 50 µl Concavalin A-conjugated Sepharose (Con A, GE Healthcare, NSW, Australia) at 4°C overnight. After removing unbound protein by gentle centrifugation, beads were washed 5 times with cold 20 mM Tris, 150 mM NaCl, pH 7.4, and resuspended in 50 µl cold HBHA buffer. Recombinant Nogo 66-His (1 µg in 100 µl water) was then added to the bead slurry with or without immobilised LILRA3 and incubated for 2 h at 4°C. Unbound protein was then removed by centrifugation and beads washed 4 times with Tris buffer and once with 50 mM Tris HCl, pH 6.8. Samples were separated by 10% SDS-PAGE under reducing conditions and Western blotting as described in Section 2.2.6. Membranes were immunoblotted with primary antibody rabbit anti-Nogo-A/B Ab (1.5 μg/ml, Imgenex, CA, USA) and followed by secondary antibody HRP-conjugated goat anti- rabbit Ab (1:5000 dilution; Bio-Rad). Immunoreactive bands were detected using Western Lightening Plus chemiluminescent substrate and images acquired by ImageQuant™ LAS4000. Membranes were then reblotted with mouse anti-LILRA3 mAb (1 μg/ml; Abnova) followed by HRP-conjugated goat anti-mouse Ab (1:10,000 dilution; Bio-Rad) and immunoreactive bands detected as above.

3.2.7.2 Co-immunoprecipitation of Nogo 66 expressed on SK-N-SH with native LILRA3 isolated from primary human monocytes

Fresh peripheral blood monocytes (2 x 107 cells/treatment) from a healthy blood bank donor were cultured for 72 h in the presence of 25 ng/ml recombinant IL-10 (R&D Systems) with 5 µg/ml Brefeldin A (Sigma). Monocytes were then non-detergent lysed in PBS by sonication (50% power cycle for 4 cycles at 40 sec with 1 min rest on ice). LILRA3 in the soluble fraction was bound to 50 µl of Protein A Sepharose beads (Sigma) and eluted with 0.2 M glycine (Sigma), pH 2.7 and collected directly into PBS pH 8.5-

100 containing Eppendorf tubes. The enriched endogenous LILRA3 protein was then bound to the surface of SK-N-SH neuroblastoma cell line (1 x 107 cells/treatment) that expressed endogenous Nogo for 90 min at RT. This was followed by 15 min incubation with mouse anti-LILRA3 mAb (Abnova) or negative control mouse IgG, both conjugated to sheep anti-mouse Dynal bead secondary Ab (Dynal, Thermo Fisher Scientific) on ice and non- detergent lysis of cells using a N2 cavitation chamber (372). SK-N-SH membrane proteins that bound the LILRA3 bait that specifically reacted with anti-LILRA3 mAb or non- specifically bound to the control IgG were immunoprecipitated using a magnetic stand, resolved in 10% SDS PAGE under reducing conditions, transferred to a PVDF membrane and sequentially Western blotted using anti-Nogo-A/B (Imgenex) and anti-LILRA3 (in- house) Abs .

3.2.8 Binding of Nogo 66 to plate-immobilised LILRA3

Nunc MaxiSorp 96-well flat bottom plates were equilibrated with 100 μl 0.05 M carbonate-bicarbonate buffer, pH 9.6 for 30 min at RT, then coated with increasing concentrations (0-30 nM) recombinant LILRA3-APtag or maximum amounts (30 nM) of human IgG control in 200 µl TBS and incubated overnight at 4°C. Unbound proteins were aspirated, wells washed once in TBS then 20 nM recombinant Nogo 66-His or 20 nM His-tag peptide control in 200 µl TBS was added, and plates were incubated for 2 h at RT. After removing unbound protein, wells were blocked with 5% BSA in TBS containing 0.05% Tween-20 (TBST) for 30 min at RT, washed 3 times with 200 µl/well TBST, then 50 μl mouse anti-His mAb (0.5 μg/ml; Novagen, CA, USA) diluted in TBST with 5% BSA was added to each well and incubated at 4°C overnight. Wells were washed 3 times with TBST, incubated at RT for 2 h with 50 μl biotinylated goat anti-mouse Ab (1 μg/ml; DAKO, Glostrup, Denmark) in TBS, then washed 3 times with TBST and incubated with 50 μl Streptavidin-HRP (1:200 dilution; R&D Systems, MN, USA) in TBS for 20 min at RT in the dark. After 4 washes with TBST, 100 μl of TMB substrate was added and plates incubated in the dark for 1 h at RT, reaction stopped with 50 μl 1

M H2SO4 and optical density at 450 nm and 540 nm measured using SpectraMax Plus plate reader (Molecular Devices, CA, USA).

101

3.2.9 Primary mouse and human cortical neuron cultures

Primary mouse cortical neurons were derived in vitro with the assistant from Dr Thomas Fath group (Neurodegeneration and Repair Unit, School of Medical Sciences, UNSW, Australia) as previously described (374). Briefly, E16.5 embryos were harvested from C57B6 mice and cerebral cortices carefully dissected, enzymatically digested and sequentially triturated using a wide and narrow fire-polished glass pipette. Dissociated neurons in DMEM with 10% FBS were then carefully seeded (1 x 105 cells) onto poly- D-lysine (PDL) coated wells or 12 mm coverslips. After 2 h media was changed to Neurobasal media supplemented with 2% B27 and 2 mM Glutamax (Life Technologies,

VIC, Australia), incubated at 37°C in 5% CO2.

Human foetal brains were obtained from 14-19-week fetuses after therapeutic termination in accordance with established institutional guidelines and ethics committee approval. Neurons were prepared and phenotyped by Prof. Gilles Guillemin group (Faculty of Medicine and Health Sciences, Department of Biomedical Sciences, Macquarie University, Australia) according to our established protocol (375,376). Briefly, 1-2 g cortical brain tissue was washed in PBS with 2% antibiotics and antimycotics (Life Technologies) then dissociated using a Neural Tissue Dissociation Kits (Miltenyl Biotec, NSW, Australia). Cells were filtered through 40 µm nylon mesh, centrifuged and resuspended in complete Neurobasal media containing 2% B27, 2 mM Glutamax, 50 mM HEPES, 200 IU/ml penicillin G, 200 μg/ml streptomycin sulfate, and 5 mM glucose (Life Technologies) at 2 x 105/ml, seeded onto PDL-treated-Matrigel- coated (Life Technologies) 24-well plates or 12 mm coverslips and then incubated at

37°C in 5% CO2 air.

The collection of foetal brain tissue to derive human cortical neurons in culture was approved by Macquarie University Human Ethics Committee (Ref # 5201300330) and The University of New South Wales Animal Ethics Committee approved the use of mouse foetal brain to derive cortical neurons in culture (Ref # 13/119A).

3.2.10 Co-culture primary cortical neurons with Nogo 66-His and LILRA3-His

PDL-coated or PDL plus Matrigel-coated 24-well plates were first spotted with 2.5 µl (10 nM/spot) recombinant Nogo 66-His (total 48 spots/well) or His-tag control in duplicates and dried at RT as described (185,194). Wells were then rinsed with PBS and 102 incubated with 150 µl recombinant LILRA3-His or human IgG in PBS (each 100 nM) at 4°C overnight. Unbound proteins were aspirated, wells rinsed with 500 µl Neurobasal media and seeded with primary mouse or human cortical neurons at 5 x 104/well in 500 µl or 2 x 105/well in 1 ml complete Neurobasal media respectively. Seeded mouse and human neurons were cultured at 37°C, in 5% CO2 in air in a humidified incubator until ready to use.

The LIVE/DEAD® assay kit (Molecular Probes, OR, USA) was used to detect live cells vs dead cells in our cultured human neurons and mouse cortical neurons according to manufacturer’s instruction. The viability of live cultured human and mouse neurons used for all experiments was >90% and 95% respectively.

3.2.11 Binding of LILRA3-APtag to mouse cortical neurons

3.2.11.1 In-situ staining of mouse cortical neurons with LILRA3-APtag

In-situ staining of LILRA3-APtag or APtag control protein to mouse cortical neurons was assessed as previously described (20). In brief, 5 day-cultured mouse cortical neurons were fixed with 4% paraformaldehyde (Electron Microscopy Sciences, PA, USA) for 10 min at RT, followed by 2 washes with PBS and one wash with HBHA. Mouse cortical neurons were then incubated with 100 nM LILRA3-APtag or APtag (control) at 4°C overnight. After 4 washes with HBHA, neurons were washed twice in Hanks buffer (150 mM NaCl, 20 mM HEPES, pH 7) and endogenous phosphatases were heat-inactivated at 65°C for 30 min in Hanks buffer. This was followed by rinsing the neurons once with AP substrate buffer (100 mM Tris-HCl, pH 9.5, 100 mM NaCl and 5 mM MgCl2) and incubation with AP substrate containing 0.17 mg/mL BCIP and 0.33 mg/mL NBT diluted in AP substrate buffer (BCIP/NBT Substrate Kit IV, Vector Laboratories, CA, USA) for 15 min up to 24 h until the positive blue staining was developed. For Ab blocking, neurons on coverslips were pre-incubated with 10 µg/ml rabbit anti-Nogo-A/B Ab in HBHA without BSA for 30 min at RT, rinsed and incubated with LILRA3-APtag or APtag control as previously described. Positive blue stained neurons counterstained with 1% neutral red were visualised using Olympus BX51 light microscope (Olympus, VIC, Australia).

103

3.2.11.2 Quantification of LILRA3-APtag binding to mouse cortical neurons

The fixed mouse cortical neurons were incubated with LILRA3-APtag or APtag control as previously described (see Method 3.2.11.1). After overnight incubation, neurons were washed 4 times with HBHA and then lysed with 250 µl AP lysis buffer (1% Triton X-100, 10 mM Tris-HCl, pH 8.5) by scraping the dishes thoroughly. Lysate was transferred to Eppendorf tubes and then vortexed vigorously. Lysate was collected after centrifugation at 14,000 x g for 5 min and heat-inactivation at 65°C for 15 min. Units of AP activity were determined using AP assay with AP activity standard (Sigma, NSW, Australia) (371). For Scatchard analysis of binding, neurons were incubated with serially diluted LILRA3-APtag (0-50 nM) and amounts of bound protein plotted against free protein or as a ratios of bound/free plus bound protein (371).

3.2.12 Nogo-A gene silencing

Four Nogo shRNA constructs and 1 scrambled shRNA inbuilt in psi-LVRU6MP lentiviral vector (vector map refer to Figure 3-1) were custom-made by GeneCopoeia (MD, USA). Nogo shRNA sequences (Table 3-1) were designed based on Gene Bank accession number NM_024226.3 and targeting Nogo RTN domain, a common carboxyl region that is shared across all Nogo isoforms (189,194).

Figure 3-1: Schematic diagram of psi-LVRU6MP lentiviral vector Nogo or scramble shRNA was inbuilt in psi-LVRU6MP lentiviral vector, which contains mCherry fluorescent tag after shRNA sequence and puromycin resistance tag for stable selection.

104

Table 3-1: The list of target sequences of Nogo and scramble shRNA

Target sequences

Nogo shRNA-1 gtgatccaagctatccaga

Nogo shRNA-2 ggatatataagggtgtgatcc

Nogo shRNA-3 gctcttggtcatgtgaacagc

Nogo shRNA-4 ggcgcagatagatcattatct

Scramble shRNA gcttcgcgccgtagtctta

3.2.12.1 Nogo shRNA lentivirus production

Nogo shRNA lentiviruses were produced in HEK 293FT according to manufacturer’s instruction (Life Technologies) (refer to Figure 3-2). Day 1, 1.3 x 106 HEK 293FT cells were plated in a 10-cm dish in 10 ml of DMEM complete media. Day 2, the media was changed to 10 ml DMEM complete media without penicillin/streptomycin and incubated at 37°C with 5% CO2 until ready to use. Cells were co-transfected with Nogo shRNA expression plasmid and ViraPower Packaging Mix (Life Technologies) using Lipofectamine 2000 (Life Technologies). In general, 3 µg Nogo shRNA expression plasmid and 9 µl ViraPower Packaging Mix were diluted in 200 µl Opti-MEM (GIBCO, Life Technologies) in a sterile 14 ml polypropylene tube (Thermo Fisher Scientific). 36 µl Lipofectamine 2000 diluted in 200 µl Opti-MEM was drop-wise added into the DNA solution with gentle mixing. The mixture was incubated for 20 min at RT to form the DNA-lipofectamine complex and then added into the culture dish drop by drop followed by a gentle swirl of the dish to distribute the complex. The dish was incubated at 37°C overnight. Day 3, the culture media was replenished with 10 ml fresh DMEM media with 4% FBS and 1x TiterBoost reagent (GeneCopoeia, MD, USA) and incubated for another 48 h at 37°C. Day 5, the lentiviral-containing culture media was collected by centrifugation at 500 x g for 10 min and filtering through 0.45 µm polyethersulfone low protein-binding filters. Aliquots (0.5 ml/tube) were stored at -80°C.

3.2.12.2 Lentivirus titer estimation by transduction

Day 1, 2 x 105/well HT1080 cells were cultured in 2 ml DMEM complete media in a 6-well plate at 37°C with 5% CO2 overnight. Day 2, overnight culture media was

105 replaced with 1 ml transduction media containing serial diluted lentivirus culture media (5 fold dilutions from 250 µl to 10 µl), 5 µg/ml Polybrene (Sigma) and DMEM media with 5% FBS and penicillin (100 U/ml)/streptomycin (100 μg/ml). The cells were incubated for 2h at 4°C in order to increase the transduction efficiency and then transferred back to 37°C and incubated overnight. Day 3, the transduction media was changed to 2 ml DMEM media with 10% FBS, penicillin (100 U/ml)/streptomycin (100 μg/ml) and incubated for additional 48 h. Day 5, the cells were trypsinised and the total number of cells was determined using a hemocytometer. The fraction of mCherry positive cells were counted by FACS (fluorescent activated cell sorting) or visualised under a fluorescent microscope. The lentiviral titer in the culture media was determined by the percentage of positive mCherry fluorescent cells multiplied by the total number of cells and then divided by the actual volume of added lentivirus culture media.

3.2.12.3 Transduction primary mouse cortical neurons with Nogo shRNA lentiviruses supernatants

Freshly prepared viral supernatants were used to infect 106 primary mouse cortical neurons in 6-well PDL-coated plates (see Figure 3-2). In brief, neurons were cultured for 24 h in 2 ml complete Neurobasal media and then transducted with 0.25 ml virus (MOI:1). Five days after transduction, neurons were used for binding assays (see Section 3.2.11). After initial screening of all 4 shRNA constructs for Nogo-A and -B mRNA knockdown, 1 Nogo shRNA construct with target sequence ggcgcagatagatcattatct achieved the maximum Nogo-A and -B gene silencing (>70%). Gene silencing was validated by qRT- PCR using primer sets Nogo-A and -B and mouse HPRT as housekeeping control (refer to Section 3.2.18). Nogo protein expression was detected using Western blotting with rabbit anti-Nogo-A/B Ab (Imgenex). Scrambled shRNA and vector alone were used as relative controls.

106

Figure 3-2: Schematic presentation of lentivirus production and transduction to mouse cortical neurons Packing cells HEK 293FT were co-transfected with lentiviral expression plasmid and ViraPower packing plasmids, and then the culture media containing lentivirus particles was collected and used to infect/transduce the primary mouse cortical neurons. The successfully infected neurons were observed with red fluorescence under the fluorescent microscope.

107

3.2.13 Assessment of neurite outgrowth in cortical neurons

Primary mouse and human cortical neurons were co-cultured with recombinant LILRA3 and Nogo 66 according to methods described in Section 3.2.10. 4 day-cultured mouse or 8 day-cultured human neurons were fixed with 4% paraformaldehyde in PBS for 10 min at RT, rinsed and resuspended in PBS. Contiguous phase contrast digital images of the entire well at 20 x and 40 x objective were acquired using an Olympus CKX41 microscope mounted with Q Imaging 3.3 RTV camera and Olympus CellSens software version 1.8 (Olympus, VIC, Australia). Neurite length of randomly-selected neurons per well was then assessed by an independent observer using computer-assisted imaging as described (NIH-ImageJ2 software) (377). Neurite lengths of 30 neurons per treatment per experiment were measured for mouse neurons (n=7), and lengths of 20 neurons per condition in duplicates were measured for human neurons (n=4).

3.2.14 Immunofluorescence staining

To compare effects on synapse formation, mouse cortical neurons were cultured for 21 days on PDL-coated 12 mm coverslips in 4-well plates that were prepared (28 spots/coverslip; 10 nM/spot) with recombinant Nogo 66 ± recombinant LILRA3-His ± IgG control as previously described in Section 3.2.10. Neurons were then fixed with 4% paraformaldehyde in PBS for 10 min at RT, followed by 10 min permeabilisation with 0.1% Triton X-100 in PBS. After 2 PBS washes, cells were blocked in blocking buffer (2% FBS and 0.05% Twin-20 in PBS) for 30 min at RT and then incubated with primary Abs diluted in blocking buffer overnight at 4°C including rabbit anti-synaptophysin mAb (2 µg/ml; Sapphire Bioscience, NSW, Australia) as a presynaptic marker and mouse anti- postsynaptic density protein 95 (PSD 95) (1 µg/ml; Chemicon, CA, USA) as post- synaptic marker. This was followed by 4 washes with PBS and 2 h incubation at RT with goat anti-rabbit Alexa 488 and donkey anti-mouse Alexa 555 Abs (Molecular Probes, OR, USA) diluted in 0.1% Triton X-100 in PBS. Coverslips were then washed 4 times with PBS and incubated with chicken anti-β-III tubulin Ab (1.2 µg/ml; Merck Millipore) for 2 h at RT as neuronal marker. After 4 washes in PBS, coverslips were incubated with goat anti-chicken Alexa Fluor 647 secondary Ab (1:500 dilutions; Molecular Probes) for 2 h at RT, washed and wet mounted using ProLong Gold Antifade reagent containing 4',6'-diamidino-2-phenylindole (DAPI) (Molecular Probes). Images were acquired in 108

1024 x 1024 pixel array using Leica TCS SP5cw STED microscope, 100x HCX Plan Apo NA 1.4 objective (Mannheim, Germany).

Numbers of synaptic contacts defined as synaptophysin-positive pre-synaptic terminals (green) in direct contact with PSD 95-positive post-synaptic protein (red) in 77.5 x 77.5 µm area (=1 field of view) were quantified using a custom written MATLAB code (MATLAB 2012b, MA, USA) designed by Dr Enrico Klotzsch. In brief, images from both channels were normalised to the maximum pixel value, before their intensity ratio was calculated to extract regions of the image with high co-localisation. In each channel, only pixels with values of two standard deviations above the average background were counted. Intensity ratio images were then processed identifying numbers of synapse contacts by two approaches, first using a spot detection and second a water-shedding algorithm to segment and identify individual clusters (378); both yielded similar results. Six-randomly selected fields per sample per treatment in 3 independent experiments were measured. Similarly, 14 day-cultured mouse cortical neurons were also stained with synaptophysin and Phalloidin as pre-and post-synaptic markers respectively.

Standard two-step immunofluorescence staining was performed on 5 day-cultured mouse cortical neurons in order to determine effects of recombinant LILRA3-His on axonal development and dendrite formation using mouse anti-Tau 1 mAb (2 µg/ml; Merck Millipore) and chicken anti-β-III tubulin respectively (1.2 µg/ml; Merck Millipore). Surface Nogo-A, PIRB and NgR1 expression was determined using rabbit anti-Nogo-A/B Ab (1 µg/ml Imgenex), rat anti-PIRB mAb (0.5 µg/ml; R&D Systems) and rabbit-anti NgR1 Ab (5 µg/ml; Merck Millipore) respectively. Fluorescent images were acquired using 63 x objective on Olympus BX51 microscope mounted with DP73 camera and Olympus CellSens software version 1.8 (Olympus, VIC, Australia).

The expression of LILRA3 in human cortical neurons was determined using standard two-step immunofluorescent staining with some modifications. In brief, 10 day- cultured primary human cortical neurons were fixed with 4% paraformaldehyde for 10 min at RT, rinsed, blocked with 20% goat serum for 20 min then incubated with mouse anti-LILRA3 or isotype-matched negative control mAb (Abnova; 2µg/ml in 0.5% saponin with 1% BSA in PBS) overnight at 4°C. Neurons were then washed 4 times with PBS + 0.5% saponin and 1% BSA then incubated for 2 h at RT with rabbit anti- microtubule-associated protein 2 (MAP 2) or control rabbit IgG Ab (2 µg/ml in 0.5%

109 saponin with 1% BSA; Merck Millipore). Coverslips were then washed 4 times, incubated with goat anti-mouse Alexa Fluor 488 and goat anti-rabbit Alexa Fluor 568 (Molecular Probes) for 1.5 h at RT. After washing, coverslips were wet mounted and imaged using 63 x objective on Olympus BX51 microscope.

3.2.15 Signalling molecules involved in Nogo 66-mediated inhibition

Mouse cortical neurons were cultured in Neurobasal media supplemented with 2% B27 and 2 mM Glutamax for 1 h on PDL-coated 6 cm dishes spotted with recombinant Nogo 66-His + control IgG, recombinant LILRA3-His + control IgG, His-tag control + LILRA3 or His-tag control + control IgG as described above (Section 3.2.10). Dishes were then rinsed with 3 ml PBS and lysed in 300 µl cell lysis buffer (150 mM NaCl, 50 mM Tris-HCl, 5 mM EDTA and 1% NP-40) containing 2 mg/ml protease inhibitors (Roche Applied Science) and 10 µM pervanadate (Sigma). Protein concentrations in cell lysates were determined using BCA assay according to the manufacturer instruction (Thermo Scientific). Four sets of 20 µg cell lysate from each sample were separated by 10% SDS-PAGE under reducing conditions then transferred onto PVDF membranes. Membranes were blocked with 5% BSA in TBST (TBS with 0.1% Tween 20) for 2 h at RT then incubated with the following primary rabbit Abs: anti-phospho (p)-ERK 1/2, anti-p-P38, anti-p-MEK or anti-p-AKT in TBST (1:1000 dilution; Cell Signalling Technology, MA, USA) overnight at 4°C. Membranes were washed 3 times with TBST then incubated with goat anti-rabbit HRP secondary antibody in TBST (Bio-Rad) for 2 h at RT, followed by 3 washes in TBST and immunoreactive bands detected as previously described (see Section 2.2.6).

Membranes were stripped using 62.5 mM Tris-HCL (pH 6.7), 100 mM β- mercaptoethanol (Sigma) in 2% SDS for 30 min at 50°C, rinsed thoroughly in TBS then blocked with the blocking buffer for 2 h RT. Total ERK, P38, MEK or AKT was detected using rabbit anti-total ERK 1/2, anti-total P38, anti-total MEK or anti-total AKT Abs (1:1000 dilution; Cell Signalling Technology) as above. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) protein as a loading control was detected using rat anti- GAPDH mAb (Abcam, Cambridge, UK) followed by HRP-conjugated goat anti-rat Ab (Bio-Rad). Protein levels were semi-quantified using ImageJ densitometry analysis of samples relative to the corresponding GAPDH and then normalised to control samples.

110

3.2.16 RNA isolation and cDNA synthesis

Cells were washed twice with PBS and then homogenised in TRIzol® Reagent (Invitrogen, Life Technologies) according to manufacturer’s instructions. In general, the homogenised cells were incubated for 5 min at RT followed by adding 200 l chloroform per 1 ml Trizol to the cell lysates. Tubes were shaken vigorously for 15 sec and incubated for 5 min at RT. Samples were then centrifuged at 12,000 x g for 15 min at 4°C and the aqueous phase was transferred to an RNAse-free Eppendorf tube to which 100% isopropanol was added (0.5 ml per 1 ml Trizol) was added followed by 10 min incubation at RT. Samples were again centrifuged at 12,000 x g for 15 min at 4°C, and supernatant was removed from the tube without disturbing the RNA pellet. RNA pellet was cleaned with 1 ml of 75% (v/v) ethanol and centrifuged at 12,000 x g for 10 min at 4°C. Ethanol was decanted and the RNA pellet was air-dried until it became transparent. The RNA pellet was resuspended in 20 l of DNAse and RNAse free water (GIBCO, Life Technologies) and heated for 10 min at 60°C. The quantity and quality of extracted RNA were determined using a Nanodrop ND-1000 Spectrophotometer (Nanodrop Technologies Inc, DE, USA) and RNA bands detected using Molecular Imager Gel Doc XR System (Bio-Rad). The isolated RNA was stored at -80°C.

Before reverse transcription, RNA was treated with DNAse to remove any genomic DNA contamination. In brief, total 10 l mixture containing 1 g of RNA, 0.5 l of Turbo DNAse and 1 l of 10 x Turbo DNAse buffer (Invitrogen, Life Technologies) was gently mixed and incubated at 37°C for 30 min, followed by inactivation of DNAse using 1 l of 50 mM EDTA with incubation at 75°C for 15 min. The synthesis of first-strand DNA was prepared using the Superscript III First-strand Synthesis System according to manufacturer’s instructions (Invitrogen, Life Technologies). Briefly, total 20 l reverse transcription mixture containing 1 g DNAse treated RNA, 10 l of 2 x buffer and 2 l Superscript III enzyme was gently mixed and incubated at 25°C for 10 min, 50°C for 50 min, 85°C for 5 min, and then chilled on ice. 1 l of E.coli RNAse H was added to the mixture and incubated for an additional 20 min at 37°C. The cDNA samples were ready for qRT-PCR or stored at -20°C.

111

3.2.17 Conventional Polymerase Chain Reaction

Conventional Polymerase Chain Reaction (PCR) was used to determine LILRA3 mRNA expression in primary human cortical neurons (35,59). In brief, 25 l of PCR reaction mixture was prepared using 2 l cDNA, 1 x PCR buffer (Applied Biosystems,

Life Technologies), 0.2 mM dNTP (Invitrogen, Life Technologies), 2.5 mM MgCl2 (Applied Biosystems), 400 nM primer set, and 0.5 l AmpliTaq Gold DNA Polymerase (Applied Biosystems). LILRA3 primer sets (forward 5’- CGCTGCGTCTAAAATCAAAGCG-3’ and reverse primers 5'- CACCCAGCTCCTCTTGACA-3') and GAPDH housekeeping gene were purchased from R&D Systems. PCR reaction was run on the PCR thermocycler using the following program: 95°C for 5 min, then 35 cycles of 95°C for 30 sec, 60°C for 45 sec and 72°C for 45 sec, and final extension at 72°C for 10 min. For GAPDH housekeeping gene, the following program was used: 94°C for 4 min, then 35 cycles of 94°C for 45 sec, 55°C for 45 sec and 72°C for 45 sec, and final extension at 72°C for 10 min. PCR products were mixed with 1x GelRed (Biotium, CA, USA) then visualised in 0.8% agarose gel electrophoresis using a Gel Doc XR system.

3.2.18 Quantitative Real Time- PCR

Quantitative real time-PCR (qRT-PCR) was performed to determine the relative levels of LILRA3 mRNA in primary human cortical neurons and Nogo-A expression in primary mouse cortical neurons as described (35). In brief, 10 l qPCR reaction mixtures containing 2 l cDNA, 5 l EXPRESS SYBR® GreenER™ qPCR Supermix Universal (Life Technologies, Australia) and 200 nM of primer sets (Table 3-2) were loaded into a 384-well optical reaction plate (Roche, NSW, Australia) in duplicate. Reactions were run on LightCycler 480 Real-Time PCR System (Roche) using the following conditions: pre- incubation at 95°C for 5 min; then 35 cycles of 95°C, 10 sec for denaturation; 60°C, 15 sec for annealing and 72°C, 15 sec for extension. Melt curve analyses were conducted using a final dissociation step, 1 cycle of 95°C, 5 sec followed by 65°C for 1 min. Data was analysed using the Roche LightCycler 480 Software 1.5. Relative quantities of mRNA were obtained using the comparative CT method and normalised against relative housekeeping gene.

112

Table 3-2: Primers used for qRT-PCR amplification Targeted gene Primer set sequence Forward: 5'-AATCAAAGCGCCAATCTCAT-3' LILRA3 Reverse: 5'-GAGTCAGCAGGTAGGGGTTG-3' Forward: 5'-CATGTACGTTGCTATCCAGGC-3' Human β-actin Reverse: 5'-CTCCTTAATGTCACGCACGAT-3' Forward: 5'-CAGTGGATGAGACCCTTTTTGAT-3' Mouse Nogo-A Reverse: 5'-GCTGCTCCTTCAAATCCATAA-3' Forward: 5'-AAGGACCTCTCGAAGTGTTGGATA-3' Mouse HPRT Reverse: 5'-CATTTAAAAGGAACTGTTGACAACG-3'

3.2.19 Immunoprecipitation of LILRA3 from adult brain lysate

LILRA3 was immunoprecipitated from adult brain lysates purchased from Abcam, VIC, Australia using a standard protocol. In brief, cortical (ab30061) and cerebellar (ab30078) protein lysates (100 µg each) were pooled and diluted with 1.8 ml lysis buffer (1% NP-40 in PBS pH7.5, 10mM EDTA, 20mM idoacetamide, 0.5mM sodium orthovanadate, 5mM sodium fluoride). Lysate was first pre-cleared with Protein G Sepharose-coupled goat anti-mouse IgG (5 μg; Life Technologies) at 4°C for 2 h then divided into 2 tubes (900 µl/tube) and incubated with either mouse anti-LILRA3 (5 μg/ml;

Abnova) or IgG1 control mAbs (Sigma) overnight at 4°C. Next day, 5 μg Protein G Sepharose-coupled goat anti-mouse secondary Ab (Life Technologies) was added and samples incubated for 3 h at 4°C. Sepharose-bound protein was pelleted by 1 min centrifugation at 200 x g followed by 2 washes with Tris buffer and a final wash with 50 mM Tris-HCl, pH 6.8. Samples were separated by 10% SDS-PAGE under reducing conditions, Western blotting then analysed using rabbit anti-LILRA3 Ab (Section 2.2.6).

3.2.20 Regulation the expression of LILRA3 in primary human cortical neurons

Firstly, LILRA3 genotype was determined in primary human cortical neurons as previously described (Sections 2.2.2 and 2.2.3). Samples with either LILRA3 wild type or heterozygous deletion were used for this experiment. Primary human cortical neurons were seeded at 1 x 106/well in a 24-well plate and incubated in 0.5 ml of complete neurobasal media with recombinant human (rh) IFN-α 1a (25 ng/ml) (MyBioSource), rhIFN-β 1b (25 ng/ml) (Bayer Schering Pharma, Bayer Australia), rhIFN-γ (25 ng/ml) 113

(R&D Systems), rhIL-10 (25 ng/ml) (R&D Systems) , or 1 α,25-Dihydroxyvitamin D3 (vitamin D3, 10 nM) (Sigma, Australia) in duplicate for 6, 12 and 24 h at 37°C in 5%

CO2. Cells were then harvested for RNA isolation (see Section 3.2.16) and LILRA3 mRNA was quantified using qRT-PCR (see Section 3.2.18).

3.2.21 Statistical analysis

All analyses were performed in GraphPad InStat software version 6.05 (CA, USA). The results are presented as the mean ± SEM. One way ANOVA with Dunn’s post-test was used for multiple comparisons. P value <0.05 was considered statistically significant.

114

3.3 Results

3.3.1 Identification of Nogo 66 as a new ligand for soluble LILRA3

To identify candidate LILRA3-binding proteins, co-immunoprecipitation experiments using recombinant LILRA3-AP protein as bait were performed by Ms Ainslie Mitchell and Dr Nicodemus Tedla. A total of 11 bands from immunoprecipitated protein using LILA3-AP as bait and corresponding APtag controls shown in Figure 1 were trypsin digested and analysed using Nano LC-MS/MS. Three LILRA3-binding proteins with high MASCOT scores were identified in 3 independent experiments (Table 3-3) (Figure 3-3). These proteins were not present in control samples when APtag control protein was used as bait, indicating immunoprecipitation specificity. Two proteins, Nogo and the 67 kDa laminin receptor (LAMR1) were identified as potential new binding partners, whereas HLA-B is known to bind LILRA3 (83). Multiple peptides sequences identified as Nogo proteins were part of a highly conserved 66 amino acid surface membrane loop of the reticulon family of proteins that include Nogo-A, -B and -C (Table 3-3) (Figure 3-3).

Table 3-3: Mascot search results of proteins pulled down from plasma membranes of PBMC when using LILRA3-APtag bait but not control APtag (n=3) Protein ID Mass (kDa) Score Number of peptide matches LILRA3 2653861 47 643-776 20-27 Nogo-A* 9408096 129 189-277 4-7 HLA-B27/B5** 32177 40 109-113 2-4 LAMR1 250127 67 112-155 2-5 *3 peptides matched to the Nogo 66 amino acid loop of Nogo-A **2 of the 4 peptides also matched HLA-C

115

116

Figure 3-3: Nogo 66 is identified as LILRA3 binding protein by peptide mass spectrometry sequencing (A) Isolation of LILRA3 binding molecules using recombinant LILRA3-APtag as bait and anti- AP mAb for co-immunoprecipitation of complexes from blood mononuclear cell membranes. Recombinant APtag protein control showed four major components (representative of three independent experiments). (B) In-gel trypsin digests and peptide sequencing by mass spectrometry of bands from the recombinant LILRA3-APtag bait yielded high-score matches with Nogo-A, HLA-B and 67 kDa laminin receptor (LAMR1) that were not detected in corresponding gels slices excised from the control recombinant APtag bait. As expected, the recombinant LILRA3-APtag bait was also detected in multiple bands when used as bait. Similarly, recombinant APtag was detected in all four major components in lane 1 (A) when recombinant APtag control was used as bait (n=3).

117

3.3.2 Production of recombinant LILRA3 and Nogo 66 proteins

To characterise the interaction between LILRA3 and Nogo 66, recombinant LILRA3 and Nogo 66 proteins were produced and purified according to established methods (refer to Method Sections 3.2.2 and 3.2.3) respectively. Recombinant LILRA3 proteins including LILRA3-APtag, LILRA3-His proteins and APtag control were isolated from culture media of overexpressed mammalian HEK 293T cells in order to produce properly glycosylated proteins (20). Figure 3-4 shows that recombinant purified LILRA3- APtag, LILRA3-His and APtag alone control had expected molecular mass of approximately 150 kDa, 75 kDa and 75 kDa respectively (Figure 3-4). The three fractions containing the highest concentration of protein, such as fractions 8-10 from LILRA3- APtag, were pooled together and protein concentration was determined using BCA assay. Concentrations range from 200 to 400 µg protein/ml.

