Insulin-Like Growth Factor Binding Proteins IGFBP3, IGFBP4, And

Imaging, Diagnosis, Prognosis

Insulin-like Growth Factor Binding Proteins IGFBP3, IGFBP4, andIGFBP5PredictEndocrineResponsivenessin Patients with Ovarian Cancer GraemeWalker,1Kenneth MacLeod,1Alistair R.W.Williams,2 David A. Cameron,1 John F. Smyth,1and Simon P. Langdon1

Abstract Purpose: This studysought to explore the predictive value of the insulin-like growth factor (IGF) binding proteins (IGFBP) as markers of response in ovarian cancer patients treated with the aromatase inhibitor letrozole. Experimental Design: IGFBP mRNA expression in cell lines was measured byquantitative reverse transcription-PCR and IGFBP protein expression measured in sections from primary tumors of patients treated with letrozole bysemiquantitative immunohistochemistry. Results: Quantitative reverse transcription-PCR analysis showed that IGFBP3 and IGFBP5 were down-regulated and IGFBP4 was up-regulated by17 h-estradiol (E2) in an estrogen receptor (ER)^ positive ovarian cancer cell line. Expressions of IGFBP1, IGFBP2, and IGFBP6 were unaffected byE 2.TheE2 modulation of these genes was reversed bytamoxifen. Using ER a-specific (propyl pyrazole triol) and ERh-specific (diarylpropionitrile) agonists, the gene expression modu- lations produced byE 2 could be replicated bypropylpyrazole triol but not bydiarylpropionitrile. For ovarian cancer patients being treated with letrozole, we tested the predictive value of the IGFBPs in paraffin-fixed sections from their primarytumors bysemiquantitative immunohistochemistry. Using serum CA125 as an indicator of progression/response, significant differences in expression levels of IGFBPs were observed between tumors from CA125 responding/stable patients compared with tumors from progressing patients. Mean immunoscores for IGFBP3 and IGFBP5 were significantlylower, and mean expression of IGFBP4 was significantlyhigher in tumors from patients demonstrating CA125 response or stabilization compared with CA125 progression. Conclusion: These results indicate that expression levels of certain IGFBP familymembers in ovarian cancers are estrogen regulated and can, thus, help identifypatients who could benefit from endocrine therapy.

Epithelial ovarian cancer is the leading cause of death from More recently, we and others have shown that the aromatase gynecologic malignancies in the Western world, and new inhibitor letrozole, which acts by depleting levels of estrogen approaches are required to treat this disease. Ovarian cancers available to ERa, has shown clinical benefit in a subgroup frequently express high levels of estrogen receptor a (ERa), of ovarian cancer patients (7, 8). In a phase II trial of letrozole which raises the possibility that ERa might represent a in patients with ovarian cancer, we showed that a response or therapeutic target. We have previously shown that ERa-positive stabilization of disease, as defined by CA125 levels, was ovarian cancer cell line models are growth responsive to associated with higher levels of ERa expression, low erbB2 estrogen and antiestrogen manipulations both in vitro and receptor levels, and high epidermal growth factor receptor in vivo (1–4). The antiestrogen tamoxifen has been widely used expression (7), and an extension to this trial has confirmed to treat chemoresistant diseases with inconclusive results (5, 6). that expression of ERa predicts sensitivity (9). The overall combined rate of CA125 marker response and stabilization was 32% in the first trial, and the median survival was 14 Authors’ Affiliations: 1Edinburgh Cancer Research Center and 2Department of months with 17% of patients alive at 2 years (7). In the Pathology, University of Edinburgh, Edinburgh, United Kingdom follow-up study that was restricted to patients with moderate- Received 9/12/06; revised 12/1/06; accepted 12/22/06. to-high ERa-expressing cancers, the CA125 response rate The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be herebymarked advertisement in accordance increased to 16% with CA125 stabilization shown in a further with 18 U.S.C. Section 1734 solelyto indicate this fact. 37% of patients (9). Requests for reprints: Simon Langdon, Edinburgh Cancer Research Center, To search for predictive markers to help identify estrogen- Universityof Edinburgh, Crewe Road South, Edinburgh, EH4 2XR, United sensitive ovarian cancers, we used microarray analysis to Kingdom. Phone: 44-1317773537; Fax: 44-1317773520; E-mail: simon.langdon@ cancer.org.uk. highlight a panel of potentially useful gene markers (4). That h F 2007 American Association for Cancer Research. study explored 17 -estradiol (E2) modulation of gene expres- doi:10.1158/1078-0432.CCR-06-2245 sion in an ERa-positive ovarian cancer cell line (PE01) in vitro

