BASIC RESEARCH www.jasn.org

Deletion of Lkb1 in Renal Tubular Epithelial Cells Leads to CKD by Altering Metabolism

† Seung Hyeok Han,* Laura Malaga-Dieguez,* Frank Chinga,* Hyun Mi Kang,* ‡ Jianling Tao,*§ Kimberly Reidy,* and Katalin Susztak*

*Renal Electrolyte and Hypertension Division, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania; †Department of Internal Medicine, Yonsei University College of Medicine, Seoul, Korea; ‡Children’s Hospital at Montefiore, Albert Einstein College of Medicine, Bronx, New York; and §Division of Nephrology, Peking Union Medical College Hospital, Peking Union Medical College and Chinese Academy of Medical Sciences, Beijing, China

ABSTRACT Renal tubule epithelial cells are high-energy demanding polarized epithelial cells. Liver kinase B1 (LKB1) is a key regulator of polarity, proliferation, and cell metabolism in epithelial cells, but the function of LKB1 in the kidney is unclear. Our unbiased gene expression studies of human control and CKD kidney samples identified lower expression of LKB1 and regulatory proteins in CKD. Mice with distal tubule epithelial-specific Lkb1 fl fl deletion (Ksp-Cre/Lkb1 ox/ ox) exhibited progressive kidney disease characterized by flattened dedifferenti- ated tubule epithelial cells, interstitial matrix accumulation, and dilated cystic-appearing tubules. Expression of epithelial polarity markers b-catenin and E-cadherin was not altered even at later stages. However, expres- sion levels of key regulators of metabolism, AMP-activated protein kinase (Ampk), peroxisome proliferative activated receptor gamma coactivator 1-a (Ppargc1a), and Ppara, were significantly lower than those in controls and correlated with fibrosis development. Loss of Lkb1 in cultured epithelial cells resulted in energy depletion, apoptosis, less fatty acid oxidation and glycolysis, and a profibrotic phenotype. Treatment of Lkb1- deficient cells with an AMP-activated protein kinase (AMPK) agonist (A769662) or a peroxisome proliferative activated receptor alpha agonist (fenofibrate) restored the fatty oxidation defect and reduced apoptosis. In conclusion, we show that loss of LKB1 in renal tubular epithelial cells has an important role in kidney disease development by influencing intracellular metabolism.

J Am Soc Nephrol 27: 439–453, 2016. doi: 10.1681/ASN.2014121181

Renal tubular epithelial cells (TECs) display strict effect of LKB1 on cell polarity appears to be cell apico-basal polarity. They allow a highly regulated type specific and deletion of LKB1 did not alter po- uptake or excretion of substances at its apical larity of lung epithelial and pancreatic cells.2 surface, while keeping a closed, impenetrable sur- face through the formation of tight intercellular junctions in the basolateral membrane. The estab- Received December 5, 2014. Accepted April 12, 2015. lishment and maintenance of TEC polarity is in- SHH and LMD contributed equally to this work. completely understood. The liver kinase B1 (LKB1) is Published online ahead of print. Publication date available at an important regular of polarity. Early studies in- www.jasn.org. dicated thatsingleintestinalepithelialcellspolarizein a Present address: Dr. Malaga-Dieguez, Department of Pediatrics, cell-autonomous fashion in response to LKB1 expres- Division of Pediatric Nephrology, New York University School of 1 sion. The LKB1 or STK11 gene encodes an evolu- Medicine, New York tionarily conserved serine/threonine protein kinase. Correspondence: Dr. Katalin Susztak, Associate Professor of Medi- Following LKB1 expression, intestinal epithelial cells cine, Perelman School of Medicine, University of Pennsylvania, 415 reorganized their cytoskeleton to form an apical brush Curie Blvd, 415 Clinical Research Building, Philadelphia, PA 19104. border, demonstrating LKB1’s critical role in estab- Email: [email protected] lishing epithelial polarity. On the other hand, the Copyright © 2016 by the American Society of Nephrology

J Am Soc Nephrol 27: 439–453, 2016 ISSN : 1046-6673/2702-439 439 BASIC RESEARCH www.jasn.org

LKB1 was originally identified as a tumor suppressor. Mutations The primary aim of this study was to examine the role of of LKB1 in humans cause Peutz–Jeghers syndrome (PJS).3,4 PJS is a LKB1 in renal TECs, as defects in metabolism and polarity have rare disease inherited in an autosomal dominant fashion and char- been proposed to play a role in kidney disease development. acterized by predisposition to benign hamartomatous polyps of the intestine and mucocutaneous pigmentation abnormalities. Molecular pathways of LKB1-induced tumor development are RESULTS not fully understood, as LKB1 is broadly expressed,5,6 but the changes appear to be organ specific. Downstream activation of Decreased LKB1 Expression in Fibrotic Kidney Samples mammalian target of rapamycin (mTOR) signaling appears to First we examined the expression pattern of LKB1 in control and play an important role in the process. Several early case reports fibrotic kidneys by analyzing transcript levels of LKB1 and described polycystic disease development in patients with PJS,7,8 associated genes in 95 microdissected human kidney sam- however the incidence of kidney in these patients has not been ples.27,30,31 CKD was defined based on the eGFR ,60 ml/min/ characterized. 1.73 m2 for $3months.32 Among these, 41.1% of the samples Activation of LKB1 occurs via allosteric binding of LKB1 to met the criteria for CKD (Supplemental Table 1). As expected, STE20-related adaptor andmouse protein 25.9,10 Phosphorylation CKD samples showed significant glomerulosclerosis and inter- on Ser428 may also increase LKB1’sactivity.11,12 LKB1 can phos- stitial fibrosis. Microarray analysis was performed on microdis- phorylate more than 13 different target proteins.13 The best- sected tubule samples using the Affymetrix platform.27,30,31 known substrate of LKB1 is AMPK, a master regulator of cellular LKB1 transcript level did not show statistically significant and organismal metabolism.14 In some, but not all cells, mTOR is differences when control and CKD samples were compared. also regulated by LKB1.15,16 This may be less surprising as LKB1 is ubiquitously expressed. LKB1 serves as a critical metabolic checkpoint and arrest cell On the other hand, the expression of the allosteric activator of cycle in response to low intracellular ATP, such as low nutrient LKB1, the calcium binding protein 39 (CAB39, homolog of availability. LKB1 influences both glucose and lipid metabolism. mouse protein 25) positively correlated with eGFR (Figure ThemetaboliceffectofLKB1ismostly mediatedbyAMPK.Inmost 1A). Protein expression of CAB39L, analyzed by immunohis- cells, AMPK inhibits lipogenesis and this effect has been proposed tochemistry, confirmed the transcript level data. In healthy to be important for the tumor suppressor function of LKB1.17 In kidneys CAB39L was expressed both in proximal and distal some cancer types, LKB1 (via AMPK) can modulate glycolysis via tubules in the nucleus and in the cytoplasm (Supplemental the phosphorylation of phosphofructo kinase. LKB1 controls sev- Figure 1). Its expression was significantly decreased in ad- eral transcriptional regulators of metabolism including Foxo3, vanced stages of CKD (Figure 1B). Transcript levels of an im- Hnf4a,andPpargc1a,havingalong-terminfluence on metabo- portant LKB1 target, AMP-activated alpha 2 catalytic subunit lism. Some effects of LKB1 are independent of AMPK and they are (AMPK2a) also correlated with eGFR (Figure 1C), raising the mediated via microtubule affinity-regulating kinase, synapses of possibility that LKB1’s activity is regulated in CKD. the amphid defective kinase, and salt-inducible kinase.18–20 Recently, a phosphorylation-mediated activation of LKB1 has Kidney fibrosis is the histologic manifestation of CKD. Kidney been described.11 This encouraged us to analyze phospho-LKB1 fibrosis is characterized by accumulation of matrix and inflam- levels by immunostaining in control and CKD human kidney matory cells. Epithelial cells are progressively lost in CKD and the samples. Double immunofluorescence staining with the proxi- remaining cells undergo dedifferentiation.21–23 As the kidney is a mal tubule marker LTL indicated that phospho-LKB1 is mostly primary epithelial organ the loss of functional epithelial cells has expressed in distal tubules in healthy control kidney samples been proposed to be the cornerstone of functional decline. Sev- (Figure 1D, upper panel). Nuclear phospho-LKB1 expression eral groups proposed that epithelial cells actually become fibro- (Figure 1D, lower panel) and percentage of positive nuclear stain- blasts in fibrosis via a process called epithelial to mesenchymal ing were significantly lower in CKD kidney samples (Figure 1E). transition.21,22 During epithelial to mesenchymal transition epi- Taken together, we observed decreased expression of LKB1 thelial cells reduce the expression of apico-basal polarity markers binding partner (CAB39L), phosphorylated LKB1, and LKB1 (e-cadherin) and acquire mesenchymal markers including vi- targets in distal tubule cells when patient samples with kidney mentin and alpha smooth muscle actin. The dedifferentiation fibrosis were compared with controls, suggesting the dysre- process is governed by the activation of transforming growth gulation of the LKB1 pathway in kidney fibrosis and raising the factor beta/Smad, Notch, and Wnt pathways.24–26 Recent studies possibility that it might play a role in disease development. indicate that metabolic alterations are also important in kidney fibrosis development. Large-scale unbiased studies indicated Distal Tubule-Specific LKB1 Deletion Results in concerted decrease in expression of genes related to glucose Progressive Tubulointerstitial Damage and fatty acid oxidation both in patients and in mouse models. To investigate the functional role of LKB1 in the kidney, we Pharmacological activation of the peroxisome proliferative generated mice with tubule epithelial-specificdeletionofLkb1. activated receptor alpha (PPARa) pathway or genetic expres- We crossed mice expressing Cre recombinase under the control sion of Ppargc1a decreased fibrosis development in multiple ofthecadherin16promoterwithmiceharboringfloxed alleles of fl fl models.27–29 Lkb1 to generate Ksp-Cre/Lkb1 ox/ ox mice. Littermate floxed

