Heteroclitic CD8 T Cell Epitopes Enhanced Antiviral Immunity

Structural and Functional Correlates of Enhanced Antiviral Immunity Generated by Heteroclitic CD8 T Cell Epitopes

This information is current as Jonathan A. Trujillo, Stephanie Gras, Kelly-Anne Twist, of September 30, 2021. Nathan P. Croft, Rudragouda Channappanavar, Jamie Rossjohn, Anthony W. Purcell and Stanley Perlman J Immunol 2014; 192:5245-5256; Prepublished online 2 May 2014;

doi: 10.4049/jimmunol.1400111 Downloaded from http://www.jimmunol.org/content/192/11/5245

References This article cites 56 articles, 31 of which you can access for free at: http://www.jimmunol.org/content/192/11/5245.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists by guest on September 30, 2021 • Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2014 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Structural and Functional Correlates of Enhanced Antiviral Immunity Generated by Heteroclitic CD8 T Cell Epitopes

Jonathan A. Trujillo,*,1 Stephanie Gras,†,1 Kelly-Anne Twist,† Nathan P. Croft,† Rudragouda Channappanavar,‡ Jamie Rossjohn,†,x,{,2 Anthony W. Purcell,†,2 and Stanley Perlman*,‡,2

Peptides that bind poorly to MHC class I molecules often elicit low–functional avidity T cell responses. Peptide modification by altering the anchor residue facilitates increased binding affinity and may elicit T cells with increased functional avidity toward the native epitope (“heteroclitic”). This augmented MHC binding is likely to increase the half-life and surface density of the heteroclitic complex, but precisely how this enhanced T cell response occurs in vivo is not known. Furthermore, the ideal heteroclitic epitope will elicit T cell responses that completely cross-react with the native epitope, maximizing protection and minimizing undesirable off-target effects. Such epitopes have been difficult to identify. In this study, using mice infected with a murine Downloaded from coronavirus that encodes epitopes that elicit high (S510, CSLWNGPHL)– and low (S598, RCQIFANI)–functional avidity responses, we show that increased expression of peptide S598 but not S510 generated T cells with enhanced functional avidity. Thus, immune responses can be augmented toward T cell epitopes with low functional avidity by increasing Ag density. We also identified a heteroclitic epitope (RCVIFANI) that elicited a T cell response with nearly complete cross-reactivity with native epitope and demonstrated increased MHC/peptide abundance compared with native S598. Structural and thermal melt analyses indicated that the Q600V substitution enhanced stability of the peptide/MHC complex without greatly altering the antigenic http://www.jimmunol.org/ surface, resulting in highly cross-reactive T cell responses. Our data highlight that increased peptide/MHC complex display contributes to heteroclitic epitope efficacy and describe parameters for maximizing immune responses that cross-react with the native epitope. The Journal of Immunology, 2014, 192: 5245–5256.

athogen and tumor clearance both require effective T cell avidity T cell responses that are neither protective against patho- responses; therefore, any vaccines designed to enhance gen exposure nor efﬁcacious in diminishing tumor burden (3–9). immune protection against infectious diseases or cancer Several approaches have been used to enhance the functional

