DOCSLIB.ORG

Supplemental Table 2. Expression Profile of Cell Cycle Genes in FOXF1 Sirna-Transfected BT549 Cells Vs

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplemental Table 2. Expression Profile of Cell Cycle Genes in FOXF1 Sirna-Transfected BT549 Cells Vs Supplemental Table 2. Expression profile of cell cycle genes in FOXF1 siRNA-transfected BT549 cells vs. control siRNA-transfected cells siControl siFOXF1 siControl siFOXF1 siControl siFOXF1 Gene symbol Average Ct Average Ct AVG Delta(Ct) (Ct(GOI)AVG - AveDelta(Ct) Ct(HKG)) (Ct(GOI)2^(-Avg.(Delta(Ct)) - Ave Ct(HKG)) 2^(-Avg.(Delta(Ct)) A01 ABL1 20.391 21.0059 0.55892 0.65368 0.67881013 0.635656822 A02 ANAPC2 32.7951 38.8081 12.96302 18.45588 0.00012524 2.78116E-06 A03 ANAPC4 24.797 27.2979 4.96492 6.94568 0.032019176 0.008112262 A04 DIRAS3 Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined A05 ATM 31.4392 32.8151 11.60712 12.46288 0.00032056 0.000177133 A06 ATR 22.1905 22.2736 2.35842 1.92138 0.195004592 0.26400186 A07 BAX 21.7453 21.5838 1.91322 1.23158 0.265499307 0.42585081 A08 BCCIP 22.4774 23.2689 2.64532 2.91668 0.159837741 0.132431663 A09 BCL2 Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined A10 BIRC5 32.4976 31.663 12.66552 11.31078 0.000153921 0.000393655 A11 BRCA1 26.31 30.093 6.47792 9.74078 0.011218939 0.001168781 A12 BRCA2 25.3534 25.4835 5.52132 5.13128 0.021772939 0.028531907 B01 CCNB1 15.6774 15.1967 -4.15468 -5.15552 17.81079489 35.64233627 B02 CCNB2 20.1845 19.4191 0.35242 -0.93312 0.783269127 1.909400841 B03 CCNC 19.3827 19.6594 -0.44938 -0.69282 1.365453325 1.616440047 B04 CCND1 Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined B05 CCND2 29.8269 29.5986 9.99482 9.24638 0.000980075 0.001646502 B06 CCNE1 22.2102 22.1076 2.37812 1.75538 0.192359902 0.296195166 B07 CCNF 27.5356 27.1297 7.70352 6.77748 0.004797438 0.009115389 B08 CCNG1 18.6415 19.3194 -1.19058 -1.03282 2.282444848 2.046019649 B09 CCNG2 27.2948 28.1258 7.46272 7.77358 0.005668882 0.004570032 B10 CCNH 19.088 19.0514 -0.74408 -1.30082 1.674905849 2.463688742 B11 CCNT1 27.314 29.2946 7.48192 8.94238 0.005593938 0.00203271 B12 CCNT2 23.1953 23.2571 3.36322 2.90488 0.097178434 0.133519281 C01 CDC16 18.847 19.2198 -0.98508 -1.13242 1.979423072 2.192261655 C02 CDC2 17.5007 18.1826 -2.33138 -2.16962 5.032865349 4.499048752 C03 CDC20 18.4535 18.4698 -1.37858 -1.88242 2.60012323 3.686929934 C04 CDC34 34.6153 34.0491 14.78322 13.69688 3.54656E-05 7.53058E-05 C05 CDK2 19.058 19.3012 -0.77408 -1.05102 1.710099181 2.071994251 C06 CDK4 21.036 21.5722 1.20392 1.21998 0.434094184 0.429288669 C07 CDK5R1 34.2815 33.7238 14.44942 13.37158 4.46983E-05 9.43525E-05 C08 CDK5RAP1 27.7663 27.208 7.93422 6.85578 0.004088479 0.008633852 C09 CDK6 20.0366 21.7226 0.20452 1.37038 0.867827375 0.386789356 C10 CDK7 19.6398 19.8845 -0.19228 -0.46772 1.142567976 1.382922204 C11 CDK8 28.2742 27.9151 8.44212 7.56288 0.002875204 0.005288668 C12 CDKN1A 20.3262 20.1767 0.49412 -0.17552 0.709994621 1.129371398 D01 CDKN1B 27.624 27.3991 7.79192 7.04688 0.004512304 0.007562715 D02 CDKN2A 17.6365 18.178 -2.19558 -2.17422 4.580737845 4.513416759 