Clin Cancer Res 2007;13(5) March 1,2007 1438 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2007 American Association for Cancer Research. IGFBPs and Endocrine Response in Ovarian Cancer

(4). The gene which showed the most marked change on this IGFBP5: AAGAAGCTGACCCAGTCCAA and GAATCCTTTGCGGTCA- 1200–cancer-gene array was insulin-like growth factor (IGF) CAAT binding protein (IGFBP) 3, which was down-regulated by IGFBP6: AAGATGTGAACCGCAGAGAC and GGTAGAAGCCTC- estrogen. Because IGFBP4 and IGFBP5 are also well-described GATGGTCA ACTIN: CTACGTCGCCCTGGACTTCGAGC and GATGGAGCCGCC- estrogen-regulated markers in breast cancer (10–13), we GATCCACACGG considered that this family might provide valuable predictive information in the context of ovarian cancer. Immunohistochemistry. We had previously recruited a series of 60 The IGFBP family of binding proteins consists of six ovarian cancer patients to receive letrozole (2.5 mg/d) daily at the time structurally related proteins (14, 15). Their role is to bind and of CA125 relapse of their disease (7). Of these, CA125 data were regulate the effects of the IGFs, which play major roles in cell evaluable for 49 patients at 12 weeks of treatment. At this time, five proliferation, differentiation, and apoptosis in many cell types. patients showed >50% reduction in their CA125 value (CA125 In addition, some of the family members, notably IGFBP3, response) and 14 patients had CA125 reductions, which fell by <50% have direct IGF-independent effects on cellular growth and and then remained stable (i.e., did not increase to >50% of the initial CA 125 value) at 12 weeks, whereas the CA125 values of 30 patients apoptosis (15). All six family members are expressed in the progressed by >50%. Formalin-fixed paraffin-embedded histologic normal ovary, with IGFBP1-IGFBP5 and IGFBP6 being identi- sections from tumor specimens resected at the initial laparotomy were in situ fied by hybridization and by reverse transcription-PCR, assessed for the presence of biochemical markers. Sections (3 Am) were respectively (16–18). These molecules play significant roles in deparaffinized and rehydrated. Endogenous peroxidase activity was