P by guest on September 30, 2021 should include relevant CD8 or CD4 T cell epitopes (1, 2). avidity of T cell responses to tumor and viral Ags, including use of However, some subdominant epitopes recognized in infectious potent adjuvants during immunization (10), adoptive immuno- settings and from many tumors induce weak, low–functional therapy of high-avidity T cell clones (11, 12), and immunization with optimized peptides, including heteroclitic peptides; the latter, although altered in sequence, result in augmented T cell responses *Interdisciplinary Program in Immunology, University of Iowa, Iowa City, IA 52242; to the native epitope (2, 13, 14). † Department of Biochemistry and Molecular Biology, School of Biomedical Sciences, Heteroclitic CD8 T cell epitopes were initially identified in the Monash University, Clayton, Victoria 3800, Australia; ‡Department of Microbiology, University of Iowa, Iowa City, IA 52242; xAustralian Research Council Centre of context of tumors (13). In most instances, heteroclitic peptides Excellence in Advanced Molecular Imaging, Monash University, Clayton, Victoria { display enhanced binding to the MHC molecule (15, 16), although 3800, Australia; and Institute of Infection and Immunity, Cardiff University School heteroclitic peptides that augment binding to the TCR have also of Medicine, Heath Park, Cardiff CF14 4XN, United Kingdom been identified (e.g., see Ref. 17). Heteroclitic epitopes exhibiting 1J.A.T. and S.G. contributed equally to this work. 2 augmented MHC class I (MHCI) binding and potentially greater J.R., A.W.P., and S.P. are joint senior authors. effective peptide/MHC complex (pMHC) surface density may Received for publication January 14, 2014. Accepted for publication April 1, 2014. induce a higher functional avidity T cell response. However, This work was supported by National Institutes of Health Grant R01 NS036592 and whether increased pMHCI levels actually result in enhanced National Health and Medical Research Council of Australia (NHMRC) Project Grant 1023141. A.W.P. is an NHMRC Senior Research Fellow. J.R. is an NHMRC Australia functional avidity has not been established because several in vitro Fellow. J.A.T. was supported by predoctoral individual National Research Service studies showed that low levels of peptide expressed on the surface Award National Institutes of Health Grant AI093129. S.G. is an Australian Research of APCs induced CD8 T cells with high functional avidity. Con- Council Future Fellow. versely, higher levels of pMHCI expression resulted in the out- The atomic coordinates and structure factors presented in this article have been submitted to the Protein Data Bank (http://www.pdb.org/pdb/home/home.do) under growth of cells with lower avidity for the pMHCI (3). Based on accession numbers 4PV8 and 4PV9. these in vitro observations, weakly immunogenic epitopes, which Address correspondence and reprint requests to Dr. Stanley Perlman, University of often result from low-affinity pMHCI interactions and subse- Iowa, Department of Microbiology, 3-712 BSB, Iowa City, IA 52242. E-mail address: quently exhibit low pMHCI density, would be predicted to induce [email protected] high–functional avidity responses. The relationship between the Abbreviations used in this article: Aba, aminobutyric acid; B6, C57BL/6; DC, dendritic cell; JHMV, JHM strain of mouse hepatitis virus; MHCI, MHC class I; MRM, level of pMHCI on the surface of APCs and the subsequent CD8 multiple reaction monitoring; p.i., postinfection; pMHC, peptide/MHC complex; T cell response has also been investigated in vivo (18–20). In- pMHCI, peptide/MHC class I complex; rJ, recombinant version of JHMV; r.m.s.d., creased epitope density raised the magnitude of the response but root mean square deviation; t , melting temperature; VacV, vaccinia virus. m did not affect the functional avidity of the primary immune re- Copyright Ó 2014 by The American Association of Immunologists, Inc. 0022-1767/14/$16.00 sponse. Importantly, none of these in vitro or in vivo studies have www.jimmunol.org/cgi/doi/10.4049/jimmunol.1400111 5246 HETEROCLITIC EPITOPES IN CORONAVIRUS ENCEPHALOMYELITIS examined the relationship between pMHCI density and functional heteroclitic epitopes function, levels of both Kb/Q600V and Kb/ avidity of the T cell response elicited toward a weakly immuno- Q600Y were increased compared with Kb/S598. genic epitope and its corresponding heteroclitic analog. One concern with the use of heteroclitic epitopes is that a var- Materials and Methods iable fraction of the response may recognize only the modified Mice and not the native epitope (21). The outgrowth of cells that recognize only the modified epitope is not only futile as a Six- to 8-wk-old pathogen-free B6 mice were purchased from the National Cancer Institute (Frederick, MD) and housed in the Animal Care Facility at vaccine strategy but raises the possibility that the modified the University of Iowa. This study was carried out in strict accordance with the epitope-specific response could also respond to a self-epitope. recommendations in the GuidefortheCareandUseofLaboratoryAnimals This could initiate or contribute to the development of auto- of the National Institutes of Health. Animal experiments were approved by immune disease, thus making the use of heteroclitic peptides in the Institutional Animal Care and Use Committee at the University of Iowa. clinical settings problematic. Viruses Mice infected with a murine coronavirus, the neurotropic JHM strain of mouse hepatitis virus (JHMV) or its recombinant form rJ was propagated on 17Cl-1 cells and titered on HeLa cells expressing the (rJ), develop acute encephalitis and acute and chronic demyelin- MHV receptor CEACAM1 (27) as previously described (28). VacV-S510, -S598, -S598Q600Y, and -S598Q600V were engineered using complementary ating diseases (22). Of note, JHMV is a member of the same group oligonucleotides containing the DNA sequence of the identified epitope, of coronaviruses as two pathogenic human coronaviruses associ- an N-terminal methionine, and appropriate restriction enzyme sequences. ated with severe respiratory disease (severe acute respiratory Oligonucleotides for the S510 construct were previously published (24). syndrome–coronavirus and Middle East respiratory syndrome– Oligonucleotides used for the S598 constructs were: forward, 59- Downloaded from TCGACGCCACCATGAGGTGC(CAA,TAC,GTG)ATCTTCGCCAACA- corona virus) (23). The CD8 T cell response to JHMV in C57BL/6 TCTAAGGTAC-39 and reverse, 59-CTTAGATGTTGGCGAAGAT(TTG, (B6) mice is directed at two epitopes, spanning residues 510–518 GTA,CAC,)GCACCTCATGGTGGCG-39, where the boldface nucleotides and 598–605 of the surface glycoprotein (CSLWNGPHL, S510, encode amino acids Gln, Tyr, and Val, respectively. The oligonucleotides H-2Db–restricted and RCQIFANI, S598, H-2Kb–restricted) (24). were annealed and ligated into PSC65 (a VacV shuttle vector with a strong Epitope S510 is immunodominant, induces a high–functional synthetic VacV early/late promoter for expressing the gene of interest, provided by Dr. B. Moss, National Institutes of Health). VacV-S was avidity response, and in some settings undergoes mutation as part constructed by inserting a deleted S gene (lacking the transmembrane http://www.jimmunol.org/ of viral evasion of the T cell response (25). Epitope S598 is domain) (24) into pSC65. Mice were infected i.p. with 2 3 107 PFU subdominant and binds with lower affinity to the MHCI molecule recombinant VacV, and CD8+ T cell responses were measured in the than peptide S510 (14). Furthermore, the low–functional avidity spleen. Recombinant JHMV expressing variant S598 epitopes were engineered as previously described (14). Mutations were introduced using a response to epitope S598 is unable to protect mice after infection site-directed mutagenesis kit (QuikChange II Site-Directed Mutagenesis with virus mutated in S510 (26). With the goal of enhancing kit; Stratagene, La Jolla, CA) and the following primers: Q600V, forward, the S598-specific response, we optimized peptide binding to Kb 59-CACTTGTTTAGTAAATGATCGCTGCGTGATTTTTGCTAACATA- by changing a secondary anchor residue at position three of the TTGTTAAATGG-39,reverse,59-CCATTTAACAATATGTTAGCAAA- epitope from Gln to Tyr to match the consensus motif for Kb AATCACGCAGCGATCATTTACTAAACAAGTG-39; Q600F, forward, 59-CACTTGTTTAGTAAATGATCGCTGCTTCATTTTTGCTAACATAT- by guest on September 30, 2021 binding (RCYIFANI; Q600Y) (14). We showed that the modified TGTTAAATGG-39, reverse, 59-CCATTTAACAATATGTTAGCAAAAAT- peptide enhanced the stability of pMHCI and induced CD8 T cells GAAGCAGCGATCATTTACTAAACAAGTG-39. Underlined nucleotides with higher functional avidity toward the native form of the S598 correspondtotheGlntoValorPhechanges. At least two independent epitope. However, as in other studies of heteroclitic epitopes, we isolates of each recombinant virus were propagated and analyzed. ∼ found that a substantial fraction ( 35%) of the responding T cells One step viral growth kinetics recognized only the variant Q600Y epitope. For the reasons described above, this level of cross-reactivity would be unsuitable Virus was inoculated onto confluent 17Cl-1 cells at a multiplicity of infection of 0.1. Cells were harvested at the indicated time points and total in a clinical setting because part of the T cell response would be virus (cell-associated and cell-free) was titered as previously described (14). ineffectual (i.e., these T cells would recognize only the heteroclitic peptide and would not contribute to a protective immune re- Purification of MHC/peptide complexes sponse) and could potentially recognize a self-epitope. DC2.4 cells (1 3 108), grown as previously described (29), were infected In this study, we investigated a putative mechanism of action of with VacV-S598, VacV-S598Q600Y,VacV-S598Q600V, VacV-S510, or VacV-S heteroclitic epitopes, designed around the subdominant JHMV at 5 PFU/cell and incubated for 4 h before snap freezing. DC2.4 cells S598 epitope. If heteroclitic epitopes function by increasing the were disrupted by gentle resuspension in a total of 5 ml lysis buffer (0.5% effective epitope density on the surface of APCs, one would predict IGEPAL [Sigma-Aldrich], 50 mM Tris [pH 8], 150 mM NaCl, and protease inhibitors [complete protease inhibitor mixture tablet; Roche Mo- that increasing surface density of the native epitope by another lecular Biochemicals]). DC2.4s were disrupted by gentle resuspension in mechanism would also result in the induction of a high–functional a total of 5 ml lysis buffer without cryogenic milling. Lysates were in- avidity T cell response. To evaluate this possibility, we used a cubated with rotation for 1 h at 4˚C and cleared by centrifugation. MHC/ b peptide complexes were immunoaffinity purified using specific mAbs 28- vaccinia virus (VacV)–based experimental system to vary K /S598 b b abundance on APCs. The results showed that increased pMHCI 14-8S (anti–H-2D ) or Y-3 (anti–H-K ) bound to protein A–Sepharose, as previously described (29). Bound complexes were eluted by acidification expression of epitope S598, which induces a low–functional avidity with 10% acetic acid. The mixture of peptides and MHC protein chains was response, but not of epitope S510, which stimulates a high–func- fractionated on a 4.6-mm-internal diameter 3 50-mm-long reversed-phase tional avidity response in rJ-infected mice, resulted in the selection C18 HPLC column (Chromolith SpeedROD; Merck) using an A¨ KTAmicro of CD8 T cells with enhanced ability to respond to the epitope. We HPLC system (GE Healthcare) running on a mobile phase buffer A of 0.1% trifluoroacetic acid and buffer B of 80% acetonitrile/0.1% trifluoroacetic acid also addressed the problem of selection of T cells that responded to and at a flow rate of 1 ml/min with peptides separated across a gradient of b variant but not native epitope by using the crystal structures of K / 2% B to 45% B over the course of 20 min, collecting 500 ml fractions. S598 and Kb/Q600Y (14) to identify additional mutations at subanchor position 3 that were predicted to be heteroclitic. We showed Liquid chromatography–multiple reaction monitoring–mass that one heteroclitic S598 analog (Q600V) elicited a T cell response spectrometry that nearly completely cross-reacted with the native epitope. Con- Following peptide elution, samples were concentrated, treated with tris(2- sistent with the notion that surface density is a major factor in how carboxyethyl)phosphine (5 mM) for 30 min at 60˚C, and immediately The Journal of Immunology 5247 analyzed by mass spectrometry. An AB SCIEX QTRAP 5500 mass Protein expression, purification, crystallization, and structure spectrometer was used for multiple reaction monitoring (MRM) detec- determination tion, coupled online to an Eksigent nano LC and Nanoflex cHiPLC b manifold (Eksigent). Samples (10 ml) were injected and loaded onto K and b2-microglobulin molecules were expressed in Escherichia coli as a trap column (200 mm 3 0.5 mm ChromXP C18-CL, 3 mm, 120 A˚ )at inclusion bodies, refolded with the Q600V or Q600F peptides and purified a flow rate of 10 ml/min in 98% water, 2% acetonitrile, and 0.1% formic as previously described (34). The two pMHCI complexes were concen- acid for 10 min. For online fractionation of samples onto the mass trated to 5 mg/ml, using the hanging-drop vapor diffusion technique at spectrometer, samples were eluted from the trap column and passed over 20˚C. Crystals were grown with a reservoir containing 16–24% polyethylene a cHiPLC analytical column (75 mm 3 15 cm ChromXP C18-CL, 3 mm, glycol 3350, 0.1 M sodium cacodylate (pH 6.5), and 0.2 M sodium acetate. 120 A˚ ) at 300 nl/min under the following buffer B (98% acetonitrile, The crystals belong to space group P21 and the unit cell dimensions were 0.1% formic acid in water) gradient conditions: 0–3 min 2–10% B, 3–33 consistent with two molecules per asymmetric units (Table II). min 10–40% B, 33–36 min 40–80% B, 36–38 min hold at 80% B, 38–39 The crystals were flash frozen to a temperature of 2173˚C before data were min 80–2% B, followed by equilibration at 2% B until the end of the run collected using the Australian Synchrotron (MX2 beamline with an ADSC at 48 min. The QTRAP 5500 was operated in MRM mode in unit resolution Q305 detector). The data were processed and scaled with the XDS (35). The for Q1 and Q3, coupled to an information-dependent acquisition criterion set crystal structures were solved using the molecular replacement method in the to trigger an enhanced product ion scan (10,000 Da/s; rolling collision en- program Phaser (36) from the CCP4 suite of programs (37). The search probe ergy; unit resolution) following any MRM transition .500 counts. Optimal used to solve the structure was the structure of mouse MHCI Kb minus the MRM Q1→Q3 transition conditions were designed through analysis of peptide (Protein Data Bank accession no. 2ZSV [http://www.pdb.org/pdb/ synthetic peptides and are listed in Table I. Data analysis was performed home/home.do]) (14). The progress of refinement was monitored by the using Analyst v1.5.2 (AB SCIEX). Isotopically labeled S598 (S598*, con- Rfree value with neither a s nor a low-resolution cut-off being applied to the taining a modified isoleucine: ([13C])6, (15N)1, mass shift of +7 Da; Mim- data. This protocol includes several cycles of refinement with the PHENIX otopes, Clayton, VIC, Australia) was added to samples prior to analysis to software (38) Buster (39), followed by manual model rebuilding with Coot control for losses during processing and to provide absolute quantitation as program (40). Final refinement statistics are summarized in Table II. The Downloaded from previously described (30). final models were validated using the Protein Data Bank validation Web site, and submitted to Protein Data Bank database (http://www.rcsb.org/pdb/home/ Circular dichroism home.do; accession nos. 4PV8 [Kb/Q600F] and 4PV9 [Kb/Q600V]). The total number of intermolecular bonds was calculated using the CCP4 pro- CD spectra were recorded using an AVIV 410-SF CD spectrometer. gramsuite(37)withacut-offof4A˚ being used for the van der Waals, 3.5 A˚ Wavelength scans were performed between 190 and 250 nm using a 1-mm- for hydrogen bonds, and 5 A˚ for salt bridges. path length quartz cuvette at 20˚C with a sample concentration of 0.178 mg/ml in 10 mM Tris and 150 mM NaCl (pH 8). For thermal denaturation Statistics http://www.jimmunol.org/ scans, ellipticity at 218 nm was monitored between 20 and 90˚C in 0.5˚C steps. Data were normalized and then fit to a Boltzmann sigmoidal curve. Two-tailed, unpaired Student t tests were used to analyze differences The temperature at which 50% of the protein complex was unfolded was in mean values between groups except where indicated. All results are expressed as means 6 SEM. A p value , 0.05 was considered significant. determined (melting temperature [tm]).