D03 CDKN2B 24.5389 25.7537 4.70682 5.40148 0.038291819 0.023658788 D04 CDKN3 18.062 17.8909 -1.77008 -2.46132 3.410728693 5.507203808 D05 CHEK1 19.7164 20.0825 -0.11568 -0.26972 1.083485615 1.205573826 D06 CHEK2 21.0729 21.1993 1.24082 0.84708 0.423132088 0.555908752 D07 CKS1B Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined D08 CKS2 17.7676 18.9019 -2.06448 -1.45032 4.182831842 2.732686576 D09 CUL1 19.9308 19.9251 0.09872 -0.42712 0.933861172 1.344546826 D10 CUL2 19.4667 19.3871 -0.36538 -0.96512 1.288220897 1.952225896 D11 CUL3 35.485 39.9909 15.65292 19.63868 1.94089E-05 1.22509E-06 D12 DDX11 29.9368 29.871 10.10472 9.51878 0.000908189 0.001363207 E01 DNM2 32.4104 32.3534 12.57832 12.00118 0.000163512 0.000243941 E02 E2F4 30.9643 31.2912 11.13222 10.93898 0.000445521 0.000509376 E03 GADD45A Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined E04 GTF2H1 21.4486 21.3144 1.61652 0.96218 0.32612117 0.513280729 E05 GTSE1 22.0112 21.7734 2.17912 1.42118 0.220810396 0.373406773 E06 HERC5 29.2313 29.0098 9.39922 8.65758 0.001480992 0.002476331 E07 HUS1 Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined E08 KNTC1 21.8068 21.7638 1.97472 1.41158 0.254419296 0.375899786 E09 KPNA2 36.6913 33.7573 16.85922 13.40508 8.41142E-06 9.21868E-05 E10 MAD2L1 18.1565 18.2572 -1.67558 -2.09502 3.194477548 4.272320859 E11 MAD2L2 35.0533 34.8664 15.22122 14.51418 2.61792E-05 4.27363E-05 E12 MCM2 23.1059 24.4197 3.27382 4.06748 0.10339082 0.059643966 F01 MCM3 37.3741 33.013 17.54202 12.66078 5.23993E-06 0.000154428 F02 MCM4 18.2862 18.5102 -1.54588 -1.84202 2.919821147 3.585116498 F03 MCM5 21.784 21.9788 1.95192 1.62658 0.258472016 0.323855017 F04 MKI67 19.2416 19.175 -0.59048 -1.17722 1.505747642 2.261405955 F05 MNAT1 19.6929 19.7648 -0.13918 -0.58742 1.101278992 1.50255729 F06 MRE11A 30.9678 32.5749 11.13572 12.22268 0.000444441 0.000209222 F07 NBN Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined F08 PCNA 17.4911 17.7371 -2.34098 -2.61512 5.066466778 6.126741575 F09 RAD1 21.7625 21.9925 1.93042 1.64028 0.262352783 0.320794208 F10 RAD17 21.0312 20.6359 1.19912 0.28368 0.435540867 0.821492894 F11 RAD51 29.9035 30.6412 10.07142 10.28898 0.000929395 0.000799297 F12 RAD9A 26.4463 26.3916 6.61422 6.03938 0.010207547 0.015204266 G01 RB1 39.5 35.0395 19.66792 14.68728 1.20051E-06 3.79043E-05 G02 RBBP8 18.9719 19.1509 -0.86018 -1.20132 1.815264781 2.299499685 G03 RBL1 21.1005 21.3763 1.26842 1.02408 0.415114146 0.491723769 G04 RBL2 Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined G05 RPA3 19.5674 19.4371 -0.26468 -0.91512 1.201369548 1.885725916 G06 SERTAD1 24.4933 24.1882 4.66122 3.83598 0.039521459 0.070025297 G07 SKP2 20.4889 21.0351 0.65682 0.68288 0.634274831 0.622920519 G08 SUMO1 22.3272 22.0501 2.49512 1.69788 0.177375665 0.308238719 G09 TFDP1 24.9559 24.8139 5.12382 4.46168 0.028679824 0.045383762 G10 TFDP2 23.5693 24.8361 3.73722 4.48388 0.074986776 0.044690748 G11 TP53 35.0331 36.1395 15.20102 15.78728 2.65483E-05 1.7683E-05 G12 UBA1 Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined H01 B2M 15.8312 16.2871 -4.00088 -4.06512 16.00976249 16.73875127 H02 HPRT1 27.69 28.22 7.85792 7.86778 0.004310527 0.004281168 H03 RPL13A 16.8619 17.5346 -2.97018 -2.81762 7.836340032 7.049984082 H04 GAPDH 13.4913 14.0455 -6.34078 -6.30672 81.05223145 79.16111346 H05 ACTB 25.286 25.6739 5.45392 5.32168 0.022814265 0.0250043 siControl siFOXF1 Log10 (2^(-Avg.