118

Figure 3-4: SDS-PAGE and silver staining of individual fractions collected during purification of recombinant LILRA3 proteins and APtag alone protein (A) Recombinant LILRA3-APtag is approximately 150 kDa. (B) Recombinant LILRA3-His is approximately 75 kDa. (C) APtag control protein around is approximately 75 kDa.

119

Recombinant Nogo 66-His (12 kDa molecular weight) was produced in BL21 DE3 E.coli and was present in both the cytoplasmic fraction and inclusion bodies (Figure 3-5A). Initial experiments indicated that Nogo 66-His was mainly present in inclusion bodies rather than the cytoplasm (Figure 3-5A), thus inclusion bodies were used for protein isolation. Inclusion body protein was denatured in 8 M urea overnight and gradually refolded back by dialysis into 2M urea, followed by a two-step purification using IMAC Nic-charged resin and reverse phase HPLC (Method Section 3.2.3). Figure 3-5B and C show the 15 elution fractions collected from the IMAC chromatography step and analysed by SDS-PAGE.

Figure 3-5: Production of recombinant Nogo 66-His from E.coli and purification using Profinity IMAC Nic-charged resin (A) Comparison of recombinant Nogo-His expression in the cytoplasm and inclusion body fractions of E.coli as analysed using a silver stained SDS-PAGE gel; inclusion bodies contain the majority of Nogo 66-His with expected molecular mass 12 kDa. (B)(C) Silver stained SDS-PAGE gels showing the quantity of Nogo 66-His eluted from Profinity IMAC Nic-charged resin when 15 x 1 ml fractions were collected. The majority of Nogo 66-His was eluted in fractions 3-8. MW = molecular weight marker

120

Fractions 3, 9 and 10 were combined and further purified using HPLC. Figure 3-6A shows that Nogo 66-His was eluted from C8 column between 15-20 min. Several peaks were detected in HPLC and were analysed using SDS-PAGE and silver staining. The large peak (peak 2) was identified as the main elution of Nogo 66-His (Figure 3-6B). This is further confirmed with Western blotting using anti-His antibody which demonstrated a single immune-reactive component of the correct molecular weight (Figure 3-6C).

2 2 Nogo 66-His

1 3

1 4 Absorbance A 214 nm 214 A Absorbance 0 Time (min) 5 10 15 20 25 30

B C MW 1 2 3 4 MW 250 250 150 150 100 100 75 75 50 50 37 37 25 * 25 20 20 15 15 10 10

Figure 3-6: Purification of recombinant Nogo 66-His protein using HPLC (A) HPLC hydrophobicity purification chromatographic profile using C8 column showing that majority of recombinant Nogo 66-His was eluted between 15-20 min. (B) The individual elution indicated as peak 1,2,3 and 4 was analysed by SDS-PAGE and silver stain, showing peak 2 contained large quantity of Nogo 66-His. The extra band marked * in peak 2 (lane 2) may be due to the dimerisation of Nogo 66-His (around 25 kDa). (C) Western blotting of purified Nogo 66- His with anti-His mAb was used to confirm the identity.

121

3.3.3 Recombinant LILRA3 bound to recombinant Nogo 66 with high affinity

Several independent approaches were used to characterise the binding between recombinant LILRA3 and recombinant Nogo 66. First, SPR steady-state equilibrium analysis indicated that soluble LILRA3 maintained picomolar affinity binding (KD = 2.21 ± 0.45 x 10-10 M, n=3) to chip-immobilised recombinant Nogo 66 (500-600 RU) (Figure 3-7A). Second, recombinant Nogo 66 specifically bound to Concanavalin A Sepharose- immobilised untagged recombinant LILRA3 but not control Sepharose (Figure 3-7B). Third, recombinant Nogo 66 bound LILRA3 but not relevant negative controls in a concentration-dependent manner (Figure 3-7C). All these results indicated that Nogo 66 is a high affinity ligand to LILRA3.

122

A B 1 2 600 -10 KD=3.11 x 10 M 500

400 rLILRA3 75kD rLILRA a 300 200nM 50kD 3 100nM a

200 His Response unit (RU) unit Response His - 100 40nM 15kD 20nM rNogo 50 10kDa PBS 66 a

Nogo 66 Nogo 0 0 100 200 300 Time after injection (sec)

C 2.0

*** ***

1.5

1.0 **

0.5 OD at 405 nm (±SEM) at nm 405 OD

0 0nM 3nM 30nM 30nM 30nM rLILRA3-APtag IgG rNogo 66-His His rNogo 66-His Figure 3-7: Recombinant Nogo 66 (rNogo66) bound to recombinant LILRA3 (rLILRA3) with high affinity (A) Representative surface plasmon resonance profiles of various concentrations of LILRA3

-10 binding to chip-immobilised Nogo 66 (KD=3.11x10 M) (n=3). (B) Con A-Sepharose- immobilised recombinant LILRA3-6xHis (lane 2) but not Con A Sepharose alone (lane 1) precipitated recombinant Nogo 66, detected by Western blotting using rabbit anti-Nogo Ab. Blotting of same membrane with anti-LILRA3 mAb confirmed immobilisation of recombinant LILRA3 onto Con A Sepharose (lane 2), whereas Con A Sepharose alone did not contain LILRA3 (lane 1) (n=5 experiments). (C) His-tagged recombinant Nogo 66 bound plate-immobilised purified untagged recombinant LILRA3 in a concentration-dependent manner. His-tag control protein did not bind maximal concentration of plate-immobilised recombinant LILRA3 and Nogo 66 did not bind human IgG control confirming specificity (n=4; **p<0.01, ***p<0.001, one way ANOVA).

123

3.3.4 Recombinant LILRA3 bound to native Nogo 66 expressed on cultured mouse cortical neurons with high affinity and specificity

Considering mouse Nogo 66 has only one amino acid difference with human Nogo 66 (196), it is likely that LILRA3 also interacts with mouse Nogo 66. To demonstrate this, a series of binding assays were performed in readily-accessible cultured primary mouse cortical neurons due to limited access to primary human CNS neurons. Figure 3-8A shows that high level of Nogo-A was expressed in 4 day–cultured primary mouse cortical neurons. In-situ binding assay showed that recombinant LILRA3-APtag (Figure 3-8B) had strong positive reactivity to mouse cortical neurons, but not APtag control protein (Figure 3-8C). Importantly, pre-incubation of neurons with rabbit anti-Nogo-A/B Ab markedly blocked in-situ LILRA3 binding (Figure 3-8D), indicating specific binding of LILRA3 to Nogo-A on the surface of these cells (n=4).

The binding specificity and affinity of LILRA3 to mouse cortical neurons were determined using a ligand binding assay (method described in Section 3.2.11.2). Figure 3-9A shows that primary mouse cortical neurons incubated with LILRA3-APtag protein had high alkaline phosphatase (AP) enzyme activity, whereas little activity was observed in neurons incubated with APtag control (n=6, p<0.001). This result indicated LILRA3 bound to the surface of mouse cortical neurons with strong specificity. Importantly, binding of LILRA3-APtag to the cultured primary cortical neurons was high affinity, saturable and yielded a straight line Scatchard plot (Figure 3-9B and C). The apparent -8 dissociation constant of interaction was, KD = 6.70 x 10 M and maximum specific binding (Bmax), 0.154 x 10-8 M.

124

A Nogo-A B DAPI

C D

20µm

Figure 3-8: In-situ binding of recombinant LILRA3 to cell surface Nogo-A on primary mouse cortical neuron cultures (A) Representative primary mouse cortical neurons cultured on PDL-coated coverslips for 4 days stained with rabbit anti-Nogo A Ab show abundant expression of Nogo-A in red (n=5). LILRA3- APtag (B) but not control APtag (C) bound to the surface of these neurons (blue staining, neutral red counterstain). (D) LILRA3-APtag binding was markedly reduced by pre-incubation with 10 µg/ml rabbit anti-Nogo-A/B Ab for 30 min, confirming specificity (n=4).

125

A *** B 0.3 120

0.2

APtag (pM) (pM) APtag -

-8 KD = 6.70 x 10 M 40 -8 0.1 Bmax = 0.154 x10 M R2 = 0.93

Bound LILRA3 Bound 0 Bound AP activity (U/ml ± SEM) ± (U/ml activity AP Bound 0.0 0 5 10 15 20 APtag LILRA3-APtag Free LILRA3-APtag (nM)

) ) 3 - 2 15 R = 0.78 p = 0.04

Bound/Free (x10 Bound/Free 5

0 0 40 80 120 Bound (pM) Figure 3-9: High binding affinity of recombinant LILRA3-APtag to primary mouse cortical neurons (A) Significant binding of LILRA3-APtag but not APtag control to the surface of cortical neurons (n=6, p<0.001; One way ANOVA) (B) Representative Scatchard analysis of LILRA3-APtag binding to primary cortical neurons showing saturable high affinity binding (KD=6.70 x 10-8 M, Bmax=0.154 x 10-8 M, R2=0.93) (n=3). (C) Data in B presented as a Scatchard plot yielded a straight line plot, typical of a saturable receptor-ligand interaction (p=0.04, R2=0.78).

126

Nogo-A gene silencing on primary mouse cortical neurons with specific shRNA was used to prove that the high affinity binding of LILRA3 to mouse cortical neurons is through Nogo 66. After Nogo shRNA lentivirus transduction, Nogo-A mRNA (Figure 3-10A) and protein (Figure 3-10B and C) in mouse cortical neurons were significantly reduced by ~70% and 55% respectively, which lead to significant 34.3 ± 8.6% reduction in binding of LILRA3-APtag to mouse cortical neurons compared to neurons transduced with scrambled shRNA (Figure 3-10D; n=3, p<0.05). These results were consistent with in-situ anti-Nogo Ab blocking experiments (Figure 3-8), and strongly corroborated the SPR and co-immunoprecipitation studies (Figure 3-7).

127

Figure 3-10: Knocking down Nogo-A protein reduced LILRA3 binding to mouse cortical neurons (A) Transient 5 day knockdown in primary cortical neurons using lentivirus based shRNA reduced Nogo-A mRNA by 78.3 ± 6.3% compared to neurons transfected with scrambled shRNA (n=3, p<0.001, one way ANOVA). (B) Representative Western blot using anti-Nogo-A Ab showing decreased levels of Nogo-A protein in transfected cells (upper panel ) compared to β- actin housekeeping gene (control) (lower panel). (C) A summary densitometry of 3 independent Western blotting experiments showing 55.1 ± 8.2% reduction in Nogo-A protein after specific gene silencing as compared to scrambled shRNA (p<0.01; one way ANOVA). (D) Nogo-A shRNA gene silencing in primary cortical neurons significantly abrogated surface binding of LILRA3-APtag by 34.3 ± 8.6% compared to neurons treated with scrambled shRNA (n=3, p<0.05; One way ANOVA).

128

3.3.5 Confirmation of endogenous LILRA3 binding to endogenous cell surface Nogo

To confirm the interaction of endogenous LILRA3 with endogenous cell surface Nogo, endogenous LILRA3 protein was firstly enriched using protein A Sepharose from primary monocytes treated with recombinant IL-10 + Brefeldin A in vitro for 72 h. Western blotting showed that LILRA3 bound to protein A Sepharose (lane 4; Figure 3-11B) and can be eluted using 0.2 M glycine (lanes 7 and 8; Figure 3-11B). The enriched LILRA3 was used as bait to pull down endogenous Nogo-A/B that was naturally expressed on the surface of SK-N-SH neuronal cell line (lane 5; Figure 3-11A) using anti-

LILRA3 mAb; control IgG1 mAb was used as negative control. Western blotting showed successful co-precipitation of endogenous Nogo-A/B (lanes 2 and 3; Figure 3-11A) with endogenous LILRA3 (lanes 2 and 3; Figure 3-11B) using anti-LILRA3 mAb, but not control IgG1 (lane 1; Figure 3-11), suggesting specificity.

129

A - -

Figure 3-11: Conformation of endogenous LILRA3 binding to endogenous cell surface Nogo-A and Nogo-B Representative Western blotting with anti-Nogo-A/B (A) and in-house anti-LILRA3 (B) showing co-immunoprecipitation Nogo-A/B in SK-N-SH lysate with LILRA3 with anti-LILRA3 mAb (lanes 2 and 3), but not when control IgG1 was used (lane 1) (n=1); lane 4 is LILRA3 in 3 µl/50 µl of Sepharose beads prior to elution with 0.2 M glycine, confirming successful LILRA3 bead binding, lane 5 is 15µl of total 1.5 ml SK-N-SH lysate before immunoprecipitation as a positive control for the anti-Nogo-A/B Western blotting and confirming Nogo expression in these cells, lane 6 is blank, lanes 7 and 8 are 15 µl/500 µl (1 x 107 monocytes) bead-enriched LILRA3 in glycine elution buffer prior to addition to SK-N-SH cell lysates, confirming successful elution of LILRA3 from the beads and also severed as a positive control for the anti-LILRA3 Western blotting.

130

3.3.6 LILRA3 significantly reversed Nogo 66-mediated inhibition of neurite outgrowth

Ligation of the inhibitory receptors NgR1 or PIRB by Nogo 66 leads to inhibition of neurite outgrowth (65,194,196) (reviewed in Section 1.4.1.2). Figure 3-12A illustrates our hypothesis of LILRA3 function in neuronal tissue that is a competitively binding of soluble LILRA3 with Nogo 66 blocks the interaction between Nogo 66 and NgR1 or PIRB, thereby antagonising inhibitory effects of Nogo 66 on neurite outgrowth. To test this hypothesis, the first experiment is to confirm the expression of NgR1 and PIRB on primary mouse cortical neurons using immunofluorescent staining. Figure 3-12B shows that NgR1 and PIRB were constitutively expressed on 3 day-cultured mouse cortical neurons, which were co-stained with a specific neuronal marker, β-III tubulin.

131

Figure 3-12: Schematic representation of Nogo 66-mediated inhibition of neurite outgrowth (A) Proposed diagram of the interaction between the neuronal Nogo 66 with NgR1 and PIRB leading to inhibition of neurite outgrowth and neuroplasticity (left); whereas soluble LILRA3 may competitively bind Nogo 66 and block the interaction of Nogo 66 with NgR1 or PIRB leading to promote neurite outgrowth (right). (B) Representative immunofluorescence staining shows that both NgR1 and PIRB (green) are expressed on the surface of β III tubulin-positive (red) mouse cortical neurons cultured for 3 days (n=6). Images acquired in 1024 x 1024 pixel array using Leica TCS SP5cw STED microscope, 100x HCX Plan Apo NA 1.4 objective (Mannheim, Germany).

132

To assess potential competitive effects of recombinant LILRA3, an in vitro neurite outgrowth inhibition model was used by culturing primary mouse cortical neurons on plate-immobilised recombinant Nogo 66 (refer to Method Section 3.2.10). As expected, neurite length of neurons cultured on recombinant Nogo 66-His-coated coverslips were significantly shorter (170.7 ± 73 µm; Figure 3-13A and E) than neurons cultured on control His-tag peptide control-coated coverslips (593.3 ± 37 µm) (Figure 3-13C and E; n=7, p<0.001). Importantly, Nogo 66-mediated inhibition of neurite outgrowth was dramatically reversed by co-incubation with recombinant LILRA3 (Figure 3-13B and E; n=7, p<0.001); the average length of 773.9 ± 38 µm was 5 times longer than neurons cultured on recombinant Nogo 66. Interestingly, neurons cultured on recombinant LILRA3-coated coverslips (Figure 3-13D and E, p<0.05 ) were 15-25% longer than those of His-tag alone, suggesting that LILRA3 may also have partially reversed negative effects of native Nogo-A that was expressed on these neurons (Figure 3-8A) or possibly has an additional function in promoting neurite outgrowth through the interaction with another yet defined ligand.

133

134

Figure 3-13: LILRA3 significantly reversed Nogo 66-mediated inhibition of neurite outgrowth in mouse cortical neurons (A) Representative images of primary mouse cortical neurons cultured for 4 days on PDL-coated coverslips that were spotted with recombinant Nogo 66 show little scattered neurite outgrowth. (B) Nogo-mediated inhibition of neurite outgrowth was completely reversed in neurons co- incubated with recombinant LILRA3. (C) Neurons cultured on control rHis-tag and human IgG control-coated coverslips. (D) Neurons cultured on recombinant LILRA3-coated coverslips in the presence of control recombinant His-tag but absence of Nogo 66 promoted neurite outgrowth. (E) Summary of neurite length of randomly-selected neurons; lengths of 30 neurons were measured per treatment per experiment (n=7) and presented as mean ± SEM (*p<0.05, ***p<0.001; One way ANOVA; all contrast images acquired using 40x objective).

Co-immunofluorescent staining for β-III tubulin (a neuron specific marker) and Tau 1 (a marker for axonal development) showed that neurons cultured on Nogo 66 were limited and patchy, likely due to inhibitory effects of Nogo 66 that restricted the development of a neuronal network (Figure 3-14A). In contrast, neurons co-cultured on recombinant Nogo 66 and recombinant LILRA3-coated coverslips retained extensive staining for both proteins (Figure 3-14B), which was similar to neurons plated on His-tag peptide control-coated coverslips (Figure 3-14C). These results were consistent with previous results shown in Figure 3-13, which both indicated that LILRA3 reversed inhibition of neurite and axonal growth outgrowth by Nogo 66 and promoted robust dendrite and axonal development.

135

Figure 3-14: Co-immunofluorescent staining of LILRA3 mediated neurite outgrowth in mouse cortical neurons by blocking the inhibitory effects of Nogo 66 Representative images of primary mouse cortical neurons that were co-stained with a neuronal marker β-III tubulin (red), a marker for axonal development Tau 1 (green) and nuclear stain DAPI (blue) showed that neurons cultured on Nogo 66 spotted coverslips had little and patchy co-neurite outgrowth (A), whereas neurons co-incubated with recombinant LILRA3 and Nogo 66 had enhanced β-III tubulin and Tau 1 staining (B), indicating that LILRA3 reversed Nogo-mediated inhibition and promoted neurite outgrowth. (C) Neurons cultured on control rHis-tag and human IgG control-coated coverslips promoted neurite outgrowth and enhanced β-III tubulin and Tau 1 expression (All fluorescent images acquired using 63x objective).

136

To confirm that LILRA3 also modulates Nogo 66 induced inhibition of neurite outgrowth in human neurons, primary human foetal cortical neurons were cultured on Matrigel-coated plates with or without recombinant Nogo 66 ± recombinant LILRA3 for 8 days (Methods 3.2.9 and 3.2.10). As expected, Nogo 66 inhibited neurite outgrowth (average length 270.4 ± 85.3 µm) (Figure 3-15A and E) compared to His-tag control (average length of 466.3 ± 50.7 µm) (Figure 3-15C and E; n=4, p<0.01). Importantly, co- treatment with recombinant LILRA3 significantly reversed Nogo 66-mediated inhibition, yielding neurite lengths of 530.2 ± 36.7 µm (Figure 3-15B and E; p<0.01). This length was twice that of neurons grown on Nogo 66-coated plates and 1.3 times that of neurons on His-tag control (Figure 3-15E). Further, neurites of neurons grown on recombinant LILRA3 tended to be somewhat longer (544.8 ± 110.1 µm) than those on His-tag control (Figure 3-15E). This is the first demonstration that LILRA3 regulates neurite outgrowth in human and mouse cortical neurons through interaction with the highly homologous Nogo 66.

137

** 800 NS ** NS 600

400

200

Neurite length (µm ± (µm SEM) length Neurite

tag+IgG

tag+rLILRA3

rHis

rNogo 66+IgG rNogo rHis rNogo 66+rLILRA3 rNogo

138

Figure 3-15: LILRA3 significantly reversed Nogo 66-mediated inhibition of neurite outgrowth in human cortical neurons. (A) Representative primary human cortical neurons cultured for 8 days on PDL-matrigel-coated plates that had been spotted with recombinant Nogo 66 showing diminished neurite outgrowth. (B) Significant reversal of Nogo 66-mediated inhibition of neurite outgrowth on plates co-coated with recombinant Nogo 66 and recombinant LILRA3. (C) Neurons cultured on control rHis-tag and human IgG control-coated coverslips. (D) Neurons cultured on recombinant LILRA3-coated plates in the absence of recombinant Nogo 66 had similar neurite lengths compared to control IgG-coated plates (C), suggesting no tropic effects on LILRA3 alone. (E) Summary of neurite length measurement on 20 randomly-selected neurons per treatment per experiment. Data are mean ± SEM of 4 independent experiments in duplicates (**p<0.01; NS, not significant; one way ANOVA; all acquired using 40x objective).

3.3.7 LILRA3 increased numbers of synaptic contacts in mouse cortical neurons

Mouse cortical neurons cultured on coverslips coated with recombinant Nogo 66 for 21 days had an average of 135.6 ± 12.0 synaptophysin and PSD 95 double-positive spots i.e. synaptic contacts per field of view (77.5 x 77.5 µm area) (Figure 3-16A-C and J). These were significantly fewer than synaptic contacts of neurons cultured on His-tag control coated coverslips (324.4 ± 9.6 per field) (Figure 3-16G-H and J; n=3, p<0.0001). Importantly, co-coating with recombinant LILRA3 completely reversed recombinant Nogo 66-mediated inhibition and increased synaptic contacts to 337.6 ± 7.8 per field, numbers similar to those in control neurons (Figure 3-16D-F and J). Similarly, staining of 14 day-cultured mouse cortical neurons with synaptophysin and phalloidin as pre-and post-synaptic markers respectively showed significantly less synaptic contacts in neurons grown on Nogo 66 coated coverslips as compared to neurons grown on Nogo 66 and LILRA3 coated coverslips (Figure 3-17).

139

A B C Synaptophysin PSD95 βIII-?tubulin -

rNogo66+ IgG

20µm D E F rNogo 66+ rLILRA3

G H I

rHis-tag+

IgG

500 **** **** 400

300

200

100

rNogo 66+ rNogo 66+ rHis-tag+ Median synaptic contacts per field per contacts synaptic Median IgG rLILRA3 IgG

140

Figure 3-16: LILRA3 increased density of synaptic contacts in mouse cortical neurons cultured for 21 days (A-C) Representative images of 3 independent primary mouse cortical neurons cultures on PDL- coated coverslips that were spotted with recombinant Nogo 66 plus control IgG had reduced numbers of synaptic contacts, as demonstrated by decreased number of spots synaptophysin (green dots) and PSD 95 (red dots) double positive cells; β-III tubulin was used as marker for dendrites (purple). (D-F) Co-incubation of neurons with recombinant LILRA3 reversed Nogo 66- mediated inhibition resulting in increased numbers of synaptic contacts to numbers comparable to His-tag control treated neurons (G- I). (J) Whisker-Box plots ± min to max of synaptic contacts of 3 independent neurons cultures under the different treatment conditions showing significantly lower synaptic contacts for neurons cultured on Nogo 66 plus IgG spotted coverslips (median=132 contacts) as compared to neurons grown on Nogo 66 plus LILRA3 (343.6 contacts) or control His-tag-coated coverslips (324.5 contacts) (****p<0.0001; one way ANOVA).

141

Figure 3-17: LILRA3 increased numbers of synaptic contacts in mouse cortical neurons cultured for 14 days (A, B) Representative primary mouse cortical neurons cultured for 14 days on PDL-coated coverslips that were spotted with recombinant Nogo 66 plus LILRA3 had increased numbers of pre-synaptic terminals stained with anti-synaptophysin Ab (green dots), post synaptic structures stained with anti-phalloidin-Alexa 555 (red dots) and synaptic contacts (red and green dots indicated by yellow arrows) along the neuronal dendrites stained with anti-β-III tubulin (purple) compared to significantly lower synaptic contacts in neurons cultured on Nogo 66 spotted coverslips (C). (D) His-tag control treated neurons showed similar numbers of synaptic contacts to (B). (E) Summary of numbers of synaptic contacts in neurons cultured under the different treatment conditions. Data are presented as means ± SEM of 5 independent experiments (**p<0.0, one way ANOVA).

142

3.3.8 LILRA3 reversed Nogo 66 mediated dephosphorylation of MEK and ERK

Mouse cortical neurons were cultured in growth-promoting Neurobasal media containing B-27 supplement for 1 h with recombinant Nogo 66 ± recombinant LILRA3 coated dishes and phosphorylation of potentially relevant kinases assessed (188,379). Neurons cultured on Nogo 66-coated dishes showed marked suppression of mitogen activated protein tyrosine kinase (MEK) and extracellular signal regulated kinases (ERK1/2) phosphorylation compared to neurons cultured on control His-tag coated dishes (Figure 3-18; n=2). Importantly, Nogo 66-mediated suppression MEK and ERK1/2 phosphorylation was completely reversed by co-culture with LILRA3 (Figure 3-18). There was slight suppression of p38 phosphorylation in response to Nogo 66 that was also reversed by LILRA3, whereas AKT phosphorylation was minimally affected by any combination of Nogo 66 ± recombinant LILRA3 (Figure 3-18).

143

A B 1 2 3 4 2.0 pMEK 50 pMEK 37 1.5 50 MEK 1.0 37 50 0.5 GAPDH 37 1 2 3 4 0.0

1 2 3 4 1.5 pERK 1/2 50 pERK 1/2 37 1.0 ERK 1/2 50 37 0.5 50 GAPDH 37 1 2 3 4 0.0

1 2 3 4 2.0 pP38 50 pP38 37 1.5 50 P38 1.0

37 Normalised Normalised ratio GAPDH to 50 0.5 GAPDH 37 1 2 3 4 0.0

1 2 3 4 1.5 pAKT 75 pAKT 50 1.0 75 AKT 50 0.5 50 GAPDH 1 2 3 4 37 0.0

Figure 3-18: Regulation of MEK/ERK signalling pathway by recombinant LILRA3 Nogo 66-mediated inhibition of neurite outgrowth (A) Mouse cortical neuron plated onto coverslips coated with recombinant Histidine-tag control and a control protein (human IgG) (1) or recombinant Histidine-tag and recombinant LILRA3 (2) for 1 h showed phosphorylation of MEK and ERK1/2 that was markedly reduced on neurons cultured on recombinant Nogo 66 and human IgG coated coverslips (3). Nogo 66-mediated dephosphorylation of MEK and ERK1/2 was completely reversed in neurons cultured on coverslips coated with recombinant Nogo 66 and recombinant LILRA3 (4). Phosphorylation of p38 was marginally altered by recombinant Nogo 66 and/or recombinant LILRA3 and there was no effect on AKT. (B) Summary densitometry of two independent experiments showing marked suppression of MEK and ERK1/2 phosphorylation by recombinant Nogo 66 that was completely reversed by recombinant LILRA3.

144

3.3.9 The expression and the regulation of LILRA3 in the CNS

To date, the primary source of LILRA3 are reported to be peripheral blood leukocytes (35). However, given that LILRA3 is a 70 kDa protein (20), it may not easily cross the intact/normal blood-brain barrier, thus the expression of LILRA3 in the CNS was investigated by several approaches. Two-step immunofluorescent staining of primary human cortical neurons derived from fresh foetal brains showed strong co-expression of LILRA3 protein with a neuronal marker, MAP 2 (Figure 3-19A). There was no immunoreactivity in neurons incubated with isotype matched negative control Abs (Figure 3-19B), confirming specificity. LILRA3 mRNA was detected in primary cortical neurons by conventional RT-PCR (Figure 3-19C) and semi-quantified by qRT-PCR, although expression levels were much less than PBMCs (Figure 3-19D). Moreover, LILRA3 was immunoprecipitated from normal adult cortical brain tissue lysates using specific anti- LILRA3 mAb (Figure 3-19E). LILRA3 mRNA and protein identities were confirmed respectively by DNA sequencing of the PCR products and by in-gel tryptic digest of immunoprecipitated proteins followed by peptide mass spectrometry. This is the first demonstration of LILRA3 mRNA and protein expression in tissue/cells other than leukocytes.

145

A LILRA3 C Primary neurons

MAP 2 controlve

MWM PBMC DAPI

500bp 200bp B

20µm

D E -2 10x10 *** -2 8.0x10 -2 6.0x10 -2 4.0x10 -2 2.0x10 75 kDa -3

actin ratio actin 2.0x10 -

β -3 1.5x10 50 kDa

-3 1.0x10 -3

0.5x10 LILRA3/ 0 Primary neurons PBMC

Figure 3-19: LILRA3 is expressed in cultured primary human cortical neurons and normal human brain (A) Representative immunofluorescence staining showing LILRA3 expression in cultured primary human cortical neurons, co-stained with a neuron marker, MAP 2, and DAPI nuclear staining (n=4; 63 x objective). (B) Neurons incubated with corresponding negative control primary but the same secondary Abs as in A and B confirming absence of non-specific staining. (C) RT-PCR using mRNA from human primary cortical neuron cultures showing specific LILRA3 transcript; mRNA from PBMC was used as positive control, and no template RT-PCR was a negative control. (D) Quantitative RT-PCR shows measurable but significantly less LILRA3 mRNA in cultured primary cortical neurons compared to PBMC (n=3; ***p<0.001, one way ANOVA). (E) Immunoprecipitation of LILRA3 from normal brain tissue lysate using anti- LILRA3 showing specific band but not when isotype-matched control mAb was used (n=1).

146

A previous study demonstrated that LILRA3 mRNA in peripheral PBMCs is significantly upregulated by anti-inflammatory cytokine IL-10 and immunoregulatory cytokine IFN-γ, but significantly downregulated by pro-inflammatory TNFα after 12 hours co-incubation (35). Therefore, the regulation of LILRA3 in primary human cortical neurons was investigated by co-culturing with mediators that are known to improve the clinical outcomes of MS including INF-α; INF-β, IFN-γ, IL-10 and vitamin D3. The initial experiment showed that primary neurons co-cultured with IL-10 and INF-γ for 24 hours had an apparent increase in LILRA3 mRNA over 6 hours or 12 hours co-culturing (Figure 3-20A). Therefore, 3 independent experiments were performed at the 24 hour time point and showed that only IL-10 significantly upregulated LILRA3 mRNA compared to untreated controls (Figure 3-20B). LILRA3 mRNA was also elevated by treatment of INF-β, INF-γ or vitamin D3, but this did not reach statistical significance (Figure 3-20B).

147

A -5 25 x 10

-5 20 x 10

-5 15 x 10 Untreated -5 IFN-α 5 x 10 IFN-β -5 4 x 10 IFN-γ -5 actin ratio (mean ± SEM) ± (mean ratio actin IL-10 - 3 x 10 β -5 vitamin D3 2 x 10 -5 1 x 10 0 6 12 24 LILRA3 to to LILRA3 Hours

-4 * 12 x 10

-4 9 x 10

-4 6 x 10 -4 3 x 10 -5

6 x 10 actin ratio (mean ± SEM) ± (mean ratio actin - -5 β 3 x 10

0 Untreated IFN-α IFN-β IFN-γ IL-10 vitamin D3 LILRA3 to to LILRA3

Figure 3-20: Regulation of LILRA3 mRNA in primary human cortical neurons by mediators known to improve the clinical outcomes for MS (A) Time-dependent regulation of LILRA3 mRNA by INF-α, IFN-β, IFN-γ, IL-10 and vitamin D3 showing apparent upregulation by IL-10 and INF-γ at 24 hours (n=1). (B) LILRA3 mRNA in primary human cortical neurons were significantly upregulated by IL-10, and substantial increased by IFN-β, IFN-γ and vitamin D3, but was not statistically significant (n=3; p<0.05; one way ANOVA).

148

3.4 Discussion

Clinical association studies (35,127,129-131) (Chapter 2) and limited in vitro experiments (20) suggest that soluble LILRA3 may have immune regulatory roles in chronic inflammation but its exact functions are unclear, primarily due to insufficient knowledge of its natural ligands. Initial experiments using mammalian-produced recombinant LILRA3 with structure typical of the native protein (20) as bait, reproducibly identified 3 binding proteins with high MASCOT scores using mass peptide sequencing. These corresponded to Nogo 66, 67 kDa LAMR1 and HLA-B. Identification of MHC class I was consistent with earlier findings showing that LILRA3 bound to single HLA- B or HLA-C-coated beads (83). However, this is the first report to show concomitant binding of LILRA3 to an MHC-class I and two new non-MHC ligands raising the possibility of multiple ligands of varying affinities. Consistent with this, the closely- related cell surface receptor, LILRB2 was shown to functionally interact with various MHC class I (2,12,69) and non-MHC ligands with varying affinities including interaction with angiopoietin-like proteins (90) and β amyloid (64).

Of particular interest in this part of the study was the high affinity interaction of LILRA3 with Nogo 66, suggesting that LILRA3 may have new functions in the CNS, distinct from its expected immunoregulatory roles in leukocytes (20). This interaction was rigorously validated using several independent methods, including surface plasmon resonance, biochemical and immunochemical techniques. Extensive ligand-binding studies showed that LILRA3 specifically bound primary mouse cortical neurons with high affinity and binding was saturable and specific. Results showed that these neurons expressed high levels of Nogo-A, and successful abrogation of binding by anti-Nogo Ab and following Nogo-A gene silencing validated that LILRA3 binding was in the most part via Nogo-A. Interestingly, LILRB2, which has 81% sequence homology to LILRA3 (9), and mouse PIRB also bind Nogo 66 (65) suggesting a shared ligand.

Nogo 66 inhibits neurite outgrowth via interaction with PIRB (65), although PIRB- mediated signalling events in neurons remain unclear. Based on our knowledge of PIRB- mediated inhibitory signalling pathways in leukocytes (379), it is proposed that binding of Nogo 66 to PIRB may inhibit neurite outgrowth by dephosphorylating growth- promoting protein tyrosine kinase substrates. Indeed, MEK and ERK 1/2 phosphorylation 149 in mouse cortical neurons cultured on recombinant Nogo 66-coated coverslips were profoundly suppressed and this was associated with reduced neurite outgrowth. Importantly, recombinant LILRA3 markedly reversed Nogo 66-mediated suppression of MEK and ERK 1/2 phosphorylation and promoted neurite outgrowth. Effects of Nogo 66 on p38 phosphorylation were modest and there was little effect on AKT phosphorylation suggesting a more specific regulation of the MEK/ERK pathway. To our knowledge this is the first report showing Nogo 66-mediated suppression of MEK and ERK phosphorylation in primary neurons that was successfully reversed by LILRA3. Although further investigation is required, it is speculated that suppression of MEK and ERK phosphorylation in Nogo 66-treated neurons occurs via its ligation of PIRB that promotes recruitment of Src homology 2 domain-containing protein tyrosine phosphatases (SHP-1 and/or SHP-2), thereby deactivating signalling and causing neuronal growth arrest (Figure 3-21). Future studies should include co-immunoprecipitation of PIRB recruited phosphatases using anti-PIRB antibody from mouse cortical neurons that are co-cultured with recombinant Nogo 66-His + control IgG, recombinant LILRA3-His + control IgG, His-tag control + LILRA3 or His-tag control + control IgG, and then Western blotting with anti-phosphorylated SHP-1 or SHP-2 antibodies. These results could confirm whether PIRB recruits SHP-1/2 upon Nogo 66 ligation and whether LILRA3 blocks Nogo 66-PIRB promoted SHP-1/2 recruitment. Consistent with this, ligation of PIRB on the surface of neurons restricted plasticity in the visual cortex (176) and suppressed axonal regeneration (187) through recruitment of SHP-1/2, and limited data indicates that the recruited SHP-1/2 dephosphorylate (deactivate) Trk leading to suppression of downstream MAPK signalling (188).