Preparation of brain-derived leukocytes Results Brain-derived mononuclear cells were isolated as previously described (31). Increased Kb/S598 abundance enhances functional avidity Briefly, mice were perfused with PBS and brains were harvested, dispersed using 25-gauge needles, and digested with collagenase D (1 mg/ml; Roche Heteroclitic CD8 T cell epitopes often augment the stability of the Diagnostics) and DNase I (0.1 mg/ml; Roche Diagnostics) at 37˚C for pMHC, which should increase the effective surface expression of by guest on September 30, 2021 30 min. Mononuclear cells were isolated by passing homogenized tissue the epitope. However, whether increased surface epitope expres- through a 70-mm cell strainer, followed by centrifugation through a 30% sion actually results in enhanced functional avidity is not estab- Percoll gradient (Pharmacia, Uppsala, Sweden). lished. Because it is not possible to increase epitope expression in Intracellular cytokine staining and functional avidity analysis the context of an rJ infection, we investigated the relationship between total pMHCI displayed and functional avidity of the T cell Mononuclear cells were harvested from the brains or spleens of mice at 7 d response by using a set of VacV that expressed epitope S598 or postinfection (p.i.) and analyzed for expression of IFN-g by an intracellular cytokine assay as previously described (32). Briefly, brain- S510 at widely varying levels. In one construct, the epitopes were derived cells were stimulated in the presence of APCs (CHB3 cells, expressed from a soluble form of the S protein (VacV-S), whereas B cell line, I-Ab,H-2Db,H-2Kb) pulsed with the indicated peptide for 6 h in another set of VacV constructs, epitopes S598 and S510 were at 37˚C in the presence of 1 ml/ml GolgiPlug (BD Pharmingen). expressed as minigenes (VacV-S598 and VacV-S510; Fig. 1A). Splenocytes were similarly exposed to peptides, but in the absence of exogenous APCs. Peptides were used at a final concentration of 1 mM, Previous reports indicated that epitope expression from a mini- unless indicated otherwise. Cells were stained with Abs specific for CD8 gene results in elevated pMHCI surface levels and high-magnitude (53-6.7; BD Pharmingen), CD4 (RM 4-5; BD Pharmingen), CD16/CD32 T cell responses (41, 42). We confirmed these results using DC2.4 (2.4G2; BD Pharmingen), and IFN-g (XMG1.2; eBioscience) and ana- cells (H-2b–restricted) infected in vitro with each construct, with lyzedbyflowcytometryusingaFACSCaliburoraFACSVerse(BD levels of peptide S510 or S598 measured by targeted liquid Biosciences, Mountain View, CA). Data sets were analyzed using FlowJo software (Tree Star, Ashland, OR). To assess functional avidity, chromatography–multiple reaction monitoring–mass spectrometry splenocytes or brain-derived mononuclear cells isolated at day 7 p.i. 4 h p.i. as previously described (29, 30) (Table I). Examination of were stimulated with graded doses of the relevant peptide and examined peptides eluted from immunoaffinity purified Kb- and Db-peptide for INF-g production. The frequency of CD8 T cells producing IFN-g at complexes derived from cells infected with VacV-S598 or VacV- each concentration of peptide was measured and expressed as a percentage of the maximum response detected. Data were fit to sigmoidal S510 revealed detectable levels of S598 and S510 (Fig. 1B). dose–response curves and used to calculate the amount of peptide needed Quantification performed using an isotopically labeled S598 to reach a half-maximum response (EC50). standard (see Materials and Methods) indicated that ∼3000 copies of Kb/S598 were present per infected cell (Fig. 1C). In contrast, Immunization with peptide-coated dendritic cells neither peptide was detectable from cells infected with VacV-S, Splenic dendritic cells (DCs) were isolated after s.c. injection of B6 mice suggesting very low levels of Ag presentation from this VacV with 5 3 106 B16 cells expressing Flt3L (provided by M. Prlic and recombinant (a limit of detection of 30–60 copies of Kb/S598 was M. Bevan, University of Washington), pulsed with the indicated pep- calculated based on the efficiency of detection of the isotopically tides (10 nM, 100 nM, or 1 mM final concentration), and injected i.v. into mice as previously described (33). Mice were sacrificed 6 d later labeled S598* peptide standard) (Fig. 1B, 1C). As a control (29), and epitope S598–specific T cell responses were measured in the spleen we found equivalently high levels of a VacV-derived peptide (the b as described above. immunodominant K -restricted epitope B820–27, TSYKFESV) from 5248 HETEROCLITIC EPITOPES IN CORONAVIRUS ENCEPHALOMYELITIS

T cell response, similar to that induced by S598 in the rJ-infected brain (14) or rJ in the spleen after i.p. inoculation (Fig. 2D). Re- markably, however, infection with VacV-S598 gave rise to a population of T cells with signiﬁcantly greater sensitivity to S598, requiring ∼1000-fold less peptide to achieve a half-maximum response (Fig. 2B, 2C). Thus, increased abundance of the Kb/ S598 complex resulted in the greater accumulation of CD8 T cells with high functional avidity. An alternative explanation for these results is that peptide processing was different when S598 was expressed from a minigene versus intact S protein. However, minimal CD8 T cell responses to peptides with N- or C-terminal extensions or partial overlap with S598 (RCQIFANIL, RCQIFA- NILL, DRCQIFANI, CQIFANIL, QIFANILL) were detectable after immunization with VacV-S (data not shown) and none of these extended forms could be detected by liquid chromatography– tandem mass spectrometry (data not shown), together suggesting that the same formulation of epitope S598 was recognized after immunization with either VacV construct.

During JHMV infection, the immunodominant epitope S510 Downloaded from generates a high–functional avidity CD8 T cell response (24, 43). To determine whether increasing the levels of Db/S510 would also enhance the functional avidity of this already potent response, mice were infected with VacV-S or VacV-S510. We observed similar frequencies of CD8 T cells speciﬁc for S510 in mice