(Delta(Ct)))Log10 (2^(-Avg.(Delta(Ct)))Fold change Gene description -0.168251685 -0.196777288 -1.067887744 C-abl oncogene 1, receptor tyrosine kinase -3.902257854 -5.555773476 -45.03141792 Anaphase promoting complex subunit 2 -1.494589846 -2.09085802 -3.947009523 Anaphase promoting complex subunit 4 Undetermined Undetermined Undetermined DIRAS family, GTP-binding RAS-like 3 -3.494091283 -3.751700712 -1.809711846 Ataxia telangiectasia mutated -0.709955162 -0.578393013 1.353823814 Ataxia telangiectasia and Rad3 related -0.575936608 -0.370742522 1.603962041 BCL2-associated X protein -0.796320668 -0.878008168 -1.206945055 BRCA2 and CDKN1A interacting protein Undetermined Undetermined Undetermined B-cell CLL/lymphoma 2 -3.812701431 -3.404884054 2.557510211 Baculoviral IAP repeat-containing 5 -1.95004823 -2.932266961 -9.598839537 Breast cancer 1, early onset -1.662082936 -1.544669196 1.310429736 Breast cancer 2, early onset 1.250683302 1.551966163 2.001164826 Cyclin B1 -0.106088991 0.28089711 2.437732799 Cyclin B2 0.135276859 0.208559602 1.183812011 Cyclin C Undetermined Undetermined Undetermined Cyclin D1 -3.008740621 -2.783437731 1.679975275 Cyclin D2 -0.715885453 -0.528422034 1.539796824 Cyclin E1 -2.318990592 -2.040224775 1.900053446 Cyclin F 0.358400292 0.3109098 -1.115553729 Cyclin G1 -2.246502569 -2.340080754 -1.240446918 Cyclin G2 0.223990399 0.391585839 1.470941631 Cyclin H -2.252282345 -2.691924613 -2.751960953 Cyclin T1 -1.012430102 -0.874456014 1.373959996 Cyclin T2 0.296538628 0.340892388 1.107525564 Cell division cycle 16 homolog (S. cerevisiae) 0.701815311 0.653120699 -1.118650992 Cell division cycle 2, G1 to S and G2 to M 0.414993931 0.566664884 1.417982768 Cell division cycle 20 homolog (S. cerevisiae) -4.450192652 -4.123171727 2.123346768 Cell division cycle 34 homolog (S. cerevisiae) 0.233021299 0.316388546 1.211622269 Cyclin-dependent kinase 2 -0.362416032 -0.367250574 -1.011194134 Cyclin-dependent kinase 4 -4.34970884 -4.025246669 2.110873319 Cyclin-dependent kinase 5, regulatory subunit 1 (p35) -2.388438212 -2.063795424 2.111751389 CDK5 regulatory subunit associated protein 1 -0.061566655 -0.412525485 -2.243669223 Cyclin-dependent kinase 6 0.057882048 0.14079775 1.210363175 Cyclin-dependent kinase 7 -2.541331347 -2.276653734 1.839406062 Cyclin-dependent kinase 8 -0.148744941 0.052836785 1.590675992 Cyclin-dependent kinase inhibitor 1A (p21, Cip1) -2.345601644 -2.121322256 1.676020738 Cyclin-dependent kinase inhibitor 1B (p27, Kip1) 0.660935438 0.654505437 -1.01491577 Cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) -1.416894004 -1.626007501 -1.618502955 Cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) 0.532847175 0.740931149 1.614670736 Cyclin-dependent kinase inhibitor 3 0.03482315 0.08119381 1.11268097 CHK1 checkpoint homolog (S.