the regulation of both folliculogenesis and steroidogenesis with blocked by incubating sections in 3% H2O2. Sections were immersed in IGFBP4, in particular, having a major role in the selection of the citrate buffer (0.005 mol/L, pH 6.0) and microwaved for 3 Â 5 min, dominant follicle (16, 19). An association between serum levels except for IGFBP6 staining (because the antibody showed improved of this family and the presence of ovarian cancer has also been staining in the absence of microwaving). Slides were washed in identified (20). Although serum levels of IGFBP2 are signifi- 0.05 mol/L Tris-NaCl buffer (pH 7.6) and then incubated in 20% FCS cantly elevated in patients with ovarian cancer relative to those for 10 min. Primary antibodies were added for 1 to 2 h. The following antibodies were used: IGFBP1 (Ab10732, Abcam, Cambridge, United with benign tumors, expressions of both IGFBP3 and IGFBP5 Kingdom; 1:5 dilution), IGFBP2 (Ab4243, Abcam; 1:5 dilution), are lower (20). IGFBP3 (Ab4248, Abcam; 1:500 dilution), IGFBP4 (17661, USBiolo- In this study, we investigated the estrogen regulation of gical, Swampscott, MA; 1:3 dilution), IGFBP5 (Ab4255, Abcam; 1:300 transcription of the IGFBPs in an ER-positive, estrogen-sensitive dilution), IGFBP6 (Ab4258, Abcam; 1:5 dilution). ovarian cancer cell line. We then explored whether the expres- The anti-IGFBP1 antibody is noncross reactive with IGFBP2, IGFBP3, sion levels in clinical samples relate to letrozole responsiveness and IGFBP4. The anti-IGFBP3 antibody has minimal cross-reactivities for patients with ovarian cancer to assess their value as predictive with IGFBP1 (f10%), IGFBP2 (<0.2%), IGFBP4 (<0.2%), and IGFBP5 markers. (<0.2%). The anti-IGFBP4 antibody shows no cross-reactivities. The anti-IGFBP5 antibody has minimal cross-reactivities with IGFBP1 (<0.5%), IGFBP2 (<0.1%), IGFBP3 (<0.1%), and IGFBP4 (<0.5%). Materials and Methods The cross-reactivities of the IGFBP2 and IGFBP6 antibodies are undefined. Cell culture. The PEO4 and PE014 cell lines were developed at the After primary antibody incubation, sections were washed in Tris- Edinburgh Cancer Research Center (21). Cell lines were routinely NaCl buffer. A streptavidin-biotin multilink method (StrAviGen Multi- link kit, Biogenex, San Ramon, CA) was used for detection of reactivity. cultured at 37jC, 90% humidity, and 5% CO2 in RPMI 1640 (Life Technologies, Paisley, United Kingdom) containing 10% heat-inacti- Sections were stained with secondary multilink antibody (1:20 dilution vated FCS, 100 Ag/mL streptomycin, and 100 IU/mL penicillin. Where for 30 min), followed by horseradish peroxidase–labeled streptavidin complex (1:20 dilution for 30 min). Diaminobenzidine tetrachloride specified, cells were treated with E2 (Sigma, Poole, United Kingdom), tamoxifen (Sigma), ERa agonist (propyl pyrazole triol, Tocris, Avon- was used as chromogen and applied for 5 min. Slides were then lightly mouth, United Kingdom), or ERh-specific agonist (diarylpropionitrile, counterstained with hematoxylin and mounted conventionally. IGFBP Tocris) at the concentrations shown. expression was measured using a scoring system consisting of the Real-time quantitative PCR. Reverse transcription-PCR was done product of the percentage of positive cells and intensity of staining using a Rotorgene 2000 (Corbett Research, Cambridge, United (0-3), producing a histoscore ranging from 0 to 300. All tumor cells in Kingdom) and a one-step Quantitect reverse transcription-PCR kit the section were counted in the scoring system. Sections were scored by (Qiagen, Cowley, United Kingdom) as per protocol. Thermal cycling two independent readers, and mean values were obtained. Where initial conditions were 50jC for 30 min and 95jC for 15 min, followed by 45 scoring produced a value divergent by >10%, these sections were cycles of 95jC for 15 s, 55jC for 30 s, and 72jC for 45 s. Single-product rescored until agreement was reached. amplification was confirmed by product melt analyses. PCR primers Statistics. Differences between groups were tested using the Mann- were designed by Primer 3.0 and Blast searched to check specificity. Whitney test and ANOVA, followed by a Dunnett’s multiple compar- Specific PCR amplification products were detected by the fluorescent isons test and Fisher’s exact test where described. double-stranded DNA-binding dye SYBR Green. Primer sequences used were as follows: Results

IGFBP1: GTTTAGCCAAGGCACAGGAG and TATCTGG- IGFBP3, IGFBP4, and IGFBP5 are modulated by estrogen in CAGTTGGGGTCTC an estrogen-responsive ovarian cancer cell line in vitro. The IGFBP2: GAGAAGGTCACTGAGCAGCA and GGGATGTGCAGG- modulation by E of the individual IGFBP family members was GAGTAGAG 2 IGFBP3: GCGGGAGACAGAATATGGTC and AGGCTGCCCATACT- first investigated in the ER-positive, estrogen growth–sensitive TATCCA PE04 cell line. After exposure to 0.1 nmol/L E2 for 6 h, IGFBP3 IGFBP4: GCCCAAGAGGACTGAGACTG and CACATGCCAAAATCA- and IGFBP5 expressions were down-regulated, whereas IGFBP4 GAGGA was up-regulated and IGFBP1, IGFBP2, and IGFBP6 expressions