infected with either virus (Fig. 2E). In sharp contrast to S598, http://www.jimmunol.org/ equivalently high–functional avidity S510-specific CD8 T cell FIGURE 1. Detection of peptides S598, S510, and B820–27 complexed responses were generated in response to infection with either with H-2K/Db.(A) Schematic of VacV constructs expressing the full length VacV-S (low Db/S510 expression) or VacV-510 (high Db/S510 S protein of JHMV (VacV-S) or the epitopes S598 or S510 as a minigene expression) (Fig. 2F, 2G). (VacV-S598 and VacV-S510, respectively). Also shown are the relative To address whether the functional avidity of the virus-specific levels of Kb/S598 or Db/S510 exhibited by each VacV construct and the response was broadly altered by infection with VacV expressing functional avidity of the responses they elicit. (B) Detection of S598, S510, b the S protein versus a minigene construct, we examined the CD8 and vaccinia-derived B820–27 eluted from H-2 -peptide complexes at 4 h p.i. with VacV-S, VacV-S510, or VacV-S598. Data show MRM traces T cell response to VacV epitope B820–27. The percentages of CD8 by guest on September 30, 2021 (single Q1→Q3 transition shown for clarity). Data are from one of three T cells specific for B820–27 were similar in the spleens of mice independent experiments. (C) Calculated epitope abundance of S598 from infected with VacV-S, VacV-S598, or VacV-S510 (Fig. 2H). Ad- each of the VacV constructs. Isotopically labeled S598 (S598*) was in- ditionally, each virus construct induced high–functional avidity troduced at the time of epitope elution to control for peptide recovery and B820–27-specific CD8 T cell responses, with equivalent EC50 facilitate absolute quantification. Individual Q1→Q3 transition m/z values values (Fig. 2I, 2J). Taken together, these results suggest that the are indicated. observed differences in the functional avidity of the T cell responses to S598 are most likely the consequence of different cells infected with all three viruses (Fig. 1B). Of note, we could levels of cognate Ag. not examine surface levels of epitopes S598 or S510 in rJ-infected cells because we could not identify a Db+/Kb+ cell line that was Heteroclitic S598 analogs induce higher functional avidity susceptible to efficient infection with rJ. S598-specific CD8 T responses Next, we assessed the magnitude and functional avidity of the We previously showed that whereas the heteroclitic Q600Y peptide S598-specific CD8 T cell response induced by low (VacV-S) elicited a higher functional avidity S598-specific CD8 T cell and high (VacV-S598) levels of S598. For this purpose, we i.p. response than did the native S598 epitope, only a fraction of infected B6 mice with either VacV-S or VacV-S598 and assessed Q600Y-primed cells recognized the native epitope (14). An ideal the magnitude of the response in the spleen at day 7 p.i. by heteroclitic analog would increase the number of high-affinity measuring the percentage of CD8 T cells producing IFN-g in virus-specific effectors while minimizing the expansion of cells response to ex vivo stimulation with S598 peptide. S598-specific that fail to recognize the native viral epitope. To try to achieve CD8 T cells were detected using cytokine expression because Kb/ this, we selected four additional amino acid substitutions (Val, S598 tetramer exhibits poor binding and detects only a minority Phe, Glu, Pro) at position three of the S598 epitope that were of S598-specific CD8 T cells identified after peptide stimulation predicted to be heteroclitic based on our previous work (14). (S. Perlman, unpublished observations). VacV-S598 elicited a signifi- These modifications were chosen because they are nonhomolo- cantly higher percentage of S598-specific CD8 T cells than did gous, bulky substitutions, similar to the Gln to Tyr change in our VacV-S (Fig. 2A). original study. Gln has a polar uncharged side chain, Val, Phe, and To assess the functional avidity of the resultant S598-specific Pro, similar to Tyr, contain hydrophobic side chains, and Glu T cell populations, splenocytes from mice infected with VacV-S is a charged homolog of Gln. One of these variants (Q600E, or VacV-S598 were stimulated with graded doses of S598 pep- RCEIFANI) was not immunogenic when examined in preliminary tide and examined for IFN-g production (Fig. 2A–C). We assessed experiments (data not shown). We engineered recombinant JHMV relative functional avidity by determining the peptide concentra- encoding the Q600F or Q600V substitutions (rJ.S598Q600F and tion needed to reach a half-maximum response (EC50). Infection rJ.S598Q600V) (Fig. 3A) but could not develop a recombinant virus with VacV-S induced a low–functional avidity S598-specific CD8 containing the Q600P substitution, most likely because the P The Journal of Immunology 5249

Table I. MRM transitions used to monitor for JHMV and VACV epitopes

Epitope Sequence Q1 m/z (Charge) Q3 m/z (Ion) Dwell Time (ms) Optimal Collision Energy

B820–27 (VacV) TSYKFESV 480.7 (+2) 609.3 (y5)25 28 655.3 (SYKFE) 25 30 756.4 (b6)25 22 772.4 (y6)25 23 843.4 (b7)25 22 859.4 (y7)25 25 S598 (JHMV) RCQIFANI 482.8 (+2) 501.3 (b4)40 22 648.3 (b5)40 22 719.4 (b6)40 22 833.4 (b7)40 22 S510 (JHMV) CSLWNGPHL 513.7 (+2) 423.2 (y4)40 20 537.3 (y5)40 20 723.4 (y6)40 20 836.4 (y7)40 20 substitution was detrimental to virus viability. As shown in S598 complex formation required substitution of the cysteine of Fig. 3B, both rJ.S598Q600F and rJ.S598Q600V exhibited similar the peptide (RCQIFANI) with L-a-aminobutyric acid (Aba, an Downloaded from in vitro growth kinetics as did JHMV encoding native S598 (rJ), isostereomer of cysteine). This modification at the P2-Cys does indicating that the mutations do not greatly affect virus fitness. not affect epitope recognition (14). Thus Aba-modified peptides Initially, we showed that, similar to Q600Y (14), Q600F and were used in both these analyses and the structural studies below. Q600V enhanced the thermostability of the Kb/peptide complexes We next examined the epitope-specific CD8 T cell responses (tm = 62.7 6 0.4˚C and 60.2 6 0.2˚C, respectively) compared with in the brains of B6 mice intranasally infected with rJ or one of b b wild-type K /S598 (tm = 56.2 6 1.9˚C) (Fig. 3C). Efficient K / its variants. In mice infected with rJ.S598Q600Y (Fig. 4A, 4B), http://www.jimmunol.org/ by guest on September 30, 2021

FIGURE 2. Increasing abundance of Kb/S598 enhances functional avidity. B6 mice were i.p. infected with VacV-expressing epitopes S598 or S510 as a minigene or a soluble form of the S protein of JHMV or with rJ. (A–C) Magnitude and functional avidity of S598-specific CD8 T cell response in spleens of mice infected i.p. with VacV-S or VacV-S598 at day 7 p.i. (D) Functional avidity of S598-specific CD8 T cell response in spleens of mice infected i.p. with VacV-S or rJ. (E–G) Magnitude and functional avidity of S510-specific CD8 T cell response in spleens of mice infected i.p. with VacV-S or VacV-S510 at day 7 p.i. (H–J) Magnitude and functional avidity of B820–27-specific CD8 T cell response in spleens of mice infected i.p. with VacV-S, VacV-S598, or VacV-S510 at day 7 p.i. Data are representative of three independent experiments and presented as the means 6 SEM (n = 3–4 mice/group). *p , 0.05, ***p , 0.001. 5250 HETEROCLITIC EPITOPES IN CORONAVIRUS ENCEPHALOMYELITIS

Most notably, Q600V induced the greatest proportion of cells with the desired speciﬁcity, with nearly all (∼98%) of the Q600V- reactive T cells also recognizing native S598 (Fig. 4E, 4F and summarized in Fig. 4G). Additionally, cells primed by Q600F or S598 exhibited the greatest level of bidirectional cross-reactivity, with most of the S598-primed cells recognizing the Q600F variant (Fig. 4C and summarized in Fig. 4D). In contrast, only a small fraction of S598-primed CD8 T cells recognized Q600Y or Q600V peptide (Fig. 4A, 4E, upper right panels and summarized in Fig. 4B, 4F). Because all of the S598 variants primed high-magnitude responses to S598, we next determined whether these responses exhibited higher functional avidity when reacted against S598 peptide than those induced by the native epitope. As shown in Fig. 5, all of the variants gave rise to CD8 T cell responses with lower EC50 than observed in rJ-infected mice. Cells primed by rJ.S598Q600Y or rJ.S598Q600F required ∼10-fold less peptide 28 28 (EC50 = 1.7 3 10 and 1.3 3 10 M, respectively) than 2