440 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 439–453, 2016 www.jasn.org BASIC RESEARCH

Figure 1. Expression of LKB1 and related genes in patients with kidney fibrosis. (A) Correlation between eGFR and transcript levels of CAB39L (determined on microarrays). (B) Immunostaining of control and diseased human kidney samples with CAB39L. (C) Correlation between eGFR and transcript levels of protein kinase AMP-activated alpha 2 catalytic subunit (PRKAA2) (determined on microarrays). (D, upper panel) Representative image of double immunofluorescence staining of phospho-LKB1 (red) and lotus lectin (green) in control human kidney sample. (D, lower panel) Representative image of phospho-LKB1 immunostaining of control and CKD human kidney samples. (E) The expression of phospho-LKB1 was quantified and presented as a percentage of positive nuclei. Phospho-LKB1 expression was significantly lower in CKD samples compared with healthy controls.

fl fl homozygous animals (Lkb1 ox/ ox without Cre) were considered were more prominent around the fibrotic regions. At 14 weeks of controls. Transcript levels of Lkb1 in whole kidney tissue of Ksp- age, about 3% of the tubules were affected by microcystic changes fl fl Cre/Lkb1 ox/ ox mice were reduced by 60% when compared to (Supplemental Figure 3) andevenat27weeksofagelessthan control animals (Figure 2A). 10% of tubules were occupied by cysts (Supplemental Figure 3). fl fl Ksp-Cre/Lkb1 ox/ ox mice were born at the expected Mende- Kidneys were characterized by marked interstitial proliferation, lian ratio and did not show gross abnormalities at birth and at 5 but proliferation was less prominent in tubule epithelial cells weeks of age (Figure 2B). By 14 weeks, fibrotic changes started to (Supplemental Figure 4). Epithelial deletion of Lkb1 was also appear focally accompanied by dilated tubules (Figure 2C). By 27 sufficient to induce macrophage infiltration and increased weeks of age the kidney became grossly enlarged; the normal F4/80 expression (Figure 3A). TECs appeared simplified and renal architecture was lost and animals developed severe fibrosis. even occasionally dysplastic, but we did not observe precan- Renal TECs were simplified and the lumen was dilated (Figure 2, cerous or cancerous lesions in mice with TEC-specific Lkb1 D and E) and occasionally cystic appearing. The interstitium was deletion. In summary, mice with tubule epithelial deletion of widened with accumulation of matrix and activated myofibro- Lkb1 are mostly characterized by progressive tubule dilation blasts, whereas glomeruli remained intact. In contrast, Lkb1 de- and fibrosis. fl fl letion in proximal tubules using the Pepck-Cre/Lkb1 ox/ ox mice did not result in fibrosis development (Supplemental Figure 2). No Obvious Polarity and Ciliary Abnormalities in fl fl In line with the morphologic alterations, quantitative PCR Ksp-Cre/Lkb1 ox/ ox Mice analysis showed that transcript levels of fibrosis markers such as Next, we examined the molecular mechanism of LKB1-induced Col1a1, Col3a1,andfibronectin were significantly increased in renal disease. As LKB1 is a critical determinant of cell polarity, we fl fl 14-week Ksp-Cre/Lkb1 ox/ ox mice compared with control mice analyzed the expression epithelial polarity markers in mice with (Figure 3A). Sirius-red staining confirmed the severe fibrosis de- conditional deletion of Lkb1. To this end, we examined the lo- fl fl velopment in the Ksp-Cre/Lkb1 ox/ ox mice (Figure 3, B–D). In calization of basolateral proteins, b-catenin and E-cadherin. addition to the fibrosis we also observed cystic dilatations. These Overall, there was no change in transcript levels of Cdh1 and cystic dilatations started to occur around 14 weeks of age and Zo-1 in tubule-specific Lkb1 null mice when compared with

J Am Soc Nephrol 27: 439–453, 2016 Lkb1 in CKD 441 BASIC RESEARCH www.jasn.org

Figure 2. Loss of Lkb1 in renal tubule cells causes severe structural damage in the kidney. (A) Quantitative real-time PCR analysis of Lkb1 fl fl and Cre transcript levels in kidneys of control and Ksp-Cre/Lkb1 ox/ ox mice. (B–E) Gross morphology (E) and representative images of fl fl periodic acid-Schiff-stained kidney sections from control and Ksp-Cre/Lkb1 ox/ ox mice at (B) 5, (C) 14, and (D, E) 27 weeks of age. control animals (Supplemental Figure 5A). Immunofluorescence To this end, we cultured primary TECs from wild-type fl fl labeling showed that basolateral localization of b-catenin and (WT) and WT/Lkb1 ox/ ox mice and infected them with E-cadherin was maintained, indicating no obvious polarity de- Ad5CMVCre-eGFP adenovirus to delete Lkb1 (Figure 4A). fects in tubule specific Lkb1 null mice (Supplemental Figure 5B). Fluorescence microscopy indicated more than 90% infection Recently, LKB1 has been identified as part of the ciliary efficiency (data not shown) and about 90% reduction in Lkb1 fl fl proteome.33 Therefore, we next tested for the presence of cilia level following Cre infection of Lkb1 ox/ ox cells (Figure 4B). by acetylated tubulin staining in kidney samples. Immuno- Western blot analysis showed significant reduction (about fluorescence staining indicated that primary cilia were pres- 50%) in phospho-AMPK expression in cultured primary tubule ent without gross abnormalities both in 5- and 14-week cellswith Lkb1-deletioncomparedwithcontrolcells(Figure 4C). fl fl Ksp-Cre/Lkb1 ox/ ox mice (Supplemental Figure 5C). In sum- Decreased expression of phospho-AMPK in the absence of Lkb1 mary, Lkb1 null TECs failed to show obvious polarity or cil- was also observed in vivo in mice with tubule-specific Lkb1 de- iary defects. letion by immunohistochemistry (Figure 4D). AMPK is an important negative regulator of mTOR. However, we found Metabolic Alterations in Tubule Epithelial Specific Lkb1 no significant increase in phospho-mTOR or its effector S6- Knock-Out Mice kinase levels in Lkb1-deficient cells (Supplemental Figure 6). Failing to identify significant polarity differences, we examined These results indicate that AMPK but not mTOR is an impor- metabolic changes in cells and mice with Lkb1 deletion. Most tant target of LKB1 in TECs. described effects of LKB1 are mediated by AMPK, a master We found that LKB1 controlled the expression of sev- regulator of metabolism. Therefore, we next compared AMPK eral transcription factors that play an important role in regu- levels in TECs in the presence or absence of Lkb1. lating metabolism. Quantitative PCR and western blot analyses

442 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 439–453, 2016 www.jasn.org BASIC RESEARCH

Lkb1 Deficiency Alters Fatty Acid and Glucose Metabolism of TECs Differences in Ampk, Ppara,andPpargc1a levels in the Lkb1 knock-out mice prompted us to examine further the effect of LKB1 on fatty acid and glucose utilization. AMPK is a known regulator of fatty acid utiliza- tion by influencing acyl-CoA-carboxylase (ACC) levels, a critical enzyme in fatty acid metabolism that produces malonyl-CoA. Malonyl-CoA is an inhibitor of carnitine palmitoyl-CoA transferase 1, the key rate- limiting enzyme in fatty acid oxidation. We found that phospho-ACC levels (Figure 5A) were decreased in Lkb1 null cells. Overall, these observations raised the pos- sibility of lower fatty acid oxidation in the absence of Lkb1. Transcript levels of rate-limiting en- zymes in the b-oxidation pathway, such as carnitine palmitoyl transferase (Cpt1, Cpt2) and acyl-CoA oxidase (Acox)1, were significantly decreased in kidneys of Ksp- fl fl Cre/Lkb1 ox/ ox mice compared to control animals (Figure 5B). The decrease was al- ready evident by 14 weeks of age, prior to the development of significant fibrosis. Consistent with the in vivo findings, mRNA expressions of Cpt1, Cpt2,and Acox1 were significantly decreased in vitro in the absence of Lkb1 (Figure 5C). Upon measuring fatty acid utilization using the Seahorse bioanalyzer, we found that palmitate-induced oxygen consumption rate was significantly lower in Lkb1 null cells, when compared with control cells (Figure 5D), indicating a defect in fatty acid oxidation. The significant decrease in fatty acid oxidation was associated with increased ac- cumulation of intracellular lipids. Increased lipid accumulation was evident by increased flox/flox fi Figure 3. Ksp-Cre/Lkb1 mice develop severe brosis. (A) Transcript levels of oil-red-O positive staining in Lkb1-deficient collagen 1al (Col1a1), collagen 3a1 (Col3a1), fibronectin (Fn1), and F4/80 in control fl fl cells (Figure 5E) and in kidneys of mice with and 5- and 14-week-old Ksp-Cre/Lkb1 ox/ ox mice. (B–D) Representative images of Lkb1 deletion (Figure 5F). Sirius-red staining under bright light (B) and polarized light (C) in control and Ksp- fl fl Cre/Lkb1 ox/ ox mice. Quantification of fibrosis detected by Sirius-red staining using Next, we analyzed levels of enzymes and ImageJ (D). transporters related to glucose utilization in 5- and 14-week-old control and Lkb1 knock-out animals (Figure 6A) and in control and Lkb1 indicated significant decreases in Ppara and Ppargc1a expression null TECs (Figure 6B). The transcript level of phosphofructoki- in vitro in Lkb1 null cells (Figure 4, C and E). We found that nase, the rate-limiting enzyme in glycolysis, was decreased, but did mRNA levels of Ppara and Ppargc1a were also decreased in vivo in not reach statistical significance in vivo or in vitro. Transcript levels fl fl Ksp-Cre/Lkb1 ox/ ox kidneys (Figure 4F). Immunohistochemis- of pyruvate kinase (Pk), glucose transporter 1 (Glut1), and hexo- try analysis corroborated the lower protein expression of Ppara kinase (Hk)weresignificantly reduced in vitro in absence of Lkb1. fl fl and Ppargc1a in Ksp-Cre/Lkb1 ox/ ox kidneys compared with Next, we studied glucose utilization using the Seahorse control animals (Figure 4G). bioanalyzer and found that glucose-induced extracellular