www.aacrjournals.org 14 3 9 Clin Cancer Res 2007;13(5) March 1, 2007 Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2007 American Association for Cancer Research. Imaging, Diagnosis, Prognosis were unchanged (Fig. 1). Tamoxifen alone had negligible effects IGFBP1 protein expression was detected in approximately on expression but was able to reverse the decreased expressions half (53%, 22 of 42 tumors) of the ovarian cancers studied, of IGFBP3 and IGFBP5. To assess whether these effects were whereas IGFBP2 was expressed in virtually all tumors (90%, 38 likely to be mediated via ERa or ERh, we compared the effects of 42 positive). The mean immunohistoscore was not of a ERa-specific agonist (propyl pyrazole triol; ref. 22) and a significantly different between the CA125 nonprogressors and ERh-specific agonist (diarylpropionitrile; ref. 23) with E2. The the CA125 progressors for either IGFBP1 (22 versus 26, E2-modulated changes were very similar to those produced by respectively; P = 0.653; Mann-Whitney test) or IGFBP2 (92 propyl pyrazole triol, whereas diarylpropionitrile had little versus 71, respectively; P = 0.212). In contrast, the mean effect, suggesting that ERa accounts for E2 effects on IGFBP immunohistoscore for IGFBP3 was highly significantly different expression. Expression of all the six IGFBPs in the ERa-negative, between the nonprogressors and progressors (60 versus 121, estrogen growth–unresponsive PE014 cell line was unaffected respectively; P < 0.0001) with mean expression levels being by E2 (data not shown). lower in the CA125 nonprogressors group. IGFBP3 expression Expression of IGFBPs in primary ovarian cancers and association was detected in 40 (95%) of 42 tumors. Although IGFBP3 was with letrozole clinical response. The expression of individual reduced in nonprogressors relative to progressors, expression IGFBP was measured by semiquantitative immunohistochem- of IGFBP4 was increased (142 versus 50, respectively; istry in paraffin-fixed sections obtained from ovarian cancers of P = 0.0017). IGFBP4 expression was detected in 33 (72%) of patients treated in the initial phase II clinical trial of letrozole 46 tumors, and IGFBP5 expression in 44 (100%) of 44 tumors. (7). In that study, two groups of patients had been identified: In a pattern similar to that of IGFBP3, the mean immunohisto- the first group showing either CA125 reduction or a minimal score of IGFBP5 was highly significantly different between the increase of <50% (CA125 nonprogressors) and the second CA125 nonprogressors and the CA125 progressors (136 versus group showing CA125 increase of z50% (CA125 progressors). 204, respectively; P = 0.0019), with the mean expression level Examples of staining are illustrated in Fig. 2. Immunoscore being lower in the CA125 responsive group. IGFBP6 expression values for individual tumors were measured and are shown in was detected in 38 (93%) of 41 tumors. As for IGFBP1 and Fig. 3. Mean values are recorded in Table 1. IGFBP2, the mean immunohistoscore was not significantly

Fig. 1. Effects of E2 (0.1nmol/L), the ERa-agonist propyl pyrazole triol (PPT ; 1nmol/L),theERh-specific agonist diarylpropionitrile (DPN), and tamoxifen (TAM ;1Amol/L) on IGFBP expression in the PE04 ovarian cancer cell line. Treatment was for 6 h, and quantitation of mRNA expression was carried out byquantitative reverse transcription-PCR and normalized to actin levels. Columns, mean; bars, SE. Statisticallysignificant differences with respect to the control; *, P < 0.05. ANOVA, followed bya Dunnett’s multiple comparisons test.

Clin Cancer Res 2007;13(5) March 1,2007 1440 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2007 American Association for Cancer Research. IGFBPs and Endocrine Response in Ovarian Cancer

Fig. 2. Immunohistochemical expression of IGFBP familymembers in ovarian cancer sections. Ovarian cancer sections were stained with antibodies specific for individual isoforms as described in Materials and Methods.