7 Downloaded from did the rJ-primed cells (EC50 = 1.5 3 10 M) to achieve a half-maximum response, whereas CD8 T cells selected by 29 rJ.S598Q600V (EC50 =2.23 10 M) exhibited even greater potency for S598 (Fig. 5A, 5B). These results indicate that peptide Q600V is an ideal heteroclitic epitope, inducing a high-avidity, highly cross-reactive response to the native S598 epitope. b The results described in Fig. 2 suggest that higher K /S598 http://www.jimmunol.org/ complex density resulted in a T cell response with higher functional avidity. To determine whether Kb/Q600V or Kb/Q600Y was also displayed at a higher density, we used two complementary approaches. First, we infected DC2.4 cells with VacV expressing S598, Q600V, or Q600Y as minigenes and assayed the expression of MHCI complexed with each peptide. Levels of peptide were lower from cells infected with VacV-S598 compared with cells infected with VacV expressing either variant (Fig. 6A), whereas by guest on September 30, 2021 levels of VacV-specific epitopes (B820–27) were similar in all infections. In a second approach, we reasoned that because S598 bound less stably to MHCI than did the variant peptides, it would exhibit lower surface levels after pulsing and washing. If this occurred, DCs coated with S598 would be expected to induce a lower CD8 T cell response after inoculation into mice, and this response should be of lower functional avidity. To address this possibility, we immunized mice with DCs pulsed with S598 or Q600V peptide and measured T cell responses. As shown in Fig. 6B, responses were detected to both peptides, but were much FIGURE 3. Development of rJ-expressing S598 variants exhibiting lower to S598 than Q600V; the response to S598 was so low that it greater Kb binding. (A) Schematic depiction of recombinant JHMV precluded further analyses of functional avidity. Taken together, expressing native S598 (rJ), the Q600Y substitution (rJ.S ), the Q600F Q600Y these results suggest that the surface levels of the epitopes with substitution (rJ.SQ600F), or the Q600V substitution (rJ.SQ600V). (B) In vitro higher functional avidity (Q600Y and Q600V) were substantially growth kinetics of rJ, rJ.SQ600F, and rJ.SQ600V. Data are representative of two independent experiments and presented as the means 6 SEM. *p , higher than levels of S598 when expressed endogenously or after ### 0.05, ***p , 0.001 (rJ versus rJ.SQ600F); p , 0.001 (rJ versus loading exogenously and a period of chase in vivo. C rJ.SQ600V). ( ) Summary of circular dichroism thermal denaturation scans b b b b Structures of H-2K in complex with the heteroclitic Q600V of K /S598, K /Q600F, and K /Q600V complexes used to calculate tm (parentheses). Data are from two independent experiments. and Q600F peptides To understand the structural requirements for the generation of rJ.S598Q600F (Fig. 4C, 4D), or rJ.S598Q600V (Fig. 4E, 4F), a high heteroclitic peptides that elicit almost exclusively cross-reactive frequency (35–40%) of brain-derived CD8 T cells recognized their T cells, such as the Q600V analog, we determined the crystal cognate Ag with the variant S598-specific T cell response structures of Kb/Q600V and Kb/Q600F and compared these to emerging as the immunodominant population. Concomitantly, the those of Kb/S598 and Kb/Q600Y (Fig. 7), which we previously frequency of the S510-specific T cell response contracted relative determined (14). As in the thermostability experiments (Fig. 3C), to that induced in mice infected with wild-type rJ (summary data the use of Aba-modified peptides was required for efficient Kb/ shown in Fig. 4B, 4D, 4F). Additionally, most of the CD8 T cells S598 complex formation. The structures of the Kb molecule in primed by each of the variants cross-reacted to native S598 complex with the Q600V and Q600F mutants of the S598 epitope (summarized in Fig. 4G). Approximately 75% of CD8 T cells were solved to a resolution of 2.0 and 2.3 A˚ , respectively (Table II). primed by Q600Y or Q600F produced IFN-g when stimulated The structures of the pMHCI were consistent with the previously with native S598 peptide (Fig. 4A–D and summarized in Fig. 4G). solved Kb structure in complex with the wild-type S598 epitope The Journal of Immunology 5251

FIGURE 4. S598 variant epitopes induce a high proportion of S598- reactive CD8 T cells. Brain-derived leukocytes were isolated from mice infected with either rJ, rJ.S598Q600Y, rJ.S598Q600F, or rJ.S598Q600V at day 7 p.i. (A–F) Representative ﬂow Downloaded from cytometry plots (A, C, E) and frequencies (B, D, F) of CD8 T cells producing IFN-g upon stimulation with the indicated peptides are shown. (G) The percentages of variant-speciﬁc CD8 T cells that pro- http://www.jimmunol.org/ duced IFN-g in response to stimulation with S598 peptide are shown. Data are representative of three independent experiments with three to four mice/group/experiment and are presented as the means 6 SEM. by guest on September 30, 2021

(Fig. 7A), with a root mean square deviation (r.m.s.d.) of 0.25 A˚ of acid substitution or involved other parts of the interface. For b the Cas on the a1a2 domains of the K molecule (Fig. 7). The Q600Y and Q600V, the increased number reﬂected the amino acid peptides adopted a similar conformation to that observed for the substitution: P3-Y had almost twice as many bonds as P3-Q. This S598 epitope, namely P1-Arg, P4-Ile, and P7-Asn were solvent- was also true for P3-V, but to a lesser extent. For Q600F, the exposed whereas P2-Aba, P3-Val/Phe, P5-Phe, and P8-Ile were situation was more complex, as we observed fewer bonds to P3-F buried in the Ag-binding cleft (Fig. 7). The peptides shared compared with P3-Y, with a higher number of bonds spread over a highly similar structure, with an r.m.s.d. of 0.10 and 0.14 A˚ on the epitope, reﬂecting modest side-chain movement. This was an the Ca atoms, respectively, for the Q600V (Fig. 7D) and Q600F indirect consequence of the P3-F mutation because all other (Fig. 7C) compared with the native S598 epitope. Thus, there were parameters were the same (resolution, space groups, crystalliza- minimal structural perturbations in the pMHCI structures relative tion conditions). to the wild-type complex (Fig. 7E, 7F). The Kb/Q600F and Kb/Q600Y structures were very similar with ˚ The three heteroclitic pMHC complexes exhibit a higher tm than an r.m.s.d. of 0.36 A (Fig. 7E), with the large aromatic residues at does the native S598 pMHC complex (Fig. 3C and Ref. 14), which P3 perfectly accommodated in the D pocket of the Kb binding was associated with a higher number of intermolecular bonds cleft (Fig. 8). In the Kb/S598 complex, P3-Gln occupies a similar observed in the pMHC structures, calculated using the CCP4 position (Fig. 8A); however, the larger side chains of tyrosine program suite as described in Materials and Methods (169, 175, (Fig. 8B) and phenylalanine at P3 (Fig. 8C) contacted Arg155,an 190, and 194 intermolecular bonds for S598, Q600V, Q600Y, and interaction that was not observed for the native S598 epitope or Q600F respectively, Table III). Next we addressed whether the the Q600V epitope (Fig. 8). Notably, although the overall struc- higher number of bonds was a direct consequence of the amino tures were similar, the substitution of the P3 residue by an aro- 5252 HETEROCLITIC EPITOPES IN CORONAVIRUS ENCEPHALOMYELITIS

epitope (Fig. 3). This shows that the structural rearrangements observed in the Kb molecule bound to the Q600V peptide resulted in compensatory interactions to accommodate and stabilize the shorter side chain of this buried P3 Val. Altogether, the pMHC structures show that the heteroclitic peptides adopt a similar conformation to the one observed for the native S598; however, they display some specific features. The Q600F and Q600Y, with a larger aromatic group at position 3, changed the environment of a key MHC residue, Arg155, by directly interacting with it. In contrast, the Kb/ Q600V structure shows that a smaller side chain could be accom- b FIGURE 5. S598 variant epitopes, Q600Y, Q600F, and Q600V induce modated, without becoming unstable in the K cleft, by rear- higher functional avidity S598-specific CD8 T cell responses than does rangement of a buried MHC residue. the native epitope. Brain-derived leukocytes isolated from mice infected with either rJ, rJ.SQ600Y, rJ.SQ600F, or rJ.SQ600V at day 7 p.i. were stimulated directly ex vivo with 10-fold dilutions of native S598 peptide. The per- Discussion centage of CD8 T cells producing IFN-g at each concentration was de- Heteroclitic epitopes are a subset of peptide analogs known as termined and normalized to the maximum frequency of S598-specific CD8 altered-peptide ligands that were first used to enhance T cell T cells detected. The data were fit to sigmoidal dose–response curves (A) responses to tumors (13, 47). Because tumor Ags are self- (rJ, solid black; rJ.S , solid gray; rJ.S , dashed; rJ.S , dotted) Q600Y Q600F Q600V derived, antitumor T cells need to escape negative selection in Downloaded from B and used to calculate EC50 values ( ) for each mouse. Data are repre- the thymus and tend to have low affinity for the pMHC. In con- 6 sentative of three individual experiments and presented as the means trast, high-affinity pathogen-specific T cells are not eliminated by SEM (n = 3–4 mice/group). *p , 0.05, **p , 0.01. central tolerance mechanisms so that during an infection, T cells with a broad range of affinities for their cognate Ag are recruited matic group changed the immediate environment of Arg155, into the response. Despite the presence of high-affinity pathogen- typically a key MHC position for T cell recognition (44–46) specific T cells in the periphery, some of these T cell responses http://www.jimmunol.org/ (Fig. 8B, 8C). exhibit low functional avidity. Under these circumstances, im- The overall structures of the Kb molecule complexed with the munization with heteroclitic epitopes provides a useful approach native S598 or Q600V were very similar (r.m.s.d of 0.33 A˚ on the to enhance the functional avidity of the pathogen-specific T cell Ca atoms). However, we observed local changes in the MHC response (14). T cells with increased functional avidity are asso- structure that likely contributed to the observed immunological ciated with more efficient pathogen clearance in vivo (3, 8, 48) differences (Fig. 7F). Namely, the shorter side chain of the valine and, as we showed previously, with the prevention of CTL escape; created space around the P3 residue, allowing the side chain of for instance, the presence of the high–functional avidity Q600Y Leu156 of the Kb H chain to reorient to reach the smaller P3 epitope was able to prevent CTL escape at epitope S510 in mice 156 b residue (Fig. 8E). The conformation of Leu in the K /Q600V infected with rJ (14). by guest on September 30, 2021 complex would cause steric clashes with a larger side chain at P3. Our results now highlight a possible mechanism for how such The shorter P3 side chain also allowed the Arg155 guanidinium heteroclitic peptides function: heteroclitic peptides enhance head group to move closer to the peptide, changing the position of pMHC stability and consequent epitope dwell time on the cell a stretch of the a2 helix compared with that observed with the surface, thereby increasing effective surface epitope density. This native S598 epitope (146 to 157, r.m.s.d. = 0.54 A˚ , maximum induces a T cell response with higher functional avidity. This displacement of 0.91 A˚ for the Gly151 Ca). Surprisingly the suggests that increasing the Ag density presented to T cells that Q600V peptide, similar to Q600Y, increased the stability of the Kb/ typically develop a low-avidity T cell response reprograms the Q600V complex compared with Kb complexed with the native S598 T cell response and generates higher avidity responses. This is