J Am Soc Nephrol 27: 439–453, 2016 Lkb1 in CKD 443 BASIC RESEARCH www.jasn.org

Figure 4. Lower expression of metabolic regulators in tubule epithelial-specific Lkb1 knock-out mice and in cells with Lkb1 deletion. (A and B) Lkb1 mRNA levels (A) and LKB1 protein levels (B) in cultured cells. (C) Representative western blots followed by quantification analysis of P-AMPK, PPARa and PGC1a, and beta actin levels in control (CON) and Lkb1-deficient tubule cells. (D) Representative fl fl images from P-AMPK immunostaining of control and Ksp-Cre/Lkb1 ox/ ox kidney samples. (E and F) Transcript levels of Ppara and fl fl Ppargc1a in control and Lkb1-null cells (E) and control and 14-week-old Ksp-Cre/Lkb1 ox/ ox mice. (G) Representative images of PPARa fl fl and PGC1a immunostaining of control and 27-week Ksp-Cre/Lkb1 ox/ ox kidneys.

444 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 439–453, 2016 www.jasn.org BASIC RESEARCH acidification (ECAR), a measure of glycolysis, was actually utilization related transcripts (Figure 9D) were not different fol- significantly lower in cells lacking Lkb1 (Figure 6C). lowing A79 or fenofibrate treatment. Seahorse Bioanalyzer–based As our results indicated a defect both in fatty acid oxidation glucose utilization studies confirmed that neither the Ampk nor and glycolysis, we therefore visualized mitochondria by mitro- the PPARa agonists could restore glucose-induced ECAR in Lkb1 tracker staining. Whereas control cells had a well preserved null cells (Figure 9E). filamentous mitochondrial network, Lkb1 null cells showed a To prove that AMPK and PPARa and downstream fatty acid punctate mitochondrial staining pattern (Figure 7A),indicatinga utilization play a critical role in mediating the effect of LKB1, we potential mitochondrial defect. Distorted mitochondrial struc- examined functional outcomes in Lkb1 null cells after AMPK or ture was further confirmed by electron microscopy (Figure PPARa agonist treatments. The epithelial marker E-cadherin ex- 7B).34 As we observed a significant defect both in fatty acid pression was significantly lower in cells with Lkb1 deletion and and glucose utilization we measured intracellular ATP content A769662 and fenofibrate restored Cdh1 expression. Expression in control and Lkb1 null cells. Wefound that cellular ATP content of Acta2, Col1a1, Col3a1,andFn1 were significantly increased in was lower in the absence of Lkb1 (Figure 7C). Lkb1 null cells, and fenofibrate and A769662 were able to ame- Taken together, these findings indicate that mitochondrial liorate the increase (Figure 9F). Furthermore, pretreatment with structure and fatty acid and glucose utilization were altered in A769662 and fenofibrate decreased the Lkb1 deletion–induced Lkb1-deficient kidneys and TECs, resulting in lower ATP levels. high apoptosis rate (Figure 9G) evident by the expression of cleaved caspase-3. In summary, the metabolic effect of LKB1 Lkb1 Deletion Results in Increased Apoptosis appears to be at least partly mediated by AMPK or PPARa as Next, we examined cell death as decreased energy levels and pharmacological agonists of these pathways protected cells from mitochondrial alterations are usually associated with increased apoptosis and dedifferentiation. apoptosis rate. Quantitative PCR analysis indicated that mRNA expression levels of Bcl2 (anti-apoptotic gene) were significantly lower in Lkb1 null kidneys and tubule cells obtained from these DISCUSSION animals (Figure 8A). Western blot analysis confirmed the de- creased BCL2 levels in renal TECs with Lkb1 deletion (Figure In summary, here we report that genetic deletion of Lkb1 in 8B). Increased levels of cleaved caspase-3 in cultured renal distal tubule epithelial cells caused severe structural damage in TECs with Lkb1 deletion (Figure 8B) further substantiated the the kidney, which was associated with dedifferentiation of increased apoptosis rate. The increased apoptosis rate and higher tubule epithelial cells, accumulation of interstitial matrix, and cleaved caspase-3 expression was also evident in renal TECs of inflammatory cells. This phenotype most resembles tubuloin- fl fl kidneys of Ksp-Cre/Lkb1 ox/ ox mice (Figure 8C). terstitial fibrosis, observed in patients with CKD, which is the In addition to apoptosis, Lkb1 deletion was associated with final common pathway to ESKD development. As the expres- dedifferentiation of TECs evident by the increased expression sion of phosphorylated LKB1 and LKB1 co-activator CAB39L of Col1a1, Col3a1,andActa2 (Figure 8D), likely explaining the is decreased in patient samples with kidney fibrosis, these ob- fibrotic phenotype observed in vivo (Figures 2 and 3). In sum- servations raise the possibility that LKB1 actually plays a role mary, these findings suggest that Lkb1 deficiency results in in fibrosis development. increased cell death and dedifferentiation most likely due to Even though LKB1 has been identified as an important energy depletion. component of the ciliary complex and cilia plays an important role in cystic disease development, we did not observe bona fide AMPK and PPARa Agonists Attenuate Lkb1 Deletion- cystic disease in our animals. Tubule epithelial cells showed Induced Epithelial Dedifferentiation and Apoptosis significant dilatation and occasional microcystic changes; Next, we tested whether lower AMPK and PPARa levels play however, these changes did not reach the severity observed functional roles mediating the effect of LKB1. To examine this in animal models of polycystic kidney disease. Microcystic hypothesis we treated Lkb1 null TECs with the AMPK agonist change and a swiss-cheese appearance of the kidney is de- (A769662) and the PPARa agonist fenofibrate. The drug dosage scribed in severe fibrosis. Furthermore, cilia structure was was titrated to restore levels of the rate-limiting enzyme levels in present in tubule epithelial cells even in the absence of LKB1. the fatty acid oxidation pathway, Cpt1, Cpt2,andAcox1 (Figure Future studies might determine smaller changes in cilia length 9A) (100 mM A769662 and 1 mMfenofibrate). Western blot and width, as well as potential functional defects. Mice with analysis confirmed that these drugs fully restored protein expres- tubule-specific Lkb1 deletion did not develop renal cell carci- sion of phospho-ACC (Figure 9B). Oxygen consumption studies noma or excessive proliferation and precancerous lesions, indicated that palmitate oxidation was increased in cells treated even though Lkb1 is an important tumor suppressor and de- with AMPK or PPARa agonists in the absence of Lkb1 (Figure creased LKB1 expression has been demonstrated in renal cell 9C), suggesting that these pathways play a functional role in me- carcinoma.35 It is likely that additional mutations or activation diating LKB1’s effect. of mTOR are necessary for renal cell cancer development. We next evaluated whether AMPKor PPARa agonists can also We found that LKB1’s effect was mostly mediated by AMPK restore the glycolytic capacity of the Lkb1 null cells. Glucose and downstream metabolic changes as the AMPK agonist

J Am Soc Nephrol 27: 439–453, 2016 Lkb1 in CKD 445 BASIC RESEARCH www.jasn.org

Figure 5. Alterations in fatty acid oxidation in renal TECs in absence of Lkb1. (A) p-ACC western analysis (representative and quantification) of control and Lkb1 null cells. (B and C) The mRNA expression of carnitine palmitoyl-transferase 1 (Cpt1), carnitine palmitoyl-transferase 2 fl fl (Cpt2), and acyl-coA oxidase 1 (Acox1)incontrolandKsp-Cre/Lkb1 ox/ ox kidneys (B) and control and Lkb1-deficient cells (C). (D) Oxygen consumption rate of control and Lkb1-deficient cells, when indicated palmitate (180 mM), etoxomir (40 mM), and oligomycin (1 mM) was added. The right panel shows quantification from multiple measurements. Representative images of oil-red-O staining of control and Lkb1- fl fl deficient TECs (E) and control and Ksp-Cre/Lkb1 ox/ ox mice (F) and ImageJ-based quantification of the oil-red-O staining.