different between the CA125 nonprogressors and the CA125 IGFBP4 was associated only with IGFBP2. The strongest progressors (75 versus 108, respectively; P = 0.086). The staining associations were between IGFBP3 and IGFBP5 and between observed was predominantly cytoplasmic for all antibodies (Fig. 2). IGFBP1 and IGFBP2. These values indicate that IGFBP3 and IGFBP5 are decreased Prediction of response. Multivariate logistic regression was in CA125 nonprogressive tumors, whereas IGFBP4 is increased. conducted on the data set to determine which markers IGFBP1, IGFBP2, and IGFBP6 are not differentially expressed. provided independent prediction of progression or not during The results are consistent with estrogen-regulating expression letrozole therapy. IGFBP and ERa scores were dichotomized at and, indeed, growth in the letrozole responding tumors. their median values. IGFBP3 was the most powerful predictor Because IGFBP3 and IGFBP5 are reduced in nonprogressive of lack of progression, with only ERa status significantly adding tumors, whereas IGFBP4 is increased, it is interesting to compare to its predictive power (P = 0.05). The only other significant combinations of these with the outcome, particularly to try and combinations were any two of ERa, IGFBP4, and IGFBP5, all of exploit the inverse direction of E2 modulation that exists between which were inferior to IGFBP3 alone. The combination of IGFBP4 and IGFBP3 or IGFBP5. In CA125 nonprogressors, the IGFBP4, IGFBP5, and ERa was superior to IGFBP3 but still immunoscore of IGFBP3 was lower than IGFBP4 in 12 of 15 inferior to that obtained with both IGFBP3 and ERa. CA125 nonprogressors and higher in 22 of 24 tumors from Association of IGFBP expression with other signaling compo- CA125 progressors (P < 0.0001, Fisher’s exact test; Fig. 4). nents. We have previously identified several other predictive Similarly, the immunoscore of IGFBP5 was lower than IGFBP4 markers in this series of tumors which were critical to signaling, in 8 of 15 nonprogressors and higher in 25 of 26 tumors from namely, ERa, epidermal growth factor receptor, and erbB2 (5). CA125 progressors (P = 0.0005; Fisher’s exact test; Fig. 4). These A higher expression of ERa is linked to letrozole response, and differential changes could provide an index of IGFBP3-IGFBP4 this is inversely associated with IGFBP3 expression but not with or IGFBP5-IGFBP4 that could have predictive value. other family members (Table 2). Similarly, expression of ErbB2 Coexpression of IGFBP family members in ovarian cancers. The is associated with both IGFBP3 and IGFBP5 expressions. coexpression of family members was next analyzed in this set of Expression of the epidermal growth factor receptor is associated tumors (Table 2). IGFBP1, IGFBP2, and IGFBP6 were observed with IGFBP4 but not with other family members. to be significantly coexpressed in these tumors, as were IGFBP3 and IGFBP5. It is interesting that these former three are Discussion unaffected by E2, whereas the latter two are both down- regulated. Further analysis of the IGFBP3 and IGFBP5 We show in this study that estrogen modulates the expression comparison revealed that although the 39 paired comparison of the IGFBP isoforms IGFBP3, IGFBP4, and IGFBP5 in ER- overall was highly significant (P < 0.0001), the association was positive ovarian cancer cells in culture. These effects are markedly significant in the CA125 nonprogressors (n =15 mimicked by the ERa agonist propyl pyrazole triol and are pairs, P < 0.0001) but random in the CA125 progressors (n = reversed by tamoxifen consistent with ERa mediating this 24 pairs, P = 0.52). We speculate that this is consistent with E2 effect. Furthermore, no effects are seen in an ER-negative model. modulating expression down only in responding tumors. In contrast, IGFBP1, IGFBP2, and IGFBP6 are not modulated

www.aacrjournals.org 14 41 Clin Cancer Res 2007;13(5) March 1, 2007 Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2007 American Association for Cancer Research. Imaging, Diagnosis, Prognosis

Fig. 3. Association between CA125 response and expression of individual IGFBPs. Immunoscores are shown for individual tumors and varybetween 0 and 300. IGF BP3, IGFBP4, and IGFBP5 expressions were significantlydifferent between CA125 progressors and nonprogressors, whereas expressions of IGFBP1, IGFBP2 ,andIGFBP6 were not (N.S.). Mann-Whitneytest.

by E2. We have previously shown that ERa mediates the IGFBP expression with outcome has significance from two growth effects of E2 in the PE04 cell line, with propyl pyrazole perspectives. The first is that these data supports the view that triol also stimulating growth, whereas tamoxifen reverses estrogen regulates gene expression and likely growth in certain the effect (4). of these ER-positive tumors. Secondly, these markers could Extension into primary tumor tissue from patients with help provide a predictive signature of outcome defining the ovarian cancers treated with letrozole showed expression subset of cancers that are most likely to be sensitive to letrozole patterns consistent with this pattern of regulation. If letrozole- and help target this approach more effectively. We have sensitive tumors are estrogen-driven, then we would anticipate previously shown that expression of progesterone receptor, that IGFBP4 would be up-regulated and IGFBP3 and IGFBP5 combined with expression of ERa, showed significant associa- would be down-regulated in such tumors relative to unrespon- tion with outcome (7); however, the IGFBPs seem to be more sive tumors. This was found to be the case. Association of powerful predictors. Prospective studies are now required to compare and confirm the predictive power of these biomarkers. IGFBP3, IGFBP4, and IGFBP5 are most clearly predictive of Table 1. Association of IGFBP expression with endocrine response in these ovarian cancers, and this is CA125 outcome consistent with previous literature reports of estrogen regulation in breast cancer. The results obtained here with estrogen Mean immunoscore and anti-estrogens in PE04 cells parallel those found in ER- P IGFBP CA125 CA125 * positive MCF-7 breast cancer cells, in which E2 down-regulated response/stable progression IGFBP3, whereas the pure antiestrogen ICI 182,780 (faslodex, IGFBP1 22 26 0.653 fulvestrant) up-regulated the protein (24). In breast cancers, IGFBP2 92 71 0.212 expression of IGFBP3 has been reported to be inversely IGFBP3 60 121 <0.0001 a IGFBP4 142 50 0.0017 associated with ER and we observed a similar association IGFBP5 136 204 0.0019 here in ovarian cancer (25). Estrogen has been shown to IGFBP6 75 108 0.086 increase IGFBP4 in MCF-7 and other ER-positive breast cancer cell lines (26, 27), whereas ICI 182,780 has the opposite effect *Mann-Whitney test. (27). Analysis of the IGFBP4 promoter region has identified two Sp1 binding sites used by ERa in this regulation (11). In