b FIGURE 6. Abundance of native and variant S598 peptides. (A) Calculated abundance of peptides S598, Q600Y, Q600V, and B820–27 eluted from H-2K complexes following infection with the indicated VacV constructs. Three biological replicates are shown for each infection. Differences were analyzed using a two-way ANOVA test. **p , 0.01, ***p , 0.001. (B and C) S598-specific CD8 T cell response after immunization with DCs coated with 10 nM, 100 nM, or 1 mM S598 or Q600V. Cells were stimulated with 1 mM peptide S598 directly ex vivo. Representative flow cytometry plots for DCs coated with 100 nM peptide (B) and summary data (C) are shown. Summary data from one experiment with four individual mice are shown. Data are representative of three separate experiments. *p , 0.05. The Journal of Immunology 5253 Downloaded from http://www.jimmunol.org/ FIGURE 7. Structures of S598/Kb, Q600Y/Kb, Q600F/Kb, and Q600V/Kb complexes. The Kb molecule is represented in cartoon with the peptide in stick; all panels are in the same orientation. The MHC is colored the same as the bound peptide: white for S598 (A), blue for Q600Y (B), orange for Q600F (C), and pink for the Q600V (D). The P3 residue is in yellow stick on all peptides. (E) Superposition of the Kb/Q600Y (blue) and Kb/Q600F (orange) complexes. (F) Superposition of the Kb/S598 (white) and Q600V/Kb (pink) complexes. consistent with antigenic competition during T cell expansion that an S598 minigene. After infection, Kb/S598 complexes were not can be overcome by increasing the Ag density (49). detected at quantifiable levels from cells infected with VacV-S In this study, the relationship between total pMHC being dis- despite functional recognition of infected cells (Figs. 1B, 2A), played and functional avidity was first demonstrated using mice whereas high levels of Kb/S598 were present following VacV- by guest on September 30, 2021 infected with recombinant VacV expressing either the S protein or S598 minigene infection. This increased expression of Kb/S598

Table II. Data collection and reﬁnement statistics

H-2Kb-Q600V H-2Kb-Q600F Data collection statistics Temperature 2173˚C 2173˚C Space group P21 P21 Cell dimensions (a, b, c)(A˚ ) 66.47, 90.75, 89.52 66.46, 90.99, 89.61 (˚) b = 111.57 b = 111.65 Resolution (A˚ ) 100 – 2.0 (2.2–2.0) 100 – 2.3 (2.5–2.3) Total number of observations 275,720 (68,922) 155,539 (31,982) Number of unique observations 65,401 (16,113) 42,500 (8,686) Multiplicity 4.2 (4.2) 3.6 (3.7) Data completeness (%) 97.7 (97.2) 96.1 (89.4) I/sI 12.1 (4.3) 11.6 (3.9) a Rmerge (%) 9.7 (44.1) 7.7 (45.3) Reﬁnement statistics Nonhydrogen atoms Protein 6,436 6,436 Water 787 401 b Rfactor (%) 17.32 17.03 b Rfree (%) 21.79 21.65 Rms deviations from ideality Bond lengths (A˚ ) 0.010 0.010 Bond angles (˚) 1.08 1.13 Ramachandran plot (%) Allowed region 99.2 99.0 Generously allowed region 0.8 0.8 Disallowed region 0 0.2 Values in parentheses are for the highest resolution shell. a Rmerge = S|Ihkl 2,Ihkl.|/SIhkl. b Rfactor = Shk||Fo| 2 |Fc||/Shkl|Fo| for all data except ∼5%, which were used for Rfree calculation. 5254 HETEROCLITIC EPITOPES IN CORONAVIRUS ENCEPHALOMYELITIS

Table III. Distribution of intermolecular bonds (3) and an in vivo study showing no increase in functional avidity (51) as the surface epitope density increased. The major Epitope Nb bond VDW HB SB difference between these reports and ours is that the T cell re- S598 169 150 18 1 sponse to epitope S598 normally exhibits low functional avidity Q600Y 190 169 20 1 whereas epitopes with high–functional avidity responses were Q600F 194 174 19 1 examined in the published studies. Consistent with this notion, Q600V 175 159 15 1 enhancement in functional avidity of the response to epitope S510 was not observed when VacV-S510–infected mice were compared with those infected with VacV-S (Fig. 2E–G). This complexes resulted in greatly enhanced functional avidity of the occurred even though analogously to Kb/S598, expression of the responding cells (Fig. 2B, 2C) and a modest increase in the Db/S510 complex was detectable by mass spectrometry in VacV- magnitude of the S598-speciﬁc CD8 T cell response (Fig. 2A). S510–infected cells but not when expressed from VacV-S These observations indicate that increased display of Kb/S598 (Fig. 1B, 1C). provides sufﬁcient signal to enhance the T cell response to this To determine whether heteroclitic epitopes have the same normally subdominant epitope and fosters the generation of physiological effect as increasing the pMHC abundance of the high-avidity T cells. Increases in magnitude of response in vivo native epitope, we examined the capacity of two new and one as epitope density increased have been reported previously (20, established S598 analog to elicit high–functional avidity T cell 50), but our results are in marked contrast with in vitro studies responses that cross-reacted on the wild-type epitope (Figs. 4, that showed diminished functional avidity of responding T cells 5). Viruses expressing each of the S598 analogs all elicited higher Downloaded from http://www.jimmunol.org/ by guest on September 30, 2021