150

Figure 3-21: Summary of the proposed mechanisms of LILRA3-mediated promotion of neurite outgrowth and synapse formation The ligation of NgR1 complex by Nogo 66 activates the small GTPase, RhoA and its effector protein Rho-associated, coiled-coil containing protein kinase 1(ROCK) eventually leading to the growth cone collapse (left). The ligation of PIRB by Nogo 66 promotes recruitment of Src homology 2 domain-containing protein tyrosine phosphatases (SHP-1 and/or SHP-2) to dephosphorylate key growth-promoting protein tyrosine kinases such as MEK and ERK, and thus causing neuronal growth arrest (left). Soluble LILRA3 may act as a soluble antagonist of PIRB and/or NgR1 by competitively binding to Nogo 66 and preventing Nogo 66-mediated inhibitory signals (right).

151

In addition to PIRB, Nogo 66 can inhibit neurite outgrowth by interacting with the NgR1 complex that consists of NgR1 and two transmembrane proteins LINGO1 and p75, or TROY (217-219). This binding leads to an increase in intracellular Ca2+ and activation of the small GTPase, RhoA and its downstream Rho-associated, coiled-coil containing protein kinase 1 (ROCK) pathway (188,196,226). This pathway eventually results in the destabilisation of actin cytoskeleton, leading to growth cone collapse (188,196,226). LILRA3-mediated reversal of neurite growth may also in part be due to competitive blocking of Nogo 66-NgR1 interaction by soluble LILRA3 (Figure 3-21), however, this requires further investigation. Future studies including co-culturing mouse cortical neurons with recombinant Nogo 66-His + control IgG, recombinant LILRA3-His + control IgG, His-tag control + LILRA3 or His-tag control + control IgG and Western blotting these cell lysates with anti-RhoA and ROCK antibodies could confirm whether LILRA3 interferes with the Nogo 66-NgR1 interaction. Interestingly, p75 enhances the ability of PIRB to recruit SHP-1/2 (380), suggesting cross-talk between the NgR1 and

PIRB signalling pathways.

The reversal of Nogo 66-mediated inhibition of neurite outgrowth by LILRA3 was similar in human and mouse cortical neurons, strongly validating our finding. It is possible that LILRA3 exerts positive effects in human neurons by competitively blocking LILRB2-Nogo 66 interaction, although this requires further investigation. Importantly, this study is the first to demonstrate human LILR protein having cross-species functions in mice and man, despite the lack of LILRs in rodents, likely due to highly homologous shared Nogo 66 ligand. This property would allow more thorough investigation of LILR functions using an unlimited source of cultured primary mouse neurons, and opens for the first time opportunities to explore in vivo LILR functions such as the use of tissue- specific transgenic expression of human LILRA3 in rodents to investigate its role in CNS.

This study provided evidence that LILRA3 as a new high affinity soluble receptor consistently and significantly reversed Nogo 66-mediated inhibition of neurite outgrowth and synapse formation in vitro by 60-70%. These effects are comparable to or better than other known inhibitors, including antibodies against Nogo-A, Nogo-A gene deletion, the use of soluble NgR fragments, NgR blocking peptides, inhibitors of Rho-A/ROCK or inhibitors of intracellular calcium influx (381). Importantly, unlike these inhibitors, LILRA3 is an endogenous protein making it an attractive therapeutic candidate. Although

152 methodological differences should be accounted for and future concurrent comparative studies are required, our SPR results indicated a binding affinity of Nogo 66 to LILRA3 that is 10-100 times higher than its binding to PIRB (162) or NgR1 (199). These properties are consistent with a typical soluble competitive antagonist with broad functional specificity. Nogo-A is a potent negative regulator used to guide the CNS development and maturation under a controlled manner. However, its inhibitory effects contribute in part to the unfavourable milieu for neuroregeneration after CNS injuries. The upregulation of Nogo-A and NgR1 have been detected in oligodendrocytes around chronic active lesions in the brain tissues of patients with MS (211), suggesting that Nogo-mediated inhibitory signalling may play a role in the disease progression. Consistent with this, Jurewicz et al have shown that soluble Nogo-A is only detectable in CSF of patients with MS and not in other neurological diseases, thus Nogo-A has been considered as a MS biomarker to predict neurodegeneration of the CNS (252). Furthermore, Nogo-A has been shown to inhibit the maturation of oligodendrocytes (241). These results suggest that the increased amount of Nogo-A in MS lesion may restrict the remyelination of MS thus contributing to neurodegeneration. All these results strongly suggest the inhibitory properties of Nogo- A are contributing to the disease progression of MS. Recently, blocking Nogo-A mediated inhibitory effects by specific anti-Nogo-A antibody, or siRNA or blocking NgR and its downstream signalling have shown some encouraging results in EAE mice such as promoting axonal regeneration and functional recovery (253,254,256). LILRA3, as a new high binding affinity receptor for Nogo 66 may act as a potential therapeutic treatment for MS to block Nogo 66-mediated inhibitory effects and promote neuroregeneration.

Soluble LILRA3 may have potent anti-inflammatory properties in vitro (20,35). Consistent with this, chapter 2 has shown that LILRA3 is significantly upregulated in patients with MS and its high expression level in serum is correlated with disease progression and better clinical outcomes, confirming the potent anti-inflammatory role of LILRA3 in MS. These anti-inflammatory properties may in part be explained by interaction with ubiquitously expressed Nogo 66 in Nogo-B, which is involved in various inflammatory responses such as promoting monocyte migration or macrophage infiltration (265,266) and activation of microglia in vitro (260). The uncontrolled macrophage/microglia activation may cause continuous scavenging of myelin, leading to

153 demyelination and neurodegeneration (313). Therefore, LILRA3 may play a role in regulating inflammatory-mediated demyelination and neurodegeneration in MS. Dual anti-inflammatory and neuroregenerative functions of LILRA3 may provide an attractive therapeutic approach to treat patients with MS, in which neuroinflammation and neurodegeneration processes have been shown to contribute to disease pathogenesis.

The constitutive expression of LILRA3 has been detected in neurons derived from foetal cortical neurons and in normal adult brain tissue (Figure 3-19), in addition to the initial knowledge about the expression of LILRA3 in leukocytes. Interestingly, LILRA3 mRNA is tightly regulated by the anti-inflammatory cytokine IL-10 in both leukocytes (35,66) and neurons (Figure 3-20), suggesting the anti-inflammatory properties of LILRA3 have effects in both the immune system and the CNS. Moreover, the abundant expression of LILRA3 in leukocytes and neurons supports the dual functions of LILRA3. Future studies that systematically map expression patterns and identify cellular sources of LILRA3 and define its relationships to Nogo-A in the brain of healthy controls and patients with MS could provide new insights into its pathophysiological roles in MS.

154

CHAPTER 4: STUDYING THE QUATERNARY FORMS OF LILRA3 IN A SINGLE CELL LEVEL

4.1 Introduction

LILRA3 belongs to a family of immune regulatory molecules that are primarily expressed on leukocytes (9). LILRA3 is unique as such that it is the only member of LILRs that lacks transmembrane and cytoplasmic domains, hence it is expected to be exclusively secreted (9). Results presented in chapter 3 indicate that LILRA3 may have multiple ligands and the proposal here is that its interaction with different ligands may lead to divergent tissue specific functions. Consistent with this, in chapter 3 of this thesis it has been demonstrated that the interaction of LILRA3 with one of ligands, Nogo 66, promoted neurite outgrowth and synapse formation in the CNS and the interaction with MHC class I ligand on monocytes potentially contributed to its potent anti-inflammatory properties (20). However, what determines its capability to bind multiple ligands that likely lead to its divergent functions remains to be elucidated.

LILRA3 is a heavily glycosylated, cysteine rich protein with 4-5 potential di- sulphide bonds (http://www.uniprot.org/uniprot/Q8N6C8). These biochemical properties are likely to result in protein oligomerisation leading to the formation of various quaternary forms that may affect ligand binding, cellular distribution, secretion and functions (382,383). In support of this, our laboratory discovered that the molecular mass of native and mammalian produced recombinant LILRA3 was 65 kDa, which is 20 kDa larger than the calculated mass of 47 kDa (20). This was primarily due to its extensive N- glycosylation, as non-glycosylated E.coli produced or enzymatic de-glycosylated LILRA3 resulted in an approximate 50 kDa protein mass (20). Importantly, glycosylation has significantly affected its binding ability to ligands, preserved biological activity as well as prevented spontaneous oligomerisation (20). This chapter will investigate whether native LILRA3 and mammalian expressed recombinant LILRA3 proteins exist in various quaternary forms in the different cellular compartments and the extracellular milieu. These results may provide a prelude to future in depth functional structural studies.

Traditionally, studies aimed at addressing quaternary structures are performed using standard biochemical assays, mainly Western blotting and immunoprecipitations

155

(384,385). However, these methods are limited as they do not provide information on spatiotemporal expression of various forms of a given protein in live cells. They also require pooled protein from many cells, and lysis of cells usually with detergents that likely alter structure. Moreover, these methods require proteins to be resolved and separated in SDS-PAGE gel that may further alter quaternary structures. Particularly, for secreted proteins like LILRA3, pre-incubation of cells with drugs that block secretion or transgenic overexpression may be required for accumulating detectable amounts of proteins by Western blotting, but these may artificially alter cellular distribution and structure. To overcome this, the number and brightness (N&B) analysis was used as an emerging new method to quantify various forms of LILRA3 in live cells at a single cell level (386-392).

The N&B analysis is a moment-analysis to measure the fluctuation variation caused by a fluorescent fusion protein diffusing in and out through an illumination volume (single pixel) over time (386,387). After acquiring a series of images, the average brightness is obtained from the ratio of the fluctuation variance to the average intensity at each pixel, the number of fluctuating particles is obtained from dividing the average intensity at one pixel by the brightness (386,387). The level of brightness is used to distinguish monomeric proteins from high order aggregates. The high level of brightness indicates few high order aggregates with high fluctuation variance, whereas low brightness reflects more number of low order aggregates that display low variances. Recently, N&B analysis has been also applied to investigate the existence of preformed ligand-independent protein dimers and clusters (393,394) and for detection of large molecular complexes involved in cellular adhesion using two-colour N&B analysis (395). This method offers an exciting new approach to detect and quantify various structural forms of proteins in different compartments of live cells at a single cell level, however, N&B analysis has not been systematically validated using independent alternate methods.

Advanced imaging together with new analysis method showed that intracellular LILRA3 protein exists in various quaternary forms in the different cellular compartments. Furthermore, this approach provided new insight that intracellular LILRA3 protein is packed in discrete microvesicles as a mixture of monomeric, dimeric and oligomeric forms, but is secreted as a monomeric protein without vesicular package. This new method also provided an unexpected new finding of extensive monomeric LILRA3

156 protein expression in the nucleus that was confirmed on primary leukocytes using super- resolution microscopy. All these results were thoroughly validated using conventional Western blot studies and thus led to the conclusion that confocal live cell imaging together with N&B analysis offers an alternative to conventional Western blotting for spatiotemporal quantification of soluble, large, heavily-glycosylated proteins such as LILRA3. Detection of different forms of LILRA3 in the cytoplasm, nucleus and the extracellular milieu may indicate diverse intracellular and extracellular functions.

157

4.2 Methods

4.2.1 Generation of full-length LILRA3 plasmid constructs in mammalian expression vectors

4.2.1.1 PCR amplification of full-length LILRA3 with or without stop codon

Full-length LILRA3 was subcloned into pMHneo vector (kindly donated by Dr Jonathan Arm, Novartis), which contains a Simian Virus 40 early promoter, a multiple cloning site, Ampicillin (prokaryote) and Neomycin (eukaryotic) resistance genes (Figure 4-1). LILRA3-pCR2.1 (generated by Dr Nicodemus Tedla) was used as a template for amplifying LILRA3 cDNA flanked with Xba I restriction site at 5’ end and Xho I restriction site at 3’ end. The primers included forward primer: 5’- GCCTCTAGAATGACCCCCATCCT-3’ and reverse primer: 5’- GCCCTCGAGTCACTCACCAGCCT-3’.

Full-length LILRA3 without stop codon was used to subclone into pEGFP-N1 and pmCherry-N1 vectors (Clontech, CA, USA), which contain a cytomegalovirus promoter, a multiple cloning site, EGFP (enhanced green fluorescent protein) or mCherry fluorescent gene, Kanamycin (prokaryote) and Neomycin (eukaryotic) resistance genes. The stop codon was not included in order to generate a fusion protein with EGFP or mCherry at C-terminus of LILRA3 (Figure 4-2). LILRA3-pCR2.1 was used as a template for amplifying LILRA3 cDNA flanked with Hind III restriction site on both ends. The primers included forward primer: 5’-GCCAAGCTTACCATGACCCCCATCCT-3’ and reverse primer: 5’- GCCAAGCTTCTCACCAGCCTTGG-3’.

PCR reaction mixture (25 l) was prepared using 1 l of 1 ng/l template DNA (LILRA3-pCR2.1), 1 x Pfu Ultra HF reaction buffer (Agilent Technologies, California, USA), 0.25 mM dNTP (Invitrogen, Life Technologies), 400 nM forward and reverse primers (Sigma), and 0.5 l Pfu Ultra HF DNA Polymerase (Agilent Technologies). PCR reaction was run on the PCR thermocycler using the following programs: 95°C for 5 min, then 35 cycles of 95°C for 30 sec, 60°C for 45 sec and 72°C for 45 sec, and final extension at 72°C for 10 min. For GAPDH housekeeping gene, the following programs were used: 95°C for 2 min, then 35 cycles of 95°C for 30 sec, 65°C for 30 sec and 72°C for 90 sec,

158 and final extension at 72°C for 10 min. PCR products were mixed with 1x GelRed (Biotium) and then analysed in 0.8% agarose gel electrophoresis using gel doc XR systems.

4.2.1.2 Cloning of LILRA3 into plasmid vectors

LILRA3 PCR products were purified from agarose gel excision using QIAGEN purification kit according to manufacturer’s instructions (QIAGEN, VIC, Australia). In brief, the 0.8% agarose gel containing PCR products were excised and mixed with 3 volumes of QG buffer (eg. 100 µg gel is mixed with 300 µl QG buffer), followed by a 10 min incubation at 50°C. 1 volume of isopropanol was then added to the mixture and loaded into a QIAquick spin column following 1 min centrifugation at 10,000 x g at RT. The column was washed once with 0.75 ml wash buffer and eluted by adding 30 μl UltraPure DNase/RNase free distilled water (Life Technologies) following a 1 min centrifugation at 10,000 x g. The concentration of eluted PCR products was measured using nanodrop (Thermo Scientific).

Full length LILRA3 PCR products and pMHneo plasmid vector were digested with Xba I and Xho I restriction enzymes (Roche) (Figure 4-1). LILRA3 PCR products without stop codon, pEGFP-N1 and pmCherry-N1 plasmid vectors were digested with Hind III restriction enzyme (Roche) (Figure 4-2). All digestion reactions were performed at 37°C for 2 h and followed by a heat inactivation at 65°C for 15 min. Digested PCR products and vectors were ligated respectively using Rapid DNA Dephosphorylation and Ligation Kit according to manufacturer’s instructions (Roche). In brief, digested plasmid vector (1 µg) was dephosphorylated in a 20 μl mixture containing 2 μl rApid Alkaline phosphatase buffer, 1 μl rApid Alkaline phosphatase and UltraPure DNase/RNase free distilled water at 75°C for 2 min. The dephosphorylated vector was ligated with insert (enzyme digested PCR products) at the molar ratio of 1:3 in a total volume of 21 μl mixture containing 1 x DNA dilution buffer, 10 μl T4 ligation buffer and 1 μl T4 DNA ligase and incubated at 24°C for 5 min. The ligated plasmid DNA was then transformed into JM109 competent E.coli (Promega, NSW, Australia) and selected on LB agar plates with corresponding antibiotics (Sigma); LILRA3-pMHneo was selected with 100 µg/ml ampicillin and LILRA3-pEGFP and LILRA3-pmCherry were selected with 50 µg/ml Kanamycin.

159

4.2.1.3 Confirmation with DNA sequencing

The correct in-frame sequences of all LILRA3 plasmid constructs were confirmed using DNA sequencing. In brief, a 20 µl DNA sequencing reaction containing 300-400 ng plasmid DNA as template, 1.5 μl 5 x sequencing buffer (Applied Biosystems), 4 pmol primer (forward or reverse primer only) and 1 μl Big Dye terminator V3.1 (Applied Biosystems) was amplified using the following conditions: 25 cycles of 96C for 10 sec, 50C for 5 sec and 60C for 4 min. The sequencing product was then mixed with 5 µl of 125 mM EDTA and 60 µl of 100% ethanol, vortexed briefly and incubated for 15 min at RT, followed by a 20 min centrifugation at 16,000 x g. The supernatant was carefully aspirated and 250 µl freshly made 70% (w/v) ethanol was added to the tube, briefly vortexed and spun at 16,000 x g for 10 min at 4C. After carefully removing the supernatant, the sequencing product was dried at 90C for 1 min and sent to the Ramaciotti Centre, UNSW, Australia for sequencing analysis. DNA sequencing results were analysed using the nucleotide BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi).

Figure 4-1: The strategy of generating LILRA3-pMHneo construct Full-length LILRA3 cDNA flanked with Xba I restriction site at 5’ end and Xho I restriction site at 3’ end was subcloned into pMHneo vector, which produces untagged native LILRA3 protein in overexpressing cells. The correct sequence of LILRA3-pMHneo was confirmed using DNA sequencing.

160

Figure 4-2: The strategy of generating LILRA3-pEGFP and LILRA3-pmCherry constructs Full-length LILRA3 cDNA without stop codon flanked with Hind III restriction site on both ends was subcloned into pEGFP-N1 (top panel) or pmCherry-N1 (bottom panel), which enabled the production of LILRA3 protein fused with C-terminal EGFP or mCherry tagged protein respectively. The correct in-frame sequences with right ligation orientation were confirmed using DNA sequencing.

161

4.2.2 Transient transfection of HEK 293T cells with LILRA3 plasmid constructs

HEK 293T cells were transient transfected with native LILRA3, LILRA3-mCherry, LILRA3-EGFP, EGFP alone or mCherry alone DNA constructs using Lipofectamine LTX according to manufacturer’s instruction (Invitrogen, Life Technologies). In brief, HEK 293T cells (2 x 105 cells per ml) were seeded onto poly-L-lysine (PLL, Sigma) coated 24-well or 6-well plates with 0.5 ml or 2 ml DMEM complete media respectively (see Method Section 3.2.1). The next day, media were replenished with fresh complete media without penicillin/streptomycin. One µg plasmid DNA with 1 µl reagent plus and 2 µl Lipofectamin LTX diluted in 50 µl Opti-MEM were used for 24-well plate transfection, while 150 µl Opti-MEM containing 2.5 µg plasmid DNA, 2 µl reagent plus and 6 µl Lipofectamin LTX was used for large scale transfection in a 6-well plate.

Transfected cells were then incubated at 37 °C, 5% CO2 for up to 72 h and intracellular and secreted LILRA3 proteins were analysed by live cell imaging and/or immunochemical assays.

4.2.3 Purification of microvesicles from culture supernatant of LILRA3 overexpressing HEK 293T cells

Forty-eight hours after transfection with EGFP-tagged LILRA3 constructs, 12 ml culture supernatant was collected from a 6-well plate containing transfected 293T cells and cell debris in the supernatants were filtered out with 0.22 μm filter-sterilisation device (Merck Millipore). Microvesicles were then isolated using ultracentrifugation as previously described (396). In brief, filtered supernatants were ultracentrifuged for 70 min at 100,000 × g, 4°C using SW41 swing bucket (Beckman Coulter, NSW, Australia) and the microvesicle containing pellets washed twice with PBS and spun at 100,000 × g, 4°C for 1 h each. The final microvesicle pellets were resuspended in 50 μl PBS and resolved in 10% SDS-PAGE gels for Western blotting or silver staining (see Method Section 2.2.6).

4.2.4 Fractionation of proteins from different cellular compartments of LILRA3 overexpressing HEK 293T cells

Proteins from HEK 293T cells overexpressing untagged or EGFP-tagged LILRA3 were fractionated as described (397). In brief, 2 x 107 cell pellet was washed twice with

162 cold PBS, resuspended in 0.75 ml buffer A (250 mM sucrose, 50 mM Tris-HCl and 5 mM

MgCl2) and sonicated on ice. Soluble and insoluble fractions were then separated by centrifugation at 800 x g for 15 min. The supernatant containing cytosolic and membrane protein was transferred into a fresh pre-chilled Eppendorf tube (tube 1) while the pellet in tube 2 was resuspended in 0.75 ml buffer A, vigorous vortexed, centrifuged at 1,000 x g for 15 min and the supernatant pooled into tube 1. The remaining pellet in tube 2 saved on ice. The pooled supernatant in tube 1 was ultracentrifuged for 1 h at 100,000 x g to further separate cytosolic proteins (in the supernatant) and membrane proteins (in the pellet). Cytosolic proteins were acetone precipitated by incubation with four times the sample volume of cold acetone for 60 min at -20 °C following 10 min centrifugation at 15,000 x g at -4°C. The supernatant was removed and cytosolic protein pellet was dried properly and left on ice. The pellet (tube 2) was resuspended in 1 ml buffer B (1 M sucrose, 50 mM Tris-HCl and 5 mM MgCl2), gently layered onto 3 ml buffer C (2 M sucrose, 50 mM Tris-HCl and 5 mM MgCl2) and spun at 2,100 x g for 1 h. Two distinct layers containing upper layer of proteins derived from organelles and bottom layer containing nuclear proteins were collected into separate tubes, pelleted by centrifugation at 1,000 x g for 15 min and finally washed once with cold TBS. All fractions were resuspended in 30 µl Tricine SDS-PAGE loading buffer and used for Western blotting under reducing and non-reducing conditions. All buffers contained 1 x protease inhibitor cocktail solution and 1 mM DTT and all extraction steps were carried out at 4°C.

4.2.5 Western blotting or silver staining for LILRA3 proteins in culture supernatants and cell lysates of transfected HEK 293T cells

Culture supernatants, cell lysates, microvesicles and the different cellular compartments of untagged or fluorescent tagged-LILRA3 transfected HEK 293T cells were resolved into 10% SDS-PAGE under reducing or non-reducing conditions, transferred onto PVDF membranes (0.2 µm pore size; Merck Millipore) and LILRA3 protein was detected with anti-LILRA3 mAb (Abnova) by Western blotting as describe (Method Section 2.2.6). In brief, cell lysates and culture supernatants of HEK 293T cells that were overexpressed with native LILRA3, LILRA3-Cherry and LILRA3-EGFP were analysed at 24, 48 and 72 hours post-transient transfection. Cell lysates were quantified using BCA assay according to the manufacture’s instruction. Cell lysate (20 µg per sample) or culture supernatants (20 µl) was analysed by Western blotting as previously 163 described (see Method Section 2.2.6) under reducing conditions. To study the structural forms of LILRA3 in cellular compartments and culture supernatants, samples were analysed by Western blotting under non-reducing condition, in which cell lysates or culture supernatants were mixed with 1 x Tricine sample buffer (Bio-Rad) and directly resolved into 10% SDS-PAGE without heating, following by Western blotting as previously described (Section 2.2.6). Microvesicles isolated from 48 hours post- transfected culture supernatant were analysed using both Western blotting and silver staining under reducing or non-reducing conditions.

4.2.6 Time-lapse and confocal microscopic imaging of HEK 293T cells transfected with LILRA3-EGFP or LILRA3-mCherry

HEK 293T cells (1 x 105) were seeded on PLL coated µ-Dish at (35 mm, high glass bottom from Ibidi GmbH, Germany) overnight. Cells were then transfected with LILRA3-EGFP or LILRA3-mCherry constructs as above (Section 4.2.2), immediately transferred to Nikon Biostation IM-Q (Nikon, Japan) and time-lapse images were collected using 40 x Plan Fluor 0.8 NA objective with 2 x tube lens at 10 min intervals for 48 h. The Nikon Biostation IM-Q is a compact cell incubator and monitoring system that allows multiple fields of cells to be imaged over time with both good qualities of phase and fluorescence images (398).

In order to gain more insight of LILRA3 protein translation in a single live cell level, time-lapse images of live HEK 293T cells at 12 hours post-transfection with LILRA3-EGFP or LILRA3-mCherry were also acquired using high-resolution Zeiss LSM 780 microscope (Zeiss, Germany) with 63 x plan Apochromat 1.4 NA objective for 10 min with 3 sec interval. LILRA3-EGFP was detected at 488 nm laser, emission 517 nm-695 nm with 1 AU pinhole size, while LILRA3-mCherry was detected at 561 nm laser, emission 569 nm-735 nm with 1 AU pinhole size. All time-lapse images were edited using ImageJ.

To study the 3-dimensional (3D) localisation of LILRA3-EGFP in a single cell, a series of z-stacked confocal fluorescent images with 0.3 µm in depth were acquired from 4% fresh paraformaldehyde fixed transfected HEK 293T cells using inverted Leica TCS SP5 microscope using 100 x HCX Plan Apo NA 1.4 objective (Leica Microsystems, Germany). LILRA3-EGFP was detected using 488 nM Argon Ion Laser, emission 493

164 nm - 600 nm with 1 AU pinhole size. Z-staked 3D structure of LILRA3-EGFP in a single HEK 293T cell was reconstructed using Imaris software (Bitplane, Zurich, Switzerland).

4.2.7 N&B analysis of fluorescent tagged-intracellular LILRA3

The N&B analysis of the intracellular fluorescent-tagged LILRA3 protein in live cells was performed together with Dr Alex Macmillan using the SimFCS software developed by the Laboratory for Fluorescence Dynamics at the University of California (Irvine, CA; www.lfd.uci.edu). Briefly, live cell images from LILRA3-EGFP or pEGPF control transfected HEK 293T cells (on PLL-coated quarter dishes; Ibidi) were acquired on high-resolution Zeiss LSM 780 microscope (Zeiss, Germany) at 14, 19, 24 and 29 h post-transfection using 100 x plan Apochromat 1.4 NA objective with 488 nm laser line, emission 517 nm -695 nm, 1AU pinhole size. In order to measure N&B, detector was used in pseudo-photon counting mode. Images were acquired in 256 x 256 pixel array and laser dwell time of 12.5 µs; 100 frames were acquired for single experiment and the number of molecules (N) and intrinsic brightness of each molecule (B) of 20 cells measured at each time point in 3 independent experiments, and the variances in the average signal calculated as follows:

(< 퐼 > −표푓푓푠푒푡)2 푁 = 2 2 휎 − 휎0 휎2 − 휎2 퐵 = 0 < 퐼 > −표푓푓푠푒푡

Where N is the apparent number of molecules, B is the intrinsic brightness of each molecule, < 퐼 > is the average signal intensity, the offset is a constant quantity 2 2 characteristic of the detector settings, 휎 is the variance and 휎0 is the readout variance of the detector.

4.2.8 Localisation of nuclear LILRA3 in transfected HEK 293T cells and primary monocytes using 2-colour super-resolution microscopy

4.2.8.1 Immunofluorescence staining of LILRA3 in nucleus

HEK 293T cells transfected with native LILRA3 plasmid construct or freshly isolated primary human PBMCs (see Method Section 3.2.4) were cultured on PDL-coated

165 cover slips for 3 h at 37°C with 5% CO2 in a humidified atmosphere followed by 1x wash with PBS to remove non-adherent cells. Adherent HEK 293T cells or PBMCs were fixed with 4% paraformaldehyde for 10 min at RT, rinsed 3 x with PBS and then permeabilised with 0.1% Triton X-100 in PBS for 5 min at RT. After the permeabilisation, the cells were blocked with blocking buffer (0.02% Tween-20, 2% FBS in PBS) for 30 min at RT and then incubated with an in-house rabbit anti-LILRA3 mAb (2 µg/ml diluted in blocking buffer) overnight at 4°C. The next day, cells were washed 4 x with PBS and incubated with a nuclear membrane protein marker, mouse anti-LAP 2 mAb (2 µg/ml diluted in blocking buffer; Abcam, UK), for 2 h at RT. Slides were then washed 4 x with PBS, incubated with goat anti-rabbit Alexa Fluor 488 and goat anti-mouse Alexa Fluor 647 (both 1:400 dilution; Molecular Probes, Thermo Fisher Scientific) for 1.5 h at RT. Slides were washed again with PBS and then were imaged using a super-resolution microscopy.

4.2.8.2 Two color super-resolution microscopy

Super-resolution images were performed by Dr Enrico Klotzsch using direct stochastic optical reconstruction microscopy (dSTORM) as previously described (399). This imaging technique surpasses the resolution limitation of the normal confocal microscope (100-200 nm accuracy) and provides better spatial resolution (~ 20 nm accuracy) (399). dSTORM utilises photo-switchable fluorophores that can be reversibly converted between a fluorescent state and a dark state upon irradiation with different wavelengths of light, and the super-resolution image can be reconstructed by combining the sequential acquisition of images with the stochastic photo-switchable fluorophores (399). In brief, samples were measured using a “blinking buffer” maximizing the number of photons per fluorophore and optimize bright to dark fluorophore ratio, containing 50 mM cysteamine, 40 μg/ml catalase, 10% glucose and 0.5 μg/ml glucose oxidase in PBS adjusted to pH 7.4 (378,400). Measurements were performed using a Zeiss Elyra microscope containing a 405 nm, 488 nm, 561 nm and a 642 nm laser, focused onto the back-focal plane of a total internal reflection fluorescence (TIRF) objective (alpha Plan- Apochromat 100x/1.46, Zeiss) for highly inclined illumination (illumination intensity ∼ 1 kW/cm2) (401). Emission light was filtered using appropriate filter sets for Alexa 488 or Alexa 647 and imaged on two back-illuminated iXon DU 897 EMCCD cameras (Andor Technology Ltd, Ireland), which were water-cooled to −70°C. The 405 nm activation laser was subsequently increased over time to guarantee for a constant number 166 of localisations per frame. The lateral drift was typically smaller than 50 nm/h and a drift- correction was implemented as described (378), and an implemented focus hold guaranteed stable z positions (typical <10 nm/h). Nuclear localisation of LILRA3 was analysed as previously described (402). Briefly, blocks of typically 3000 frames were used to reconstruct one image and localisation bursts with a distance smaller than 90 nm in consecutive frames (interrupted by not more than 2 dark frames) were grouped into a single localisation. Localisations with an uncertainty larger than 30 nm were discarded and data were rendered using Thomson blurring (403).

167

4.3 Results

4.3.1 LILRA3 is secreted to culture supernatant in a time dependent manner

HEK 293T cells were transiently transfected with untagged LILRA3, LILRA3- EGFP or LILRA3-mCherry plasmid DNA. Culture supernatants (20 µl) and cell lysates (20 µg) from different time points post-transfection were analysed by Western blotting under reducing condition using anti-LILRA3 mAb (Figure 4-3A). Intracellular LILRA3 appeared markedly higher at 24 hours post-transfection compared to 48 hours and 72 hours. Although accurate quantification was not performed as each culture supernatant contained a variable number of cells and volumes, LILRA3 protein in culture supernatant seems to progressively increase over the 72 hours period (Figure 4-3B), which suggested that a gradual increase in the secreted LILRA3 protein was associated with progressive intracellular depletion. Notably, the expressing and secreting patterns were similar among all the 3 constructs (Figure 4-3), indicating the different fluorescent tags did not affect the synthesis and secretion of the protein.

Figure 4-3: Western blotting analysis of intracellular and extracellular LILRA3 expression in HEK 293T cells over a period of 24-72 hours Western blotting under reducing conditions of 20 µl culture supernatant and 20 µg cell lysates at various time points post-transfection with anti-LILRA3 mAb showed gradual decrease in the intracellular untagged (lane 1), mCherry-tagged (lane 2) and EGFP-tagged LILRA3 proteins (A) as contrasted to secreted LILRA3 in the culture supernatant (B) (n=3).

168

4.3.2 Intracellular LILRA3 is packed in microvesicles

Given that the fluorescent tagged LILRA3 proteins had similar synthesis and production pattern with the untagged “native” protein, we took advantage of the fluorescent-tagged LILRA3 to monitor the expression dynamics of LILRA3 in live cells. Representative time-lapse images in Figure 4-4 showed that LILRA3-EGFP was detected as early as 6 hours post-transfection and mainly expressed in the perinuclear area. In the following 8 hours, LILRA3 protein moved to the cytoplasm and formed discreet, intensely fluorescent vesicles (Figure 4-4). After 12 hours, intensely fluorescent vesicles disappeared from the cytoplasm leading to dim and diffused fluorescence stains (Figure 4-4). These results suggest rapid synthesis, vesicular packaging and rapid secretion of LILRA3 protein with little intracellular stores within a 24 hour time frame. This is consistent with the previous results obtained using conventional Western blotting (Figure 4-3).

6 h 8 h 10 h

12 h 14 h 18 h

Figure 4-4: Monitoring the translation and secretion of LILRA3-EGFP in transfected HEK 293T cells under Nikon Biostation IM-Q Representative time-lapse images of LILRA3-EGFP in HEK 293T cells using Nikon Biostation IM Q microscope showed synthesis of LILRA3 protein as early as 6 hours post-transfection that gradually moved from the perinuclear localisation, packed into vesicles in the cytoplasm (10-14 hours) and released into culture supernatants (18 hours) (scale bar = 10 µm; images were acquired using Nikon Biostation IM-Q with 40x objective) (n=3).

169

To further analyse the size and distribution of LILRA3 containing microvesicles, live HEK 293T cells at 12 hours post-transfection were imaged using Zeiss LSM 780 microscope that can provide higher resolution images. Figure 4-5A shows that various sizes of LILRA3-mCherry microvesicles were distributed in the cytoplasm and the average sizes of microvesicles were less than 0.5 µm. Representative time-lapse images in Figure 4-5B1-4 showed that the distribution of LILRA3-mCherry containing microvesicles changed every 3 sec, suggesting that LILRA3 may undergo protein trafficking before secretion.