Clin Cancer Res 2007;13(5) March 1,2007 1442 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2007 American Association for Cancer Research. IGFBPs and Endocrine Response in Ovarian Cancer

Fig. 4. Comparison of IGFBP3-IGFBP4 and IGFBP4-IGFBP5 immunoscores in ovarian cancer sections from patients demonstrating a CA125 progression versus patients demonstrating a CA125 response or stabilization. Lines, patient values. In CA125 nonprogressors, the immunoscore of IGFBP3 was lower than IGFBP4 in 12 of 15 CA125 nonprogressors and higher in 22 of 24 tumors from CA125 progressors (P < 0.0001;Fisher’s exact test). Similarly, the immunoscore of IGFBP5 was lower than IGFBP4 in 8 of 15 nonprogressors and higher in 25 of 26 tumors from CA125 progressors (P = 0.0005; Fisher’s exact test).

MCF-7 cells, IGFBP5 is down-regulated by estrogen and up- cancers, IGFBP3 has been associated with disease stage and regulated by ICI 182,780 (12). Both IGFBP3 and IGFBP5 have residual tumor volume when measured by ELISA or by direct inhibitory effects independent of IGF binding, and quantitative reverse transcription-PCR (28–30). IGFBP5 has functional roles for both IGFBP3 and IGFBP5 have been been shown to be overexpressed in high-grade serous ovarian described in ER-positive MCF-7 breast cancer cells. Recombi- carcinomas, and a role has been proposed in this histology nant IGFBP3 inhibited basal and E2-stimulated MCF-7 prolif- (31). We observed that these two isoforms were strongly eration, whereas an antisense oligonucleotide abolished coexpressed in this series of tumors, but only in tumors that antiestrogen-induced growth inhibition (24). Similarly, a were letrozole responsive. We have also begun to link IGFBP targeted antisense to IGFBP5 can inhibit the growth effects of isoform expression with expression of other molecules critical estrogen and antiestrogens, and this protein has been proposed to ERa signaling, such as the epidermal growth factor receptor to play a role in modulation of proliferation (12). In ovarian and erbB2. And because these receptors are coexpressed with different isoforms, there may be functional interactions between these pathways. The association between IGFBP3 a Table 2. Coexpression of IGFBP family members and with ER expression, but not with IGFBP5 and IGFBP4, and association with ERa, HER2, and HER1 despite their respective relationships with HER2 and EGFR expression, suggests that multiple factors are regulating the P for correlation* IGFBPs in addition to estrogen. Although endocrine therapy is used by some clinicians in the IGFBP1 IGFBP2 IGFBP3IGFBP4 IGFBP5 IGFBP6 treatment of ovarian cancer, it is still not well established ÀIGFBP1 0.0009 0.55 0.35 0.99 0.046 partially because of the relatively low-response rate and also the ÀIGFBP2 0.0009 — 0.39 0.011 0.49 0.026 ÀIGFBP3 0.55 0.39 — 0.11 <0.0001 0.19 lack of useful markers to identify the sensitive subgroup in ÀIGFBP4 0.35 0.011 0.11 — 0.72 0.72 unselected patients. Our initial phase II trial with letrozole (7) ÀIGFBP5 0.99 0.49 <0.0001 0.72 — 0.61 was the first estrogen-targeted trial in ovarian cancer, to our ÀIGFBP6 0.046 0.026 0.19 0.72 0.61 — knowledge, to identify a statistically significant association ÀERa 0.28 0.570.028 0.18 0.95 0.078 a ÀHER2 0.32 0.23 0.021 0.82 0.046 0.50 between ER expression and outcome, although larger trials ÀHER1 0.22 0.061 0.21 0.024 0.45 0.50 with tamoxifen have suggested a link with ER expression (5, 6). Predictive markers, such as these IGFBPs, could therefore help *Pearson correlation. identify patients at the outset who have the greatest likelihood of response.