FIGURE 8. Detail of the Ag-binding cleft in the region surrounding position 3 of the peptide. The Kb cleft is represented as ribbon, with key residues in stick; the peptides are represented as stick with the P3 amino acids colored in yellow. The color scheme is consistent with Fig. 6: Kb/Q600Y in blue (A), Kb/Q600F in orange (B), Kb/S598 in white (C), Kb/Q600Y, Kb/Q600F, and Kb/S598 superimposed (D), and the Kb/Q600V in pink superimposed with the Kb/S598 on panel (E). Hydrogen bonds are represented by red dashed lines, and van der Waals interactions by blue dashed lines. The spheres represent the Ca atom of the Gly151 from the Kb molecule. The Journal of Immunology 5255 avidity T cell responses compared with the wild-type infection, the pMHCI complex, which will help guide the rational design with Q600V in particular generating T cells with almost two logs of these altered ligands in the setting of vaccine development. greater functional avidity when stimulated with the native peptide Furthermore, understanding T cell engagement with the pMHC (Fig. 5). Moreover, the numbers of Kb/Q600Y or Kb/Q600V complex will clearly also be important in designing effective, highly complexes were significantly greater than those of Kb/S598 from cross-reactive heteroclitic epitopes. Notably, although we analyzed cells infected with VacV-expressing minigenes (Fig. 6A). Taken T cell epitopes expressed by a murine coronavirus, the results may together, these results suggest that heteroclitic epitopes act in part be useful for the design of vaccines directed against pathogenic by increasing the surface density of immunogenic and cross- human coronaviruses, such as severe acute respiratory syndrome– reactive epitopes. Whether these results are valid for all or most coronavirus, which also requires a robust T cell response for ef- heteroclitic epitopes and whether this is the sole or major basis of ficient virus clearance (56, 57). the heteroclitic effect of such epitopes will require further inves- tigation. Thus, although we modified an anchor residue in the Acknowledgments peptide that enhanced binding to the MHCI molecule, this mod- We thank Dr. David Tscharke for helpful discussions. ification may also have altered T cell binding (52), contributing to the heteroclitic effect that we observed. The design of heteroclitic epitopes remains empiric, with the Disclosures rules for determining optimal configuration not established. The The authors have no financial conflicts of interest. two additional heteroclitic epitopes (Q600F and Q600V) that we identified augmented recognition of the native S598 epitope to References Downloaded from a similar degree (Fig. 4C–F). As Tyr and Phe are structurally 1. Croft, N. P., and A. W. Purcell. 2011. Peptidomimetics: modifying peptides in similar, the Q600F would have been predicted to behave similarly the pursuit of better vaccines. Expert Rev. Vaccines 10: 211–226. to the Q600Y epitope; structural and thermostability analyses of 2. Purcell, A. W., J. McCluskey, and J. Rossjohn. 2007. More than one reason to b rethink the use of peptides in vaccine design. Nat. Rev. Drug Discov. 6: 404–414. K /Q600F support this conclusion (Figs. 3C, 7, 8). Less clear is 3. Alexander-Miller, M. A., G. R. Leggatt, and J. A. Berzofsky. 1996. Selective why cells primed with the native epitope are able to respond to expansion of high- or low-avidity cytotoxic T lymphocytes and efficacy for adoptive immunotherapy. Proc. Natl. Acad. Sci. USA 93: 4102–4107. APCs coated with peptide Q600F when there is virtually no rec- http://www.jimmunol.org/ 4. Zeh, H. J., III, D. Perry-Lalley, M. E. Dudley, S. A. Rosenberg, and J. C. Yang. ognition of the Q600Y epitope (Fig. 4A–D). The latter is not 1999. High avidity CTLs for two self-antigens demonstrate superior in vitro and explained by gross differences in T cell populations responding to in vivo antitumor efficacy. J. Immunol. 162: 989–994. S598 and Q600Y, at least based on Vb usage (14). The structural 5. Gallimore, A., T. Dumrese, H. Hengartner, R. M. Zinkernagel, and b H. G. Rammensee. 1998. Protective immunity does not correlate with the hi- resemblance of the Q600F and Q600Y epitopes bound to the K erarchy of virus-specific cytotoxic T cell responses to naturally processed pep- Ag-binding cleft blur cross-reactivity pattern differences between tides. J. Exp. Med. 187: 1647–1657. 6. Sedlik, C., G. Dadaglio, M. F. Saron, E. Deriaud, M. Rojas, S. I. Casal, and the two epitopes. The design of heteroclitic peptides is largely C. Leclerc. 2000. In vivo induction of a high-avidity, high-frequency cytotoxic T- based on increased stability of the pMHC, which for most epitopes lymphocyte response is associated with antiviral protective immunity. J. Virol. results in enhanced T cell activity. However, the natural plasticity 74: 5769–5775. 7. Neveu, B., E. Debeaupuis, K. Echasserieau, B. le Moullac-Vaidye, M. Gassin, by guest on September 30, 2021 of the epitope has been shown to be crucial for some TCRs to L. Jegou, J. Decalf, M. Albert, N. Ferry, J. Gournay, et al. 2008. Selection of dock appropriately onto their pMHC targets (53, 54). The new high-avidity CD8 T cells correlates with control of hepatitis C virus infection. network interactions of the modified P3-Tyr residue with Arg155 Hepatology 48: 713–722. 152 8. Almeida, J. R., D. A. Price, L. Papagno, Z. A. Arkoub, D. Sauce, E. Bornstein, and Glu , observed only in Q600Y (Fig. 7B), could explain the T. E. Asher, A. Samri, A. Schnuriger, I. Theodorou, et al. 2007. Superior control cross-reactivity pattern differences observed when Kb/Q600Y and of HIV-1 replication by CD8+ T cells is reflected by their avidity, poly- b b functionality, and clonal turnover. J. Exp. Med. 204: 2473–2485. K /Q600F or K /S598 are compared. 9. Bullock, T. N., D. W. Mullins, T. A. Colella, and V. H. Engelhard. 2001. Ma- The second heteroclitic epitope Q600V encodes P3-Val, an nipulation of avidity to improve effectiveness of adoptively transferred CD8+ amino acid that has a shorter side chain than the aromatic Phe or T cells for melanoma immunotherapy in human MHC class I-transgenic mice. J. Immunol. 167: 5824–5831. Tyr; with the latter being the most frequently detected subanchor in 10. Speiser, D. E., P. Baumgaertner, V. Voelter, E. Devevre, C. Barbey, N. Rufer, and the consensus Kb ligand binding motif (55). The structural rear- P. Romero. 2008. Unmodified self antigen triggers human CD8 T cells with rangement observed in the cleft of Kb facilitated stability of the stronger tumor reactivity than altered antigen. Proc. Natl. Acad. Sci. USA 105: 3849–3854. complex, and it might lead to reconsideration of whether P3-Val 11. Zhang, Y., Y. Liu, K. M. Moxley, L. Golden-Mason, M. G. Hughes, T. Liu, is actually a suboptimal secondary anchor residue. Indeed, mass M. H. Heemskerk, H. R. Rosen, and M. I. Nishimura. 2010. Transduction of ∼ b human T cells with a novel T-cell receptor confers anti-HCV reactivity. PLoS spectrometry–based sequencing of 500 epitopes eluted from K Pathog. 6: e1001018. showed that whereas Tyr was dominant at P3 (34%), Val was 12. Kessels, H. W., M. C. Wolkers, M. D. van den Boom, M. A. van der Valk, and detected in a significant fraction (9%) (unpublished observations). T. N. Schumacher. 2001. Immunotherapy through TCR gene transfer. Nat. Immunol. 2: 957–961. Q600V exhibited enhanced stability and presented a similar anti- 13. Dyall, R., W. B. Bowne, L. W. Weber, J. LeMaoult, P. Szabo, Y. Moroi, genic surface to the one observed for S598, thereby inducing a G. Piskun, J. J. Lewis, A. N. Houghton, and J. Nikolic´-Zugic´. 1998. Heteroclitic T cell response with nearly complete cross-reactivity with the immunization induces tumor immunity. J. Exp. Med. 188: 1553–1561. 14. Butler, N. S., A. Theodossis, A. I. Webb, R. Nastovska, S. H. Ramarathinam, native epitope (Fig. 4G). M. A. Dunstone, J. Rossjohn, A. W. Purcell, and S. Perlman. 2008. Prevention of In conclusion, we have shown that increased expression of cytotoxic T cell escape using a heteroclitic subdominant viral T cell determinant. PLoS Pathog. 4: e1000186. MHCI complexed with a peptide that induces a low–functional 15. Rosenberg, S. A., J. C. Yang, D. J. Schwartzentruber, P. Hwu, avidity T cell response or priming with heteroclitic variants that F. M. Marincola, S. L. Topalian, N. P. Restifo, M. E. Dudley, S. L. Schwarz, stabilize pMHCI enhanced the functional avidity of the ensuing P. J. Spiess, et al. 1998. Immunologic and therapeutic evaluation of a synthetic peptide vaccine for the treatment of patients with metastatic melanoma. T cell response. The use of heteroclitic peptides provides a prac- Nat. Med. 4: 321–327. tical approach to induce high–functional avidity T cell responses 16. Borbulevych, O. Y., T. K. Baxter, Z. Yu, N. P. Restifo, and B. M. Baker. 2005. by increasing the cell surface expression of weakly immunogenic Increased immunogenicity of an anchor-modified tumor-associated antigen is due to the enhanced stability of the peptide/MHC complex: implications for epitopes. Furthermore, we identified a heteroclitic epitope that elicits vaccine design. J. Immunol. 174: 4812–4820. a T cell response with nearly complete cross-reactivity to the native 17. Chen, J. L., G. Stewart-Jones, G. Bossi, N. M. Lissin, L. Wooldridge, E. M. Choi, G. Held, P. R. Dunbar, R. M. Esnouf, M. Sami, et al. 2005. Structural epitope. The structural data show that these heteroclitic epitopes and kinetic basis for heightened immunogenicity of T cell vaccines. J. Exp. Med. induce modest conformational changes in the local environment of 201: 1243–1255. 5256 HETEROCLITIC EPITOPES IN CORONAVIRUS ENCEPHALOMYELITIS