446 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 439–453, 2016 www.jasn.org BASIC RESEARCH

Figure 6. Alterations in glucose utilization in renal TECs in absence of Lkb1. (A and B) Transcript levels of Glut1 (glucose transporter1), Hk fl fl (hexokinase), Pfk (phosphor-fructokinase), and Pk (pyruvate kinase) in control and Ksp-Cre/Lkb1 ox/ ox kidneys (A) and control and Lkb1- deficient cells (B). (C) ECAR of control and Lkb1-deficient TECs. When indicated glucose (10 mM), 2–4 dinitrophenol (2–4DNP,100mM), 2-deoxyglucose (2-DG, 100 mM), and rotenone (1 mM) were added. The right panel summarizes results from three independent experi- ments. DNP, dinitrophenol.

A769662 had a protective effect on renal TECs. Loss of Lkb1 effect of LKB1. Such an AMPK independent effect has recently resulted in impaired glucose utilization, including lower en- been described in the muscle during exercise.42 Furthermore, zyme levels and altered glucose-induced ECAR. This is in our results cannot fully exclude the possibility that Lkb1 de- keeping with recent results showing that AMPK can regulate letion also results in a broader mitochondrial dysfunction, as glucose transporters and enzymes involved in glucose oxi- was also evident by altered mitochondrial morphology and the dation.36–39 Our data, on the other hand, indicate that decreased expression of peroxisome proliferator-activated re- lower glucose utilization plays only a minor role in the phe- ceptor gamma, coactivator 1 alpha (PGC1a), a key regulator of notype development because the PPARa agonist fenofibrate mitochondrial biogenesis. Recent studies suggest that PGC1a and AMPK agonist A769662 did improve apoptosis and de- is downregulated in bone marrow43 and skeletal muscle differentiation, even though the glycolytic defect was not cells44,45 in the absence of Lkb1 deletion. Future studies will restored. dissect LKB1-mediated differences in mitochondrial function We propose that the decreased fatty acid utilization induced and fatty acid oxidation in renal TECs. by Lkb1 deletion plays an important functional role in the In this respect we would like to point out that, for example, phenotype development as we observed protection from ap- target of rapamycin complex 1 is a frequently observed im- optosis and dedifferentiation following A769662 and fenofi- portant downstream effector of LKB1; we did not observe brate treatment. This is consistent with the known role of increased mTOR activation in our model. Growing evidence PPARa in regulating fatty acid utilization while not having indicates that LKB1 can exert its effects independent of mTOR an effect on glucose utilization. Previous publications40,41 signaling. In particular, van der Velden et al. demonstrated and our recent study27 indicate that fatty acids are the major that mTOR activity was unchanged in the Lkb1 mutant ze- energy source in the kidney. Nevertheless, it should be noted brafish, and rapamycin treatment failed to rescue the mu- that fatty acid oxidation and apoptosis was not completely tant phenotype.46 The effect of LKB1 was also independent recovered by A769662 and PPARa agonist evidenced by the of mTOR in the hematopoietic system or in the heart.43,45,47 Seahorse analysis in spite of almost full normalization of While further studies will be necessary to work out the re- phospho-ACC expression and the transcript levels of genes in- lationship between LKB1 and mTOR signaling in renal tu- volved in the b-oxidation pathway. These findings could imply bule cells, ours studies indicate a mTOR independent role that additional mechanisms besides AMPK could mediate the for LKB1.

J Am Soc Nephrol 27: 439–453, 2016 Lkb1 in CKD 447 BASIC RESEARCH www.jasn.org

oxidation and energy depletion play an importantroleinthephenotypedevelop- ment, indicating that restoring LKB1 ac- tivity in CKD could offer therapeutic benefit.

CONCISE METHODS

Generation of Mice Lacking Lkb1 in the Renal TECs Mice harboring Lkb1-floxed alleles have been de- fl fl scribed previously.53 Lkb1 ox/ ox mice were crossed to transgenic mice expressing Cre recombinase under the cadherin 16 promoter (Ksp-Cre).54 Trans- genic mice were identified by genomic PCR anal- ysis using transgene-specificprimers.Thepresence of a WT Lkb1 and a floxed Lkb1 allele was detected using primers Lkb36/Lkb39 and Lkb39/Pcrs5. The primer sequences of Lkb36, Lkb39,and Pcrs5 are as follows: Lkb36,59-GGGCTTC- CACCTGGTGCCAGCCTGT-39; Lkb39,59- GAGATGGGTACCAGGAGTTGGGGCT-39; and Pcrs5,59-TCTAACAATGCGCTCATC- GTCATCCTCGGC-39. The presence of the Cre recombinase was detected using primers forward 59-GCATAACCAGTGAAACAG- CATTGCTG-39 and reverse 59-GGACATGTT- CAGGGATCGCCAGGCG-39.Animalcareand experiments were performed in accordance with the National Institutes of Health guidelines and approved by the Animal Care Committee at Perelman School of Medicine, University of Pennsylvania.

Figure 7. Loss of LKb1 induces mitochondrial changes and energy depletion. (A) Rep- resentative images of Mitrotracker staining of control and Lkb1-deficient TECs. (B) Rep- Quantitative Real-Time PCR Analysis resentative transmission electron microscopy images of control TECs and Lkb1-deficient We compared transcript levels of Lkb1,genes TECs. (C) ATP concentration per protein amount in control and Lkb1 deficient TECs. related to b-oxidation, glycolysis, apoptosis, and dedifferentiation (Acta2, Col1a1,and Col3a1) by quantitative real-time PCR. The detailed method is de- Growing evidence suggests the key role of metabolism in scribed in the supplemental material. fibrosis development. Our unbiased gene expression studies indicated a concerted downregulation of metabolic pathways in kidney fibrosis. We found that decreased fatty acid oxidation Western Blot Analysis plays an important role in fibrosis development and pharma- We examined protein expression levels of LKB1, p-AMPK, p-ACC, cological activation of Ppara or genetic overexpression of PPARa,PGC1a, BCL2, and cleaved caspase-3 using western blot Ppargc1a ameliorated fibrosis development.27 Several studies analyses. The detailed method and information on antibodies are indicate that the AMPK, PPARa,andPGC1a pathways are available in the supplemental material. important in fibrosis development.29,48–51 Data from the Duf- field group suggest that microRNA 21 is an important up- Histology, Immunohistochemistry, and stream regulator of the pathway.52 Immunofluorescence In conclusion, this study showed that selective deletion of We also performed Sirius-red staining, immunohistochemistry, and Lkb1 in the kidney induced severe injury over time, charac- immunofluorescence studies to examine morphologic changes, fibrosis, terized by dilated tubules and interstitial fibrosis. Our data and expression of p-AMPK, PPARa,PGC1a, and cleaved caspase-3. The indicate that loss of AMPK activity and lower fatty acid detailed method is described in the supplemental material.

448 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 439–453, 2016 www.jasn.org BASIC RESEARCH

Figure 8. Loss of LKb1 results in apoptosis and increased expression of fibrosis markers. (A) Quantitative PCR-based transcript level of Bcl2 fl fl in control and Ksp-Cre/Lkb1 ox/ ox mice and Lkb1-deficient cells. (B) Western blot analysis (representative images and quantification) of control and Lkb1-deficient tubule epithelial cells with antibodies against BCL2 (B-cell CLL/lymphoma 2), cleaved caspase-3, and beta actin. fl fl (C) Representative immunostaining for cleaved caspase-3 of control and Ksp-Cre/Lkb1 ox/ ox mice. (D) Transcript levels of profibrotic markers such as Col1a (collagen 1a1), Col3a1 (collagen 3a1), and Acta2 (alpha smooth muscle actin) in control and Lkb1-deficient cells.

J Am Soc Nephrol 27: 439–453, 2016 Lkb1 in CKD 449 BASIC RESEARCH www.jasn.org

Figure 9. AMPK and PPARa agonists attenuated cell injury by restoring fatty acid oxidation in Lkb1-null cells. (A) Relative mRNA level of carnitine palmitoyl-transferase 1 (Cpt1), carnitine palmitoyl-transferase 2 (Cpt2), and acyl-coA oxidase 1 (Acox1) in control and Lkb1 null TECs treated with increasing dose of A769662 (A76) or fenofibrate. (B) Western blot analysis of P-ACC and beta actin in control Lkb1 null TECs treated with A769662 (A76) or fenofibrate. (C) Palmitate-induced oxygen consumption rate measured by Seahorse bioanalyzer of control and Lkb1 null TECs. When indicated cells were also treated with A769662 (A76) or fenofibrate. (D) Relative mRNA levels of glucose transporter 1 (Glut1), hexokinase (Hk), phosphofructokinase (Pfk)andpyruvatekinase(Pk) of control, Lkb1 null

450 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 439–453, 2016 www.jasn.org BASIC RESEARCH