www.aacrjournals.org 14 4 3 Clin Cancer Res 2007;13(5) March 1, 2007 Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2007 American Association for Cancer Research. Imaging, Diagnosis, Prognosis

References 1. Langdon SP, Hawkes MM, Lawrie SS, et al. Oestro- estradiol in MCF-7 cells: role of estrogen receptor- ligands: structure-affinity/activity relationships and gen receptor expression and the effects of oestrogen Sp1complexes. Endocrinol 1999;140:2501 ^ 8. estrogen receptor-a-selective agonists. J Med Chem and tamoxifen on the growth of human ovarian carci- 12. Parisot JP, Leeding KS, Hu XF, et al. Induction of in- 2000;43:4934 ^ 47. noma cell lines. Br J Cancer 1990;62:213^ 6. sulin-like growth factor binding protein expression by 23. MeyersMJ,SunJ,CarlsonKE,MarrinerGA, 2. Langdon SP, Crew AJ, Ritchie AA, et al. Growth inhi- ICI 182,780 in a tamoxifen-resistant human breast Katzenellenbogen BS, Katzenellenbogen JA. Estrogen bition of oestrogen receptor-positive human ovarian cancer cell line. Breast Cancer Res Treat 1999;55: receptor-h potency-selective ligands: structure-activity carcinoma byanti-oestrogens in vitro and in a xeno- 231 ^ 42. relationship studies of diarylpropionitriles and their graft model. Eur J Cancer 1994;30A:682^ 6. 13. HuynhH,YangXF,PollakM,etal.Aroleforinsulin- acetylene and polar analogues. J Med Chem 2001; 3. Langdon SP, Hirst GL, Miller EP, et al.The regulation like growth factor binding protein 5 in the antiprolifer- 44:4230 ^ 51. of growth and protein expression byestrogen in vitro : ative action of the antiestrogen ICI 182780. Cell 24. Huynh H,Yang X, Pollak M. Estradiol and antiestro- a studyof 8 human ovarian carcinoma cell lines. J Ste- Growth Differ 1996;7:1501 ^ 6. gens regulate a growth inhibitoryinsulin-like growth roid Biochem Mol Biol 1994;50:131^5. 14. Jones JI, Clemmons DR. Insulin-like growth factors factor binding protein 3 autocrine loop in human 4. O’Donnell AJM, MacLeod KG, Burns DJ, et al. and their binding proteins: biological actions. Endocr breast cancer cells. J Biol Chem 1996;271:1016^ 21. Estrogen receptor a mediates gene expression Rev1995;16:3 ^34. 25. Yu H, Levesque MA, Khosravi MJ, Papanastasiou- changes and growth response in ovarian cancer 15. Firth S, Baxter RC. Cellular actions of the insulin-like Diamandi A, Clark GM, Diamandis EP. Insulin-like cells exposed to estrogen. Endocr Relat Cancer growth factor binding proteins. Endocr Rev 2002;23: growth factor-binding-3 and breast cancer survival. 2005;12:851 ^ 66. 824 ^ 54. Int J Cancer 1998;79:624 ^ 8. 5. Hatch KD, Beecham JB, Blessing JA, Creasman WT. 16. PoretskyL, Cataldo NA, Rosenwaks Z, Giudice LC. 26. Sheikh MS, Shao ZM, Hussain A, et al. Retinoic acid Responsiveness of patients with relapsed ovarian The insulin-related ovarian regulatorysystem in health and estrogen modulation of insulin-like growth factor cancer to tamoxifen. Cancer 1991;68:269 ^ 71. and disease. Endocr Rev 1999;20:535 ^82. binding protein 4 expression and the estrogen recep- 6. Ahlgren JD, Ellison NM, Gottlieb RJ, et al. Hormonal 17. El-RoieyA, Chen A, RobertsVJ, LeRoith D, Roberts tor status of human breast carcinoma cells. Biochem palliation of chemoresistant ovarian cancer: three con- CT, Jr.,Yen SS. Expression of insulin-like growth fac- Biophys Res Commun 1993;193:1232^ 8. secutive phase II trials of the Mid-Atlantic Oncology tors (IGF-I and II), the IGF and insulin receptors, and 27. Pratt SE, Pollak MN. Estrogen and antiestrogen Program. J Clin Oncol 1993;10:1957 ^ 68. IGF-binding proteins 1-6 and the localization of their modulation of MCF-7 human breast cancer cell proli- 7. Bowman A, Gabra H, Langdon SP, et al. CA125 gene products in normal and polycystic ovary syn- feration is associated with specific alterations in accu- response is associated with estrogen receptor expres- drome ovaries. J Clin Endocrinol Metab 1994;78: mulation of insulin-like growth factor-binding proteins sion in a phase II trial of letrozole in ovarian cancer: 14 8 8 ^ 9 6. in conditioned media. Cancer Res 1993;53:5193^ 8. Identification of an ‘‘endocrine-sensitive’’ subgroup. 