A B-1 B -2

B-3 B-4

Figure 4-5: High resolution time-lapse images of HEK 293T live cells transfected with LILRA3-mCherry (A) Various sizes of LILRA3 microvesicles are expressed in HEK 293T cells transfected with LILRA3-mCherry and in particular these accumulated under the cell membrane (white box). Scale bar = 10 µm. (B1-4) High magnification in the area of white box showed that the microvesicle pattern was changed every 3 sec. (Acquired using Zeiss LSM 780 microscope with 63 x objective) (n=3)

170

To further analyse the distribution of LILRA3 containing microvesicles in a whole single cell, LILRA3-EGFP over expressing HEK 293T cells were fixed with 4% paraformaldehyde after 24 hours post-translation and then imaged using Leica TCS SP5 microscope. Various sizes of discrete LILRA3-EGFP microvesicles were observed in a single plane confocal image (Figure 4-6A) and 3D images reconstructed from z-stacked confocal images (Figure 4-6B). These results were consistent with previous images obtained using LILRA3-mCherry (Figure 4-5), suggesting that packaging of LILRA3 in microvesicles prior to secretion is independent of the nature of the fluorescent tag.

A B

Figure 4-6: High resolution images of fixed LILRA3-EGFP overexpressed HEK 293T cells (A) Representative high resolution confocal image showing LILRA3-EGFP was expressed as punctuate vesicular elements (n=10). (B) 3D images were reconstructed from z-stacked confocal images using Imaris software (scale bar = 10 µm; images were acquired using Leica TCS SP5 microscope under 100 x objective)

171

4.3.3 LILRA3 is secreted as vesicle-free monomeric form

Although intracellular LILRA3 was packed as discrete and high mobile microvesicles (results in Section 4.3.2), it was not clear whether LILRA3 was secreted as single molecules or as vesicular particles. To address this, microvesicle enriched and microvesicle depleted culture supernatants were resolved in two 10% SDS PAGE gels under reducing condition. One gel was used for silver staining to assess successful enrichment of microvesicles and confirm comparable protein loading and the other gel was transferred to PVDF membrane for Western blotting with anti-LILRA3 mAb. Silver staining showed the presence of abundant proteins in the microvesicle enriched supernatant and the microvesicle depleted fraction (Figure 4-7A), indicating successful isolation of microvesicles. Western blotting revealed that LILRA3 was only detected in microvesicle depleted, but not in microvesicle enriched supernatant (Figure 4-7B), suggesting LILRA3 was secreted as vesicle-free protein.

A B 1 2 1 2 250 250 150 150 100 75 100 75 50 37 50 25 37 20 15 25 10

Figure 4-7: Determination of secreted LILRA3 as vesicle-free protein (A) Silver staining of protein from vesicle-depleted (lane 1) and vesicles-enriched (lane 2) culture supernatant showed comparable amounts of protein loaded. (B) Western blotting using anti- LILRA3 mAb demonstrated specific immunoreactive band only in the vesicle-depleted supernatant (lane 1), indicating that LILRA3 protein is secreted as a free protein without vesicular package (n=3).

172

LILRA3 is cysteine rich protein (contains 12 cysteine residues) and has 4 C2-type immunoglobulin-like domains with the potential to form 4-5 di-sulphide bonds (http://www.uniprot.org/uniprot/Q8N6C8). Hence it is likely that secreted LILRA3 might be in dimeric or multimeric forms that can potentially affect ligand binding and/or functions. To investigate the size(s) of secreted LILRA3 in fresh culture supernatant, Western blotting the supernatant under non-reducing and reducing conditions with anti- LILRA3 antibody showed that LILRA3 was only secreted as monomeric protein (Figure 4-8).

Figure 4-8: LILRA3 protein is secreted as monomers 1 2 Representative Western blotting LILRA3-EGFP in culture 250 150 supernatant under non-reducing (lane 1) and reducing (lane 2) 100 75 conditions with anti-LILRA3 antibody showed that LILRA3 was exclusively secreted as a monomeric protein (n=3). 50

4.3.4 Detection of monomeric, dimeric and oligomeric LILRA3 in cytoplasm and nucleus

N&B analysis was used to spatiotemporally quantify the structural forms of intracellular LILRA3 with the assistance of Dr Alex Macmillan. Figure 4-9A and B are the representative N&B analysis at earlier (12 hour) and late (24 hour) time points of post- transfection respectively. The left of Figure 4-9A and B were the two-dimensional histograms; each pixel/dot represented the average intensity and brightness. LILRA3- EGFP protein was distinct from background based on the high fluorescent intensity (>2). Monomeric (green), dimeric (red) or oligomeric (blue) LILRA3-EGFP protein was differentiated based on the EGFP brightness, 1.3, 1.6 and 1.9 respectively as previously described (404). The spatiotemporal distribution of different forms of intracellular LILRA3 in live cells is presented on the right of Figure 4-9A and B using the confocal cell images. The proportions of monomeric, dimeric and oligomeric forms of LILRA3 were quantified in 20 cells at each time point and showed that intracellular LILRA3 had significant higher proportions of dimeric and oligomeric forms than monomeric form at 173 both time points (Figure 4-9C). The spatiotemporal distribution of multiple forms of intracellular LILRA3 was consistent between early (12 hour) and late (24 hour) time points (Figure 4-9C). Interestingly, these results were opposite to those found in culture supernatant, where secreted LILRA3 was presented in an exclusive monomeric form (Figure 4-8).

Notably, there was substantial expression of LILRA3-EGFP in the nucleus of transfected HEK 293T cells (Figure 4-9A and B). The cytoplasm and nucleus areas of all images acquired at 24 hours post-transfection were separated using ImageJ by Dr Enrico Klotzsch and further analysed by N&B analysis (Figure 4-10A and B). Results showed that up to 60% of nuclear LILRA3 protein was monomers and approximately 30% is dimers and 10% is oligomers (Figure 4-10C). There was significantly higher proportion of monomeric LILRA3 in nucleus than in cytoplasm (approximately 20%), whereas cytoplasm had significantly higher proportion of oligomeric LILRA3 (approximately 45%) than nucleus (Figure 4-10C).

174

Figure 4-9: N&B analysis of monomeric, dimeric and oligomeric forms of intracellular LILRA3 Representative images of N&B analysis and quantification of global distribution of intracellular LILRA3-EGFP in HEK 293T cells 12 (A) or 24 hours (B) post-transfection showing significantly larger proportions of the intracellular LILRA3-EGFP were in dimeric or oligomeric forms (C) at both time points; events in the green, red and blue rectangles represent the monomeric, dimeric and oligomeric forms of the protein respectively. Total of 20 cells were analysed per time point per experiment and data are presented as mean ± SD of 3 independent experiments (NS, not significant *p<0.05, **p<0.001, ****p<0.00001; two way ANOVA).

175

Figure 4-10: N&B analysis of multiple forms of LILRA3 in the cytoplasm and nucleus compartments Representative images of N&B analysis and quantification of LILRA3-EGFP in the cytoplasm (A) or nuclear (B) compartments of HEK 293T cells 24 hours post-transfection showing significantly higher proportions of the monomeric forms were found in the nucleus (C). In contrast, LILRA3 in the cytoplasm was mostly oligomeric (C). Data are presented as mean ± SD of 3 independent experiments (NS, not significant, ***p<0.0001; two way ANOVA).

176

Cell lysate obtained from LILRA3-EGFP overexpressed HEK 293T cells was analysed by Western blotting under non-reducing conditions. Figure 4-11A shows that LILRA3-EGFP had distinct immune-reactive bands at ~80 kDa, ~200 kDa and > 300 kDa proteins corresponding to the monomeric, dimeric and oligomeric forms of LILRA3 protein. This result was consistent with previous N&B analysis which showed the expression of multiple forms of LILRA3 inside cells (Figure 4-9).

Initial N&B analysis suggested that multiple forms of LILRA3 protein expressed differentially in the different compartments including cytoplasm and nucleus (Figure 4-10). To eliminate the possibility that EGFP tag may lead dimerisation of LILRA3 or facilitate LILRA3 to and enter into nucleus, different cellular compartments of untagged “native” LILRA3 overexpressed in HEK 293T cells were fractionated according to method Section 4.2.4 and analysed by Western blotting under non-denaturing conditions. Figure 4-11B showed that variable amounts and sizes of LILRA3 protein were found in cell membrane, cytosolic, cell organelles and nuclear proteins, in which monomeric, dimeric and oligomeric LILRA3 proteins were detected in total cell lysate (lane 1), cell organelle (lane 2) and nuclear fractionations (lane 5), whereas only monomeric LILRA3 protein was found in cell membrane (lane 3) and cytosol (lane 4) fractionations (Figure 4-11B). These results were in good agreement with N&B analysis showing the expression of multiple forms of LILRA3 in cytoplasm and nucleus (Figure 4-10). However, the amount of individual form of LILRA3 in different cellular compartments cannot be semi- quantified due to a lack of a universal house-keeping protein that is expressed across different cellular compartments. Considering fractionation of proteins from different cellular compartments and Western blotting analysis are time-consuming and it is difficult to isolate pure cellular compartment proteins, N&B analysis may represent a superior alternative method for spatiotemporal characterisation and quantification of LILRA3.

177

A B 1 2 3 4 5

250 250 150 150 100 100 75 Monomer 75 Dimer 50 Oligomer 50 37 37 25 20 25 10 20

Figure 4-11: Western blotting analysis of structural forms of LILRA3 (A) Representative Western blotting of total cell lysates from HEK 293T cells overexpressed EGFP-tagged LILRA3 protein under non-reducing conditions showed immunoreactive bands with molecular mass at ~80 kDa, ~200 kDa, > 300 kDa, which were consistent with monomeric, dimeric and oligomeric forms of the protein (n=6). (B) Representative Western blotting of untagged LILRA3 protein in different cellular compartments under non-reducing conditions showing total cell lysate (lane 1), cell organelle (lane 2) and nuclear fractionations (lane 5) expressed multiple forms of LILRA3, whereas cell membrane (lane 3) and cytosol (lane 4) only had monomeric LILRA3 protein (n=2).

4.3.5 Confirmation of the expression of LILRA3 protein in cell nucleus by super- resolution fluorescence microscopy

To confirm the unexpected finding of LILRA3 expression in the nucleus, regardless of the structural forms, dSTORM super-resolution microscopy was used to overcome the resolution limitation of the normal confocal microscope (100-200 nm accuracy) and provides better spatial resolution (~ 20 nm accuracy) (399). Our results showed that substantial immunoreactivity to anti-LILRA3 mAb (Figure 4-12A and B), but not control IgG1 mAb (not shown because it is black) was detected in the nucleus of HEK 293T cells transfected with untagged LILRA3. Importantly, the expression of native LILRA3 was also detected in the nucleus of primary monocytes (Figure 4-12C and D), strongly

178 suggesting that nuclear translocation of LILRA3 was not due to forced overexpression, but naturally occurred.

Figure 4-12: Detection of LILRA3 protein in the nucleus of transfected HEK 293T cells and primary monocytes Representative super resolution (dSTORM) images showing LILRA3 protein in the nucleus of HEK 293T cells transfected with untagged LILRA3 plasmid DNA (A and B) or in freshly isolated peripheral blood monocytes (C and D) confirming physiological presence of LILRA3 protein (green) in the nucleus (scale bar = 10 µm). Lamina-associated polypeptide 2 (LAP 2) (red) was used as nuclear membrane marker (n = 3).

179

4.4 Discussion

LILRA3 as a secreted protein has been shown to possess both anti-inflammatory (20) and neuroregenerative functions (Chapter 3). These completely unrelated functions may be caused by the interaction with different tissue specific ligand(s) and/or due to the presence of various oligomeric/quaternary forms of LILRA3. In this study, confocal live cell imaging and N&B analysis method were used to detect and quantify the spatiotemporal expression of possible diverse structural forms of fluorescent-tagged LILRA3 expressed in single cells. Results were then thoroughly validated using conventional Western blotting.

Construction of fluorescent fusion proteins is a widely used method to study proteins of interest in vitro and in vivo, however, this may affect protein folding, localisation and functionality of the protein of interest in some cases (405). Initial investigation showing that the expression and secretion patterns in cells overexpressing untagged native LILRA3 protein or fluorescent tagged LILRA3 protein were reproducible (Figure 4-3), indicating that the fluorescent tag did not affect the kinetics of LILRA3 protein synthesis and secretion, and thus fluorescent fusion LILRA3 are representable of native LILRA3 and suitable to be used in the following imaging study. Confocal live cell imaging demonstrated that intracellular LILRA3 was packed in various sized microvesicles, rapidly synthesised and secreted. Previous studies showing increased intracellular accumulation of LILRA3 protein in Brefeldin A-treated primary human monocytes, but not in untreated monocytes strongly suggests that LILRA3 protein may be continuously secreted into the extracellular milieu including into the peripheral circulation with little intracellular storing (35). These results together with the abundant presence of soluble LILRA3 in sera (Chapter 2) (35), suggest that LILRA3 likely follows the secretory pathway of many serum proteins that have similar size and/or structure to LILRA3 including immunoglobulins and albumin (406,407). This involves translation in rough ER, translocation to Golgi through transport vesicles, post-translational modification in ER and Golgi, and finally exocytosis into extracellular spaces (406,407). There are two secretory pathways: constitutive secretory pathway and regulated secretory pathway (408,409). Constitutive secretory pathway involves continually delivering essential proteins to destined places such as constantly updating plasma membrane proteins or secretion of immunoglobulins from plasma cells, whereas regulated secretory 180 pathway stores soluble proteins and other substances in secretory vesicle close to the plasma membrane and discharges rapidly upon cell stimulation such as neurotransmitters and hormones (408,409). Given that LILRA3 is constantly secreted without accumulation in the cytoplasm, it is likely secreted via the constitutive secretory pathway.

Confocal microscopy showed for the first time that intracellular LILRA3 was packed in discrete microvesicles prior to secretion, although in contrast it was secreted as vesicle-free protein. The biological significance of the intracellular packaging of LILRA3 within the vesicles followed by vesicle-free release to the extracellular milieu remains to be elucidated. It is possible that the intracellular containment within the vesicles may prevent the unwanted enzymatically digestion or facilitate efficient transport while preventing it from inappropriately interacting with its potential intracellular ligands such as intracellular MHC I molecules (83) and Nogo 66 (Chapter 3).

Although LILRA3 is cysteine rich protein with 4-5 potential di-sulphide bonds, it is secreted as exclusively monomeric protein (Figure 4-8), suggesting it may rapidly engage with its cell surface ligands such as MHC-I molecules (83) and Nogo 66 (Chapter 3) and thus effectively commit its anti-inflammatory and neuroregenerative duties. In contrast, results in Section 4.3.4 showed that intracellular LILRA3 exhibited monomeric, dimeric and tetrameric forms. These findings were confirmed by two independent approaches: N&B analysis in live cells with overexpressing LILRA3-EGFP and non- reducing Western blotting using cells overexpressing untagged LILRA3 or LILRA3- EGFP. Moreover, spatiotemporally quantitation by N&B analysis suggested that a significant proportion of the intracellular LILRA3 was in dimeric and oligomeric forms, in contrast to the exclusively monomeric form found in culture supernatants. The various forms of LILRA3 in the cytoplasm are likely caused by events following biosynthesis such as glycosylation. Glycosylation is one of the most important post-translational modifications for membrane-bound or secreted proteins and plays a potent role in maintaining protein structure (16), prevention of aggregation (21) and retaining high affinity ligand binding (17,18,20). LILRA3 contains complex N- and O-linked glycosylation (20) that is usually enzymatically processed in the cellular compartment ER and Golgi apparatus respectively (407,410). Detection of different forms of LILRA3 in the intracellular and extracellular milieu suggested that the early non-glycosylated forms may form aggregates of dimers and oligomers with little or no biological activity and

181 mostly retained within the cell, whereas the mature protein may be fully-glycosylated, mostly secreted to the extracellular milieu and exerts biological functions via high affinity binding to cell surface ligands. This is consistent with our previous study showing E.coli- produced non-glycosylated LILRA3 is highly susceptible to aggregation, did not bind cell surface ligands and did not have biological activity as opposed to the fully glycosylated LILRA3 protein produced in a mammalian system that exhibited all these biological properties (20).

There is increasing evidence suggesting that protein glycosylation patterns can be altered under disease conditions (411-413). Serum immunoglobulins that have similar size and/or structure to LILRA3 have been demonstrated to undergo the glycosylation alteration under autoimmune diseases such as RA and SLE (412,414), leading to protein structural changes or aggregation and thus changes in functions (411,415). A typical example is monomeric IgA eliciting anti-inflammatory effects upon ligation of FcαR1, however, reduction of O-linked glycan promotes IgA self-aggregation that mediates strong pro-inflammatory effects (50,416). Since LILRA3 is heavily glycosylated and glycosylation is crucial for LILRA3 to maintain high binding affinity to its ligands and thus its functions (20), it would be interesting to investigate in the future whether the elevated LILRA3 level in sera of patients with RA (35) and MS (Chapter 2) exhibit altered glycosylation patterns and consequently elicit diverse functions.

This was the first study to show the substantial expression of LILRA3 in the cell nucleus. This surprising finding was rigorously confirmed by several approaches including N&B analysis, Western blotting and super-resolution fluorescence microscopy. The detection of native LILRA3 in the nucleus of freshly isolated primary peripheral blood monocytes (Figure 4-12) further confirmed that the nuclear translation of LILRA3 is a natural phenomenon, and not driven by overexpression mechanisms. Interestingly, N&B analysis revealed that the nuclear LILRA3 protein was mostly monomeric, which is similar to the biologically active secreted protein, suggesting new functions of LILRA3 in the nucleus. Our previous results suggested that LILRA3 also interacts with LAMR1 (Chapter 2), an important multifunctional protein widely expressed in different cellular compartments including the nucleus (417,418). LAMR1 has been shown to interact with histones and potentially play a key role in gene regulation (417,418). Whether the

182 interaction between LAMR1 and LILRA3 may play a role in gene regulation requires further investigation.

Furthermore, LILRA3 lacks nuclear localisation sequence (NLS), which is a unique amino acid sequence that facilitates protein translocation into the cell nucleus (419). Thus, mechanisms for the nuclear translocation of LILRA3 remain to be elucidated. Potential mechanisms may include cell cycle dependent passive translocation (420) or sugar- mediated nuclear translocation (421,422), which are previously described for translocation of large proteins without NLS. Heat shock protein 70 that has similar size with LILRA3 and also contains O-linked glycosylation, has been shown to be translocated to the nucleus and nucleolus via sugar-mediated nuclear translocation and plays an essential role in DNA integrity (423,424). Interestingly, studies have shown that O-linked glycosylation is particularly enriched in nuclear proteins such as chromatin and transcription factors and plays an important role in gene transcription and translation (see reviews (425,426)). Given that LILRA3 is also predicted to have up to 8 O-linked glycosylated sites (20), whether LILRA3 may play a role in gene regulation requires further investigation.

N&B analysis is a powerful tool that has been used to study a wide range of cellular processes in live cells involving intracellular protein aggregation (427,428), DNA aggregation delivered through lipofection (429), virus budding and oligomerisation (390,430), chemical induced mutagenesis (431) and ligand-independent cell surface protein dimers and clusters (393,394). Recently, a much advanced N&B analysis named as two-colour cross-correlation N&B has been used to characterise the lipid-protein or protein-protein interactions using two fluorescent fusion proteins of interest (432,433) and also detect larger molecular complexes involved in cellular adhesions (395). Furthermore, this is a very approachable technique that can be performed using a wide range of microscopies including 2-photon scanning microscopy (386,387), total internal reflection fluorescence (430,434) and confocal microscopy (392,435). Therefore, N&B analysis is a valuable tool that can be used in the future to study the structural confirmation of LILRA3 after ligand interaction or the alteration of glycosylated sites. Importantly, this is the first study to systematically collaborate N&B results obtained from live cells with Western blotting of different cellular compartments isolated from these cells. Live imaging together with N&B analysis maybe used as a better alternative

183 method as they offer numerous advantages including production of quantifiable data from single live cells that can be actively manipulated. N&B analysis is dynamic and it allows precise localisation of different forms of a given protein overtime. Moreover, unlike Western blotting, this technique detects proteins in their native forms and in their natural cellular milieu.

In conclusion, the key findings in this chapter are that LILRA3 was mostly oligomeric and packed in discrete microvesicles in the cytoplasm, in contrast, it was secreted exclusively as vesicle-free monomeric protein. Furthermore, this is first study to discover the expression of monomeric LILRA3 in the nucleus, suggesting that LILRA3 may have potential functions in gene regulation in addition to anti-inflammatory and neuroregenerative functions. Importantly, high resolution live cell imaging and N&B analysis may offer a superior alternative to conventional Western blotting for spatiotemporal characterisation and quantification of oligomeric/quaternary proteins such as LILRA3. Our preliminary data showing the detection of different forms of LILRA3 in the extracellular milieu, cytoplasm and nucleus may indicate diverse intracellular and extracellular functions. However, future study into the crystal structure of full length proper glycosylated LILRA3 is imperative in order to have a better understanding of the natural molecular structure of LILRA3 and its potential interaction ligands.

184

CHAPTER 5: FINAL DISCUSSION AND FUTURE DIRECTIONS

LILRA3 is a secreted protein with four C2-type immunoglobulin-like domains (5,8,9). LILRA3 protein has been detected in human sera of healthy subjects and patients with RA (35) and mRNA is constitutively expressed in a variety of immune cells including monocytes/macrophages, natural killer cells and lymphocytes (5,35) as well as mast cells (59). This widespread constitutive expression may suggest a physiological immunoregulatory role. Unlike the membrane-bound activating and inhibitory LILRs (2,5,6), soluble LILRA3 cannot transduce intracellular signals due to lack of transmembrane and cytoplasmic domains (33). The functions of LILRA3 remain largely unknown, despite its strong clinical associations with chronic inflammatory diseases (reviewed in (107)). Some in vitro evidence suggests that LILRA3 may possess anti- inflammatory properties (20) and its expression is tightly regulated by immunoregulatory cytokines (35,66). Since LILRA3 bears high similarity to the extracellular domains of some activating and inhibitory LILRs, particularly LILRA1 and LILRB2 (5,6,9), it has been proposed to act as a soluble antagonist/agonist to these receptors, likely through shared ligands. However, limited knowledge about LILRA3 ligands has hindered the progress of understanding its functions. Several studies suggested that some members of MHC I molecules are the potential ligands for LILRA1, LILRA3 and/or LILRB2 (Section 1.2.6.1) but the functional consequences of these interactions have not been systematically characterised. There are three main complications with such studies: firstly producing correctly folded and post- translationally modified full-length LILR proteins, including LILRA3, is difficult because of their complex structures (5,6,9). LILRs are large and cysteine rich with multiple potential di-sulphide bonds (5) that may render them susceptible to aggregation (382,383) and are complex with potentially 4-8 glycosylation sites that make them unsuitable for production in commonly used eukaryotic expression systems (5,20). Secondly, methods used to date heavily relied on truncated recombinant proteins to study interaction partners (13,83,436), and do not address the possibilities that LILRs may have more than one native ligand(s) (2,12,69,90). Thirdly, LILRs are selectively conserved in

185 humans and primates, but there are no rodent homologues, which precludes in vivo experiments using rodent models. Our laboratory overcame some of these difficulties by producing full-length recombinant LILRA3 protein typical of the native protein including extensive N- glycosylation, which added 20 kDa to the calculated mass and significantly affected ligand binding (20). This protein was used for high throughput screening of potential LILRA3 ligand(s) on the surface of cells from different lineages (20) and was also used as bait to pulldown LILRA3 candidate ligands from plasma membranes, which were identified by mass spectrometric sequencing (Section 3.3.1). Using this innovative unbiased proteomic approach we identified 2 new non-MHC I ligands: Nogo 66 and LAMR1, and one known MHC I molecule HLA-B27 (Section 3.3.1) (83). Nogo 66 is a potent neurite outgrowth inhibitor in the CNS (185,194,196) and plays a critical role in the pathogenesis of MS (233,255,369), whereas LAMR1 is a multifunctional protein involved in a wide range of cellular functions such as cell adhesion and migration via binding to laminin 1 (417), suppression of inflammation (437,438) and is exploited by neurotropic pathogens to cross the blood brain barrier (439,440). These results supported the proposal that LILRs including LILRA3 may bind multiple ligands with varying affinities and display diverse functions, a new concept presented in this thesis.

The focus of this thesis was therefore to independently validate the unexpected finding of LILRA3-Nogo 66 interaction, characterise binding affinity and define functions (Chapter 3). Results obtained using several independent methods including SPR, co-immunoprecipitation and a plate-based binding assay confirmed that recombinant LILRA3 binds to recombinant Nogo 66 with high binding affinity and specificity (Section 3.3.3). Furthermore, in-situ staining of primary cortical neurons (Figure 3-8) and quantitative AP binding assay (Figure 3-9) showed that recombinant LILRA3 also binds to native Nogo 66 expressed on primary mouse cortical neurons with high affinity and specificity. Most importantly, the successful co-immunoprecipitation of the native Nogo protein by native LILRA3 produced further confirmation that Nogo 66 is a true high affinity ligand for LILRA3 (Figure 3-11). Nogo 66 is a highly conserved 66 amino acid surface membrane loop at the C- terminus of reticulon proteins including Nogo-A, -B and -C, and is critical for several vital roles of the Nogo proteins (Section 1.4). In Nogo-A, primarily expressed on

186 oligodendrocytes, interaction of the Nogo 66 loop with NgR1 and PIRB on neurons potently inhibits neurite outgrowth and axonal regeneration after CNS injury (Sections 1.4.1.2 and 1.4.1.3). Our results showed for the first time that the high affinity binding of LILRA3 to Nogo 66 is able to counteract Nogo 66-mediated inhibitory effects and promote neurite outgrowth (Section 3.3.6) and synaptic formation (Section 3.3.7) in vitro, indicating a new role of LILRA3 in CNS. Although Nogo 66-PIRB mediated inhibitory signalling pathway remains unclear, evidence presented in chapter 3 indicated that the engagement of Nogo 66 with PIRB may suppress MEK and ERK 1/2 phosphorylation (Section 3.3.8), which is consistent with our current understanding of PIRB-mediated signalling pathway in leukocytes (379). Interestingly, previous studies showed that the ligation of PIRB by MAG (another known inhibitor of neurite outgrowth), suppressed axonal regeneration through the recruitment of SHP-1/2 and subsequently deactivated TrkB leading to suppression of downstream MAPK signalling (187,188). Whether Nogo 66-PIRB mediated suppression of MEK and ERK 1/2 phosphorylation also involves the recruitment of SHP-1/2 requires further investigation. A recent report showed that inhibitory LILRB2, a human orthologue of PIRB that shares 81% amino acid identity with LILRA3 is expressed in human brain (64) and binds Nogo 66 (65). It is therefore possible that LILRA3 competitively blocks inhibition mediated by LILRB2-Nogo 66 interaction in human neurons, akin to its effect on PIRB-Nog 66 interaction in mice. Indeed, our preliminary data showed that LILRA3 significantly reversed the Nogo 66- mediated inhibitory effects and promoted neurite outgrowth in human foetal cortical neurons. Although this result is significant, human foetal cortical neurons cannot fully represent the adult human brain. Lack of primary adult human CNS neurons precludes studies aimed at investigating LILRA3 functions in human. Adult primary neurons differentiated from induced pluripotent stem cells may become readily available in the future, allowing in depth functional studies on the role of LILRA3 and/or LILRB2 in the CNS.

LILRA3 may also block the interaction between Nogo 66 and NgR1 thereby acting as a broad soluble antagonist, however this requires further investigation. Although methodological differences should be accounted for and future concurrent comparative studies are required, the Nogo 66-LILRA3 interaction shown in this study has much higher binding affinity (approximately 200 pM) than the interaction of Nogo 66-PIRB

187

(45-570 nM) (65) or Nogo 66-NgR1 (1.1 nM) (199), which is in line with a typical soluble competitive antagonist with broad functional specificity (Figure 3-21).

In addition to its newly discovered pro-neurite outgrowth functions, LILRA3 has been shown to suppress LPS-mediated inflammatory responses in monocytes (20), however the underlying mechanisms are unknown. Interestingly, Nogo-B that contains the 66 amino acid surface loop is ubiquitously expressed on a variety of cells and inhibits inflammation in vivo (262,441). It is reasonable to suggest that ligation of surface Nogo- B expressed on leukocytes by LILRA3 may trigger inhibitory signals that subsequently suppress inflammation and this may plausibly explain the published data that show Nogo- B-mediated inhibitory effects require surface ligation (442) and data presented in this thesis that LILRA3 displays anti-inflammatory properties (Figure 5-1). If confirmed this suggest a dual neuroregenerative and anti-inflammatory role for LILRA3 through high affinity interaction with the common 66 amino acid loop of Nogo-A or Nogo-B respectively. Moreover, considering the anti-inflammatory function of LAMR1 (417,438) and immunoregulatory functions of HLA-B27 (96,436), the interaction of LILRA3 with these molecules may contribute to its anti-inflammatory/immunoregulatory functions. It is possible that LILRA3 may competitively block the engagement of activating LILRA1 (82) with HLA-B27 on the surface of innate immune cells, thereby preventing transduction of activating signals through LILRA1 and/or disrupt interaction of LAMR1 with extracellular matrix laminin 1 (417), and this in turn may prevent adhesion and migration of leukocytes to sites of inflammation (Figure 5-1). Interestingly, LILRA3 gene and protein in macrophages are strongly upregulated by IL-10, a prototypical anti- inflammatory cytokine and is downregulated by TNF-α, one of the most potent pro- inflammatory cytokines in vitro (35), which may further support the proposed anti- inflammatory functions for LILRA3. These proposals will require thorough systemic studies including comparison of the relative binding affinities of LILRA3 to Nogo 66, LAMR1 and/or HLA-B27 and investigation of their corresponding associated functions. Moreover, determining whether these molecules act as cell/tissue specific ligand(s) or act as co-ligands would be of significant interest in the field. Preliminary evidence presented in chapter 4 of this thesis indicate that LILRA3 protein exists in multiple quaternary forms in vesicles intracellularly but is primarily secreted as monomeric protein. Evidence is also presented that LILRA3 is abundantly

188 present in the nucleus of primary monocytes. These diverse localisations and quaternary structures may contribute to its diverse biological functions. However, detailed future studies of LILRA3 structure including its quaternary forms, post-translational modifications and its secondary, tertiary crystal structures are required in order to gain more insights to the factors that regulate its ability to bind multiple ligands and display diverse functions.

189

Figure 5-1: Schematic illustration of the proposed anti-inflammatory roles of LILRA3 via interactions with its ligands. (A) Proposed mechanisms of LILRA3 and the 66 amino acid loop of Nogo-B (Nogo 66B) suppressing inflammatory responses in immune cells. Ligation of Nogo-B on the surface of inflammatory cells may trigger yet unknown inhibitory signals that counteract excessive activation of cells in response to inflammatory stimuli. (B) LILRA3 may prevent trans-activation signalling by competitively binding to HLA-B27, thereby blocking LILRA1 binding and signalling. (C) LILRA3 may competitively disrupt interaction of LAMR1 on leukocytes with matrix laimin-1 leading to the inhibition of leukocyte adhesion and migration. Collectively these may result to potent LILRA3-mediated anti-inflammatory effects. Mo: monocytes; ECM: extracellular matrix;

190

The potential dual neuroregenerative and anti-inflammatory properties of LILRA3 (Figure 5-1) indicate that it may play a pathophysiological role in CNS diseases that are characterised by neuronal degeneration and excessive inflammation. Of particular interest is its potential role in the pathogenesis of MS. This role is supported by two lines of evidence: firstly two previous genetic studies that found a link between genetic deletion of LILRA3 and increased incidence of MS (127,129), and the characteristic features of unregulated chronic inflammation and neurodegeneration (Section 1.5.4); and secondly, the well-established inhibitory roles of Nogo-A in this disease (233,255,369). It was proposed here that individuals that lack LILRA3 due to 6.7 kbp gene deletion are susceptible to MS (33,114,126). This is an attractive proposal in which the absence of this potentially counter-inflammatory and neuroprotective protein may lead to the development of MS, however two key issues remain unresolved. First, the published data on the genetic link between LILRA3 deletion and MS was inconsistent with more recent publications on European populations (128,132) and a number of genome wide association studies (136-139); second, there was no experimental evidence that indicate the 6.7 kbp deletion of the LILRA3 gene was associated with an actual lack of protein as predicted. Therefore, the aim of chapter 2 was to address these questions by undertaking LILRA3 genotyping on a large North American cohort of patients with MS and correlating the genotyping results with LILRA3 protein.

Results presented in this thesis showed that LILRA3 gene deletion polymorphism was not associated with MS susceptibility in a North American cohort and did not affect the age of disease onset, clinical subtype or disease severity (Section 2.3.2). These findings were contrary to previous studies that reported association between LILRA3 gene deletion and MS susceptibility in German (129) and Spanish (127) populations but consistent with Polish (128) and Finnish (132) studies, which also failed to find a link between LILRA3 deletion and MS susceptibility in their populations. These contradicting results may be as a result of differences in genetic background among the different populations and variable sample sizes. However, a number of multicentre genome-wide association studies that included over 80,000 European patients with MS (136-139) and a meta-analysis in a larger Spanish cohort with MS (359) also failed to reveal LILRA3 gene polymorphism as a risk variant for MS susceptibility. Collective analysis of results from this study together with previous published studies indicated that LILRA3 is likely

191 not a risk gene for MS susceptibility. However, it is possible that presence/absence and levels of LILRA3 protein may contribute to disease onset, clinical outcomes and severity. To address this, LILRA3 protein was measured in healthy subjects with homozygous or heterozygous deletion of the LILRA3 gene and levels compared with individuals with intact gene on both alleles. Results showed for the first time that homozygous LILRA3 gene deletion was associated with total lack of LILRA3 protein, and somewhat surprisingly subjects with heterozygous gene deletion had slightly more LILRA3 protein as compared to subjects that had both alleles intact (Figure 2-2), however, the exact reason for this over compensation is unknown.

Importantly this is the first study to demonstrate that serum LILRA3 protein is significantly upregulated in patients with MS compared with healthy controls (Figure 2- 3). Patients with more severe clinical outcome like PPMS had the highest amount of serum LILRA3 comparing with patients with less severe clinical outcomes including SPMS and RRMS (Figure 2-4). These results are inconsistent with our later correlation studies showing that the elevated LILRA3 level in patients’ sera was positively correlated with higher EDSS (high disease severity) (Figure 2-5). All these results suggest a role of LILRA3 in the clinical-pathological progresses of MS.