Oil-Red-O Staining cultured cells (13106) were lysed in 100 ml of ATP assay buffer and Oil-red-O working solution was made with 60% 3 mg/ml oil-red-O centrifuged (13,000g32 minutes, 4°C). The supernatants (50 ml) (#O0625; Sigma-Aldrich, St. Louis, MO) in isopropanol. Frozen were added to 96-well plates and mixed with 50 ml of the reaction sections were fixed in 10% formalin, dipped with 60% isopropanol, mix (ATP probe, ATP converter, developer mix in ATP assay buffer). and then stained with oil-red-O working solution for 15 minutes at The plates were incubated at room temperature for 30 minutes in the room temperature. After rinsing with 60% isopropanol and washing dark. We determined absorbance of the samples at 570 nm using a with distilled water, sections were mounted with glycerin jelly. micro-plate reader. Quantificationofoil-red-OwasperformedusingImageJv1.49(National Institutes of Health, Bethesda, MA; online at http://rsbweb.nih.gov/ij) as Mitochondrial Visualization previously described.55 Cells were plated at 13105 cells/well onto 12 mm petri dishes (WillCo-dish). After the virus infection, cells were stained with 200 nM Primary Cell Cultures MitoTracker Red FM dye for 30 minutes and visualized with a Leica TCS fl fl fl fl Weisolated TECs from WT,WT/Lkb1 ox/ ox mice, andKsp-Cre/Lkb1 ox/ ox SP8 confocal microscope (Leica SP5, Goettingen, Germany). Images were mice. Cells were cultured in RPMI media (Gibco, Grand Island, NY), acquired with LAS software. 10% FBS (Gibco), 100 units/ml penicillin G, 2.5 mg/ml amphoter- icin B, and 20 ng/ml of epidermal growth factor (all from Sigma- Electron Microscopic Examination Aldrich). Briefly, kidneys were dissected visually, placed in 1 ml ice-cold Mitochondrial structure was further examined by standard trans- Dulbecco’s phosphate buffered saline (DPBS) (Cellgro) and minced mission electron microscopy. Primary TECs were fixed with a mixture into pieces of ;1mm3. Fragments were transferred to collagenase of 2% paraformaldehyde and 2.5% glutaraldehyde overnight, washed, solution (1 mg/ml in DPBS; Sigma-Aldrich) and digested for dehydrated, and embedded in resin according to standard procedures. 60 minutes at 37°C. Afterwards, the supernatant was sieved through a Mitochondria were examined by a JEOL 1010 microscope (Tokyo, 100 mm nylon mesh. Samples were centrifuged for 10 minutes at Japan). 3000 rpm. The pellet was resuspended in sterile red blood cell lysis buffer (8.26 g NH4Cl, 1 g KHCO3,0.037gEDTA/lddH2O) and Measurement of Oxygen Consumption Rate and incubated on ice for 10 minutes, followed by centrifugation for Extracellular Acidification Rate 10minutesat3000rpm.ThepelletwaswashedtwicewithDPBS A Seahorse Bioscience 324 extracellular flux analyzer was used to mea- before plating in 10 cm dishes. sure the rate change of dissolved oxygen in medium immediately sur- rounding adherent cells cultured in an XF24 V7 cell culture microplate Infection of Kidney TECs and Treatment (Seahorse Bioscience). Mouse primary TECs cultured in RPMI 1640 sup- When cell confluency reached 70%–80%, the media were changed plement with 0.5% FBS were seeded in XF24 V7 cell culture microplate at fl fl with serum-free RPMI and WTand WT/Lkb1 ox/ ox cells were infected 1.03104 cells per well. Oxygen consumption rates (pmol/minute) and with Ad5CMV-eGFP (Ad-GFP) and Ad5CMVCre-eGFP (Ad-Cre-GFP) extracellular acidification rate (mpH/minute) were assessed at baseline (University of Iowa Gene Transfer Vector Core, Iowa City, IA) at 431010 and after the addition of palmitate conjugated BSA (180 mM) or 10 mM plaque forming units/ml. There were no differences in transcript glucose followed by the addiction of the carnitine palmitoyltransferase-1 levels of Lkb1 and genes involved in b-oxidation and glycolysis inhibitor etomoxir (40 mM) or the mitochondrial upcoupler, 2–4dini- when we compared WT cells infected with Ad-GFP, WT cells infected trophenol (100 mM) or glycolysis inhibitor 2-deoxyglucose (100 mM). fl fl with Ad-Cre-GFP, and WT/Lkb1 ox/ ox cells infected with Ad-GFP The final state was determined after the addition of the ATP synthase (Supplemental Figure 7). Therefore, we used WT cells infected with inhibitor oligomycin (1 mM) or rotenone (1 mM). Ad-Cre-GFP as a control group. At the same time, infected cells were treated with 100 mM A769662 (#A1803; LC Laboratories, Woburn, Human Kidney Samples MA)or1mMfenofibrate (#F6020, Sigma-Aldrich). Infection effi- Kidney samples were obtained from routine surgical nephrectomies. ciency was estimated under fluorescence microscope by the presence Samples were de-identified and the corresponding clinical informa- of GFP-positive cells; it was approximately 90%. Cells were harvested tion was collected by an individual who was not involved in the and scraped off 48 hours post infection. research protocol. The study was approved by the Institutional Review Boards of the Albert Einstein College of Medicine Montefiore Measurement of ATP Medical Center (IRB#2002–202) and the University of Pennsylvania. Total ATP concentration was determined using an ATP colorimetric/ Histologic analysis was performed by an expert pathologist fluorometric assay kit (Biovision, Mountain View, CA). Primarily (IRB#815796).

cells and Lkb1 null cells treated with A769662 or fenofibrate. (E) Glucose-induced ECAR in control, Lkb1 null cells, and Lkb1 null cells treated with A769662 or fenofibrate. (F) Transcript levels of cadherin 1 (Cdh1), alpha smooth muscle actin (Acta), fibronectin (Fn1), col- lagen 1a1 (Col1a1), and collagen 3a1 (Col3a1) of primary mouse TECs in the presence and absence of Lkb1 and treated with A769662 (A76) or fenofibrate (Feno). (G) Western blot analysis (representative image and quantification) for BCL2 (B-cell CLL/lymphoma 2), cleaved- caspase 3, and beta-actin of control and Lkb1 null cell treated with A769662 or fenofibrate.