18. Voutilainen R, Franks S, Mason HD, Martikainen H. 28. KatsarosD,YuH,LevensqueMA,etal.IGFBP-3in Clin Cancer Res 2002;8:2233 ^9. Expression of insulin-like growth factor (IGF), IFG- epithelial ovarian carcinoma and its association with 8. Papadimitriou CA, Markaki S, Siapkaras J, et al. Hor- binding protein and IGF receptor messenger ribonu- clinico-pathological features and patient survival. Eur monal therapywith letrozole for relapsed epithelial cleic acids in normal and polycystic ovaries. J Clin J Cancer 2001;37:478 ^ 85. ovarian cancer. Long-term results of a phase II study. Endocrinol Metab 1996;81:1003 ^ 8. 29.WileyA, Katsaros D, Fracchioli S,Yu H. Methylation Oncology2004;66:112^ 7. 19. Giudice LC. Insulin-like growth factor familyin Graa- of the insulin-like growth factor binding protein 3 gene 9. GourleyC, SmythJF, McKean M, et al. Phase IIstudy fian follicle development and function. J Soc Gynecol and prognosis of ovarian cancer. Int J Gynecol Cancer of letrozole in estrogen receptor (ER) positive re- Investig 2001;8:S26 ^ 9. 2006;16:210^8. lapsed epithelial ovarian cancer (EOC). J Clin Oncol 20. Baron-HayS, Boyle F, Ferrier A, Scott C. Elevated 30. Lu L, Katsaros D,WileyA, et al. The relationship of 2006;24:18S;5025. serum insulin-like growth factor binding protein-2 as insumin-like growth factor-II, insulin-like growth factor 10. Vendrell JA, Magnino F, Danis E, et al. Estrogen reg- a prognostic marker in patients with ovarian cancer. binding protein-3, and estrogen receptor-a expression ulation in human breast cancer cells of new down- Clin Cancer Res 2004;10:1796 ^ 806. to disease progression in epithelial ovarian cancer. Clin stream gene targets involved in estrogen metabolism, 21. Langdon SP, Lawrie SS, HayF, et al. The char- Cancer Res 2006;12:1208 ^ 14. cell proliferation and cell transformation. J Mol Endo- acterisation and properties of 9 human ovarian 31. Wang H, Rosen DG, Wang H, Fuller GN, Zhang W, crinol 2004;32:397 ^ 414. adenocarcinoma cell lines. Cancer Res 1988;48: Liu J. Insulin-like growth factor-binding protein 2 and 11. Qin C, Singh P, Safe S. Transcriptional activation of 6166 ^ 72. 5 are differentiallyregulated in ovarian cancer of differ- insulin-like growth factor-binding protein-4 by17 h- 22. Stauffer SR, Coletta CJ,Tedesco R, et al. Pyrazole ent histologic types. Mod Pathol 2006;19:1149 ^ 56.

Clin Cancer Res 2007;13(5) March 1,2007 1444 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2007 American Association for Cancer Research. Insulin-like Growth Factor Binding Proteins IGFBP3, IGFBP4, and IGFBP5 Predict Endocrine Responsiveness in Patients with Ovarian Cancer

Graeme Walker, Kenneth MacLeod, Alistair R.W. Williams, et al.

Clin Cancer Res 2007;13:1438-1444.

Updated version Access the most recent version of this article at: http://clincancerres.aacrjournals.org/content/13/5/1438

Cited articles This article cites 28 articles, 9 of which you can access for free at: http://clincancerres.aacrjournals.org/content/13/5/1438.full#ref-list-1

Citing articles This article has been cited by 9 HighWire-hosted articles. Access the articles at: http://clincancerres.aacrjournals.org/content/13/5/1438.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/13/5/1438. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.