18. Bullock, T. N., D. W. Mullins, and V. H. Engelhard. 2003. Antigen density PHENIX: a comprehensive Python-based system for macromolecular structure presented by dendritic cells in vivo differentially affects the number and avidity solution. Acta Crystallogr. D Biol. Crystallogr. 66: 213–221. of primary, memory, and recall CD8+ T cells. J. Immunol. 170: 1822–1829. 39. Bricogne, G., E. Blanc, M. Brandl, C. Flensburg, P. Keller, W. Paciorek, 19. Dzutsev, A. H., I. M. Belyakov, D. V. Isakov, D. H. Margulies, and P. Roversi, A. Sharff, O. S. Smart, C. Vonrhein, and T. O. Womack. 2011. Buster J. A. Berzofsky. 2007. Avidity of CD8 T cells sharpens immunodominance. Int. Version 2.10. Global Phasing, Cambridge, U.K. Immunol. 19: 497–507. 40. Emsley, P., B. Lohkamp, W. G. Scott, and K. Cowtan. 2010. Features and de- 20. Wherry, E. J., K. A. Puorro, A. Porgador, and L. C. Eisenlohr. 1999. The in- velopment of Coot. Acta Crystallogr. D Biol. Crystallogr. 66: 486–501. duction of virus-specific CTL as a function of increasing epitope expression: 41. Anton, L. C., J. W. Yewdell, and J. R. Bennink. 1997. MHC class I-associated responses rise steadily until excessively high levels of epitope are attained. J. peptides produced from endogenous gene products with vastly different effi- Immunol. 163: 3735–3745. ciencies. J. Immunol. 158: 2535–2542. 21. Rubio, V., T. B. Stuge, N. Singh, M. R. Betts, J. S. Weber, M. Roederer, and 42. Porgador, A., J. W. Yewdell, Y. Deng, J. R. Bennink, and R. N. Germain. 1997. P. P. Lee. 2003. Ex vivo identification, isolation and analysis of tumor-cytolytic Localization, quantitation, and in situ detection of specific peptide-MHC class I T cells. Nat. Med. 9: 1377–1382. complexes using a monoclonal antibody. Immunity 6: 715–726. 22. Bergmann, C. C., T. E. Lane, and S. A. Stohlman. 2006. Coronavirus infection of 43. Butler, N. S., A. Theodossis, A. I. Webb, M. A. Dunstone, R. Nastovska, the central nervous system: host-virus stand-off. Nat. Rev. Microbiol. 4: 121–132. S. H. Ramarathinam, J. Rossjohn, A. W. Purcell, and S. Perlman. 2008. Struc- 23. van Boheemen, S., M. de Graaf, C. Lauber, T. M. Bestebroer, V. S. Raj, tural and biological basis of CTL escape in coronavirus-infected mice. J. A. M. Zaki, A. D. Osterhaus, B. L. Haagmans, A. E. Gorbalenya, E. J. Snijder, Immunol. 180: 3926–3937. and R. A. Fouchier. 2012. Genomic characterization of a newly discovered 44. Burrows, S. R., Z. Chen, J. K. Archbold, F. E. Tynan, T. Beddoe, L. Kjer- coronavirus associated with acute respiratory distress syndrome in humans. mBio Nielsen, J. J. Miles, R. Khanna, D. J. Moss, Y. C. Liu, et al. 2010. Hard wiring of 3: e00473-12. T cell receptor specificity for the major histocompatibility complex is under- 24. Castro, R. F., and S. Perlman. 1995. CD8+ T-cell epitopes within the surface pinned by TCR adaptability. Proc. Natl. Acad. Sci. USA 107: 10608–10613. glycoprotein of a neurotropic coronavirus and correlation with pathogenicity. J. 45. Gras, S., S. R. Burrows, S. J. Turner, A. K. Sewell, J. McCluskey, and Virol. 69: 8127–8131. J. Rossjohn. 2012. A structural voyage toward an understanding of the MHC-I- 25. Pewe, L., S. B. Heard, C. Bergmann, M. O. Dailey, and S. Perlman. 1999. Se- restricted immune response: lessons learned and much to be learned. Immunol. lection of CTL escape mutants in mice infected with a neurotropic coronavirus: Rev. 250: 61–81. quantitative estimate of TCR diversity in the infected central nervous system. J. 46. Valkenburg, S. A., S. Gras, C. Guillonneau, L. A. Hatton, N. A. Bird, Downloaded from Immunol. 163: 6106–6113. K. A. Twist, H. Halim, D. C. Jackson, A. W. Purcell, S. J. Turner, et al. 2013. 26. Pewe, L., S. Xue, and S. Perlman. 1998. Infection with cytotoxic T-lymphocyte Preemptive priming readily overcomes structure-based mechanisms of virus escape mutants results in increased mortality and growth retardation in mice escape. Proc. Natl. Acad. Sci. USA 110: 5570–5575. infected with a neurotropic coronavirus. J. Virol. 72: 5912–5918. 47. Fikes, J. D., and A. Sette. 2003. Design of multi-epitope, analogue-based cancer 27. Williams, R. K., G. S. Jiang, and K. V. Holmes. 1991. Receptor for mouse vaccines. Expert Opin. Biol. Ther. 3: 985–993. hepatitis virus is a member of the carcinoembryonic antigen family of glyco- 48. Speiser, D. E., D. Kyburz, U. Stubi,€ H. Hengartner, and R. M. Zinkernagel. 1992. proteins. Proc. Natl. Acad. Sci. USA 88: 5533–5536. Discrepancy between in vitro measurable and in vivo virus neutralizing cytotoxic

28. Anghelina, D., L. Pewe, and S. Perlman. 2006. Pathogenic role for virus-specific T cell reactivities. Low T cell receptor specificity and avidity sufficient for http://www.jimmunol.org/ CD4 T cells in mice with coronavirus-induced acute encephalitis. Am. J. Pathol. in vitro proliferation or cytotoxicity to peptide-coated target cells but not for 169: 209–222. in vivo protection. J. Immunol. 149: 972–980. 29. Croft, N. P., S. A. Smith, Y. C. Wong, C. T. Tan, N. L. Dudek, I. E. Flesch, 49. Dijkman, R., M. F. Jebbink, S. M. Koekkoek, M. Deijs, H. R. Jońsdo´ttir, L. C. Lin, D. C. Tscharke, and A. W. Purcell. 2013. Kinetics of antigen ex- R. Molenkamp, M. Ieven, H. Goossens, V. Thiel, and L. van der Hoek. 2013. Isolation pression and epitope presentation during virus infection. PLoS Pathog. 9: and characterization of current human coronavirus strains in primary human epithelial e1003129. cell cultures reveal differences in target cell tropism. J. Virol. 87: 6081–6090. 30. Tan, C. T., N. P. Croft, N. L. Dudek, N. A. Williamson, and A. W. Purcell. 2011. 50. Wherry, E. J., M. J. McElhaugh, and L. C. Eisenlohr. 2002. Generation of CD8+ Direct quantitation of MHC-bound peptide epitopes by selected reaction moni- T cell memory in response to low, high, and excessive levels of epitope. J. toring. Proteomics 11: 2336–2340. Immunol. 168: 4455–4461. 31. Zhao, J., J. Zhao, and S. Perlman. 2009. De novo recruitment of antigen- 51. Bullock, T. N., T. A. Colella, and V. H. Engelhard. 2000. The density of peptides experienced and naive T cells contributes to the long-term maintenance of an- displayed by dendritic cells affects immune responses to human tyrosinase and

tiviral T cell populations in the persistently infected central nervous system. J. gp100 in HLA-A2 transgenic mice. J. Immunol. 164: 2354–2361. by guest on September 30, 2021 Immunol. 183: 5163–5170. 52. Theodossis, A., C. Guillonneau, A. Welland, L. K. Ely, C. S. Clements, 32. Wu, G. F., A. A. Dandekar, L. Pewe, and S. Perlman. 2000. CD4 and CD8 T cells N. A. Williamson, A. I. Webb, J. A. Wilce, R. J. Mulder, M. A. Dunstone, et al. have redundant but not identical roles in virus-induced demyelination. J. 2010. Constraints within major histocompatibility complex class I restricted Immunol. 165: 2278–2286. peptides: presentation and consequences for T-cell recognition. Proc. Natl. Acad. 33. Pham, N. L., V. P. Badovinac, and J. T. Harty. 2009. A default pathway of Sci. USA 107: 5534–5539. memory CD8 T cell differentiation after dendritic cell immunization is deflected 53. Archbold, J. K., W. A. Macdonald, S. Gras, L. K. Ely, J. J. Miles, M. J. Bell, by encounter with inflammatory cytokines during antigen-driven proliferation. J. R. M. Brennan, T. Beddoe, M. C. Wilce, C. S. Clements, et al. 2009. Natural Immunol. 183: 2337–2348. micropolymorphism in human leukocyte antigens provides a basis for genetic 34. Chen, A. T., M. Cornberg, S. Gras, C. Guillonneau, J. Rossjohn, A. Trees, control of antigen recognition. J. Exp. Med. 206: 209–219. S. Emonet, J. C. de la Torre, R. M. Welsh, and L. K. Selin. 2012. Loss of anti- 54. Macdonald, W. A., Z. Chen, S. Gras, J. K. Archbold, F. E. Tynan, viral immunity by infection with a virus encoding a cross-reactive pathogenic C. S. Clements, M. Bharadwaj, L. Kjer-Nielsen, P. M. Saunders, M. C. Wilce, epitope. PLoS Pathog. 8: e1002633. et al. 2009. T cell allorecognition via molecular mimicry. Immunity 31: 897–908. 35. Kabsch, W. 2010. Integration, scaling, space-group assignment and post-re- 55. Rammensee, H. G., K. Falk, and O. Ro¨tzschke. 1993. Peptides naturally pre- finement. Acta Crystallogr. D Biol. Crystallogr. 66: 133–144. sented by MHC class I molecules. Annu. Rev. Immunol. 11: 213–244. 36. Read, R. J. 2001. Pushing the boundaries of molecular replacement with max- 56. Zhao, J., J. Zhao, and S. Perlman. 2010. T cell responses are required for pro- imum likelihood. Acta Crystallogr. D Biol. Crystallogr. 57: 1373–1382. tection from clinical disease and for virus clearance in severe acute respiratory 37. Collaborative Computational Project, Number 4. 1994. The CCP4 suite: programs syndrome coronavirus-infected mice. J. Virol. 84: 9318–9325. for protein crystallography. Acta Crystallogr. D Biol. Crystallogr. 50: 760–763. 57. Zhao, J., J. Zhao, N. Van Rooijen, and S. Perlman. 2009. Evasion by stealth: 38. Adams, P. D., P. V. Afonine, G. Bunkoćzi, V. B. Chen, I. W. Davis, N. Echols, inefficient immune activation underlies poor T cell response and severe disease J. J. Headd, L. W. Hung, G. J. Kapral, R. W. Grosse-Kunstleve, et al. 2010. in SARS-CoV-infected mice. PLoS Pathog. 5: e1000636.