The functions of LILRA3 protein in MS are unknown, however, the above clinical association together with in vitro anti-inflammatory functions (20) and its regulation by IL-10 (35,66) may indicate that it has clinically beneficial roles. Consistent with this, there was significant positive correlation between serum LILRA3 level and IL-10, but negative correlation with TNFα (Figure 2-7), and patients that showed clinical improvement over 12 month follow-up showed significantly more LILRA3 compared to patients that had worsening disease severity scores, although the latter should be interpreted with caution due to the small number of patients studied (Figure 2-6). Although detailed prospective studies using a large cohort of patients and concurrent measurements of IL-10 and LILRA3 in serum are required, increase of LILRA3 in patients that show clinical improvement may in part be related to the upregulation of IL- 10 in response to an effective treatment(s). IL-10 is a strong anti-inflammatory cytokine and is involved in a wide range of immune suppressive functions including inhibition of T cells activation, suppression of pro-inflammatory cytokine production and decreasing antigen-presenting capacity in monocytes/macrophages (345,346). Moreover there is a

192 strong pathogenic link between IL-10 and MS, for example, elevated IL-10 mRNA or protein in serum has been associated with disease remission in MS (354-356) and patients that responded to treatment with IFN-β had substantially increased serum IL-10 (347- 349). Interestingly, vitamin D is proposed to downregulate inflammation in MS through upregulation of IL-10 (443,444). We suggest that the IL-10-LILRA3 counter-regulatory feedback mechanism may contribute to suppressing excessive inflammation in patients with MS. Thus in patients that lack LILRA3 gene/protein, deficiency of this negative feedback loop may result in poorer clinical outcome compared to patients with intact LILRA3 gene and high levels of protein. This may in part explain the clinical heterogeneity of this disease and variable responses to treatment(s).

To date, the reported primary sources of LILRA3 are peripheral blood monocytes (35). Here is the demonstration that LILRA3 mRNA and protein are constitutively expressed in primary human cortical neurons derived from foetal tissue and adult brain tissue (Section 3.3.9). Importantly, we showed that LILRA3 mRNA in primary human neurons was regulated by mediators that are shown to reduce inflammation and improve clinical outcomes in MS, including IL-10, INF-β and vitamin D (Section 3.3.9) (Figure 5-1), suggesting that LILRA3 may have direct neuroprotective properties in neurons. In addition to anti-inflammatory function, previous studies also showed that IL-10 provides direct neuroprotective effects in rat spinal cord neurons (445) and rat cortical neurons (446) through binding IL-10 receptor and subsequently activating Stat3 and PI3K-AKT pathways. This study is the first report to show response to IL-10 by primary human cortical neurons, therefore it is intriguing to investigate whether the neuroprotective effect of IL-10 may in part be via its ability to upregulate LILRA3. Studying the exact functions of neuron-derived LILRA3 such as the consequences of its overexpression or genetic deletion (silencing) in the survival and growth of primary human cortical neurons under physiological and inflammatory conditions is imperative in order to fully understand its function in the CNS.

An important and potentially clinically relevant finding in this project was that serum LILRA3 level was one of the strongest positive indicators of disease severity in MS compared to sex, age of disease onset, age at the time of blood collection and recent disease recurrence (Table 2-5), thus this simple non-invasive assay of measuring serum LILRA3 levels might potentially be used as a biomarker for disease severity. Despite

193 substantial efforts during the last decades, the establishment of effective biomarkers to predict disease severity and clinical outcomes of MS has proven extremely difficult due to the clinical-pathological complexities of this disease (295,296,344). Currently, detection of gadolinium-enhancing lesion using MRI and presence of oligocloncal IgG bands in CSF are the most common biomarkers used by clinicians for disease diagnosis, assessing the disease progression and disease activity in MS patients (295,296,344). However, these measurements are not specific for disease severity, expansive in terms of cost of analysis (MRI) and invasive (taking of CSF). Many other potential biomarkers have been identified in CSF such as neurofilaments (447-449), Nogo-A (252) and autoantibodies to major component of the axonal cytoskeleton including tubulin and tau (450,451) that are shown to correlate with neurodegeneration and disease progression, but the invasiveness of CSF collection is not ideal for multiple measurements and lack of validation in a large cohort and blinded longitudinal studies hinder the translation process into practical clinical biomarkers. Moreover, many other potential biomarkers have been identified in human serum (344), for example, a recent multicentre study found a linear correlation between serum lactate levels and EDSS (452), differential expression levels of circulating miRNAs are also linked to disease EDSS and disease duration (453). However, the majority of these suggested serum biomarkers are only correlative, lack specificity and are missing functional annotation. In contrast, knowing LILRA3 likely possesses both anti-inflammatory and neuroregenerative properties in MS, it is not surprising that serum LILRA3 level can be used as a potential biomarker to predict disease severity. Future studies of serum LILRA3 level in a large cohort and blinded longitudinal studies as well as correlation with other objective biomarkers such as MRI imaging, oligocloncal IgG bands will further validate the reliability of LILRA3 as a clinical biomarker for disease severity. Considering the elevated LILRA3 in serum is also associated with more severe rheumatoid arthritis (35), LILRA3 may be used as an additional objective biomarker complementing other known markers for predicting disease severity and clinical assessments.

Although results in this thesis are novel, a lack of in vivo studies to further validate the functions of LILRA3 is a limitation of this study. This is because LILRs are only present in humans and primates, thus there are no LILRs homologs in rodents that can preclude functional studies using rodent disease models in vivo. However, this study

194 demonstrates for the first time that human LILRA3 protein can promote neurite outgrowth in mouse and human cortical neurons, suggesting cross-species functions of LILRA3 in mice and man. This is owing to the high homology of its ligand Nogo 66 between mouse and human (196). This property would allow more thorough investigation of LILR functions using an unlimited source of cultured primary mouse neurons, and provide opportunities to explore in vivo LILRA3 functions such as the use of tissue-specific transgenic expression of human LILRA3 in rodents to investigate its role in CNS.

Although several different models of MS have been developed, experimental autoimmune encephalomyelitis (EAE) is by far the best understood and most commonly used rodent model of MS and it has been proved to be an extremely useful model to study potential treatments for MS (454). Recently, blocking Nogo-A mediated inhibitory effects by specific anti-Nogo-A antibody, or siRNA or blocking NgR and its downstream signalling were shown to promote axonal regeneration and functional recovery in EAE mice (253,254,256). Future studies including brain-specific transgenic expression of human LILRA3 in the EAE model or injection of soluble LILRA3 into EAE mice may provide more insight of LILRA3 functions in MS and the potential of using LILRA3 as a treatment for MS.

In conclusion, this project confirmed Nogo 66 is a new high affinity functional ligand for LILRA3. Most importantly, LILRA3 can reverse Nogo 66-mediated inhibitory effects and promote neurite outgrowth and synapse formation in primary CNS neurons. Clinically, although there was no link between the genetic deletion of LILRA3 and MS susceptibility, there was strong correlation between LILRA3 levels in sera of patients with MS and disease severity. Importantly, LILRA3 level is an independent predictor of disease severity. The dual anti-inflammatory and pro-neurite outgrowth functions of LILRA3 may have a key role in the pathogenesis of MS and may have clinical importance as a potential marker of disease severity and as a therapeutic agent.

195

CHAPTER 6: REFERENCES

1. Arm, J. P., Nwankwo, C., and Austen, K. F. (1997) Molecular identification of a novel family of human Ig superfamily members that possess immunoreceptor tyrosine-based inhibition motifs and homology to the mouse gp49B1 inhibitory receptor. Journal of Immunology 159, 2342-2349 2. Cosman, D., Fanger, N., Borges, L., Kubin, M., Chin, W., Peterson, L., and Hsu, M. L. (1997) A novel immunoglobulin superfamily receptor for cellular and viral MHC class I molecules. Immunity 7, 273-282 3. Wagtmann, N., Rojo, S., Eichler, E., Mohrenweiser, H., and Long, E. O. (1997) A new human gene complex encoding the killer cell inhibitory receptors and related monocyte/macrophage receptors. Current Biology 7, 615-618 4. Samaridis, J., and Colonna, M. (1997) Cloning of novel immunoglobulin superfamily receptors expressed on human myeloid and lymphoid cells: structural evidence for new stimulatory and inhibitory pathways. Eur J Immunol 27, 660- 665 5. Borges, L., Hsu, M. L., Fanger, N., Kubin, M., and Cosman, D. (1997) A family of human lymphoid and myeloid Ig-like receptors, some of which bind to MHC class I molecules. J Immunol 159, 5192-5196 6. Colonna, M., Navarro, F., Bellon, T., Llano, M., Garcia, P., Samaridis, J., Angman, L., Cella, M., and Lopez-Botet, M. (1997) A common inhibitory receptor for major histocompatibility complex class I molecules on human lymphoid and myelomonocytic cells. J Exp Med 186, 1809-1818 7. Anderson, K. J., and Allen, R. L. (2009) Regulation of T-cell immunity by leucocyte immunoglobulin-like receptors: innate immune receptors for self on antigen-presenting cells. Immunology 127, 8-17 8. Brown, D., Trowsdale, J., and Allen, R. (2004) The LILR family: modulators of innate and adaptive immune pathways in health and disease. Tissue Antigens 64, 215-225 9. Borges, L., and Cosman, D. (2000) LIRs/ILTs/MIRs, inhibitory and stimulatory Ig-superfamily receptors expressed in myeloid and lymphoid cells. Cytokine Growth Factor Rev 11, 209-217 10. Willcox, B. E., Thomas, L. M., and Bjorkman, P. J. (2003) Crystal structure of HLA-A2 bound to LIR-1, a host and viral major histocompatibility complex receptor. Nat Immunol 4, 913-919 11. Fanger, N. A., Cosman, D., Peterson, L., Braddy, S. C., Maliszewski, C. R., and Borges, L. (1998) The MHC class I binding proteins LIR-1 and LIR-2 inhibit Fc receptor-mediated signaling in monocytes. Eur J Immunol 28, 3423-3434 12. Shiroishi, M., Tsumoto, K., Amano, K., Shirakihara, Y., Colonna, M., Braud, V. M., Allan, D. S., Makadzange, A., Rowland-Jones, S., Willcox, B., Jones, E. Y., van der Merwe, P. A., Kumagai, I., and Maenaka, K. (2003) Human inhibitory receptors Ig-like transcript 2 (ILT2) and ILT4 compete with CD8 for MHC class I binding and bind preferentially to HLA-G. Proc Natl Acad Sci U S A 100, 8856- 8861 13. Ryu, M., Chen, Y., Qi, J., Liu, J., Fan, Z., Nam, G., Shi, Y., Cheng, H., and Gao, G. F. (2011) LILRA3 binds both classical and non-classical HLA class I molecules but with reduced affinities compared to LILRB1/LILRB2: structural evidence. PLoS One 6, e19245 196

14. Shiroishi, M., Kajikawa, M., Kuroki, K., Ose, T., Kohda, D., and Maenaka, K. (2006) Crystal structure of the human monocyte-activating receptor, "Group 2" leukocyte Ig-like receptor A5 (LILRA5/LIR9/ILT11). J Biol Chem 281, 19536- 19544 15. Cheng, H., Mohammed, F., Nam, G., Chen, Y., Qi, J., Garner, L. I., Allen, R. L., Yan, J., Willcox, B. E., and Gao, G. F. (2011) Crystal structure of leukocyte Ig- like receptor LILRB4 (ILT3/LIR-5/CD85k): a myeloid inhibitory receptor involved in immune tolerance. J Biol Chem 286, 18013-18025 16. Shental-Bechor, D., and Levy, Y. (2008) Effect of glycosylation on protein folding: A close look at thermodynamic stabilization. Proceedings of the National Academy of Sciences 105, 8256-8261 17. Bloem, K., Vuist, I. M., van der Plas, A. J., Knippels, L. M., Garssen, J., Garcia- Vallejo, J. J., van Vliet, S. J., and van Kooyk, Y. (2013) Ligand binding and signaling of dendritic cell immunoreceptor (DCIR) is modulated by the glycosylation of the carbohydrate recognition domain. PLoS One 8, e66266 18. Margraf-Schonfeld, S., Bohm, C., and Watzl, C. (2011) Glycosylation affects ligand binding and function of the activating natural killer cell receptor 2B4 (CD244) protein. J Biol Chem 286, 24142-24149 19. Fanger, N. A., Borges, L., and Cosman, D. (1999) The leukocyte immunoglobulin-like receptors (LIRs): a new family of immune regulators. J Leukoc Biol 66, 231-236 20. Lee, T. H., Mitchell, A., Liu Lau, S., An, H., Rajeaskariah, P., Wasinger, V., Raftery, M., Bryant, K., and Tedla, N. (2013) Glycosylation in a mammalian expression system is critical for the production of functionally active leukocyte immunoglobulin-like receptor A3 protein. J Biol Chem 288, 32873-32885 21. Parodi, A. J. (2000) Role of N-oligosaccharide endoplasmic reticulum processing reactions in glycoprotein folding and degradation. Biochem J 348 Pt 1, 1-13 22. Chen, Y., Gao, F., Chu, F., Peng, H., Zong, L., Liu, Y., Tien, P., and Gao, G. F. (2009) Crystal structure of myeloid cell activating receptor leukocyte Ig-like receptor A2 (LILRA2/ILT1/LIR-7) domain swapped dimer: molecular basis for its non-binding to MHC complexes. Journal of molecular biology 386, 841-853 23. Nam, G., Shi, Y., Ryu, M., Wang, Q., Song, H., Liu, J., Yan, J., Qi, J., and Gao, G. F. (2013) Crystal structures of the two membrane-proximal Ig-like domains (D3D4) of LILRB1/B2: alternative models for their involvement in peptide-HLA binding. Protein & cell 4, 761-770 24. Yang, Z., and Bjorkman, P. J. (2008) Structure of UL18, a peptide-binding viral MHC mimic, bound to a host inhibitory receptor. Proceedings of the National Academy of Sciences 105, 10095-10100 25. Shiroishi, M., Kuroki, K., Rasubala, L., Tsumoto, K., Kumagai, I., Kurimoto, E., Kato, K., Kohda, D., and Maenaka, K. (2006) Structural basis for recognition of the nonclassical MHC molecule HLA-G by the leukocyte Ig-like receptor B2 (LILRB2/LIR2/ILT4/CD85d). Proc Natl Acad Sci U S A 103, 16412-16417 26. Hamerman, J. A., Ni, M., Killebrew, J. R., Chu, C. L., and Lowell, C. A. (2009) The expanding roles of ITAM adapters FcRgamma and DAP12 in myeloid cells. Immunol Rev 232, 42-58 27. Nakajima, H., Samaridis, J., Angman, L., and Colonna, M. (1999) Human myeloid cells express an activating ILT receptor (ILT1) that associates with Fc receptor gamma-chain. J Immunol 162, 5-8

197

28. Cao, W., Rosen, D. B., Ito, T., Bover, L., Bao, M., Watanabe, G., Yao, Z., Zhang, L., Lanier, L. L., and Liu, Y. J. (2006) Plasmacytoid dendritic cell-specific receptor ILT7-Fc epsilonRI gamma inhibits Toll-like receptor-induced interferon production. J Exp Med 203, 1399-1405 29. Mitchell, A., Rentero, C., Endoh, Y., Hsu, K., Gaus, K., Geczy, C., McNeil, H. P., Borges, L., and Tedla, N. (2008) LILRA5 is expressed by synovial tissue macrophages in rheumatoid arthritis, selectively induces pro-inflammatory cytokines and IL-10 and is regulated by TNF-alpha, IL-10 and IFN-gamma. Eur J Immunol 38, 3459-3473 30. Colonna, M., Nakajima, H., Navarro, F., and Lopez-Botet, M. (1999) A novel family of Ig-like receptors for HLA class I molecules that modulate function of lymphoid and myeloid cells. [Review] [61 refs]. Journal of Leukocyte Biology 66, 375-381 31. Ju, X. S., Hacker, C., Scherer, B., Redecke, V., Berger, T., Schuler, G., Wagner, H., Lipford, G. B., and Zenke, M. (2004) Immunoglobulin-like transcripts ILT2, ILT3 and ILT7 are expressed by human dendritic cells and down-regulated following activation. Gene 331, 159-164 32. Bellon, T., Kitzig, F., Sayos, J., and Lopez-Botet, M. (2002) Mutational analysis of immunoreceptor tyrosine-based inhibition motifs of the Ig-like transcript 2 (CD85j) leukocyte receptor. J Immunol 168, 3351-3359 33. Torkar, M., Haude, A., Milne, S., Beck, S., Trowsdale, J., and Wilson, M. J. (2000) Arrangement of the ILT gene cluster: a common null allele of the ILT6 gene results from a 6.7-kbp deletion. European Journal of Immunology 30, 3655- 3662 34. Norman, P. J., Carey, B. S., Stephens, H. A., and Vaughan, R. W. (2003) DNA sequence variation and molecular genotyping of natural killer leukocyte immunoglobulin-like receptor, LILRA3. Immunogenetics 55, 165-171 35. An, H., Chandra, V., Piraino, B., Borges, L., Geczy, C., McNeil, H. P., Bryant, K., and Tedla, N. (2010) Soluble LILRA3, a potential natural antiinflammatory protein, is increased in patients with rheumatoid arthritis and is tightly regulated by interleukin 10, tumor necrosis factor-alpha, and interferon-gamma. J Rheumatol 37, 1596-1606 36. Jones, D. C., Roghanian, A., Brown, D. P., Chang, C., Allen, R. L., Trowsdale, J., and Young, N. T. (2009) Alternative mRNA splicing creates transcripts encoding soluble proteins from most LILR genes. Eur J Immunol 39, 3195-3206 37. Suciu-Foca, N., Feirt, N., Zhang, Q. Y., Vlad, G., Liu, Z., Lin, H., Chang, C. C., Ho, E. K., Colovai, A. I., Kaufman, H., D'Agati, V. D., Thaker, H. M., Remotti, H., Galluzzo, S., Cinti, P., Rabitti, C., Allendorf, J., Chabot, J., Caricato, M., Coppola, R., Berloco, P., and Cortesini, R. (2007) Soluble Ig-like transcript 3 inhibits tumor allograft rejection in humanized SCID mice and T cell responses in cancer patients. J Immunol 178, 7432-7441 38. Beinhauer, B. G., McBride, J. M., Graf, P., Pursch, E., Bongers, M., Rogy, M., Korthauer, U., de Vries, J. E., Aversa, G., and Jung, T. (2004) Interleukin 10 regulates cell surface and soluble LIR-2 (CD85d) expression on dendritic cells resulting in T cell hyporesponsiveness in vitro. European Journal of Immunology 34, 74-80 39. Nimmerjahn, F., and Ravetch, J. V. (2008) Fc[gamma] receptors as regulators of immune responses. Nat Rev Immunol 8, 34-47

198

40. Boggon, T. J., and Eck, M. J. (2004) Structure and regulation of Src family kinases. Oncogene 23, 7918-7927 41. Sada, K., Takano, T., Yanagi, S., and Yamamura, H. (2001) Structure and function of Syk protein-tyrosine kinase. Journal of biochemistry 130, 177-186 42. Takai, T. (2002) Roles of Fc receptors in autoimmunity. Nat Rev Immunol 2, 580- 592 43. Samelson, L. E. (2002) Signal transduction mediated by the T cell antigen receptor: the role of adapter proteins. Annual review of immunology 20, 371-394 44. Brivanlou, A. H., and Darnell, J. E., Jr. (2002) Signal transduction and the control of gene expression. Science 295, 813-818 45. Binstadt, B. A., Brumbaugh, K. M., Dick, C. J., Scharenberg, A. M., Williams, B. L., Colonna, M., Lanier, L. L., Kinet, J. P., Abraham, R. T., and Leibson, P. J. (1996) Sequential involvement of Lck and SHP-1 with MHC-recognizing receptors on NK cells inhibits FcR-initiated tyrosine kinase activation. Immunity 5, 629-638 46. Kane, B. A., Bryant, K. J., McNeil, H. P., and Tedla, N. T. (2014) Termination of Immune Activation: An Essential Component of Healthy Host Immune Responses. Journal of Innate Immunity 6, 727-738 47. Lu, H. K., Mitchell, A., Endoh, Y., Hampartzoumian, T., Huynh, O., Borges, L., Geczy, C., Bryant, K., and Tedla, N. (2012) LILRA2 selectively modulates LPS- mediated cytokine production and inhibits phagocytosis by monocytes. PLoS One 7, e33478 48. Lee, D. J., Sieling, P. A., Ochoa, M. T., Krutzik, S. R., Guo, B., Hernandez, M., Rea, T. H., Cheng, G., Colonna, M., and Modlin, R. L. (2007) LILRA2 activation inhibits dendritic cell differentiation and antigen presentation to T cells. J Immunol 179, 8128-8136 49. Cao, W., Bover, L., Cho, M., Wen, X., Hanabuchi, S., Bao, M., Rosen, D. B., Wang, Y. H., Shaw, J. L., Du, Q., Li, C., Arai, N., Yao, Z., Lanier, L. L., and Liu, Y. J. (2009) Regulation of TLR7/9 responses in plasmacytoid dendritic cells by BST2 and ILT7 receptor interaction. J Exp Med 206, 1603-1614 50. van Egmond, M., Damen, C. A., van Spriel, A. B., Vidarsson, G., van Garderen, E., and van de Winkel, J. G. (2001) IgA and the IgA Fc receptor. Trends Immunol 22, 205-211 51. Pasquier, B., Launay, P., Kanamaru, Y., Moura, I. C., Pfirsch, S., Ruffie, C., Henin, D., Benhamou, M., Pretolani, M., Blank, U., and Monteiro, R. C. (2005) Identification of FcalphaRI as an inhibitory receptor that controls inflammation: dual role of FcRgamma ITAM. Immunity 22, 31-42 52. Barrow, A. D., Astoul, E., Floto, A., Brooke, G., Relou, I. A., Jennings, N. S., Smith, K. G., Ouwehand, W., Farndale, R. W., Alexander, D. R., and Trowsdale, J. (2004) Cutting edge: TREM-like transcript-1, a platelet immunoreceptor tyrosine-based inhibition motif encoding costimulatory immunoreceptor that enhances, rather than inhibits, calcium signaling via SHP-2. J Immunol 172, 5838- 5842 53. Alblas, J., Honing, H., de Lavalette, C. R., Brown, M. H., Dijkstra, C. D., and van den Berg, T. K. (2005) Signal regulatory protein alpha ligation induces macrophage nitric oxide production through JAK/STAT- and phosphatidylinositol 3-kinase/Rac1/NAPDH oxidase/H2O2-dependent pathways. Molecular and cellular biology 25, 7181-7192

199

54. Munitz, A., McBride, M. L., Bernstein, J. S., and Rothenberg, M. E. (2008) A dual activation and inhibition role for the paired immunoglobulin-like receptor B in eosinophils. Blood 111, 5694-5703 55. Motoda, K., Takata, M., Kiura, K., Nakamura, I., and Harada, M. (2000) SHP- 1/immunoreceptor tyrosine-based inhibition motif-independent inhibitory signalling through murine natural killer cell receptor Ly-49A in a transfected B- cell line. Immunology 100, 370-377 56. Chemnitz, J. M., Parry, R. V., Nichols, K. E., June, C. H., and Riley, J. L. (2004) SHP-1 and SHP-2 associate with immunoreceptor tyrosine-based switch motif of programmed death 1 upon primary human T cell stimulation, but only receptor ligation prevents T cell activation. J Immunol 173, 945-954 57. Weng, Z., Thomas, S. M., Rickles, R. J., Taylor, J. A., Brauer, A. W., Seidel- Dugan, C., Michael, W. M., Dreyfuss, G., and Brugge, J. S. (1994) Identification of Src, Fyn, and Lyn SH3-binding proteins: implications for a function of SH3 domains. Molecular and cellular biology 14, 4509-4521 58. Buday, L. (1999) Membrane-targeting of signalling molecules by SH2/SH3 domain-containing adaptor proteins. Biochim Biophys Acta 1422, 187-204 59. Tedla, N., Lee, C. W., Borges, L., Geczy, C. L., and Arm, J. P. (2008) Differential expression of leukocyte immunoglobulin-like receptors on cord-blood-derived human mast cell progenitors and mature mast cells. J Leukoc Biol 83, 334-343 60. Huynh, O. A., Hampartzoumian, T., Arm, J. P., Hunt, J., Borges, L., Ahern, M., Smith, M., Geczy, C. L., McNeil, H. P., and Tedla, N. (2007) Down-regulation of leucocyte immunoglobulin-like receptor expression in the synovium of rheumatoid arthritis patients after treatment with disease-modifying anti- rheumatic drugs. Rheumatology (Oxford) 46, 742-751 61. Sloane, D. E., Tedla, N., Awoniyi, M., Macglashan, D. W., Jr., Borges, L., Austen, K. F., and Arm, J. P. (2004) Leukocyte immunoglobulin-like receptors: novel innate receptors for human basophil activation and inhibition. Blood 104, 2832- 2839 62. Merlo, A., Saverino, D., Tenca, C., Grossi, C. E., Bruno, S., and Ciccone, E. (2001) CD85/LIR-1/ILT2 and CD152 (cytotoxic T lymphocyte antigen 4) inhibitory molecules down-regulate the cytolytic activity of human CD4+ T-cell clones specific for Mycobacterium tuberculosis. Infect Immun 69, 6022-6029 63. Vitale, M., Castriconi, R., Parolini, S., Pende, D., Hsu, M. L., Moretta, L., Cosman, D., and Moretta, A. (1999) The leukocyte Ig-like receptor (LIR)-1 for the cytomegalovirus UL18 protein displays a broad specificity for different HLA class I alleles: analysis of LIR-1 + NK cell clones. International immunology 11, 29-35 64. Kim, T., Vidal, G. S., Djurisic, M., William, C. M., Birnbaum, M. E., Garcia, K. C., Hyman, B. T., and Shatz, C. J. (2013) Human LilrB2 is a beta-amyloid receptor and its murine homolog PirB regulates synaptic plasticity in an Alzheimer's model. Science 341, 1399-1404 65. Atwal, J. K., Pinkston-Gosse, J., Syken, J., Stawicki, S., Wu, Y., Shatz, C., and Tessier-Lavigne, M. (2008) PirB is a functional receptor for myelin inhibitors of axonal regeneration. Science 322, 967-970 66. Jung, M., Sabat, R., Krätzschmar, J., Seidel, H., Wolk, K., Schönbein, C., Schütt, S., Friedrich, M., Döcke, W.-D., Asadullah, K., Volk, H.-D., and Grütz, G. (2004) Expression profiling of IL-10-regulated genes in human monocytes and peripheral

200

blood mononuclear cells from psoriatic patients during IL-10 therapy. European Journal of Immunology 34, 481-493 67. Talwar, S., Munson, P. J., Barb, J., Fiuza, C., Cintron, A. P., Logun, C., Tropea, M., Khan, S., Reda, D., Shelhamer, J. H., Danner, R. L., and Suffredini, A. F. (2006) Gene expression profiles of peripheral blood leukocytes after endotoxin challenge in humans. 25, 203-215 68. Cella, M., Dohring, C., Samaridis, J., Dessing, M., Brockhaus, M., Lanzavecchia, A., and Colonna, M. (1997) A novel inhibitory receptor (ILT3) expressed on monocytes, macrophages, and dendritic cells involved in antigen processing. J Exp Med 185, 1743-1751 69. Colonna, M., Samaridis, J., Cella, M., Angman, L., Allen, R. L., O'Callaghan, C. A., Dunbar, R., Ogg, G. S., Cerundolo, V., and Rolink, A. (1998) Human myelomonocytic cells express an inhibitory receptor for classical and nonclassical MHC class I molecules. J Immunol 160, 3096-3100 70. Zhang, Z., Hatano, H., Shaw, J., Olde Nordkamp, M., Jiang, G., Li, D., and Kollnberger, S. (2015) The Leukocyte Immunoglobulin-Like Receptor Family Member LILRB5 Binds to HLA-Class I Heavy Chains. PLoS One 10, e0129063 71. Bashirova, A. A., Apps, R., Vince, N., Mochalova, Y., Yu, X. G., and Carrington, M. (2014) Diversity of the human LILRB3/A6 locus encoding a myeloid inhibitory and activating receptor pair. Immunogenetics 66, 1-8 72. Borges, L., Kubin, M., and Kuhlman, T. (2003) LIR9, an immunoglobulin- superfamily-activating receptor, is expressed as a transmembrane and as a secreted molecule. Blood 101, 1484-1486 73. Cho, M., Ishida, K., Chen, J., Ohkawa, J., Chen, W., Namiki, S., Kotaki, A., Arai, N., Arai, K., and Kamogawa-Schifter, Y. (2008) SAGE library screening reveals ILT7 as a specific plasmacytoid dendritic cell marker that regulates type I IFN production. International immunology 20, 155-164 74. Bankey, P. E., Banerjee, S., Zucchiatti, A., De, M., Sleem, R. W., Lin, C.-F. L., Miller-Graziano, C. L., and De, A. K. (2010) Cytokine induced expression of programmed death ligands in human neutrophils. Immunology Letters 129, 100- 107 75. Tedla, N., Bandeira-Melo, C., Tassinari, P., Sloane, D. E., Samplaski, M., Cosman, D., Borges, L., Weller, P. F., and Arm, J. P. (2003) Activation of human eosinophils through leukocyte immunoglobulin-like receptor 7. Proc Natl Acad Sci U S A 100, 1174-1179 76. Mori, Y., Tsuji, S., Inui, M., Sakamoto, Y., Endo, S., Ito, Y., Fujimura, S., Koga, T., Nakamura, A., Takayanagi, H., Itoi, E., and Takai, T. (2008) Inhibitory Immunoglobulin-Like Receptors LILRB and PIR-B Negatively Regulate Osteoclast Development. The Journal of Immunology 181, 4742-4751 77. McIntire, R. H., Sifers, T., Platt, J. S., Ganacias, K. G., Langat, D. K., and Hunt, J. S. (2008) Novel HLA-G-binding leukocyte immunoglobulin-like receptor (LILR) expression patterns in human placentas and umbilical cords. Placenta 29, 631-638 78. Burshtyn, D. N., and Morcos, C. (2016) The Expanding Spectrum of Ligands for Leukocyte Ig-like Receptors. The Journal of Immunology 196, 947-955 79. Benacerraf, B. (1981) Role of MHC gene products in immune regulation. Science 212, 1229-1238 80. Nagaraju, K. (2005) Role of major histocompatibility complex class I molecules in autoimmune myositis. Curr Opin Rheumatol 17, 725-730 201

81. Chapman, T. L., Heikeman, A. P., and Bjorkman, P. J. (1999) The inhibitory receptor LIR-1 uses a common binding interaction to recognize class I MHC molecules and the viral homolog UL18. Immunity 11, 603-613 82. Allen, R. L., Raine, T., Haude, A., Trowsdale, J., and Wilson, M. J. (2001) Leukocyte receptor complex-encoded immunomodulatory receptors show differing specificity for alternative HLA-B27 structures. J Immunol 167, 5543- 5547 83. Jones, D. C., Kosmoliaptsis, V., Apps, R., Lapaque, N., Smith, I., Kono, A., Chang, C., Boyle, L. H., Taylor, C. J., Trowsdale, J., and Allen, R. L. (2011) HLA class I allelic sequence and conformation regulate leukocyte Ig-like receptor binding. J Immunol 186, 2990-2997 84. Tavano, B., Galao, R. P., Graham, D. R., Neil, S. J., Aquino, V. N., Fuchs, D., and Boasso, A. (2013) Ig-like transcript 7, but not bone marrow stromal cell antigen 2 (also known as HM1.24, tetherin, or CD317), modulates plasmacytoid dendritic cell function in primary human blood leukocytes. J Immunol 190, 2622- 2630 85. Lepin, E. J., Bastin, J. M., Allan, D. S., Roncador, G., Braud, V. M., Mason, D. Y., van der Merwe, P. A., McMichael, A. J., Bell, J. I., Powis, S. H., and O'Callaghan, C. A. (2000) Functional characterization of HLA-F and binding of HLA-F tetramers to ILT2 and ILT4 receptors. Eur J Immunol 30, 3552-3561 86. Nakayama, M., Underhill, D. M., Petersen, T. W., Li, B., Kitamura, T., Takai, T., and Aderem, A. (2007) Paired Ig-like receptors bind to bacteria and shape TLR- mediated cytokine production. Journal of Immunology 178, 4250-4259 87. Giles, J., Shaw, J., Piper, C., Wong-Baeza, I., McHugh, K., Ridley, A., Li, D., Lenart, I., Antoniou, A. N., DiGleria, K., Kuroki, K., Maenaka, K., Bowness, P., and Kollnberger, S. (2012) HLA-B27 Homodimers and Free H Chains Are Stronger Ligands for Leukocyte Ig-like Receptor B2 than Classical HLA Class I. The Journal of Immunology 188, 6184-6193 88. Lichterfeld, M., and Yu, X. G. (2012) The emerging role of leukocyte immunoglobulin-like receptors (LILRs) in HIV-1 infection. Journal of Leukocyte Biology 91, 27-33 89. Li, D., Wang, L., Yu, L., Freundt, E. C., Jin, B., Screaton, G. R., and Xu, X. N. (2009) Ig-like transcript 4 inhibits lipid antigen presentation through direct CD1d interaction. J Immunol 182, 1033-1040 90. Zheng, J., Umikawa, M., Cui, C., Li, J., Chen, X., Zhang, C., Hyunh, H., Kang, X., Silvany, R., Wan, X., Ye, J., Canto, A. P., Chen, S.-H., Wang, H.-Y., Ward, E. S., and Zhang, C. C. (2012) Inhibitory receptors bind ANGPTLs and support blood stem cells and leukaemia development. Nature 485, 656-660 91. Wang, L., Geng, T., Guo, X., Liu, J., Zhang, P., Yang, D., Li, J., Yu, S., and Sun, Y. (2015) Co-expression of immunoglobulin-like transcript 4 and angiopoietin- like proteins in human non-small cell lung cancer. Molecular medicine reports 11, 2789-2796 92. Pangault, C., Le Friec, G., Caulet-Maugendre, S., Lena, H., Amiot, L., Guilloux, V., Onno, M., and Fauchet, R. (2002) Lung macrophages and dendritic cells express HLA-G molecules in pulmonary diseases. Hum Immunol 63, 83-90 93. Lefebvre, S., Antoine, M., Uzan, S., McMaster, M., Dausset, J., Carosella, E. D., and Paul, P. (2002) Specific activation of the non-classical class I histocompatibility HLA-G antigen and expression of the ILT2 inhibitory receptor in human breast cancer. J Pathol 196, 266-274 202