Load more

Recommended publications
  • Core Transcriptional Regulatory Circuitries in Cancer
    Oncogene (2020) 39:6633–6646 https://doi.org/10.1038/s41388-020-01459-w REVIEW ARTICLE Core transcriptional regulatory circuitries in cancer 1 1,2,3 1 2 1,4,5 Ye Chen ● Liang Xu ● Ruby Yu-Tong Lin ● Markus Müschen ● H. Phillip Koeffler Received: 14 June 2020 / Revised: 30 August 2020 / Accepted: 4 September 2020 / Published online: 17 September 2020 © The Author(s) 2020. This article is published with open access Abstract Transcription factors (TFs) coordinate the on-and-off states of gene expression typically in a combinatorial fashion. Studies from embryonic stem cells and other cell types have revealed that a clique of self-regulated core TFs control cell identity and cell state. These core TFs form interconnected feed-forward transcriptional loops to establish and reinforce the cell-type- specific gene-expression program; the ensemble of core TFs and their regulatory loops constitutes core transcriptional regulatory circuitry (CRC). Here, we summarize recent progress in computational reconstitution and biologic exploration of CRCs across various human malignancies, and consolidate the strategy and methodology for CRC discovery. We also discuss the genetic basis and therapeutic vulnerability of CRC, and highlight new frontiers and future efforts for the study of CRC in cancer. Knowledge of CRC in cancer is fundamental to understanding cancer-specific transcriptional addiction, and should provide important insight to both pathobiology and therapeutics. 1234567890();,: 1234567890();,: Introduction genes. Till now, one critical goal in biology remains to understand the composition and hierarchy of transcriptional Transcriptional regulation is one of the fundamental mole- regulatory network in each specified cell type/lineage.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Nerve Growth Factor Induces Transcription of the P21 WAF1/CIP1 and Cyclin D1 Genes in PC12 Cells by Activating the Sp1 Transcription Factor
    The Journal of Neuroscience, August 15, 1997, 17(16):6122–6132 Nerve Growth Factor Induces Transcription of the p21 WAF1/CIP1 and Cyclin D1 Genes in PC12 Cells by Activating the Sp1 Transcription Factor Guo-Zai Yan and Edward B. Ziff Howard Hughes Medical Institute, Department of Biochemistry, Kaplan Cancer Center, New York University Medical Center, New York, New York 10016 The PC12 pheochromocytoma cell line responds to nerve in which the Gal4 DNA binding domain is fused to the Sp1 growth factor (NGF) by gradually exiting from the cell cycle and transactivation domain, indicating that this transactivation do- differentiating to a sympathetic neuronal phenotype. We have main is regulated by NGF. Epidermal growth factor, which is a shown previously (Yan and Ziff, 1995) that NGF induces the weak mitogen for PC12, failed to induce any of these promoter expression of the p21 WAF1/CIP1/Sdi1 (p21) cyclin-dependent constructs. We consider a model in which the PC12 cell cycle kinase (Cdk) inhibitor protein and the G1 phase cyclin, cyclin is arrested as p21 accumulates and attains inhibitory levels D1. In this report, we show that induction is at the level of relative to Cdk/cyclin complexes. Sustained activation of p21 transcription and that the DNA elements in both promoters that expression is proposed to be a distinguishing feature of the are required for NGF-specific induction are clusters of binding activity of NGF that contributes to PC12 growth arrest during sites for the Sp1 transcription factor. NGF also induced a differentiation synthetic
    [Show full text]
  • Role of Cyclin-Dependent Kinase 1 in Translational Regulation in the M-Phase
    cells Review Role of Cyclin-Dependent Kinase 1 in Translational Regulation in the M-Phase Jaroslav Kalous *, Denisa Jansová and Andrej Šušor Institute of Animal Physiology and Genetics, Academy of Sciences of the Czech Republic, Rumburska 89, 27721 Libechov, Czech Republic; [email protected] (D.J.); [email protected] (A.Š.) * Correspondence: [email protected] Received: 28 April 2020; Accepted: 24 June 2020; Published: 27 June 2020 Abstract: Cyclin dependent kinase 1 (CDK1) has been primarily identified as a key cell cycle regulator in both mitosis and meiosis. Recently, an extramitotic function of CDK1 emerged when evidence was found that CDK1 is involved in many cellular events that are essential for cell proliferation and survival. In this review we summarize the involvement of CDK1 in the initiation and elongation steps of protein synthesis in the cell. During its activation, CDK1 influences the initiation of protein synthesis, promotes the activity of specific translational initiation factors and affects the functioning of a subset of elongation factors. Our review provides insights into gene expression regulation during the transcriptionally silent M-phase and describes quantitative and qualitative translational changes based on the extramitotic role of the cell cycle master regulator CDK1 to optimize temporal synthesis of proteins to sustain the division-related processes: mitosis and cytokinesis. Keywords: CDK1; 4E-BP1; mTOR; mRNA; translation; M-phase 1. Introduction 1.1. Cyclin Dependent Kinase 1 (CDK1) Is a Subunit of the M Phase-Promoting Factor (MPF) CDK1, a serine/threonine kinase, is a catalytic subunit of the M phase-promoting factor (MPF) complex which is essential for cell cycle control during the G1-S and G2-M phase transitions of eukaryotic cells.