J Am Soc Nephrol 27: 439–453, 2016 Lkb1 in CKD 451 BASIC RESEARCH www.jasn.org

Microarray Aaltonen LA: Localization of a susceptibility locus for Peutz–Jeghers Tissue was placed into RNALater and manually microdissected at 4°C for syndrome to 19p using comparative genomic hybridization and tar- glomerular and tubular compartments as described earlier. Dissected geted linkage analysis. Nat Genet 15: 87–90, 1997 tissue was homogenized and RNA was prepared using RNAeasy mini 6. Su JY, Erikson E, Maller JL: Cloning and characterization of a novel ’ serine/threonine protein kinase expressed in early Xenopus embryos. J columns (Qiagen, Valencia,CA) according to the manufacturer s instruc- Biol Chem 271: 14430–14437, 1996 tions. RNA quality and quantity was determined using Lab-on-Chip 7. Kieselstein M, Herman G, Wahrman J, Voss R, Gitelson S, Total RNA PicoKit (Agilent BioAnalyzer, Santa Clara, CA). Only samples Feuchtwanger M, Kadar S: Mucocutaneous pigmentation and intestinal without evidence of degradation were used. Biotinylated cRNA were polyposis (Peutz–Jeghers syndrome) in a family of Iraqi jews with prepared according to the standard Affymetrix protocol from 6 mgtotal polycystic kidney disease. With a chromosome study. Isr J Med Sci 5: 81–90, 1969 RNA (Expression Analysis Technical Manual, 2001, Affymetrix). Follow- 8. Farquet JJ, Rousso C: [Peutz–Jeghers syndrome. Report on a case m ing fragmentation, 10 g of cRNA were hybridized for 16 hours at 45°C associated with pluricystic disease of the kidneys]. Schweiz Med and GeneChips were washed and stained in the Affymetrix Fluidics Sta- Wochenschr 99: 1788–1792, 1969 tion 400. The data were scanned using a GeneChip scanner in accordance 9. Baas AF, Boudeau J, Sapkota GP, Smit L, Medema R, Morrice NA, Alessi with the Affymetrix protocol. Data were normalized in GeneSpring soft- DR, Clevers HC: Activation of the tumour suppressor kinase LKB1 by the STE20-like pseudokinase STRAD. EMBO J 22: 3062–3072, 2003 ware using the RMA16 summarization algorithm. Baseline is the median 10. Boudeau J, Baas AF, Deak M, Morrice NA, Kieloch A, Schutkowski M, of all samples. Prescott AR, Clevers HC, Alessi DR: MO25alpha/beta interact with STRADalpha/beta enhancing their ability to bind, activate and localize Statistical Analyses LKB1 in the cytoplasm. EMBO J 22: 5102–5114, 2003 Statistical analysis was performed using the statistical package SPSS for 11. Xie Z, Dong Y, Zhang M, Cui MZ, Cohen RA, Riek U, Neumann D, Windows version 11.0 (IBM SPSS, Chicago, IL). All results are presented as Schlattner U, Zou MH: Activation of protein kinase C zeta by perox- 6 ’ ynitrite regulates LKB1-dependent AMP-activated protein kinase in mean SD.Toanalyzethedifferencebetweentwogroups,Students t test cultured endothelial cells. JBiolChem281: 6366–6375, 2006 was used. Bonferroni correction was used when more than two groups 12. Elhanati S, Kanfi Y, Varvak A, Roichman A, Carmel-Gross I, Barth S, were present. P values ,0.05 were considered statistically significant. Gibor G, Cohen HY: Multiple regulatory layers of SREBP1/2 by SIRT6. Cell Reports 4: 905–912, 2013 13. Lizcano JM, Göransson O, Toth R, Deak M, Morrice NA, Boudeau J, Hawley SA, Udd L, Mäkelä TP, Hardie DG, Alessi DR: LKB1 is a master ACKNOWLEDGMENTS kinase that activates 13 kinases of the AMPK subfamily, including MARK/PAR-1. EMBO J 23: 833–843, 2004 14. Shackelford DB, Shaw RJ: The LKB1-AMPK pathway: metabolism and Work in the Susztak laboratory is supported by the National Institutes growth control in tumour suppression. Nat Rev Cancer 9: 563–575, 2009 of Health (DK076077 and DK087635). The authors would like to 15. Corradetti MN, Inoki K, Bardeesy N, DePinho RA, Guan KL: Regulation thank Peter Igarashi (University of Texas Southwestern Medical Center) of the TSC pathway by LKB1: evidence of a molecular link between – forgenerous sharingofthe Ksp-Cre transgenic animalsand Universityof tuberous sclerosis complex and Peutz Jeghers syndrome. Genes Dev 18: 1533–1538, 2004 Iowa Gene Transfer Vector Core for Ad5CMVCre-eGFP. 16. Shaw RJ, Bardeesy N, Manning BD, Lopez L, Kosmatka M, DePinho RA, Cantley LC: The LKB1 tumor suppressor negatively regulates mTOR signaling. Cancer Cell 6: 91–99, 2004 DISCLOSURE 17. Hardie DG, Alessi DR: LKB1 and AMPK and the cancer-metabolism link – – The laboratory of Dr. Susztak received research support from Boehringer ten years after. BMC Biol 11:36, 1 11, 2013 Ingelheim and Biogen Idec for projects that are not related to this work. 18. Hezel AF, Gurumurthy S, Granot Z, Swisa A, Chu GC, Bailey G, Dor Y, Bardeesy N, Depinho RA: Pancreatic LKB1 deletion leads to acinar polarity defects and cystic neoplasms. MolCellBiol28: 2414–2425, 2008 19. Chan KT, Asokan SB, King SJ, Bo T, Dubose ES, Liu W, Berginski ME, REFERENCES Simon JM, Davis IJ, Gomez SM, Sharpless NE, Bear JE: LKB1 loss in melanoma disrupts directional migration toward extracellular matrix – 1. Baas AF, Kuipers J, van der Wel NN, Batlle E, Koerten HK, Peters PJ, cues. JCellBiol207: 299 315, 2014 Clevers HC: Complete polarization of single intestinal epithelial cells 20. Patel K, Foretz M, Marion A, Campbell DG, Gourlay R, Boudaba N, upon activation of LKB1 by STRAD. Cell 116: 457–466, 2004 Tournier E, Titchenell P, Peggie M, Deak M, Wan M, Kaestner KH, 2. Lo B, Strasser G, Sagolla M, Austin CD, Junttila M, Mellman I: Lkb1 Göransson O, Viollet B, Gray NS, Birnbaum MJ, Sutherland C, Sakamoto K: regulates organogenesis and early oncogenesis along AMPK-de- The LKB1-salt-inducible kinase pathway functions as a key gluconeogenic pendent and -independent pathways. JCellBiol199: 1117–1130, 2012 suppressor in the liver. Nat Commun 5:4535, 1–16, 2014 3. Hemminki A, Markie D, Tomlinson I, Avizienyte E, Roth S, Loukola A, 21. Iwano M, Plieth D, Danoff TM, Xue C, Okada H, Neilson EG: Evidence Bignell G, Warren W, Aminoff M, Höglund P, Järvinen H, Kristo P, Pelin that fibroblasts derive from epithelium during tissue fibrosis. JClinIn- K, Ridanpää M, Salovaara R, Toro T, Bodmer W, Olschwang S, Olsen AS, vest 110: 341–350, 2002 Stratton MR, de la Chapelle A, Aaltonen LA: A serine/threonine kinase 22. Kalluri R, Neilson EG: Epithelial–mesenchymal transition and its im- gene defective in Peutz–Jeghers syndrome. Nature 391: 184–187, 1998 plications for fibrosis. JClinInvest112: 1776–1784, 2003 4. Jenne DE, Reimann H, Nezu J, Friedel W, Loff S, Jeschke R, Müller O, 23. Liu Y: Epithelial to mesenchymal transition in renal fibrogenesis: path- Back W, Zimmer M: Peutz–Jeghers syndrome is caused by mutations ologic significance, molecular mechanism, and therapeutic in- in a novel serine threonine kinase. Nat Genet 18: 38–43, 1998 tervention. JAmSocNephrol15: 1–12, 2004 5. Hemminki A, Tomlinson I, Markie D, Järvinen H, Sistonen P, Björkqvist 24. Zeisberg M, Hanai J, Sugimoto H, Mammoto T, Charytan D, Strutz F, AM, Knuutila S, Salovaara R, Bodmer W, Shibata D, de la Chapelle A, Kalluri R: BMP-7 counteracts TGF-beta1-induced epithelial-to-mesenchymal

452 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 439–453, 2016 www.jasn.org BASIC RESEARCH