94. LeMaoult, J., Zafaranloo, K., Le Danff, C., and Carosella, E. D. (2005) HLA-G up-regulates ILT2, ILT3, ILT4, and KIR2DL4 in antigen presenting cells, NK cells, and T cells. FASEB Journal 19, 662-664 95. Willcox, B. E., Thomas, L. M., Chapman, T. L., Heikema, A. P., West, A. P., Jr., and Bjorkman, P. J. (2002) Crystal structure of LIR-2 (ILT4) at 1.8 A: differences from LIR-1 (ILT2) in regions implicated in the binding of the Human Cytomegalovirus class I MHC homolog UL18. BMC Struct Biol 2, 6 96. Robinson, P. C., and Brown, M. A. (2012) The genetics of ankylosing spondylitis and axial spondyloarthritis. Rheumatic diseases clinics of North America 38, 539- 553 97. Low, H. Z., Reuter, S., Topperwien, M., Dankenbrink, N., Peest, D., Kabalak, G., Stripecke, R., Schmidt, R. E., Matthias, T., and Witte, T. (2013) Association of the LILRA3 deletion with B-NHL and functional characterization of the immunostimulatory molecule. PLoS One 8, e81360 98. Dietrich, J., Cella, M., and Colonna, M. (2001) Ig-like transcript 2 (ILT2)/leukocyte Ig-like receptor 1 (LIR1) inhibits TCR signaling and actin cytoskeleton reorganization. J Immunol 166, 2514-2521 99. Saverino, D., Fabbi, M., Ghiotto, F., Merlo, A., Bruno, S., Zarcone, D., Tenca, C., Tiso, M., Santoro, G., Anastasi, G., Cosman, D., Grossi, C. E., and Ciccone, E. (2000) The CD85/LIR-1/ILT2 inhibitory receptor is expressed by all human T lymphocytes and down-regulates their functions. J Immunol 165, 3742-3755 100. Saverino, D., Merlo, A., Bruno, S., Pistoia, V., Grossi, C. E., and Ciccone, E. (2002) Dual effect of CD85/leukocyte Ig-like receptor-1/Ig-like transcript 2 and CD152 (CTLA-4) on cytokine production by antigen-stimulated human T cells. J Immunol 168, 207-215 101. Merlo, A., Tenca, C., Fais, F., Battini, L., Ciccone, E., Grossi, C. E., and Saverino, D. (2005) Inhibitory receptors CD85j, LAIR-1, and CD152 down-regulate immunoglobulin and cytokine production by human B lymphocytes. Clin Diagn Lab Immunol 12, 705-712 102. Chang, C. C., Ciubotariu, R., Manavalan, J. S., Yuan, J., Colovai, A. I., Piazza, F., Lederman, S., Colonna, M., Cortesini, R., Dalla-Favera, R., and Suciu-Foca, N. (2002) Tolerization of dendritic cells by T(S) cells: the crucial role of inhibitory receptors ILT3 and ILT4. Nat Immunol 3, 237-243 103. Lu, H. K., Rentero, C., Raftery, M. J., Borges, L., Bryant, K., and Tedla, N. (2009) Leukocyte Ig-like receptor B4 (LILRB4) is a potent inhibitor of FcgammaRI- mediated monocyte activation via dephosphorylation of multiple kinases. J Biol Chem 284, 34839-34848 104. Wende, H., Colonna, M., Ziegler, A., and Volz, A. (1999) Organization of the leukocyte receptor cluster (LRC) on human Chromosome 19q13.4. Mammalian Genome 10, 154-160 105. Barrow, A. D., and Trowsdale, J. (2008) The extended human leukocyte receptor complex: diverse ways of modulating immune responses. Immunol Rev 224, 98- 123 106. Volz, A., Wende, H., Laun, K., and Ziegler, A. (2001) Genesis of the ILT/LIR/MIR clusters within the human leukocyte receptor complex. Immunol Rev 181, 39-51 107. Hirayasu, K., and Arase, H. (2015) Functional and genetic diversity of leukocyte immunoglobulin-like receptor and implication for disease associations. J Hum Genet 203

108. Seo, T.-K., and Kishino, H. (2008) Synonymous Substitutions Substantially Improve Evolutionary Inference from Highly Diverged Proteins. Systematic Biology 57, 367-377 109. Kuroki, K., Tsuchiya, N., Shiroishi, M., Rasubala, L., Yamashita, Y., Matsuta, K., Fukazawa, T., Kusaoi, M., Murakami, Y., Takiguchi, M., Juji, T., Hashimoto, H., Kohda, D., Maenaka, K., and Tokunaga, K. (2005) Extensive polymorphisms of LILRB1 (ILT2, LIR1) and their association with HLA-DRB1 shared epitope negative rheumatoid arthritis. Human molecular genetics 14, 2469-2480 110. Davidson, C. L., Li, N. L., and Burshtyn, D. N. (2010) LILRB1 polymorphism and surface phenotypes of natural killer cells. Hum Immunol 71, 942-949 111. Wisniewski, A., Kowal, A., Wyrodek, E., Nowak, I., Majorczyk, E., Wagner, M., Pawlak-Adamska, E., Jankowska, R., Slesak, B., Frydecka, I., and Kusnierczyk, P. (2015) Genetic polymorphisms and expression of HLA-G and its receptors, KIR2DL4 and LILRB1, in non-small cell lung cancer. Tissue Antigens 85, 466- 475 112. Delgado De La Poza, J. F., Cantó, E., Díaz-Torné, C., Ferrer Villahoz, B., Martínez Carretero, M. A., López, M., Geli, C., Díaz, C., Rodríguez-Sánchez, J. L., and Vidal, S. (2011) Contribution of LILRB1 polymorphism and HLA-DRB1- shared epitope to rheumatoid arthritis. Inmunología 30, 108-114 113. Papanikolaou, N. A., Vasilescu, E. R., and Suciu-Foca, N. (2004) Novel single nucleotide polymorphisms in the human immune inhibitory immunoglobulin-like T cell receptor type 4. Hum Immunol 65, 700-705 114. Hirayasu, K., Ohashi, J., Tanaka, H., Kashiwase, K., Ogawa, A., Takanashi, M., Satake, M., Jia, G. J., Chimge, N. O., Sideltseva, E. W., Tokunaga, K., and Yabe, T. (2008) Evidence for natural selection on leukocyte immunoglobulin-like receptors for HLA class I in Northeast Asians. Am J Hum Genet 82, 1075-1083 115. Pfistershammer, K., Lawitschka, A., Klauser, C., Leitner, J., Weigl, R., Heemskerk, M. H., Pickl, W. F., Majdic, O., Bohmig, G. A., Fischer, G. F., Greinix, H. T., and Steinberger, P. (2009) Allogeneic disparities in immunoglobulin-like transcript 5 induce potent antibody responses in hematopoietic stem cell transplant recipients. Blood 114, 2323-2332 116. Renauer, P. A., Saruhan-Direskeneli, G., Coit, P., Adler, A., Aksu, K., Keser, G., Alibaz-Oner, F., Aydin, S. Z., Kamali, S., Inanc, M., Carette, S., Cuthbertson, D., Hoffman, G. S., Akar, S., Onen, F., Akkoc, N., Khalidi, N. A., Koening, C., Karadag, O., Kiraz, S., Langford, C. A., Maksimowicz-McKinnon, K., McAlear, C. A., Ozbalkan, Z., Ates, A., Karaaslan, Y., Duzgun, N., Monach, P. A., Ozer, H. T. E., Erken, E., Ozturk, M. A., Yazici, A., Cefle, A., Onat, A. M., Kisacik, B., Pagnoux, C., Kasifoglu, T., Seyahi, E., Fresko, I., Seo, P., Sreih, A. G., Warrington, K. J., Ytterberg, S. R., Cobankara, V., Cunninghame-Graham, D. S., Vyse, T. J., Pamuk, O. N., Tunc, S. E., Dalkilic, E., Bicakcigil, M., Yentur, S. P., Wren, J. D., Merkel, P. A., Direskeneli, H., and Sawalha, A. H. (2015) Identification of Susceptibility Loci in IL6, RPS9/LILRB3, and an Intergenic Locus on Chromosome 21q22 in Takayasu Arteritis in a Genome-Wide Association Study. Arthritis & rheumatology 67, 1361-1368 117. Chang, C. C., Silvia, E. A., Ho, E. K., Vlad, G., Suciu-Foca, N., and Vasilescu, E. R. (2008) Polymorphism and linkage disequilibrium of immunoglobulin-like transcript 3 gene. Hum Immunol 69, 284-290 118. Jensen, M. A., Patterson, K. C., Kumar, A. A., Kumabe, M., Franek, B. S., and Niewold, T. B. (2013) Functional genetic polymorphisms in ILT3 are associated 204

with decreased surface expression on dendritic cells and increased serum cytokines in lupus patients. Annals of the rheumatic diseases 72, 596-601 119. Dube, M. P., Zetler, R., Barhdadi, A., Brown, A. M., Mongrain, I., Normand, V., Laplante, N., Asselin, G., Zada, Y. F., Provost, S., Bergeron, J., Kouz, S., Dufour, R., Diaz, A., de Denus, S., Turgeon, J., Rheaume, E., Phillips, M. S., and Tardif, J. C. (2014) CKM and LILRB5 are associated with serum levels of creatine kinase. Circ Cardiovasc Genet 7, 880-886 120. Mamegano, K., Kuroki, K., Miyashita, R., Kusaoi, M., Kobayashi, S., Matsuta, K., Maenaka, K., Colonna, M., Ozaki, S., Hashimoto, H., Takasaki, Y., Tokunaga, K., and Tsuchiya, N. (2008) Association of LILRA2 (ILT1, LIR7) splice site polymorphism with systemic lupus erythematosus and microscopic polyangiitis. Genes Immun 9, 214-223 121. Singaraja, R. R., Tietjen, I., Hovingh, G. K., Franchini, P. L., Radomski, C., Wong, K., vanHeek, M., Stylianou, I. M., Lin, L., Wang, L., Mitnaul, L., Hubbard, B., Winther, M., Mattice, M., Legendre, A., Sherrington, R., Kastelein, J. J., Akinsanya, K., Plump, A., and Hayden, M. R. (2014) Identification of four novel genes contributing to familial elevated plasma HDL cholesterol in humans. Journal of lipid research 55, 1693-1701 122. Teslovich, T. M., Musunuru, K., Smith, A. V., Edmondson, A. C., Stylianou, I. M., Koseki, M., Pirruccello, J. P., Ripatti, S., Chasman, D. I., Willer, C. J., Johansen, C. T., Fouchier, S. W., Isaacs, A., Peloso, G. M., Barbalic, M., Ricketts, S. L., Bis, J. C., Aulchenko, Y. S., Thorleifsson, G., Feitosa, M. F., Chambers, J., Orho-Melander, M., Melander, O., Johnson, T., Li, X., Guo, X., Li, M., Shin Cho, Y., Jin Go, M., Jin Kim, Y., Lee, J. Y., Park, T., Kim, K., Sim, X., Twee-Hee Ong, R., Croteau-Chonka, D. C., Lange, L. A., Smith, J. D., Song, K., Hua Zhao, J., Yuan, X., Luan, J., Lamina, C., Ziegler, A., Zhang, W., Zee, R. Y., Wright, A. F., Witteman, J. C., Wilson, J. F., Willemsen, G., Wichmann, H. E., Whitfield, J. B., Waterworth, D. M., Wareham, N. J., Waeber, G., Vollenweider, P., Voight, B. F., Vitart, V., Uitterlinden, A. G., Uda, M., Tuomilehto, J., Thompson, J. R., Tanaka, T., Surakka, I., Stringham, H. M., Spector, T. D., Soranzo, N., Smit, J. H., Sinisalo, J., Silander, K., Sijbrands, E. J., Scuteri, A., Scott, J., Schlessinger, D., Sanna, S., Salomaa, V., Saharinen, J., Sabatti, C., Ruokonen, A., Rudan, I., Rose, L. M., Roberts, R., Rieder, M., Psaty, B. M., Pramstaller, P. P., Pichler, I., Perola, M., Penninx, B. W., Pedersen, N. L., Pattaro, C., Parker, A. N., Pare, G., Oostra, B. A., O'Donnell, C. J., Nieminen, M. S., Nickerson, D. A., Montgomery, G. W., Meitinger, T., McPherson, R., McCarthy, M. I., McArdle, W., Masson, D., Martin, N. G., Marroni, F., Mangino, M., Magnusson, P. K., Lucas, G., Luben, R., Loos, R. J., Lokki, M. L., Lettre, G., Langenberg, C., Launer, L. J., Lakatta, E. G., Laaksonen, R., Kyvik, K. O., Kronenberg, F., Konig, I. R., Khaw, K. T., Kaprio, J., Kaplan, L. M., Johansson, A., Jarvelin, M. R., Janssens, A. C., Ingelsson, E., Igl, W., Kees Hovingh, G., Hottenga, J. J., Hofman, A., Hicks, A. A., Hengstenberg, C., Heid, I. M., Hayward, C., Havulinna, A. S., Hastie, N. D., Harris, T. B., Haritunians, T., Hall, A. S., Gyllensten, U., Guiducci, C., Groop, L. C., Gonzalez, E., Gieger, C., Freimer, N. B., Ferrucci, L., Erdmann, J., Elliott, P., Ejebe, K. G., Doring, A., Dominiczak, A. F., Demissie, S., Deloukas, P., de Geus, E. J., de Faire, U., Crawford, G., Collins, F. S., Chen, Y. D., Caulfield, M. J., Campbell, H., Burtt, N. P., Bonnycastle, L. L., Boomsma, D. I., Boekholdt, S. M., Bergman, R. N., Barroso, I., Bandinelli, S., Ballantyne, C. M., Assimes, T. L., Quertermous, T., Altshuler, D., Seielstad, M., Wong, T. Y., Tai, E. S., Feranil, A. 205

B., Kuzawa, C. W., Adair, L. S., Taylor, H. A., Jr., Borecki, I. B., Gabriel, S. B., Wilson, J. G., Holm, H., Thorsteinsdottir, U., Gudnason, V., Krauss, R. M., Mohlke, K. L., Ordovas, J. M., Munroe, P. B., Kooner, J. S., Tall, A. R., Hegele, R. A., Kastelein, J. J., Schadt, E. E., Rotter, J. I., Boerwinkle, E., Strachan, D. P., Mooser, V., Stefansson, K., Reilly, M. P., Samani, N. J., Schunkert, H., Cupples, L. A., Sandhu, M. S., Ridker, P. M., Rader, D. J., van Duijn, C. M., Peltonen, L., Abecasis, G. R., Boehnke, M., and Kathiresan, S. (2010) Biological, clinical and population relevance of 95 loci for blood lipids. Nature 466, 707-713 123. Edmondson, A. C., Braund, P. S., Stylianou, I. M., Khera, A. V., Nelson, C. P., Wolfe, M. L., Derohannessian, S. L., Keating, B. J., Qu, L., He, J., Tobin, M. D., Tomaszewski, M., Baumert, J., Klopp, N., Doring, A., Thorand, B., Li, M., Reilly, M. P., Koenig, W., Samani, N. J., and Rader, D. J. Dense genotyping of candidate gene loci identifies variants associated with high-density lipoprotein cholesterol. Circ Cardiovasc Genet 4, 145-155 124. Jiao, Y., Wang, L., Gu, X., Tao, S., Tian, L., Na, R., Chen, Z., Kang, J., Zheng, S. L., Xu, J., Sun, J., and Qi, J. (2013) LILRA3 Is Associated with Benign Prostatic Hyperplasia Risk in a Chinese Population. Int J Mol Sci 14, 8832-8840 125. Lopez-Alvarez, M. R., Jones, D. C., Jiang, W., Traherne, J. A., and Trowsdale, J. (2014) Copy number and nucleotide variation of the LILR family of myelomonocytic cell activating and inhibitory receptors. Immunogenetics 66, 73- 83 126. Hirayasu, K., Ohashi, J., Kashiwase, K., Takanashi, M., Satake, M., Tokunaga, K., and Yabe, T. (2006) Long-term persistence of both functional and nonfunctional alleles at the leukocyte immunoglobulin-like receptor A3 (LILRA3) locus suggests balancing selection. Human genetics 119, 436-443 127. Ordonez, D., Sanchez, A. J., Martinez-Rodriguez, J. E., Cisneros, E., Ramil, E., Romo, N., Moraru, M., Munteis, E., Lopez-Botet, M., Roquer, J., Garcia-Merino, A., and Vilches, C. (2009) Multiple sclerosis associates with LILRA3 deletion in Spanish patients. Genes Immun 10, 579-585 128. Wiśniewski, A., Wagner, M., Nowak, I., Bilińska, M., Pokryszko-Dragan, A., Jasek, M., and Kuśnierczyk, P. (2013) 6.7-kbp deletion in LILRA3 (ILT6) gene is associated with later onset of the multiple sclerosis in a Polish population. Human Immunology 74, 353-357 129. Koch, S., Goedde, R., Nigmatova, V., Epplen, J. T., Muller, N., de Seze, J., Vermersch, P., Momot, T., Schmidt, R. E., and Witte, T. (2005) Association of multiple sclerosis with ILT6 deficiency. Genes Immun 6, 445-447 130. Kabalak, G., Dobberstein, S. B., Matthias, T., Reuter, S., The, Y. H., Dorner, T., Schmidt, R. E., and Witte, T. (2009) Association of immunoglobulin-like transcript 6 deficiency with Sjogren's syndrome. Arthritis Rheum 60, 2923-2925 131. Du, Y., Cui, Y., Liu, X., Hu, F., Yang, Y., Wu, X., Liu, X., Ma, X., Zuo, X., Sheng, Y., Liu, X., Xu, J., Zhu, P., Sun, L., Hong, N., Zhang, X., Guo, J., and Li, Z. (2014) Contribution of functional LILRA3, but not nonfunctional LILRA3, to sex bias in susceptibility and severity of anti-citrullinated protein antibody- positive rheumatoid arthritis. Arthritis & rheumatology 66, 822-830 132. Bonetti, A., Koivisto, K., Pirttilä, T., Elovaara, I., Reunanen, M., Laaksonen, M., Ruutiainen, J., Peltonen, L., Rantamäki, T., and Tienari, P. J. (2009) A follow-up study of chromosome 19q13 in multiple sclerosis susceptibility. Journal of Neuroimmunology 208, 119-124

206

133. Wisniewski, A., Luszczek, W., Manczak, M., Jasek, M., Kubicka, W., Cislo, M., and Kusnierczyk, P. (2003) Distribution of LILRA3 (ILT6/LIR4) deletion in psoriatic patients and healthy controls. Hum Immunol 64, 458-461 134. Moodie, S. J., Norman, P. J., King, A. L., Fraser, J. S., Curtis, D., Ellis, H. J., Vaughan, R. W., and Ciclitira, P. J. (2002) Analysis of candidate genes on chromosome 19 in coeliac disease: an association study of the KIR and LILR gene clusters. European journal of immunogenetics : official journal of the British Society for Histocompatibility and Immunogenetics 29, 287-291 135. Devaraju, P., Witte, T., Schmidt, R. E., Gulati, R., and Negi, V. S. (2014) Immunoglobulin-like transcripts 6 (ILT6) polymorphism influences the anti- Ro60/52 autoantibody status in South Indian SLE patients. Lupus 23, 1149-1155 136. International Multiple Sclerosis Genetics, C. (2010) Comprehensive follow-up of the first genome-wide association study of multiple sclerosis identifies KIF21B and TMEM39A as susceptibility loci. Human molecular genetics 19, 953-962 137. International Multiple Sclerosis Genetics, C., Beecham, A. H., Patsopoulos, N. A., Xifara, D. K., Davis, M. F., Kemppinen, A., Cotsapas, C., Shah, T. S., Spencer, C., Booth, D., Goris, A., Oturai, A., Saarela, J., Fontaine, B., Hemmer, B., Martin, C., Zipp, F., D'Alfonso, S., Martinelli-Boneschi, F., Taylor, B., Harbo, H. F., Kockum, I., Hillert, J., Olsson, T., Ban, M., Oksenberg, J. R., Hintzen, R., Barcellos, L. F., Wellcome Trust Case Control, C., International, I. B. D. G. C., Agliardi, C., Alfredsson, L., Alizadeh, M., Anderson, C., Andrews, R., Sondergaard, H. B., Baker, A., Band, G., Baranzini, S. E., Barizzone, N., Barrett, J., Bellenguez, C., Bergamaschi, L., Bernardinelli, L., Berthele, A., Biberacher, V., Binder, T. M., Blackburn, H., Bomfim, I. L., Brambilla, P., Broadley, S., Brochet, B., Brundin, L., Buck, D., Butzkueven, H., Caillier, S. J., Camu, W., Carpentier, W., Cavalla, P., Celius, E. G., Coman, I., Comi, G., Corrado, L., Cosemans, L., Cournu-Rebeix, I., Cree, B. A., Cusi, D., Damotte, V., Defer, G., Delgado, S. R., Deloukas, P., di Sapio, A., Dilthey, A. T., Donnelly, P., Dubois, B., Duddy, M., Edkins, S., Elovaara, I., Esposito, F., Evangelou, N., Fiddes, B., Field, J., Franke, A., Freeman, C., Frohlich, I. Y., Galimberti, D., Gieger, C., Gourraud, P. A., Graetz, C., Graham, A., Grummel, V., Guaschino, C., Hadjixenofontos, A., Hakonarson, H., Halfpenny, C., Hall, G., Hall, P., Hamsten, A., Harley, J., Harrower, T., Hawkins, C., Hellenthal, G., Hillier, C., Hobart, J., Hoshi, M., Hunt, S. E., Jagodic, M., Jelcic, I., Jochim, A., Kendall, B., Kermode, A., Kilpatrick, T., Koivisto, K., Konidari, I., Korn, T., Kronsbein, H., Langford, C., Larsson, M., Lathrop, M., Lebrun-Frenay, C., Lechner-Scott, J., Lee, M. H., Leone, M. A., Leppa, V., Liberatore, G., Lie, B. A., Lill, C. M., Linden, M., Link, J., Luessi, F., Lycke, J., Macciardi, F., Mannisto, S., Manrique, C. P., Martin, R., Martinelli, V., Mason, D., Mazibrada, G., McCabe, C., Mero, I. L., Mescheriakova, J., Moutsianas, L., Myhr, K. M., Nagels, G., Nicholas, R., Nilsson, P., Piehl, F., Pirinen, M., Price, S. E., Quach, H., Reunanen, M., Robberecht, W., Robertson, N. P., Rodegher, M., Rog, D., Salvetti, M., Schnetz- Boutaud, N. C., Sellebjerg, F., Selter, R. C., Schaefer, C., Shaunak, S., Shen, L., Shields, S., Siffrin, V., Slee, M., Sorensen, P. S., Sorosina, M., Sospedra, M., Spurkland, A., Strange, A., Sundqvist, E., Thijs, V., Thorpe, J., Ticca, A., Tienari, P., van Duijn, C., Visser, E. M., Vucic, S., Westerlind, H., Wiley, J. S., Wilkins, A., Wilson, J. F., Winkelmann, J., Zajicek, J., Zindler, E., Haines, J. L., Pericak- Vance, M. A., Ivinson, A. J., Stewart, G., Hafler, D., Hauser, S. L., Compston, A., McVean, G., De Jager, P., Sawcer, S. J., and McCauley, J. L. (2013) Analysis of 207

immune-related loci identifies 48 new susceptibility variants for multiple sclerosis. Nature genetics 45, 1353-1360 138. International Multiple Sclerosis Genetics, C., Bush, W. S., Sawcer, S. J., de Jager, P. L., Oksenberg, J. R., McCauley, J. L., Pericak-Vance, M. A., and Haines, J. L. (2010) Evidence for polygenic susceptibility to multiple sclerosis--the shape of things to come. Am J Hum Genet 86, 621-625 139. (2011) Genetic risk and a primary role for cell-mediated immune mechanisms in multiple sclerosis. Nature 476, 214-219 140. Norman, P. J., Cook, M. A., Carey, B. S., Carrington, C. V., Verity, D. H., Hameed, K., Ramdath, D. D., Chandanayingyong, D., Leppert, M., Stephens, H. A., and Vaughan, R. W. (2004) SNP haplotypes and allele frequencies show evidence for disruptive and balancing selection in the human leukocyte receptor complex. Immunogenetics 56, 225-237 141. Poon, K., Montamat-Sicotte, D., Cumberbatch, N., McMichael, A. J., and Callan, M. F. (2005) Expression of leukocyte immunoglobulin-like receptors and natural killer receptors on virus-specific CD8+ T cells during the evolution of Epstein- Barr virus-specific immune responses in vivo. Viral immunology 18, 513-522 142. Kalmbach, Y., Boldt, A. B., Fendel, R., Mordmuller, B., Kremsner, P. G., and Kun, J. F. (2006) Increase in annexin V-positive B cells expressing LILRB1/ILT2/CD85j in malaria. European cytokine network 17, 175-180 143. Baffari, E., Fiume, D., Caiazzo, G., Sinistro, A., Natoli, S., Almerighi, C., Calo- Carducci, F., Leonardis, F., and Bergamini, A. (2013) Upregulation of the inhibitory receptor ILT4 in monocytes from septic patients. Hum Immunol 74, 1244-1250 144. Vlad, G., Piazza, F., Colovai, A., Cortesini, R., Della Pietra, F., Suciu-Foca, N., and Manavalan, J. S. (2003) Interleukin-10 induces the upregulation of the inhibitory receptor ILT4 in monocytes from HIV positive individuals. Human Immunology 64, 483-489 145. Huang, J., Burke, P. S., Cung, T. D., Pereyra, F., Toth, I., Walker, B. D., Borges, L., Lichterfeld, M., and Yu, X. G. Leukocyte immunoglobulin-like receptors maintain unique antigen-presenting properties of circulating myeloid dendritic cells in HIV-1-infected elite controllers. J Virol 84, 9463-9471 146. Liu, J., Wang, L., Gao, W., Li, L., Cui, X., Yang, H., Lin, W., Dang, Q., Zhang, N., and Sun, Y. (2014) Inhibitory receptor immunoglobulin-like transcript 4 was highly expressed in primary ductal and lobular breast cancer and significantly correlated with IL-10. Diagnostic Pathology 9, 85 147. Colovai, A. I., Tsao, L., Wang, S., Lin, H., Wang, C., Seki, T., Fisher, J. G., Menes, M., Bhagat, G., Alobeid, B., and Suciu-Foca, N. (2007) Expression of inhibitory receptor ILT3 on neoplastic B cells is associated with lymphoid tissue involvement in chronic lymphocytic leukemia. Cytometry Part B, Clinical Cytometry 72, 354-362 148. Tedla, N., An, H., Borges, L., Vollmer-Conna, U., Bryant, K., Geczy, C., and McNeil, H. P. (2011) Expression of activating and inhibitory leukocyte immunoglobulin-like receptors in rheumatoid synovium: correlations to disease activity. Tissue Antigens 77, 305-316 149. Katz, H. R. (2007) Inhibition of pathologic inflammation by leukocyte Ig-like receptor B4 and related inhibitory receptors. Immunol Rev 217, 222-230

208

150. Yamashita, Y., Ono, M., and Takai, T. (1998) Inhibitory and stimulatory functions of paired Ig-like receptor (PIR) family in RBL-2H3 cells. J Immunol 161, 4042- 4047 151. Kubagawa, H., Burrows, P. D., and Cooper, M. D. (1997) A novel pair of immunoglobulin-like receptors expressed by B cells and myeloid cells. Proc Natl Acad Sci U S A 94, 5261-5266 152. Hayami, K., Fukuta, D., Nishikawa, Y., Yamashita, Y., Inui, M., Ohyama, Y., Hikida, M., Ohmori, H., and Takai, T. (1997) Molecular cloning of a novel murine cell-surface glycoprotein homologous to killer cell inhibitory receptors. J Biol Chem 272, 7320-7327 153. Yamashita, Y., Fukuta, D., Tsuji, A., Nagabukuro, A., Matsuda, Y., Nishikawa, Y., Ohyama, Y., Ohmori, H., Ono, M., and Takai, T. (1998) Genomic structures and chromosomal location of p91, a novel murine regulatory receptor family. J Biochem 123, 358-368 154. Gou, Z., Mi, Y., Jiang, F., Deng, B., Yang, J., and Gou, X. (2014) PirB is a novel potential therapeutic target for enhancing axonal regeneration and synaptic plasticity following CNS injury in mammals. Journal of drug targeting 22, 365- 371 155. Filbin, M. T. (2008) PirB, a second receptor for the myelin inhibitors of axonal regeneration Nogo66, MAG, and OMgp: implications for regeneration in vivo. Neuron 60, 740-742 156. Kubagawa, H., Cooper, M. D., Chen, C. C., Ho, L. H., Alley, T. L., Hurez, V., Tun, T., Uehara, T., Shimada, T., and Burrows, P. D. (1999) Paired immunoglobulin-like receptors of activating and inhibitory types. Curr Top Microbiol Immunol 244, 137-149 157. Ono, M., Yuasa, T., Ra, C., and Takai, T. (1999) Stimulatory function of paired immunoglobulin-like receptor-A in mast cell line by associating with subunits common to Fc receptors. J Biol Chem 274, 30288-30296 158. Kurosaki, T., and Ravetch, J. V. (1989) A single amino acid in the glycosyl phosphatidylinositol attachment domain determines the membrane topology of Fc gamma RIII. Nature 342, 805-807 159. Takai, T. (2005) A novel recognition system for MHC class I molecules constituted by PIR. Adv Immunol 88, 161-192 160. Maeda, A., Kurosaki, M., Ono, M., Takai, T., and Kurosaki, T. (1998) Requirement of SH2-containing protein tyrosine phosphatases SHP-1 and SHP-2 for paired immunoglobulin-like receptor B (PIR-B)-mediated inhibitory signal. J Exp Med 187, 1355-1360 161. Nakamura, A., Kobayashi, E., and Takai, T. (2004) Exacerbated graft-versus-host disease in Pirb-/- mice. Nat Immunol 5, 623-629 162. Matsushita, H., Endo, S., Kobayashi, E., Sakamoto, Y., Kobayashi, K., Kitaguchi, K., Kuroki, K., Soderhall, A., Maenaka, K., Nakamura, A., Strittmatter, S. M., and Takai, T. Differential but competitive binding of Nogo protein and class i major histocompatibility complex (MHCI) to the PIR-B ectodomain provides an inhibition of cells. J Biol Chem 286, 25739-25747 163. Ho, L. H., Uehara, T., Chen, C. C., Kubagawa, H., and Cooper, M. D. (1999) Constitutive tyrosine phosphorylation of the inhibitory paired Ig-like receptor PIR-B. Proc Natl Acad Sci U S A 96, 15086-15090 164. Takai, T., Nakamura, A., and Endo, S. (2011) Role of PIR-B in autoimmune glomerulonephritis. J Biomed Biotechnol 2011, 275302 209

165. Ujike, A., Takeda, K., Nakamura, A., Ebihara, S., Akiyama, K., and Takai, T. (2002) Impaired dendritic cell maturation and increased T(H)2 responses in PIR- B(-/-) mice. Nat Immunol 3, 542-548 166. Kubo, T., Uchida, Y., Watanabe, Y., Abe, M., Nakamura, A., Ono, M., Akira, S., and Takai, T. (2009) Augmented TLR9-induced Btk activation in PIR-B-deficient B-1 cells provokes excessive autoantibody production and autoimmunity. J Exp Med 206, 1971-1982 167. Pereira, S., Zhang, H., Takai, T., and Lowell, C. A. (2004) The inhibitory receptor PIR-B negatively regulates neutrophil and macrophage integrin signaling. J Immunol 173, 5757-5765 168. Torii, I., Oka, S., Hotomi, M., Benjamin, W. H., Jr., Takai, T., Kearney, J. F., Briles, D. E., and Kubagawa, H. (2008) PIR-B-deficient mice are susceptible to Salmonella infection. J Immunol 181, 4229-4239 169. Endo, S., Sakamoto, Y., Kobayashi, E., Nakamura, A., and Takai, T. (2008) Regulation of cytotoxic T lymphocyte triggering by PIR-B on dendritic cells. Proc Natl Acad Sci U S A 105, 14515-14520 170. Masuda, A., Nakamura, A., Maeda, T., Sakamoto, Y., and Takai, T. (2007) Cis binding between inhibitory receptors and MHC class I can regulate mast cell activation. J Exp Med 204, 907-920 171. Zhang, H., Meng, F., Chu, C. L., Takai, T., and Lowell, C. A. (2005) The Src family kinases Hck and Fgr negatively regulate neutrophil and dendritic cell chemokine signaling via PIR-B. Immunity 22, 235-246 172. Nakayama, M., Kurokawa, K., Nakamura, K., Lee, B. L., Sekimizu, K., Kubagawa, H., Hiramatsu, K., Yagita, H., Okumura, K., Takai, T., Underhill, D. M., Aderem, A., and Ogasawara, K. (2012) Inhibitory Receptor Paired Ig-like Receptor B Is Exploited by Staphylococcus aureus for Virulence. The Journal of Immunology 189, 5903-5911 173. Shatz, C. J. (2009) MHC class I: an unexpected role in neuronal plasticity. Neuron 64, 40-45 174. Neumann, H., Schmidt, H., Cavalie, A., Jenne, D., and Wekerle, H. (1997) Major histocompatibility complex (MHC) class I gene expression in single neurons of the central nervous system: differential regulation by interferon (IFN)-gamma and tumor necrosis factor (TNF)-alpha. J Exp Med 185, 305-316 175. Needleman, L. A., Liu, X. B., El-Sabeawy, F., Jones, E. G., and McAllister, A. K. (2010) MHC class I molecules are present both pre- and postsynaptically in the visual cortex during postnatal development and in adulthood. Proc Natl Acad Sci U S A 107, 16999-17004 176. Syken, J., Grandpre, T., Kanold, P. O., and Shatz, C. J. (2006) PirB restricts ocular-dominance plasticity in visual cortex. Science 313, 1795-1800 177. Datwani, A., McConnell, M. J., Kanold, P. O., Micheva, K. D., Busse, B., Shamloo, M., Smith, S. J., and Shatz, C. J. (2009) Classical MHCI molecules regulate retinogeniculate refinement and limit ocular dominance plasticity. Neuron 64, 463-470 178. Adelson, J. D., Barreto, G. E., Xu, L., Kim, T., Brott, B. K., Ouyang, Y. B., Naserke, T., Djurisic, M., Xiong, X., Shatz, C. J., and Giffard, R. G. (2012) Neuroprotection from stroke in the absence of MHCI or PirB. Neuron 73, 1100- 1107

210

179. Cafferty, W. B., Duffy, P., Huebner, E., and Strittmatter, S. M. (2010) MAG and OMgp synergize with Nogo-A to restrict axonal growth and neurological recovery after spinal cord trauma. J Neurosci 30, 6825-6837 180. Dickson, H. M., Zurawski, J., Zhang, H., Turner, D. L., and Vojtek, A. B. (2010) POSH is an intracellular signal transducer for the axon outgrowth inhibitor Nogo66. J Neurosci 30, 13319-13325 181. Wang, H., Xiong, Y., and Mu, D. (2012) PirB restricts neuronal regeneration in developing rat brain following hypoxia-ischemia. Mol Med Rep 6, 339-344 182. Djurisic, M., Vidal, G. S., Mann, M., Aharon, A., Kim, T., Ferrao Santos, A., Zuo, Y., Hubener, M., and Shatz, C. J. (2013) PirB regulates a structural substrate for cortical plasticity. Proc Natl Acad Sci U S A 110, 20771-20776 183. Omoto, S., Ueno, M., Mochio, S., Takai, T., and Yamashita, T. Genetic deletion of paired immunoglobulin-like receptor B does not promote axonal plasticity or functional recovery after traumatic brain injury. J Neurosci 30, 13045-13052 184. Nakamura, Y., Fujita, Y., Ueno, M., Takai, T., and Yamashita, T. Paired immunoglobulin-like receptor B knockout does not enhance axonal regeneration or locomotor recovery after spinal cord injury. J Biol Chem 286, 1876-1883 185. Fournier, A. E., GrandPre, T., and Strittmatter, S. M. (2001) Identification of a receptor mediating Nogo-66 inhibition of axonal regeneration. Nature 409, 341- 346 186. Zheng, B., Atwal, J., Ho, C., Case, L., He, X. L., Garcia, K. C., Steward, O., and Tessier-Lavigne, M. (2005) Genetic deletion of the Nogo receptor does not reduce neurite inhibition in vitro or promote corticospinal tract regeneration in vivo. Proc Natl Acad Sci U S A 102, 1205-1210 187. Fujita, Y., Endo, S., Takai, T., and Yamashita, T. (2011) Myelin suppresses axon regeneration by PIR-B/SHP-mediated inhibition of Trk activity. EMBO J 30, 1389-1401 188. Nash, M., Pribiag, H., Fournier, A. E., and Jacobson, C. (2009) Central nervous system regeneration inhibitors and their intracellular substrates. Molecular neurobiology 40, 224-235 189. Brittis, P. A., and Flanagan, J. G. (2001) Nogo domains and a Nogo receptor: implications for axon regeneration. Neuron 30, 11-14 190. Oertle, T., and Schwab, M. E. (2003) Nogo and its paRTNers. Trends Cell Biol 13, 187-194 191. Chen, M. S., Huber, A. B., van der Haar, M. E., Frank, M., Schnell, L., Spillmann, A. A., Christ, F., and Schwab, M. E. (2000) Nogo-A is a myelin-associated neurite outgrowth inhibitor and an antigen for monoclonal antibody IN-1. Nature 403, 434-439 192. Oertle, T., Merkler, D., and Schwab, M. E. (2003) Do cancer cells die because of Nogo-B? Oncogene 22, 1390-1399 193. Prinjha, R., Moore, S. E., Vinson, M., Blake, S., Morrow, R., Christie, G., Michalovich, D., Simmons, D. L., and Walsh, F. S. (2000) Inhibitor of neurite outgrowth in humans. Nature 403, 383-384 194. GrandPre, T., Nakamura, F., Vartanian, T., and Strittmatter, S. M. (2000) Identification of the Nogo inhibitor of axon regeneration as a Reticulon protein. Nature 403, 439-444 195. Oertle, T., Huber, C., van der Putten, H., and Schwab, M. E. (2003) Genomic structure and functional characterisation of the promoters of human and mouse nogo/rtn4. Journal of molecular biology 325, 299-323 211

196. Schwab, M. E. (2010) Functions of Nogo proteins and their receptors in the nervous system. Nat Rev Neurosci 11, 799-811 197. Niederost, B., Oertle, T., Fritsche, J., McKinney, R. A., and Bandtlow, C. E. (2002) Nogo-A and myelin-associated glycoprotein mediate neurite growth inhibition by antagonistic regulation of RhoA and Rac1. J Neurosci 22, 10368- 10376 198. Hu, F., and Strittmatter, S. M. (2008) The N-terminal domain of Nogo-A inhibits cell adhesion and axonal outgrowth by an integrin-specific mechanism. J Neurosci 28, 1262-1269 199. Lauren, J., Hu, F., Chin, J., Liao, J., Airaksinen, M. S., and Strittmatter, S. M. (2007) Characterization of myelin ligand complexes with neuronal Nogo-66 receptor family members. J Biol Chem 282, 5715-5725 200. Oertle, T., van der Haar, M. E., Bandtlow, C. E., Robeva, A., Burfeind, P., Buss, A., Huber, A. B., Simonen, M., Schnell, L., Brosamle, C., Kaupmann, K., Vallon, R., and Schwab, M. E. (2003) Nogo-A inhibits neurite outgrowth and cell spreading with three discrete regions. J Neurosci 23, 5393-5406 201. Schweigreiter, R., and Bandtlow, C. E. (2006) Nogo in the injured spinal cord. J Neurotrauma 23, 384-396 202. Josephson, A., Widenfalk, J., Widmer, H. W., Olson, L., and Spenger, C. (2001) NOGO mRNA expression in adult and fetal human and rat nervous tissue and in weight drop injury. Exp Neurol 169, 319-328 203. Huber, A. B., Weinmann, O., Brosamle, C., Oertle, T., and Schwab, M. E. (2002) Patterns of Nogo mRNA and protein expression in the developing and adult rat and after CNS lesions. J Neurosci 22, 3553-3567 204. Dodd, D. A., Niederoest, B., Bloechlinger, S., Dupuis, L., Loeffler, J. P., and Schwab, M. E. (2005) Nogo-A, -B, and -C are found on the cell surface and interact together in many different cell types. J Biol Chem 280, 12494-12502 205. O'Neill, P., Whalley, K., and Ferretti, P. (2004) Nogo and Nogo-66 receptor in human and chick: implications for development and regeneration. Developmental dynamics : an official publication of the American Association of Anatomists 231, 109-121 206. Caltharp, S. A., Pira, C. U., Mishima, N., Youngdale, E. N., McNeill, D. S., Liwnicz, B. H., and Oberg, K. C. (2007) NOGO-A induction and localization during chick brain development indicate a role disparate from neurite outgrowth inhibition. BMC developmental biology 7, 32 207. Mingorance, A., Fontana, X., Sole, M., Burgaya, F., Urena, J. M., Teng, F. Y., Tang, B. L., Hunt, D., Anderson, P. N., Bethea, J. R., Schwab, M. E., Soriano, E., and del Rio, J. A. (2004) Regulation of Nogo and Nogo receptor during the development of the entorhino-hippocampal pathway and after adult hippocampal lesions. Mol Cell Neurosci 26, 34-49 208. Richard, M., Giannetti, N., Saucier, D., Sacquet, J., Jourdan, F., and Pellier- Monnin, V. (2005) Neuronal expression of Nogo-A mRNA and protein during neurite outgrowth in the developing rat olfactory system. Eur J Neurosci 22, 2145- 2158 209. Meier, S., Brauer, A. U., Heimrich, B., Schwab, M. E., Nitsch, R., and Savaskan, N. E. (2003) Molecular analysis of Nogo expression in the hippocampus during development and following lesion and seizure. FASEB J 17, 1153-1155

212

210. Hunt, D., Coffin, R. S., Prinjha, R. K., Campbell, G., and Anderson, P. N. (2003) Nogo-A expression in the intact and injured nervous system. Mol Cell Neurosci 24, 1083-1102 211. Satoh, J., Onoue, H., Arima, K., and Yamamura, T. (2005) Nogo-A and nogo receptor expression in demyelinating lesions of multiple sclerosis. J Neuropathol Exp Neurol 64, 129-138 212. Marklund, N., Fulp, C. T., Shimizu, S., Puri, R., McMillan, A., Strittmatter, S. M., and McIntosh, T. K. (2006) Selective temporal and regional alterations of Nogo- A and small proline-rich repeat protein 1A (SPRR1A) but not Nogo-66 receptor (NgR) occur following traumatic brain injury in the rat. Exp Neurol 197, 70-83 213. Wang, J. W., Yang, J. F., Ma, Y., Hua, Z., Guo, Y., Gu, X. L., and Zhang, Y. F. (2015) Nogo-A expression dynamically varies after spinal cord injury. Neural regeneration research 10, 225-229 214. Pot, C., Simonen, M., Weinmann, O., Schnell, L., Christ, F., Stoeckle, S., Berger, P., Rulicke, T., Suter, U., and Schwab, M. E. (2002) Nogo-A expressed in Schwann cells impairs axonal regeneration after peripheral nerve injury. J Cell Biol 159, 29-35 215. Lauren, J., Airaksinen, M. S., Saarma, M., and Timmusk, T. (2003) Two novel mammalian Nogo receptor homologs differentially expressed in the central and peripheral nervous systems. Mol Cell Neurosci 24, 581-594 216. Pignot, V., Hein, A. E., Barske, C., Wiessner, C., Walmsley, A. R., Kaupmann, K., Mayeur, H., Sommer, B., Mir, A. K., and Frentzel, S. (2003) Characterization of two novel proteins, NgRH1 and NgRH2, structurally and biochemically homologous to the Nogo-66 receptor. J Neurochem 85, 717-728 217. Mi, S., Lee, X., Shao, Z., Thill, G., Ji, B., Relton, J., Levesque, M., Allaire, N., Perrin, S., Sands, B., Crowell, T., Cate, R. L., McCoy, J. M., and Pepinsky, R. B. (2004) LINGO-1 is a component of the Nogo-66 receptor/p75 signaling complex. Nat Neurosci 7, 221-228 218. Wang, K. C., Kim, J. A., Sivasankaran, R., Segal, R., and He, Z. (2002) P75 interacts with the Nogo receptor as a co-receptor for Nogo, MAG and OMgp. Nature 420, 74-78 219. Park, J. B., Yiu, G., Kaneko, S., Wang, J., Chang, J., He, X. L., Garcia, K. C., and He, Z. (2005) A TNF receptor family member, TROY, is a coreceptor with Nogo receptor in mediating the inhibitory activity of myelin inhibitors. Neuron 45, 345- 351 220. Fournier, A. E., Gould, G. C., Liu, B. P., and Strittmatter, S. M. (2002) Truncated soluble Nogo receptor binds Nogo-66 and blocks inhibition of axon growth by myelin. J Neurosci 22, 8876-8883 221. Liu, B. P., Fournier, A., GrandPre, T., and Strittmatter, S. M. (2002) Myelin- associated glycoprotein as a functional ligand for the Nogo-66 receptor. Science 297, 1190-1193 222. Josephson, A., Trifunovski, A., Widmer, H. R., Widenfalk, J., Olson, L., and Spenger, C. (2002) Nogo-receptor gene activity: cellular localization and developmental regulation of mRNA in mice and humans. The Journal of comparative neurology 453, 292-304 223. Barton, W. A., Liu, B. P., Tzvetkova, D., Jeffrey, P. D., Fournier, A. E., Sah, D., Cate, R., Strittmatter, S. M., and Nikolov, D. B. (2003) Structure and axon outgrowth inhibitor binding of the Nogo-66 receptor and related proteins. EMBO J 22, 3291-3302 213

224. Schmandke, A., and Strittmatter, S. M. (2007) ROCK and Rho: biochemistry and neuronal functions of Rho-associated protein kinases. Neuroscientist 13, 454-469 225. Lehmann, M., Fournier, A., Selles-Navarro, I., Dergham, P., Sebok, A., Leclerc, N., Tigyi, G., and McKerracher, L. (1999) Inactivation of Rho signaling pathway promotes CNS axon regeneration. J Neurosci 19, 7537-7547 226. Fournier, A. E., Takizawa, B. T., and Strittmatter, S. M. (2003) Rho kinase inhibition enhances axonal regeneration in the injured CNS. J Neurosci 23, 1416- 1423 227. Mathis, C., Schroter, A., Thallmair, M., and Schwab, M. E. (2010) Nogo-a regulates neural precursor migration in the embryonic mouse cortex. Cereb Cortex 20, 2380-2390 228. Liao, H., Duka, T., Teng, F. Y., Sun, L., Bu, W. Y., Ahmed, S., Tang, B. L., and Xiao, Z. C. (2004) Nogo-66 and myelin-associated glycoprotein (MAG) inhibit the adhesion and migration of Nogo-66 receptor expressing human glioma cells. J Neurochem 90, 1156-1162 229. Pool, M., Niino, M., Rambaldi, I., Robson, K., Bar-Or, A., and Fournier, A. E. (2009) Myelin regulates immune cell adhesion and motility. Exp Neurol 217, 371- 377 230. Su, Z., Cao, L., Zhu, Y., Liu, X., Huang, Z., Huang, A., and He, C. (2007) Nogo enhances the adhesion of olfactory ensheathing cells and inhibits their migration. J Cell Sci 120, 1877-1887 231. Fry, E. J., Ho, C., and David, S. (2007) A Role for Nogo Receptor in Macrophage Clearance from Injured Peripheral Nerve. Neuron 53, 649-662 232. Yan, J., Zhou, X., Guo, J. J., Mao, L., Wang, Y. J., Sun, J., Sun, L. X., Zhang, L. Y., Zhou, X. F., and Liao, H. (2012) Nogo-66 inhibits adhesion and migration of microglia via GTPase Rho pathway in vitro. J Neurochem 120, 721-731 233. Schmandke, A., Schmandke, A., and Schwab, M. E. (2014) Nogo-A: Multiple Roles in CNS Development, Maintenance, and Disease. Neuroscientist 20, 372- 386 234. Wang, X., Chun, S. J., Treloar, H., Vartanian, T., Greer, C. A., and Strittmatter, S. M. (2002) Localization of Nogo-A and Nogo-66 receptor proteins at sites of axon-myelin and synaptic contact. J Neurosci 22, 5505-5515 235. Mingorance-Le Meur, A., Zheng, B., Soriano, E., and del Rio, J. A. (2007) Involvement of the myelin-associated inhibitor Nogo-A in early cortical development and neuronal maturation. Cereb Cortex 17, 2375-2386 236. Schmandke, A., Mosberger, A. C., Schmandke, A., Celen, Z., and Schwab, M. E. (2013) The neurite growth inhibitory protein Nogo-A has diverse roles in adhesion and migration. Cell adhesion & migration 7, 451-454 237. Petrinovic, M. M., Hourez, R., Aloy, E. M., Dewarrat, G., Gall, D., Weinmann, O., Gaudias, J., Bachmann, L. C., Schiffmann, S. N., Vogt, K. E., and Schwab, M. E. (2013) Neuronal Nogo-A negatively regulates dendritic morphology and synaptic transmission in the cerebellum. Proc Natl Acad Sci U S A 110, 1083- 1088 238. Petrinovic, M. M., Duncan, C. S., Bourikas, D., Weinman, O., Montani, L., Schroeter, A., Maerki, D., Sommer, L., Stoeckli, E. T., and Schwab, M. E. (2010) Neuronal Nogo-A regulates neurite fasciculation, branching and extension in the developing nervous system. Development 137, 2539-2550

214

239. Wang, J., Chan, C. K., Taylor, J. S., and Chan, S. O. (2008) The growth-inhibitory protein Nogo is involved in midline routing of axons in the mouse optic chiasm. J Neurosci Res 86, 2581-2590 240. Wang, J., Wang, L., Zhao, H., and Chan, S. O. (2010) Localization of an axon growth inhibitory molecule Nogo and its receptor in the spinal cord of mouse embryos. Brain Res 1306, 8-17 241. Chong, S. Y. C., Rosenberg, S. S., Fancy, S. P. J., Zhao, C., Shen, Y.-A. A., Hahn, A. T., McGee, A. W., Xu, X., Zheng, B., Zhang, L. I., Rowitch, D. H., Franklin, R. J. M., Lu, Q. R., and Chan, J. R. (2012) Neurite outgrowth inhibitor Nogo-A establishes spatial segregation and extent of oligodendrocyte myelination. Proceedings of the National Academy of Sciences 109, 1299-1304 242. Pernet, V., Joly, S., Christ, F., Dimou, L., and Schwab, M. E. (2008) Nogo-A and myelin-associated glycoprotein differently regulate oligodendrocyte maturation and myelin formation. J Neurosci 28, 7435-7444 243. McGee, A. W., Yang, Y., Fischer, Q. S., Daw, N. W., and Strittmatter, S. M. (2005) Experience-driven plasticity of visual cortex limited by myelin and Nogo receptor. Science 309, 2222-2226 244. Montani, L., Gerrits, B., Gehrig, P., Kempf, A., Dimou, L., Wollscheid, B., and Schwab, M. E. (2009) Neuronal Nogo-A Modulates Growth Cone Motility via Rho-GTP/LIMK1/Cofilin in the Unlesioned Adult Nervous System. Journal of Biological Chemistry 284, 10793-10807 245. Craveiro, L. M., Hakkoum, D., Weinmann, O., Montani, L., Stoppini, L., and Schwab, M. E. (2008) Neutralization of the membrane protein Nogo-A enhances growth and reactive sprouting in established organotypic hippocampal slice cultures. Eur J Neurosci 28, 1808-1824 246. Delekate, A., Zagrebelsky, M., Kramer, S., Schwab, M. E., and Korte, M. NogoA restricts synaptic plasticity in the adult hippocampus on a fast time scale. Proc Natl Acad Sci U S A 108, 2569-2574 247. Raiker, S. J., Lee, H., Baldwin, K. T., Duan, Y., Shrager, P., and Giger, R. J. (2010) Oligodendrocyte-myelin glycoprotein and Nogo negatively regulate activity-dependent synaptic plasticity. J Neurosci 30, 12432-12445 248. Karlen, A., Karlsson, T. E., Mattsson, A., Lundstromer, K., Codeluppi, S., Pham, T. M., Backman, C. M., Ogren, S. O., Aberg, E., Hoffman, A. F., Sherling, M. A., Lupica, C. R., Hoffer, B. J., Spenger, C., Josephson, A., Brene, S., and Olson, L. (2009) Nogo receptor 1 regulates formation of lasting memories. Proc Natl Acad Sci U S A 106, 20476-20481 249. Aloy, E. M., Weinmann, O., Pot, C., Kasper, H., Dodd, D. A., Rulicke, T., Rossi, F., and Schwab, M. E. (2006) Synaptic destabilization by neuronal Nogo-A. Brain cell biology 35, 137-156 250. Gonzenbach, R. R., and Schwab, M. E. (2008) Disinhibition of neurite growth to repair the injured adult CNS: focusing on Nogo. Cell Mol Life Sci 65, 161-176 251. Xie, F., and Zheng, B. (2008) White matter inhibitors in CNS axon regeneration failure. Experimental Neurology 209, 302-312 252. Jurewicz, A., Matysiak, M., Raine, C. S., and Selmaj, K. (2007) Soluble Nogo-A, an inhibitor of axonal regeneration, as a biomarker for multiple sclerosis. Neurology 68, 283-287 253. Karnezis, T., Mandemakers, W., McQualter, J. L., Zheng, B., Ho, P. P., Jordan, K. A., Murray, B. M., Barres, B., Tessier-Lavigne, M., and Bernard, C. C. (2004)

215

The neurite outgrowth inhibitor Nogo A is involved in autoimmune-mediated demyelination. Nat Neurosci 7, 736-744 254. Yang, Y., Liu, Y., Wei, P., Peng, H., Winger, R., Hussain, R. Z., Ben, L.-H., Cravens, P. D., Gocke, A. R., Puttaparthi, K., Racke, M. K., McTigue, D. M., and Lovett-Racke, A. E. (2010) Silencing Nogo-A promotes functional recovery in demyelinating disease. Annals of Neurology 67, 498-507 255. Fontoura, P., and Steinman, L. (2006) Nogo in multiple sclerosis: growing roles of a growth inhibitor. J Neurol Sci 245, 201-210 256. Petratos, S., Ozturk, E., Azari, M. F., Kenny, R., Lee, J. Y., Magee, K. A., Harvey, A. R., McDonald, C., Taghian, K., Moussa, L., Mun Aui, P., Siatskas, C., Litwak, S., Fehlings, M. G., Strittmatter, S. M., and Bernard, C. C. (2012) Limiting multiple sclerosis related axonopathy by blocking Nogo receptor and CRMP-2 phosphorylation. Brain 135, 1794-1818 257. Jack, C., Ruffini, F., Bar-Or, A., and Antel, J. P. (2005) Microglia and multiple sclerosis. J Neurosci Res 81, 363-373 258. Benveniste, E. N. (1997) Role of macrophages/microglia in multiple sclerosis and experimental allergic encephalomyelitis. J Mol Med (Berl) 75, 165-173 259. Kim, J. E., Li, S., GrandPre, T., Qiu, D., and Strittmatter, S. M. (2003) Axon regeneration in young adult mice lacking Nogo-A/B. Neuron 38, 187-199 260. Murphy, K. J., Miller, A.-M., Thelma, R., Cowley, F., Fionnuala Cox, F., and Lynch, M. A. (2011) The age- and amyloid-β-related increases in Nogo B contribute to microglial activation. Neurochemistry International 58, 161-168 261. Acevedo, L., Yu, J., Erdjument-Bromage, H., Miao, R. Q., Kim, J. E., Fulton, D., Tempst, P., Strittmatter, S. M., and Sessa, W. C. (2004) A new role for Nogo as a regulator of vascular remodeling. Nature medicine 10, 382-388 262. Wright, P. L., Yu, J., Di, Y. P., Homer, R. J., Chupp, G., Elias, J. A., Cohn, L., and Sessa, W. C. (2010) Epithelial reticulon 4B (Nogo-B) is an endogenous regulator of Th2-driven lung inflammation. J Exp Med 207, 2595-2607 263. Xu, W., Hong, W., Shao, Y., Ning, Y., Cai, Z., and Li, Q. (2011) Nogo-B regulates migration and contraction of airway smooth muscle cells by decreasing ARPC 2/3 and increasing MYL-9 expression. Respir Res 12, 14 264. Schanda, K., Hermann, M., Stefanova, N., Gredler, V., Bandtlow, C., and Reindl, M. (2011) Nogo-B is associated with cytoskeletal structures in human monocyte- derived macrophages. BMC Research Notes 4, 1-8 265. Yu, J., Fernandez-Hernando, C., Suarez, Y., Schleicher, M., Hao, Z., Wright, P. L., DiLorenzo, A., Kyriakides, T. R., and Sessa, W. C. (2009) Reticulon 4B (Nogo-B) is necessary for macrophage infiltration and tissue repair. Proc Natl Acad Sci U S A 106, 17511-17516 266. Yang, L., Kowalski, J. R., Yacono, P., Bajmoczi, M., Shaw, S. K., Froio, R. M., Golan, D. E., Thomas, S. M., and Luscinskas, F. W. (2006) Endothelial cell cortactin coordinates intercellular adhesion molecule-1 clustering and actin cytoskeleton remodeling during polymorphonuclear leukocyte adhesion and transmigration. J Immunol 177, 6440-6449 267. Kim, J. E., Bonilla, I. E., Qiu, D., and Strittmatter, S. M. (2003) Nogo-C is sufficient to delay nerve regeneration. Mol Cell Neurosci 23, 451-459 268. Dupuis, L., Gonzalez de Aguilar, J.-L., di Scala, F., Rene, F., de Tapia, M., Pradat, P.-F., Lacomblez, L., Seihlan, D., Prinjha, R., Walsh, F. S., Meininger, V., and Loeffler, J.-P. (2002) Nogo Provides a Molecular Marker for Diagnosis of Amyotrophic Lateral Sclerosis. Neurobiology of Disease 10, 358-365 216

269. Alonso, A., and Hernan, M. A. (2008) Temporal trends in the incidence of multiple sclerosis: a systematic review. Neurology 71, 129-135 270. Koch-Henriksen, N., and Sorensen, P. S. (2010) The changing demographic pattern of multiple sclerosis epidemiology. Lancet Neurol 9, 520-532 271. Kira, J.-i. (2003) Multiple sclerosis in the Japanese population. The Lancet Neurology 2, 117-127 272. Belbasis, L., Bellou, V., Evangelou, E., Ioannidis, J. P. A., and Tzoulaki, I. (2015) Environmental risk factors and multiple sclerosis: an umbrella review of systematic reviews and meta-analyses. The Lancet Neurology 14, 263-273 273. McKay, K. A., and Tremlett, H. (2015) The systematic search for risk factors in multiple sclerosis. The Lancet Neurology 14, 237-238 274. O'Gorman, C., Lucas, R., and Taylor, B. (2012) Environmental risk factors for multiple sclerosis: a review with a focus on molecular mechanisms. Int J Mol Sci 13, 11718-11752 275. van der Mei, I. A., Ponsonby, A. L., Blizzard, L., and Dwyer, T. (2001) Regional variation in multiple sclerosis prevalence in Australia and its association with ambient ultraviolet radiation. Neuroepidemiology 20, 168-174 276. van der Mei, I. A., Ponsonby, A. L., Dwyer, T., Blizzard, L., Simmons, R., Taylor, B. V., Butzkueven, H., and Kilpatrick, T. (2003) Past exposure to sun, skin phenotype, and risk of multiple sclerosis: case-control study. Bmj 327, 316 277. Freedman, D. M., Dosemeci, M., and Alavanja, M. C. (2000) Mortality from multiple sclerosis and exposure to residential and occupational solar radiation: a case-control study based on death certificates. Occupational and environmental medicine 57, 418-421 278. Goldacre, M. J., Seagroatt, V., Yeates, D., and Acheson, E. D. (2004) Skin cancer in people with multiple sclerosis: a record linkage study. Journal of epidemiology and community health 58, 142-144 279. Hayes, C. E., and Donald Acheson, E. (2008) A unifying multiple sclerosis etiology linking virus infection, sunlight, and vitamin D, through viral interleukin- 10. Med Hypotheses 71, 85-90 280. Milo, R., and Kahana, E. Multiple sclerosis: geoepidemiology, genetics and the environment. Autoimmun Rev 9, A387-394 281. Sellner, J., Kraus, J., Awad, A., Milo, R., Hemmer, B., and Stüve, O. (2011) The increasing incidence and prevalence of female multiple sclerosis—A critical analysis of potential environmental factors. Autoimmunity Reviews 10, 495-502 282. Ascherio, A., Munger, K. L., White, R., and et al. (2014) VItamin d as an early predictor of multiple sclerosis activity and progression. JAMA neurology 71, 306- 314 283. Ruprecht, K. (2008) [Multiple sclerosis and Epstein-Barr virus : new developments and perspectives]. Nervenarzt 79, 399-407 284. Posnett, D. N. (2008) Herpesviruses and autoimmunity. Curr Opin Investig Drugs 9, 505-514 285. Pender, M. P., and Burrows, S. R. (2014) Epstein-Barr virus and multiple sclerosis: potential opportunities for immunotherapy. Clinical & translational immunology 3, e27 286. Compston, A., and Wekerle, H. (2006) Chapter 3 - The genetics of multiple sclerosis. in McAlpine's Multiple Sclerosis (Fourth Edition) (Wekerle, A. C. C. L. M. M. N. S. ed.), Churchill Livingstone, Edinburgh. pp 113-181

217

287. Gourraud, P.-A., Harbo, H. F., Hauser, S. L., and Baranzini, S. E. (2012) The genetics of multiple sclerosis: an up-to-date review. Immunological Reviews 248, 87-103 288. International Multiple Sclerosis Genetics, C., Hafler, D. A., Compston, A., Sawcer, S., Lander, E. S., Daly, M. J., De Jager, P. L., de Bakker, P. I., Gabriel, S. B., Mirel, D. B., Ivinson, A. J., Pericak-Vance, M. A., Gregory, S. G., Rioux, J. D., McCauley, J. L., Haines, J. L., Barcellos, L. F., Cree, B., Oksenberg, J. R., and Hauser, S. L. (2007) Risk alleles for multiple sclerosis identified by a genomewide study. N Engl J Med 357, 851-862 289. McDonald, W. I., Compston, A., Edan, G., Goodkin, D., Hartung, H.-P., Lublin, F. D., McFarland, H. F., Paty, D. W., Polman, C. H., Reingold, S. C., Sandberg- Wollheim, M., Sibley, W., Thompson, A., Van Den Noort, S., Weinshenker, B. Y., and Wolinsky, J. S. (2001) Recommended diagnostic criteria for multiple sclerosis: Guidelines from the international panel on the diagnosis of multiple sclerosis. Annals of Neurology 50, 121-127 290. Lublin, F. D., and Reingold, S. C. (1996) Defining the clinical course of multiple sclerosis: results of an international survey. National Multiple Sclerosis Society (USA) Advisory Committee on Clinical Trials of New Agents in Multiple Sclerosis. Neurology 46, 907-911 291. Trapp, B. D., and Nave, K. A. (2008) Multiple sclerosis: an immune or neurodegenerative disorder? Annu Rev Neurosci 31, 247-269 292. Lassmann, H., and van Horssen, J. (2011) The molecular basis of neurodegeneration in multiple sclerosis. FEBS Letters 585, 3715-3723 293. Goldman, M. D., Motl, R. W., and Rudick, R. A. (2010) Possible clinical outcome measures for clinical trials in patients with multiple sclerosis. Therapeutic Advances in Neurological Disorders 3, 229-239 294. Kurtzke, J. F. (1983) Rating neurologic impairment in multiple sclerosis: an expanded disability status scale (EDSS). Neurology 33, 1444-1452 295. Housley, W. J., Pitt, D., and Hafler, D. A. (2015) Biomarkers in multiple sclerosis. Clinical Immunology 161, 51-58 296. Katsavos, S., and Anagnostouli, M. (2013) Biomarkers in Multiple Sclerosis: An Up-to-Date Overview. Multiple Sclerosis International 2013, 20 297. Frohman, E. M., Racke, M. K., and Raine, C. S. (2006) Multiple sclerosis--the plaque and its pathogenesis. N Engl J Med 354, 942-955 298. Dendrou, C. A., Fugger, L., and Friese, M. A. (2015) Immunopathology of multiple sclerosis. Nat Rev Immunol 15, 545-558 299. Weissert, R. (2013) The immune pathogenesis of multiple sclerosis. J Neuroimmune Pharmacol 8, 857-866 300. Barker, C. F., and Billingham, R. E. (1977) Immunologically privileged sites. Adv Immunol 25, 1-54 301. Larochelle, C., Alvarez, J. I., and Prat, A. (2011) How do immune cells overcome the blood-brain barrier in multiple sclerosis? FEBS Lett 585, 3770-3780 302. Ludowyk, P. A., Willenborg, D. O., and Parish, C. R. (1992) Selective localisation of neuro-specific T lymphocytes in the central nervous system. J Neuroimmunol 37, 237-250 303. Engelhardt, B. (2006) Molecular mechanisms involved in T cell migration across the blood-brain barrier. J Neural Transm 113, 477-485 304. McCarthy, D. P., Richards, M. H., and Miller, S. D. (2012) Mouse Models of Multiple Sclerosis: Experimental Autoimmune Encephalomyelitis and Theiler’s 218

Virus-Induced Demyelinating Disease. Methods in molecular biology (Clifton, N.J.) 900, 381-401 305. Crawford, M. P., Yan, S. X., Ortega, S. B., Mehta, R. S., Hewitt, R. E., Price, D. A., Stastny, P., Douek, D. C., Koup, R. A., Racke, M. K., and Karandikar, N. J. (2004) High prevalence of autoreactive, neuroantigen-specific CD8+ T cells in multiple sclerosis revealed by novel flow cytometric assay. Blood 103, 4222-4231 306. de Andres, C., Aristimuno, C., de Las Heras, V., Martinez-Gines, M. L., Bartolome, M., Arroyo, R., Navarro, J., Gimenez-Roldan, S., Fernandez-Cruz, E., and Sanchez-Ramon, S. (2007) Interferon beta-1a therapy enhances CD4+ regulatory T-cell function: an ex vivo and in vitro longitudinal study in relapsing- remitting multiple sclerosis. J Neuroimmunol 182, 204-211 307. Rammohan, K. W. (2009) Cerebrospinal fluid in multiple sclerosis. Annals of Indian Academy of Neurology 12, 246-253 308. Napoli, I., and Neumann, H. (2010) Protective effects of microglia in multiple sclerosis. Experimental Neurology 225, 24-28 309. Neumann, H., Kotter, M. R., and Franklin, R. J. (2009) Debris clearance by microglia: an essential link between degeneration and regeneration. Brain 132, 288-295 310. Kotter, M. R., Li, W. W., Zhao, C., and Franklin, R. J. (2006) Myelin impairs CNS remyelination by inhibiting oligodendrocyte precursor cell differentiation. J Neurosci 26, 328-332 311. Lampron, A., Larochelle, A., Laflamme, N., Prefontaine, P., Plante, M. M., Sanchez, M. G., Yong, V. W., Stys, P. K., Tremblay, M. E., and Rivest, S. (2015) Inefficient clearance of myelin debris by microglia impairs remyelinating processes. J Exp Med 212, 481-495 312. Chen, Z., Jalabi, W., Hu, W., Park, H.-J., Gale, J. T., Kidd, G. J., Bernatowicz, R., Gossman, Z. C., Chen, J. T., Dutta, R., and Trapp, B. D. (2014) Microglial displacement of inhibitory synapses provides neuroprotection in the adult brain. Nat Commun 5 313. Neher, J. J., Neniskyte, U., Zhao, J.-W., Bal-Price, A., Tolkovsky, A. M., and Brown, G. C. (2011) Inhibition of Microglial Phagocytosis Is Sufficient To Prevent Inflammatory Neuronal Death. The Journal of Immunology 186, 4973- 4983 314. Goldmann, T., Wieghofer, P., Muller, P. F., Wolf, Y., Varol, D., Yona, S., Brendecke, S. M., Kierdorf, K., Staszewski, O., Datta, M., Luedde, T., Heikenwalder, M., Jung, S., and Prinz, M. (2013) A new type of microglia gene targeting shows TAK1 to be pivotal in CNS autoimmune inflammation. Nat Neurosci 16, 1618-1626 315. Nair, P., Amsen, D., and Blander, J. M. Co-ordination of incoming and outgoing traffic in antigen-presenting cells by pattern recognition receptors and T cells. Traffic 12, 1669-1676 316. Sofroniew, M. V., and Vinters, H. V. (2010) Astrocytes: biology and pathology. Acta Neuropathol 119, 7-35 317. Pekny, M., Wilhelmsson, U., and Pekna, M. (2014) The dual role of astrocyte activation and reactive gliosis. Neuroscience Letters 565, 30-38 318. Nikcevich, K. M., Gordon, K. B., Tan, L., Hurst, S. D., Kroepfl, J. F., Gardinier, M., Barrett, T. A., and Miller, S. D. (1997) IFN-gamma-activated primary murine astrocytes express B7 costimulatory molecules and prime naive antigen-specific T cells. J Immunol 158, 614-621 219