transition and reverses chronic renal injury. Nat Med 9: 964–968, 42. Jeppesen J, Maarbjerg SJ, Jordy AB, Fritzen AM, Pehmøller C, Sylow L, 2003 Serup AK, Jessen N, Thorsen K, Prats C, Qvortrup K, Dyck JR, Hunter 25. Zavadil J, Cermak L, Soto-Nieves N, Böttinger EP: Integration of TGF- RW, Sakamoto K, Thomson DM, Schjerling P, Wojtaszewski JF, Richter beta/Smad and Jagged1/Notch signalling in epithelial-to-mesenchymal EA, Kiens B: LKB1 regulates lipid oxidation during exercise in- transition. EMBO J 23: 1155–1165, 2004 dependently of AMPK. Diabetes 62: 1490–1499, 2013 26. Bielesz B, Sirin Y, Si H, Niranjan T, Gruenwald A, Ahn S, Kato H, Pullman 43. Gan B, Hu J, Jiang S, Liu Y, Sahin E, Zhuang L, Fletcher-Sananikone E, J, Gessler M, Haase VH, Susztak K: Epithelial Notch signaling regulates Colla S, Wang YA, Chin L, Depinho RA: Lkb1 regulates quiescence and interstitial fibrosis development in the kidneys of mice and humans. J metabolic homeostasis of haematopoietic stem cells. Nature 468: 701– Clin Invest 120: 4040–4054, 2010 704, 2010 27. Kang HM, Ahn SH, Choi P, Ko YA, Han SH, Chinga F, Park AS, Tao J, 44. Koh HJ, Arnolds DE, Fujii N, Tran TT, Rogers MJ, Jessen N, Li Y, Liew Sharma K, Pullman J, Bottinger EP, Goldberg IJ, Susztak K: Defective CW, Ho RC, Hirshman MF, Kulkarni RN, Kahn CR, Goodyear LJ: Skeletal fatty acid oxidation in renal tubular epithelial cells has a key role in muscle-selective knockout of LKB1 increases insulin sensitivity, im- kidney fibrosis development. Nat Med 21: 37–46, 2015 proves glucose homeostasis, and decreases TRB3. Mol Cell Biol 26: 28. Hong YA, Lim JH, Kim MY, Kim TW, Kim Y, Yang KS, Park HS, Choi SR, 8217–8227, 2006 Chung S, Kim HW, Kim HW, Choi BS, Chang YS, Park CW: Fenofibrate 45. Thomson DM, Hancock CR, Evanson BG, Kenney SG, Malan BB, improves renal lipotoxicity through activation of AMPK-PGC-1a in db/db Mongillo AD, Brown JD, Hepworth S, Fillmore N, Parcell AC, Kooyman mice. PLoS ONE 9: e96147, 2014 DL, Winder WW: Skeletal muscle dysfunction in muscle-specificLKB1 29. Tran M, Tam D, Bardia A, Bhasin M, Rowe GC, Kher A, Zsengeller ZK, knockout mice. J Appl Physiol (1985) 108:1775–1785, 2010. Akhavan-Sharif MR, Khankin EV, Saintgeniez M, David S, Burstein D, 46. van der Velden YU, Wang L, Zevenhoven J, van Rooijen E, van Lohuizen Karumanchi SA, Stillman IE, Arany Z, Parikh SM: PGC-1a promotes M, Giles RH, Clevers H, Haramis AP: The serine-threonine kinase LKB1 recovery after acute kidney injury during systemic inflammation in mice. is essential for survival under energetic stress in zebrafish. Proc Natl JClinInvest121: 4003–4014, 2011 Acad Sci U S A 108: 4358–4363, 2011 30. Woroniecka KI, Park AS, Mohtat D, Thomas DB, Pullman JM, Susztak K: 47. Gurumurthy S, Xie SZ, Alagesan B, Kim J, Yusuf RZ, Saez B, Tzatsos A, Transcriptome analysis of human diabetic kidney disease. Diabetes 60: Ozsolak F, Milos P, Ferrari F, Park PJ, Shirihai OS, Scadden DT, 2354–2369, 2011 Bardeesy N: The Lkb1 metabolic sensor maintains haematopoietic 31. Si H, Banga RS, Kapitsinou P, Ramaiah M, Lawrence J, Kambhampati G, stem cell survival. Nature 468: 659–663, 2010 Gruenwald A, Bottinger E, Glicklich D, Tellis V, Greenstein S, Thomas 48. Dugan LL, You YH, Ali SS, Diamond-Stanic M, Miyamoto S, DeCleves DB, Pullman J, Fazzari M, Susztak K: Human and murine kidneys show AE, Andreyev A, Quach T, Ly S, Shekhtman G, Nguyen W, Chepetan A, gender- and species-specific gene expression differences in response Le TP, Wang L, Xu M, Paik KP, Fogo A, Viollet B, Murphy A, Brosius F, to injury. PLoS ONE 4: e4802, 2009 Naviaux RK, Sharma K: AMPK dysregulation promotes diabetes-related 32. National Kidney Foundation: K/DOQI clinical practice guidelines for reduction of superoxide and mitochondrial function. J Clin Invest 123: chronic kidney disease: evaluation, classification, and stratification. Am 4888–4899, 2013 JKidneyDis39[Suppl 1]: S43–S66, 2002 49. Satriano J, Sharma K, Blantz RC, Deng A: Induction of AMPK activity cor- 33. Boehlke C, Kotsis F, Patel V, Braeg S, Voelker H, Bredt S, Beyer T, rects early pathophysiological alterations in the subtotal nephrectomy Janusch H, Hamann C, Gödel M, Müller K, Herbst M, Hornung M, model of chronic kidney disease. Am J Physiol Renal Physiol 305: F727– Doerken M, Köttgen M, Nitschke R, Igarashi P, Walz G, Kuehn EW: F733, 2013 Primary cilia regulate mTORC1 activity and cell size through Lkb1. Nat 50. Portilla D, Dai G, McClure T, Bates L, Kurten R, Megyesi J, Price P, Li S: Cell Biol 12: 1115–1122, 2010 Alterations of PPARalpha and its coactivator PGC-1 in cisplatin-induced 34. Brooks C, Wei Q, Cho SG, Dong Z: Regulation of mitochondrial dy- acute renal failure. Kidney Int 62: 1208–1218, 2002 namics in acute kidney injury in cell culture and rodent models. JClin 51. Li S, Wu P, Yarlagadda P, Vadjunec NM, Proia AD, Harris RA, Portilla D: Invest 119: 1275–1285, 2009 PPAR alpha ligand protects during cisplatin-induced acute renal failure 35. Duivenvoorden WC, Beatty LK, Lhotak S, Hill B, Mak I, Paulin G, Gallino by preventing inhibition of renal FAO and PDC activity. Am J Physiol D, Popovic S, Austin RC, Pinthus JH: Underexpression of tumour sup- Renal Physiol 286: F572–F580, 2004 pressor LKB1 in clear cell renal cell carcinoma is common and confers 52. Gomez IG, MacKenna DA, Johnson BG, Kaimal V, Roach AM, Ren S, growth advantage in vitro and in vivo. Br J Cancer 108: 327–333, 2013 Nakagawa N, Xin C, Newitt R, Pandya S, Xia TH, Liu X, Borza DB, Grafals 36. Abbud W, Habinowski S, Zhang JZ, Kendrew J, Elkairi FS, Kemp BE, M, Shankland SJ, Himmelfarb J, Portilla D, Liu S, Chau BN, Duffield JS: Witters LA, Ismail-Beigi F: Stimulation of AMP-activated protein kinase Anti-microRNA-21 oligonucleotides prevent Alport nephropathy pro- (AMPK) is associated with enhancement of Glut1-mediated glucose gression by stimulating metabolic pathways. JClinInvest125: 141– transport. Arch Biochem Biophys 380: 347–352, 2000 156, 2015 37. Xi X, Han J, Zhang JZ: Stimulation of glucose transport by AMP-activated 53. Bardeesy N, Sinha M, Hezel AF, Signoretti S, Hathaway NA, Sharpless protein kinase via activation of p38 mitogen-activated protein kinase. J NE, Loda M, Carrasco DR, DePinho RA: Loss of the Lkb1 tumour sup- Biol Chem 276: 41029–41034, 2001 pressor provokes intestinal polyposis but resistance to transformation. 38. Fryer LG, Foufelle F, Barnes K, Baldwin SA, Woods A, Carling D: Nature 419: 162–167, 2002 Characterization of the role of the AMP-activated protein kinase in the 54. Shao X, Somlo S, Igarashi P: Epithelial-specific Cre/lox recombination stimulation of glucose transport in skeletal muscle cells. Biochem J 363: in the developing kidney and genitourinary tract. JAmSocNephrol13: 167–174, 2002 1837–1846, 2002 39. Sambandam N, Lopaschuk GD: AMP-activated protein kinase (AMPK) 55. Mehlem A, Hagberg CE, Muhl L, Eriksson U, Falkevall A: Imaging of control of fatty acid and glucose metabolism in the ischemic heart. Prog neutral lipids by oil red O for analyzing the metabolic status in health Lipid Res 42: 238–256, 2003 and disease. Nat Protoc 8: 1149–1154, 2013 40. Nieth H, Schollmeyer P: Substrate-utilization of the human kidney. Nature 209: 1244–1245, 1966 41. Meyer C, Nadkarni V, Stumvoll M, Gerich J: Human kidney free fatty acid and glucose uptake: evidence for a renal glucose-fatty acid cycle. This article contains supplemental material online at http://jasn.asnjournals. Am J Physiol 273: E650–E654, 1997 org/lookup/suppl/doi:10.1681/ASN.2014121181/-/DCSupplemental.

J Am Soc Nephrol 27: 439–453, 2016 Lkb1 in CKD 453 Table S1. Patient characteristics

All Control HTN DM HTN-CKD DKD p-value

N (%) 95 19 (20%) 20 (21.1%) 17 (17.9%) 19 (20.0%) 20 (21.1%) -

Age (years) 63.6 ± 13.5 62.0 ± 9.7 64.1 ± 10.8 64.5 ± 12.7 59.3 ± 20.5 67.9 ± 10.8 0.363

Gender (Male, N, %) 55 (57.9%) 11 (57.9%) 12 (60.0%) 10 (58.8%) 12 (63.2%) 10 (50.0%) 0.942

Race (N, %)

African American 36 (37.9%) 6 (35.3%) 7 (43.8%) 5 (41.7%) 11 (51.1%) 7 (36.8%)

Caucasian 19 (20.0%) 5 (29.4%) 5 (31.2%) 2 (16.7%) 2 (11.1%) 5 (26.3%) 0.825 Hispanic 6 (6.3%) 1 (5.9%) 1 (6.2%) 2 (16.7%) 1 (5.6%) 1 (5.3%)

Asian 5 (5.3%) 1 (5.9%) 1 (6.2%) 2 (16.7%) 0 (0.0%) 1 (5.3%)

BMI (kg/m2) 29.8 ± 9.3 28.6 ± 6.3 35.0 ± 15.2 28.7 ± 4.7 25.0 ± 5.8 31.6 ± 7.9 0.014

Systolic BP (mmHg) 138.7 ± 24.8 128.7 ± 19.3 142.8 ± 35.7 134.0 ± 16.8 152.4 ± 24.3 134.5 ± 27.5 0.061

Diastolic BP (mmHg) 78.1 ± 13.7 74.5 ± 12.8 79.2 ± 7.2 74.0 ± 11.4 87.4 ± 13.8 71.2 ± 12.7 0.010

Serum albumin (g/dL) 4.0 ± 0.7 4.3 ± 0.4 4.1 ± 0.5 3.9 ± 0.6 4.1 ± 0.5 3.7 ± 0.9 0.051 eGFR (mL/min/1.73 m2) 60.3 ± 29.8 85.5 ± 18.6 77.1 ± 15.4 78.4 ± 10.7 29.6 ± 21.7 33.3 ± 18.4 <0.001

Table S2. Sequences of oligonucleotide primers used for qPCR test

Gene Forward Reverse

Lkb1 CTACTCCGAGGGATGTTGGA GATAGGTACGAGCGCCTCAG

Cre ATGGATTTCCGTCTCTGGTG CCCGGCAAAACAGGTAGTTA

Ubc GCCCAGTGTTACCACCAAGAAG GCTCTTTTTAGATACTGTGGTGAGGAA

Cdh1 CCAGTTTCCTCGTCCGCGCC TCAGAGGCAGGGTCGCGGTG

Zo1 CCACCTCGCACGCATCA GAGCTGCCTCAGCACTTGGT

Col1a1 GCCAAGAAGACATCCCTGAA GTTTCCACGTCTCACCATTG

Col3a1 ACAGCTGGTGAACCTGGAAG ACCAGGAGATCCATCTCGAC

Fn ACAAGGTTCGGGAAGAGGTT CCGTGTAAGGGTCAAAGCAT

F4/80 CTGTAACCGGATGGCAAACT CTGTACCCACATGGCTGATG

Acta2 CTGACAGAGGCACCACTGAA AGAGGCATAGAGGGACAGCA

Cpt1 GGTCTTCTCGGGTCGAAAGC TCCTCCCACCAGTCACTCAC

Cpt2 CAATGAGGAAACCCTGAGGA GATCCTTCATCGGGAAGTCA

Acox1 CTTGGATGGTAGTCCGGAGA TGGCTTCGAGTGAGGAAGTT

Ppara TGCAAACTTGGACTTGAACG GATCAGCATCCCGTCTTTGT

Ppargc1a AGTCCCATACACAACCGCAG CCCTTGGGGTCATTTGGTGA

Bcl-2 TGGGATGCCTTTGTGGAACT CAGCCAGGAGAAATCAAACAGA

Glut-1 ACACTCACCACGCTTTGGTC ACACACCGATGATGAAGCGG

Hk CCAAAATAGACGAGGCCGTA TTCAGCAGCTTGACCACATC

Pfk CCATGTTGTGGGTGTCTGAG ACAGGCTGAGTCTGGAGCAT

Pk AGATGATCAAGGCAGGGATG GAATGTTGGCGATGGACTCT

Mtor TCAAGCAGGCAACATCTCAC AGGGACACCAGCCAATGTAG

Supplemental figures

Figure S1. CAB39L expression in healthy human kidney samples

Representative images of double immunofluorescence staining of CAB39L (red) and distal tubule marker PNA

(green) (arrow head). CAB39L was expressed both in PNA positive (distal) and PNA negative (proximal) tubules. CAB39L expression was also observed in the cytoplasm (lower panel).