319. Hoftberger, R., Aboul-Enein, F., Brueck, W., Lucchinetti, C., Rodriguez, M., Schmidbauer, M., Jellinger, K., and Lassmann, H. (2004) Expression of major histocompatibility complex class I molecules on the different cell types in multiple sclerosis lesions. Brain Pathol 14, 43-50 320. Zeinstra, E., Wilczak, N., and De Keyser, J. (2003) Reactive astrocytes in chronic active lesions of multiple sclerosis express co-stimulatory molecules B7-1 and B7-2. J Neuroimmunol 135, 166-171 321. Constantinescu, C. S., Tani, M., Ransohoff, R. M., Wysocka, M., Hilliard, B., Fujioka, T., Murphy, S., Tighe, P. J., Sarma, J. D., Trinchieri, G., and Rostami, A. (2005) Astrocytes as antigen-presenting cells: expression of IL-12/IL-23. Journal of Neurochemistry 95, 331-340 322. Tanuma, N., Sakuma, H., Sasaki, A., and Matsumoto, Y. (2006) Chemokine expression by astrocytes plays a role in microglia/macrophage activation and subsequent neurodegeneration in secondary progressive multiple sclerosis. Acta Neuropathologica 112, 195-204 323. Holley, J. E., Gveric, D., Newcombe, J., Cuzner, M. L., and Gutowski, N. J. (2003) Astrocyte characterization in the multiple sclerosis glial scar. Neuropathology and Applied Neurobiology 29, 434-444 324. Smith, M. E., and Eng, L. F. (1987) Glial fibrillary acidic protein in chronic relapsing experimental allergic encephalomyelitis in SJL/J mice. J Neurosci Res 18, 203-208 325. Wang, Y., Cheng, X., He, Q., Zheng, Y., Kim, D. H., Whittemore, S. R., and Cao, Q. L. (2011) Astrocytes from the Contused Spinal Cord Inhibit Oligodendrocyte Differentiation of Adult Oligodendrocyte Precursor Cells by Increasing the Expression of Bone Morphogenetic Proteins. The Journal of Neuroscience 31, 6053-6058 326. Friese, M. A., Schattling, B., and Fugger, L. (2014) Mechanisms of neurodegeneration and axonal dysfunction in multiple sclerosis. Nat Rev Neurol 10, 225-238 327. Corboy, J. R., Goodin, D. S., and Frohman, E. M. (2003) Disease-modifying Therapies for Multiple Sclerosis. Curr Treat Options Neurol 5, 35-54 328. Ersoy, E., Kuş, C. N. S., Şener, U., Çoker, I., and Zorlu, Y. (2005) The effects of interferon-β on interleukin-10 in multiple sclerosis patients. European Journal of Neurology 12, 208-211 329. Neuhaus, O., Farina, C., Wekerle, H., and Hohlfeld, R. (2001) Mechanisms of action of glatiramer acetate in multiple sclerosis. Neurology 56, 702-708 330. Uccelli, A., and Mancardi, G. (2010) Stem cell transplantation in multiple sclerosis. Current Opinion in Neurology 23, 218-225 331. McQualter, J. L., and Bernard, C. C. A. (2007) Multiple sclerosis: a battle between destruction and repair. Journal of Neurochemistry 100, 295-306 332. Acosta, C. M., Cortes, C., MacPhee, H., and Namaka, M. P. (2013) Exploring the role of nerve growth factor in multiple sclerosis: implications in myelin repair. CNS Neurol Disord Drug Targets 12, 1242-1256 333. Ehling, R., Berger, T., and Reindl, M. Multiple sclerosis - established and novel therapeutic approaches. Cent Nerv Syst Agents Med Chem 10, 3-15 334. Wang, T., Xiong, J. Q., Ren, X. B., and Sun, W. The role of Nogo-A in neuroregeneration: a review. Brain Res Bull 87, 499-503 335. Prat, A., and Antel, J. (2005) Pathogenesis of multiple sclerosis. Curr Opin Neurol 18, 225-230 220

336. Compston A, e. a. (2006) McAlpine’s multiple sclerosis. , Churchill Livingston 337. Gandhi, R., Laroni, A., and Weiner, H. L. (2010) Role of the innate immune system in the pathogenesis of multiple sclerosis. J Neuroimmunol 221, 7-14 338. Nylander, A., and Hafler, D. A. (2012) Multiple sclerosis. The Journal of Clinical Investigation 122, 1180-1188 339. Barcellos, L. F., Thomson, G., Carrington, M., and et al. (1997) Chromosome 19 single-locus and multilocus haplotype associations with multiple sclerosis: Evidence of a new susceptibility locus in caucasian and chinese patients. Jama 278, 1256-1261 340. Patsopoulos, N. A., the Bayer Pharma Ms Genetics Working Group, t. S. C. o. S. E. I.-b., a Ccr1-Antagonist, A. C. G. I. M. S. G. C., and de Bakker, P. I. W. (2011) Genome-wide meta-analysis identifies novel multiple sclerosis susceptibility loci. Annals of Neurology 70, 897-912 341. Peterson JW, e. a. Axonal degeneration in multiple sclerosis: the histopathological evidence. , 342. Lassmann, H., Bruck, W., and Lucchinetti, C. (2001) Heterogeneity of multiple sclerosis pathogenesis: implications for diagnosis and therapy. Trends Mol Med 7, 115-121 343. Barkhof, F. (1999) MRI in multiple sclerosis: correlation with expanded disability status scale (EDSS). Mult Scler 5, 283-286 344. D'Ambrosio, A., Pontecorvo, S., Colasanti, T., Zamboni, S., Francia, A., and Margutti, P. (2015) Peripheral blood biomarkers in multiple sclerosis. Autoimmun Rev 14, 1097-1110 345. Couper, K. N., Blount, D. G., and Riley, E. M. (2008) IL-10: the master regulator of immunity to infection. J Immunol 180, 5771-5777 346. Asadullah, K., Sterry, W., and Volk, H. D. (2003) Interleukin-10 therapy--review of a new approach. Pharmacological reviews 55, 241-269 347. Porrini, A. M., Gambi, D., and Reder, A. T. (1995) Interferon effects on interleukin-10 secretion Mononuclear cell response to interleukin-10 is normal in multiple sclerosis patients. Journal of neuroimmunology 61, 27-34 348. Byrnes, A. A., McArthur, J. C., and Karp, C. L. (2002) Interferon-β therapy for multiple sclerosis induces reciprocal changes in interleukin-12 and interleukin-10 production. Annals of Neurology 51, 165-174 349. Kvarnström, M., Ydrefors, J., Ekerfelt, C., Vrethem, M., and Ernerudh, J. (2013) Longitudinal interferon-β effects in multiple sclerosis: Differential regulation of IL-10 and IL-17A, while no sustained effects on IFN-γ, IL-4 or IL-13. Journal of the Neurological Sciences 325, 79-85 350. Özenci, Kouwenhoven, Huang, Xiao, Kivisäkk, Fredrikson, and Link. (1999) Multiple Sclerosis: Levels of Interleukin-10-Secreting Blood Mononuclear Cells are Low in Untreated Patients but Augmented During Interferon-β-1b Treatment. Scandinavian Journal of Immunology 49, 554-561 351. Heine, G., Niesner, U., Chang, H.-D., Steinmeyer, A., Zügel, U., Zuberbier, T., Radbruch, A., and Worm, M. (2008) 1,25-dihydroxyvitamin D3 promotes IL-10 production in human B cells. European Journal of Immunology 38, 2210-2218 352. Schleithoff, S. S., Zittermann, A., Tenderich, G., Berthold, H. K., Stehle, P., and Koerfer, R. (2006) Vitamin D supplementation improves cytokine profiles in patients with congestive heart failure: a double-blind, randomized, placebo- controlled trial. The American Journal of Clinical Nutrition 83, 754-759

221

353. Khoury, S. J., Hancock, W. W., and Weiner, H. L. (1992) Oral tolerance to myelin basic protein and natural recovery from experimental autoimmune encephalomyelitis are associated with downregulation of inflammatory cytokines and differential upregulation of transforming growth factor beta, interleukin 4, and prostaglandin E expression in the brain. J Exp Med 176, 1355-1364 354. Salmaggi, A., Dufour, A., Eoli, M., Corsini, E., La Mantia, L., Massa, G., Nespolo, A., and Milanese, C. (1996) Low serum interleukin-10 levels in multiple sclerosis: further evidence for decreased systemic immunosuppression? J Neurol 243, 13-17 355. van Boxel-Dezaire, A. H., Hoff, S. C., van Oosten, B. W., Verweij, C. L., Drager, A. M., Ader, H. J., van Houwelingen, J. C., Barkhof, F., Polman, C. H., and Nagelkerken, L. (1999) Decreased interleukin-10 and increased interleukin-12p40 mRNA are associated with disease activity and characterize different disease stages in multiple sclerosis. Ann Neurol 45, 695-703 356. Waubant, E., Gee, L., Bacchetti, P., Sloan, R., Cotleur, A., Rudick, R., and Goodkin, D. (2001) Relationship between serum levels of IL-10, MRI activity and interferon beta-1a therapy in patients with relapsing remitting MS. Journal of neuroimmunology 112, 139-145 357. Covey, T. J., Shucard, J. L., Violanti, J. M., Lee, J., and Shucard, D. W. The effects of exposure to traumatic stressors on inhibitory control in police officers: A dense electrode array study using a Go/NoGo continuous performance task. Int J Psychophysiol 358. Martins, T. B., Rose, J. W., Jaskowski, T. D., Wilson, A. R., Husebye, D., Seraj, H. S., and Hill, H. R. (2011) Analysis of proinflammatory and anti-inflammatory cytokine serum concentrations in patients with multiple sclerosis by using a multiplexed immunoassay. American journal of clinical pathology 136, 696-704 359. Ortiz, M. A., Núñez, C., Ordóñez, D., Alvarez-Cermeño, J. C., Martínez- Rodriguez, J. E., Sánchez, A. J., Arroyo, R., Izquierdo, G., Malhotra, S., Montalban, X., García-Merino, A., Munteis, E., Alcina, A., Comabella, M., Matesanz, F., Villar, L. M., and Urcelay, E. (2015) Influence of the LILRA3 Deletion on Multiple Sclerosis Risk: Original Data and Meta-Analysis. PLoS ONE 10, e0134414 360. Navikas, V., and Link, H. (1996) Review: cytokines and the pathogenesis of multiple sclerosis. J Neurosci Res 45, 322-333 361. Saraiva, M., and O'Garra, A. (2010) The regulation of IL-10 production by immune cells. Nat Rev Immunol 10, 170-181 362. Joyce, D. A., Gibbons, D. P., Green, P., Steer, J. H., Feldmann, M., and Brennan, F. M. (1994) Two inhibitors of pro-inflammatory cytokine release, interleukin-10 and interleukin-4, have contrasting effects on release of soluble p75 tumor necrosis factor receptor by cultured monocytes. European Journal of Immunology 24, 2699-2705 363. Williams, L. M., Ricchetti, G., Sarma, U., Smallie, T., and Foxwell, B. M. (2004) Interleukin-10 suppression of myeloid cell activation--a continuing puzzle. Immunology 113, 281-292 364. Tilg, H., Trehu, E., Atkins, M., Dinarello, C., and Mier, J. (1994) Interleukin-6 (IL-6) as an anti-inflammatory cytokine: induction of circulating IL-1 receptor antagonist and soluble tumor necrosis factor receptor p55,

222

365. Martin, A. M., Kulski, J. K., Witt, C., Pontarotti, P., and Christiansen, F. T. (2002) Leukocyte Ig-like receptor complex (LRC) in mice and men. Trends Immunol 23, 81-88 366. David, S., Fry, E. J., and Lopez-Vales, R. (2008) Novel roles for Nogo receptor in inflammation and disease. Trends in neurosciences 31, 221-226 367. Kritz, A. B., Yu, J., Wright, P. L., Wan, S., George, S. J., Halliday, C., Kang, N., Sessa, W. C., and Baker, A. H. (2008) In vivo modulation of Nogo-B attenuates neointima formation. Mol Ther 16, 1798-1804 368. Rodriguez-Feo, J. A., Hellings, W. E., Verhoeven, B. A., Moll, F. L., de Kleijn, D. P., Prendergast, J., Gao, Y., van der Graaf, Y., Tellides, G., Sessa, W. C., and Pasterkamp, G. (2007) Low levels of Nogo-B in human carotid atherosclerotic plaques are associated with an atheromatous phenotype, restenosis, and stenosis severity. Arteriosclerosis, thrombosis, and vascular biology 27, 1354-1360 369. Lee, J. Y., and Petratos, S. (2013) Multiple sclerosis: does Nogo play a role? Neuroscientist 19, 394-408 370. Fontoura, P., Ho, P. P., DeVoss, J., Zheng, B., Lee, B. J., Kidd, B. A., Garren, H., Sobel, R. A., Robinson, W. H., Tessier-Lavigne, M., and Steinman, L. (2004) Immunity to the extracellular domain of Nogo-A modulates experimental autoimmune encephalomyelitis. J Immunol 173, 6981-6992 371. Flanagan, J. G., and Leder, P. (1990) The kit ligand: a cell surface molecule altered in steel mutant fibroblasts. Cell 63, 185-194 372. Hartgroves, L. C., Lin, J., Langen, H., Zech, T., Weiss, A., and Harder, T. (2003) Synergistic assembly of linker for activation of T cells signaling protein complexes in T cell plasma membrane domains. J Biol Chem 278, 20389-20394 373. Gaus, K., Dean, R. T., Kritharides, L., and Jessup, W. (2001) Inhibition of cholesterol efflux by 7-ketocholesterol: comparison between cells, plasma membrane vesicles, and liposomes as cholesterol donors. Biochemistry 40, 13002- 13014 374. Fath, T., Ke, Y. D., Gunning, P., Gotz, J., and Ittner, L. M. (2009) Primary support cultures of hippocampal and substantia nigra neurons. Nat Protoc 4, 78-85 375. Guillemin, G. J., Cullen, K. M., Lim, C. K., Smythe, G. A., Garner, B., Kapoor, V., Takikawa, O., and Brew, B. J. (2007) Characterization of the kynurenine pathway in human neurons. J Neurosci 27, 12884-12892 376. Guillemin, G. J., Smythe, G., Takikawa, O., and Brew, B. J. (2005) Expression of indoleamine 2,3-dioxygenase and production of quinolinic acid by human microglia, astrocytes, and neurons. Glia 49, 15-23 377. Curthoys, N. M., Freittag, H., Connor, A., Desouza, M., Brettle, M., Poljak, A., Hall, A., Hardeman, E., Schevzov, G., Gunning, P. W., and Fath, T. (2014) Tropomyosins induce neuritogenesis and determine neurite branching patterns in B35 neuroblastoma cells. Mol Cell Neurosci 58, 11-21 378. Klotzsch, E., Smorodchenko, A., Lofler, L., Moldzio, R., Parkinson, E., Schutz, G. J., and Pohl, E. E. (2015) Superresolution microscopy reveals spatial separation of UCP4 and F0F1-ATP synthase in neuronal mitochondria. Proc Natl Acad Sci U S A 112, 130-135 379. Maeda, A., Scharenberg, A. M., Tsukada, S., Bolen, J. B., Kinet, J. P., and Kurosaki, T. (1999) Paired immunoglobulin-like receptor B (PIR-B) inhibits BCR-induced activation of Syk and Btk by SHP-1. Oncogene 18, 2291-2297

223

380. Fujita, Y., Takashima, R., Endo, S., Takai, T., and Yamashita, T. The p75 receptor mediates axon growth inhibition through an association with PIR-B. Cell Death Dis 2, e198 381. Schwab, M. E. (2004) Nogo and axon regeneration. Current opinion in neurobiology 14, 118-124 382. Nag, M., Bera, K., and Basak, S. (2015) Intermolecular disulfide bond formation promotes immunoglobulin aggregation: investigation by fluorescence correlation spectroscopy. Proteins 83, 169-177 383. Mossuto, M. F. (2013) Disulfide bonding in neurodegenerative misfolding diseases. International journal of cell biology 2013, 318319 384. Kurien, B. T., and Scofield, R. H. (2006) Western blotting. Methods 38, 283-293 385. Manoussopoulos, I. N., and Tsagris, M. (2009) Native electrophoresis and western blot analysis: method and applications. Methods Mol Biol 536, 277-287 386. Digman, M. A., Dalal, R., Horwitz, A. F., and Gratton, E. (2008) Mapping the Number of Molecules and Brightness in the Laser Scanning Microscope. Biophysical Journal 94, 2320-2332 387. Digman, M. A., Stakic, M., and Gratton, E. (2013) Chapter Six - Raster Image Correlation Spectroscopy and Number and Brightness Analysis. in Methods in Enzymology (Sergey, Y. T. ed.), Academic Press. pp 121-144 388. James, Nicholas G., Digman, Michelle A., Gratton, E., Barylko, B., Ding, X., Albanesi, Joseph P., Goldberg, Matthew S., and Jameson, David M. (2012) Number and Brightness Analysis of LRRK2 Oligomerization in Live Cells. Biophysical Journal 102, L41-L43 389. Ross, J. A., Digman, M. A., Wang, L., Gratton, E., Albanesi, J. P., and Jameson, D. M. (2011) Oligomerization State of Dynamin 2 in Cell Membranes Using TIRF and Number and Brightness Analysis. Biophysical Journal 100, L15-L17 390. Adu-Gyamfi, E., Digman, Michelle A., Gratton, E., and Stahelin, Robert V. (2012) Investigation of Ebola VP40 Assembly and Oligomerization in Live Cells Using Number and Brightness Analysis. Biophysical Journal 102, 2517-2525 391. Plotegher, N., Gratton, E., and Bubacco, L. (2014) Number and Brightness analysis of alpha-synuclein oligomerization and the associated mitochondrial morphology alterations in live cells. Biochimica et Biophysica Acta (BBA) - General Subjects 1840, 2014-2024 392. Ossato, G., Digman, M. A., Aiken, C., Lukacsovich, T., Marsh, J. L., and Gratton, E. (2010) A two-step path to inclusion formation of huntingtin peptides revealed by number and brightness analysis. Biophys J 98, 3078-3085 393. Nagy, P., Claus, J., Jovin, T. M., and Arndt-Jovin, D. J. (2010) Distribution of resting and ligand-bound ErbB1 and ErbB2 receptor tyrosine kinases in living cells using number and brightness analysis. Proc Natl Acad Sci U S A 107, 16524- 16529 394. Hellriegel, C., Caiolfa, V. R., Corti, V., Sidenius, N., and Zamai, M. (2011) Number and brightness image analysis reveals ATF-induced dimerization kinetics of uPAR in the cell membrane. The FASEB Journal 25, 2883-2897 395. Digman, M. A., Wiseman, P. W., Choi, C., Horwitz, A. R., and Gratton, E. (2009) Stoichiometry of molecular complexes at adhesions in living cells. Proc Natl Acad Sci U S A 106, 2170-2175 396. Théry, C., Amigorena, S., Raposo, G., and Clayton, A. (2001) Isolation and Characterization of Exosomes from Cell Culture Supernatants and Biological Fluids. in Current Protocols in Cell Biology, John Wiley & Sons, Inc. pp 224

397. Cox, B., and Emili, A. (2006) Tissue subcellular fractionation and protein extraction for use in mass-spectrometry-based proteomics. Nature Protocols 1, 1872-1878 398. Real, F., and Mortara, R. A. (2012) The diverse and dynamic nature of Leishmania parasitophorous vacuoles studied by multidimensional imaging. PLoS Negl Trop Dis 6, e1518 399. Heilemann, M., van de Linde, S., Schuttpelz, M., Kasper, R., Seefeldt, B., Mukherjee, A., Tinnefeld, P., and Sauer, M. (2008) Subdiffraction-resolution fluorescence imaging with conventional fluorescent probes. Angewandte Chemie 47, 6172-6176 400. Vogelsang, J., Steinhauer, C., Forthmann, C., Stein, I. H., Person-Skegro, B., Cordes, T., and Tinnefeld, P. (2010) Make them blink: probes for super-resolution microscopy. Chemphyschem : a European journal of chemical physics and physical chemistry 11, 2475-2490 401. Tokunaga, M., Imamoto, N., and Sakata-Sogawa, K. (2008) Highly inclined thin illumination enables clear single-molecule imaging in cells. Nature methods 5, 159-161 402. Schoen, I., Ries, J., Klotzsch, E., Ewers, H., and Vogel, V. (2011) Binding- activated localization microscopy of DNA structures. Nano letters 11, 4008-4011 403. Endesfelder, U., Finan, K., Holden, Seamus J., Cook, Peter R., Kapanidis, Achillefs N., and Heilemann, M. (2013) Multiscale Spatial Organization of RNA Polymerase in Escherichia coli. Biophysical Journal 105, 172-181 404. Hinde, E., Cardarelli, F., and Gratton, E. (2015) Spatiotemporal regulation of Heterochromatin Protein 1-alpha oligomerization and dynamics in live cells. Scientific reports 5, 12001 405. Snapp, E. (2005) Design and Use of Fluorescent Fusion Proteins in Cell Biology. Current protocols in cell biology / editorial board, Juan S. Bonifacino ... [et al.] CHAPTER, Unit-21.24 406. Palade, G. (1975) Intracellular aspects of the process of protein synthesis. Science 189, 867 407. Lodish H, B. A., Zipursky SL, et al. (2000) Section 17.3, Overview of the Secretory Pathway. in Molecular Cell Biology. , 4th edition Ed., New York: W. H. Freeman;. pp 408. Alberts, B. (2002) Transport from the Trans Golgi Network to the Cell Exterior: Exocytosis. in Molecular biology of the cell, 4th Ed., Garland Science, New York. pp xxxiv, 1548 p. 409. Brion, C., Miller, S. G., and Moore, H. P. (1992) Regulated and constitutive secretion. Differential effects of protein synthesis arrest on transport of glycosaminoglycan chains to the two secretory pathways. J Biol Chem 267, 1477- 1483 410. Wells, L., Vosseller, K., and Hart, G. W. (2001) Glycosylation of nucleocytoplasmic proteins: signal transduction and O-GlcNAc. Science 291, 2376-2378 411. Maverakis, E., Kim, K., Shimoda, M., Gershwin, M. E., Patel, F., Wilken, R., Raychaudhuri, S., Ruhaak, L. R., and Lebrilla, C. B. (2015) Glycans in the immune system and The Altered Glycan Theory of Autoimmunity: A critical review. Journal of Autoimmunity 57, 1-13

225

412. Parekh, R. B., Dwek, R. A., Sutton, B. J., Fernandes, D. L., Leung, A., Stanworth, D., Rademacher, T. W., Mizuochi, T., Taniguchi, T., Matsuta, K., and et al. (1985) Association of rheumatoid arthritis and primary osteoarthritis with changes in the glycosylation pattern of total serum IgG. Nature 316, 452-457 413. Rhodes, J., Campbell, B. J., and Yu, L.-G. (2001) Glycosylation and Disease. in Encyclopedia of Life Sciences, John Wiley & Sons, Ltd: Chichester. pp 414. Watson, M., Rudd, P. M., Bland, M., Dwek, R. A., and Axford, J. S. (1999) Sugar printing rheumatic diseases: A potential method for disease differentiation using immunoglobulin G oligosaccharides. Arthritis & Rheumatism 42, 1682-1690 415. Arnold, J. N., Wormald, M. R., Sim, R. B., Rudd, P. M., and Dwek, R. A. (2007) The impact of glycosylation on the biological function and structure of human immunoglobulins. Annual review of immunology 25, 21-50 416. Floege, J., and Feehally, J. (2000) IgA nephropathy: recent developments. J Am Soc Nephrol 11, 2395-2403 417. Nelson, J., McFerran, N. V., Pivato, G., Chambers, E., Doherty, C., Steele, D., and Timson, D. J. (2008) The 67 kDa laminin receptor: structure, function and role in disease. Bioscience Reports 28, 33-48 418. Kinoshita, K., Kaneda, Y., Sato, M., Saeki, Y., Wataya-Kaneda, M., Hoffmann, A., and Kaneda, Y. (1998) LBP-p40 Binds DNA Tightly through Associations with Histones H2A, H2B, and H4. Biochemical and Biophysical Research Communications 253, 277-282 419. Lange, A., Mills, R. E., Lange, C. J., Stewart, M., Devine, S. E., and Corbett, A. H. (2007) Classical nuclear localization signals: definition, function, and interaction with importin alpha. J Biol Chem 282, 5101-5105 420. Milarski, K. L., and Morimoto, R. I. (1986) Expression of human HSP70 during the synthetic phase of the cell cycle. Proceedings of the National Academy of Sciences of the United States of America 83, 9517-9521 421. Duverger, E., Pellerin-Mendes, C., Mayer, R., Roche, A. C., and Monsigny, M. (1995) Nuclear import of glycoconjugates is distinct from the classical NLS pathway. J Cell Sci 108 ( Pt 4), 1325-1332 422. Rondanino, C., Bousser, M. T., Monsigny, M., and Roche, A. C. (2003) Sugar- dependent nuclear import of glycosylated proteins in living cells. Glycobiology 13, 509-519 423. Kotoglou, P., Kalaitzakis, A., Vezyraki, P., Tzavaras, T., Michalis, L. K., Dantzer, F., Jung, J. U., and Angelidis, C. (2008) Hsp70 translocates to the nuclei and nucleoli, binds to XRCC1 and PARP-1, and protects HeLa cells from single- strand DNA breaks. Cell Stress and Chaperones 14, 391-406 424. Guinez, C., Losfeld, M.-E., Cacan, R., Michalski, J.-C., and Lefebvre, T. (2006) Modulation of HSP70 GlcNAc-directed lectin activity by glucose availability and utilization. Glycobiology 16, 22-28 425. Hart, G. W., Slawson, C., Ramirez-Correa, G., and Lagerlof, O. (2011) Cross Talk Between O-GlcNAcylation and Phosphorylation: Roles in Signaling, Transcription, and Chronic Disease. Annual Review of Biochemistry 80, 825-858 426. Wells, L., Gao, Y., Mahoney, J. A., Vosseller, K., Chen, C., Rosen, A., and Hart, G. W. (2002) Dynamic O-Glycosylation of Nuclear and Cytosolic Proteins: FURTHER CHARACTERIZATION OF THE NUCLEOCYTOPLASMIC β-N- ACETYLGLUCOSAMINIDASE, O-GlcNAcase. Journal of Biological Chemistry 277, 1755-1761

226

427. Mayer, M. C., Schauenburg, L., Thompson-Steckel, G., Dunsing, V., Kaden, D., Voigt, P., Schaefer, M., Chiantia, S., Kennedy, T. E., and Multhaup, G. (2016) Amyloid precursor-like protein (APLP)1 exhibits stronger zinc-dependent neuronal adhesion than APP and APLP2. Journal of Neurochemistry 428. Perumal, V., Krishnan, K., Gratton, E., Dharmarajan, A. M., and Fox, S. A. (2015) Number and brightness analysis of sFRP4 domains in live cells demonstrates vesicle association signal of the NLD domain and dynamic intracellular responses to Wnt3a. The International Journal of Biochemistry & Cell Biology 64, 91-96 429. Mieruszynski, S., Briggs, C., Digman, M. A., Gratton, E., and Jones, M. R. (2015) Live Cell Characterization of DNA Aggregation Delivered through Lipofection. Scientific reports 5, 10528 430. Adu-Gyamfi, E., Soni, S. P., Jee, C. S., Digman, M. A., Gratton, E., and Stahelin, R. V. (2014) A loop region in the N-terminal domain of Ebola virus VP40 is important in viral assembly, budding, and egress. Viruses 6, 3837-3854 431. Subashchandrabose, S. R., Krishnan, K., Gratton, E., Megharaj, M., and Naidu, R. (2014) Potential of fluorescence imaging techniques to monitor mutagenic PAH uptake by microalga. Environmental science & technology 48, 9152-9160 432. Olivera-Couto, A., Salzman, V., Mailhos, M., Digman, Michelle A., Gratton, E., and Aguilar, Pablo S. (2015) Eisosomes Are Dynamic Plasma Membrane Domains Showing Pil1-Lsp1 Heteroligomer Binding Equilibrium. Biophysical Journal 108, 1633-1644 433. Vogl, F., Humpolícková, J., Amaro, M., Koller, D., Köfeler, H., Zenzmaier, E., Hof, M., and Hermetter, A. (2016) Role of protein kinase C δ in apoptotic signaling of oxidized phospholipids in RAW 264.7 macrophages. Biochimica et Biophysica Acta (BBA) - Molecular and Cell Biology of Lipids 1861, 320-330 434. Unruh, J. R., and Gratton, E. (2008) Analysis of molecular concentration and brightness from fluorescence fluctuation data with an electron multiplied CCD camera. Biophys J 95, 5385-5398 435. Dalal, R. B., Digman, M. A., Horwitz, A. F., Vetri, V., and Gratton, E. (2008) Determination of particle number and brightness using a laser scanning confocal microscope operating in the analog mode. Microscopy research and technique 71, 69-81 436. Allen, R. L., and Trowsdale, J. (2004) Recognition of classical and heavy chain forms of HLA-B27 by leukocyte receptors. Curr Mol Med 4, 59-65 437. Hong Byun, E., Fujimura, Y., Yamada, K., and Tachibana, H. (2010) TLR4 Signaling Inhibitory Pathway Induced by Green Tea Polyphenol Epigallocatechin-3-Gallate through 67-kDa Laminin Receptor. The Journal of Immunology 185, 33-45 438. Gundimeda, U., McNeill, T. H., Barseghian, B. A., Tzeng, W. S., Rayudu, D. V., Cadenas, E., and Gopalakrishna, R. (2015) Polyphenols from green tea prevent antineuritogenic action of Nogo-A via 67-kDa laminin receptor and hydrogen peroxide. Journal of Neurochemistry 132, 70-84 439. Orihuela, C. J., Mahdavi, J., Thornton, J., Mann, B., Wooldridge, K. G., Abouseada, N., Oldfield, N. J., Self, T., Ala, x, Aldeen, D. A. A., and Tuomanen, E. I. Laminin receptor initiates bacterial contact with the blood brain barrier in experimental meningitis models. The Journal of Clinical Investigation 119, 1638- 1646 440. Kim, K. J., Chung, J. W., and Kim, K. S. (2005) 67-kDa Laminin Receptor Promotes Internalization of Cytotoxic Necrotizing Factor 1-expressing 227

Escherichia coli K1 into Human Brain Microvascular Endothelial Cells. Journal of Biological Chemistry 280, 1360-1368 441. Xu, W., Zhu, Y., Ning, Y., Dong, Y., Huang, H., Zhang, W., Sun, Q., and Li, Q. (2015) Nogo-B protects mice against lipopolysaccharide-induced acute lung injury. Scientific reports 5, 12061 442. Teng, R.-J., Rana, U., Afolayan, A. J., Zhao, B., Miao, Q. R., and Konduri, G. G. (2014) Nogo-B Receptor Modulates Angiogenesis Response of Pulmonary Artery Endothelial Cells Through eNOS Coupling. American Journal of Respiratory Cell and Molecular Biology 51, 169-177 443. Spach, K. M., Nashold, F. E., Dittel, B. N., and Hayes, C. E. (2006) IL-10 Signaling Is Essential for 1,25-Dihydroxyvitamin D3-Mediated Inhibition of Experimental Autoimmune Encephalomyelitis. The Journal of Immunology 177, 6030-6037 444. Farsani, Z. S., Behmanesh, M., and Sahraian, M. A. (2015) Interleukin-10 but not transforming growth factor-β1 gene expression is up-regulated by vitamin D treatment in multiple sclerosis patients. Journal of the Neurological Sciences 350, 18-23 445. Zhou, Z., Peng, X., Insolera, R., Fink, D. J., and Mata, M. (2009) Interleukin-10 provides direct trophic support to neurons. J Neurochem 110, 1617-1627 446. Sharma, S., Yang, B., Xi, X., Grotta, J. C., Aronowski, J., and Savitz, S. I. (2011) IL-10 directly protects cortical neurons by activating PI-3 kinase and STAT-3 pathways. Brain Res 1373, 189-194 447. Gresle, M. M., Shaw, G., Jarrott, B., Alexandrou, E. N., Friedhuber, A., Kilpatrick, T. J., and Butzkueven, H. (2008) Validation of a novel biomarker for acute axonal injury in experimental autoimmune encephalomyelitis. J Neurosci Res 86, 3548-3555 448. Julien, J. P., and Mushynski, W. E. (1998) Neurofilaments in health and disease. Progress in nucleic acid research and molecular biology 61, 1-23 449. Teunissen, C. E., Dijkstra, C., and Polman, C. (2005) Biological markers in CSF and blood for axonal degeneration in multiple sclerosis. Lancet Neurol 4, 32-41 450. Silber, E., Semra, Y. K., Gregson, N. A., and Sharief, M. K. (2002) Patients with progressive multiple sclerosis have elevated antibodies to neurofilament subunit. Neurology 58, 1372-1381 451. Fialova, L., Bartos, A., Soukupova, J., Svarcova, J., Ridzon, P., and Malbohan, I. (2009) Synergy of serum and cerebrospinal fluid antibodies against axonal cytoskeletal proteins in patients with different neurological diseases. Folia biologica 55, 23-26 452. Amorini, A. M., Nociti, V., Petzold, A., Gasperini, C., Quartuccio, E., Lazzarino, G., Di Pietro, V., Belli, A., Signoretti, S., Vagnozzi, R., Lazzarino, G., and Tavazzi, B. (2014) Serum lactate as a novel potential biomarker in multiple sclerosis. Biochim Biophys Acta 1842, 1137-1143 453. Siegel, S. R., Mackenzie, J., Chaplin, G., Jablonski, N. G., and Griffiths, L. Circulating microRNAs involved in multiple sclerosis. Mol Biol Rep 454. Robinson, A. P., Harp, C. T., Noronha, A., and Miller, S. D. (2014) The experimental autoimmune encephalomyelitis (EAE) model of MS: utility for understanding disease pathophysiology and treatment. Handbook of clinical neurology 122, 173-189

228