Figure S2. Lkb1 deletion in the proximal tubulles did not result in kidney fibrosis

Representative images of PAS-stained kidney sections from control and Pepck-

Cre/Lkb1flox/flox mice at 27 weeks of age

Figure S3. Cysts are not prominent in kidneys of Ksp-Cre/Lkb1flox/flox mice

Quantification of dilated tubules (TD), microcysts, and cysts in control and Ksp-

Cre/Lkb1flox/flox mice

Figure S4. Cell proliferation in Ksp-Cre/Lkb1flox/flox mice

(A and B) Immunohistochemistry images of (A) Ki-67 and (B) PCNA in control and Ksp-

Cre/Lkb1flox/flox mice. Note the increased proliferation of interstitial cells.

Figure S5. No apparent polarity or ciliary abnormalities in Ksp-Cre/Lkb1flox/flox mice

Transcript levels of cadherin 1 (Cdh1) (A) and zonular occludens-1 (Zo1) (B) in control and 5 and 14-wk old Ksp-Cre/Lkb1flox/flox mice. (B) Basolateral localization of β-catenin and E- cadherin was not altered in 14-wk old Ksp-Cre/Lkb1flox/flox mice. These markers were co- stained with peanut agglutinin (PNA), a distal tubule marker. (C) Immunostaining of acetylated tubulin (red) demonstrated that primary cilia were present and normal appearing in mutant mice, both at week 5 and 14.

Figure S6. The mTOR pathway is not activated in Ksp-Cre/Lkb1flox/flox mice

(A) Transcript level of Mtoro and Hif1a in control and Ksp-Cre/ Lkb1flox/flox mice. (B)

Representative immunostaining of p-mTOR and p-S6K levels in control and Ksp-Cre/

Lkb1flox/flox mice. (C) Western blot analysis for P-mTOR and P-S6K and beta actin of control and Lkb1-deficient cells and control and KKsp-Cre/ Lkb1flox/flox mice.

Figure S7. Comparisons of different control groups

There were no differences in transcript levels of Lkb1, genes involved in β-oxidation and glycolysis between WT cells infected with Ad-GFP, WT cells infected witth Ad-Cre-GFP, and

WT/Lkb1flox/flox cells infected with Ad-GFP. However, Lkb1 deficient cells (WT/Lkb1flox/flox cells infected with Ad-Cre-GFP) had lower levels of Lkb1, Cpt1, Cptt2, Acox1, Ppara1,

Pparagc1a, Glut1, Hk, and Pk than thesee 3 groups.

Supplemental Methods

Tubular dilatation (TD)/Cyst Index

Using a grid of squares with each side measuring 13.625 μm, we quantified the number of dilated tubules and cysts per kidney stained with PAS. Each cross was marked with a dot and the number of dots in the tubular lumen was counted. The degree of dilatation was determined by the number of dots according to criteria as previously suggested by Bastos et al1: (1) normal, one dot; (2) TD, two dots; (3) microcyst, three to ten dots; and (4) cyst, > 10 dots.

Quantitative real-time polymerase chain reaction analysis

We prepared total RNA from mouse kidney and from primary cultures of renal tubular cells using RNeasy Mini Kit (Qiagen). The quality was analyzed on agarose gels, and the quantity was measured using NanoDrop. We reverse-transcribed 1 μg total RNA using the cDNA

Archival Kit (Applied Biosystems). Quantitative real-time polymerase chain reaction (qPCR) analysis was performed using a ViiA™ 7 Real-Time PCR System (Life Technologies), with

SYBR Green Master Mix, 3-step standard cycling conditions, and sequence-specific primers.

The sequences of primers used for the experiment are presented in Table S2. We examined the melting curve to verify that a single product was amplified. For quantitative analysis, all samples were normalized to Ubiquitin C gene expression using the ΔΔCT value method.

Western blot analysis

Cell lysates were prepared with RIPA lysis buffer containing protease inhibitor cocktail (Complete Mini, Roche) and phosphatase inhibitor (PhosSTOP, Roche). Proteins were resolved on 5–15% gradient gels, transferred on to polyvinylidene difluoride membranes and probed with antibodies as below; LKB1 (#07-694, Millipore), phospho-(5'AMP-activated protein kinase) AMPK (Thr172) (#2535, Cell signaling), peroxisome proliferator-activated receptor-alpha (PPAR-α) (#ab8934, Abcam), phospho-acetyl-coenzyme A carboxylase (ACC)

(#3661, Cell signaling), peroxisome proliferator-activated receptor gamma coactivator 1- alpha (PGC-1α) (#ab54418, Abcam), phospho-mammalian target of rapamycin (mTOR)

(#5536, Cell signaling), phospho-p70 S6 Kinase (Thr389) (#9234, Cell signaling) and phospho-p70 S6 Kinase (Ser371) (#9208, Cell signaling), and β-actin (#A5316, Sigma-

Aldrich). Anti-rabbit (#7074, Cell Signaling) or anti-mouse (#7076, Cell Signaling) IgG horseradish peroxidase (HRP) was used as a secondary antibody. Blots were detected by

enhanced chemiluminescence (Western Lightning-ECL, Thermo Scientific).

Histology, immunohistochemistry, and immunofluorescence

We used formalin-fixed, paraffin-embedded kidney sections stained with periodic acid

Schiff (PAS) for routine histologic examination. Slides were examined, and pictures were

taken with an Olympus DP73 microscope.

To detect fibrosis, Sirius-red staining was performed by incubating slides in 0.1% Sirius Red

F3B for 1 h, washing twice in acidified water, dehydrating three times in 100% ethanol, and

then clearing in xylene. The sections were examined under a Nikon Eclipse E600 microscope

equipped with a digital camera (Melville, NY). All images were submitted to ImageJ v1.49

(NIH, Bethesda, Maryland, USA; online at http://rsbweb.nih.gov/ij) to quantify the

percentage of fibrosis compared to the total amount of tissue within an image. For immunofluorescence staining, sections were deparaffinized and hydrated, followed by

microwave antigen retrieval in 10 mM sodium citrate, pH 6.0. Sections were blocked in 5%

normal goat serum for 30 min at room temperature and incubated in mouse anti–β-catenin

antibody (1:100; #610154, BD Biosciences) and rabbit anti–E-cadherin antibody (1:100;

#3195, Cell signaling) overnight at 4 °C. Anti-mouse Alexa Fluor 488 (1:200; #4408, Cell

Signaling) and anti-rabbit Alexa Fluor 555 (1:200; #4413, Cell Signaling) were applied and nuclei were stained with DAPI. For double immunofluorescence staining using human kidney samples, sections were incubated with rabbit anti-phospho LKB1 (1:200; GTX30765,

GeneTex) overnight and fluorescein lotus tetraglonolobus lectin (1:200; FL1321, Vector laboratories), a proximal tubule marker, was added for 60 minutes on the following day.

For fluorescence labeling of acetylated tubulin (#T741, Sigma-Aldrich), following antigen retrieval with citrate buffer, sections were blocked with AffiniPure Fab fragment anti-mouse

IgG (#115-007-003, Jackson ImmunoResearch Labs), and incubated overnight with primary antibody. After washing, Cy3 conjugated anti-rabbit antibodies (Jackson) were applied, and the sections were mounted with fluoromount and visualized.

For immunohistochemical staining, sections were deparaffinized, hydrated in ethyl alcohol, and washed in tap water. Antigen retrieval was carried out in 1 mM EDTA, pH 8.0 by microwave for 15 min. Endogenous peroxidase activity was blocked in 3% H2O2 for 10 min.

Sections were blocked in 0.2% fish skin gelatin for 60 min at room temperature and

incubated overnight at 4 °C in rabbit anti–cleaved caspase 3 (1:100; #9664, Cell Signaling),

rabbit anti-PGC-1α (1:750, #ab54418, Abcam), and rabbit anti-phospho LKB1 (Ser428)

(1:200; GTX30765, GeneTex). Staining was visualized using peroxidase-conjugated

antibodies to rabbit immunoglobulin using the Vectastain Elite kit and 3, 3-diaminobenzidine

(DAB), as per manufacturer’s protocol (Vector Labs).

Supplemental References

1. Bastos AP, Piontek K, Silva AM, Martini D, Menezes LF, Fonseca JM, Fonseca, II, Germino GG, Onuchic LF: Pkd1 haploinsufficiency increases renal damage and induces microcyst formation following ischemia/reperfusion. J Am Soc Nephrol 20:2389-2402, 2009.