    [Show full text]
  • Supplemental Methods Proband and Control Lung Samples Lung Sections from Both the Proband and Age-Matched Controls Were Obtained
    Supplementary material J Med Genet Supplemental Methods Proband and Control Lung Samples Lung sections from both the proband and age-matched controls were obtained in the form of fixed formalin paraffin embedded (FFPE) samples. Control lung samples were obtained from the BRINDL biorepository at the University of Rochester(1). RNA expression analyses RNA was obtained for mRNA expression studies using the RNeasy FFPE kit (Qiagen) according to manufacturer’s instructions. cDNA was then generated using iScrpit kit (biorad), and quantitative PCR was done as previously published (2). Primers for qPCR are listed in supplemental table 1. Chromatin Immunoprecipitation of FFPE for Fixed Formalin Paraffin Embedded samples Chromatin immunoprecipitation was done on FFPE sections using a protocol modified from Fanelli and colleagues, Nature Methods, 2011(3) Samples were deparaffinized by incubating 10uM sections in 1ml of Xylene for 10 minutes at room temperature. The tissue was then pelleted at 17,000 x gravity for 3 min at room temperature. This process was repeated 3 times. Samples were then rehydrated by incubating with 1 ml of 100% Ethanol for 10 minutes at RT. Cells were pelleted and resuspended in progressively increasing percentage of water as follows: 95% ethanol, 70% ethanol, 50% ethanol, 20% ethanol. The sample was then resuspended in 1x PBS and the tissue dissociated by sonicating with a Bioruptor (Diagnode, NJ USA) for 30 seconds on the medium setting. Cells then resuspended in Collagenase digestion buffer and treated with collagenase A (Roche 11 088 785 103) to a final concentration of 2mg/ml and digested at 37 C for 45 minutes.
    [Show full text]
  • Daneshshahab.Pdf (3.352Mb)
    BMP SIGNALING THROUGH BMPR1A IS REQUIRED FOR ESTABLISHMENT OF PANCREATIC LATERALITY APPROVED BY SUPERVISORY COMMITTEE Ondine Cleaver, Ph.D. Melanie H. Cobb, Ph.D. Raymond J. MacDonald, Ph.D. Eric N. Olson, Ph.D. THIS DISSERTATION IS DEDICATED TO MY FAMILY, PAST, PRESENT AND FUTURE BMP SIGNALING THROUGH BMPR1A IS REQUIRED FOR ESTABLISHMENT OF PANCREATIC LATERALITY by SHAHAB SHAUN MALEKPOUR DANESH DISSERTATION Presented to the Faculty of the Graduate School of Biomedical Sciences The University of Texas Southwestern Medical Center at Dallas In Partial Fulfillment of the Requirements For the Degree of DOCTOR OF PHILOSOPHY The University of Texas Southwestern Medical Center at Dallas Dallas, Texas May, 2009 Copyright by SHAHAB SHAUN MALEKPOUR DANESH, 2009 All Rights Reserved ACKNOWLEDGEMENTS I would like to thank my thesis advisor, Dr. Ondine Cleaver for her guidance and support. Ondine accepted me into her lab as a fifth year graduate student who had already been in three labs and had no background in developmental biology or mouse work. Her undying guidance, motivation and enthusiasm for science have allowed me to grow as a scientist and complete my thesis in two short years. I would like to thank my committee members Dr. Melanie Cobb, Dr. Eric Olson, and especially my thesis chair, Dr. Raymond MacDonald. They have provided invaluable suggestions and guidance that have facilitated my project that has allowed me to complete a substantial amount of work in a short time. I would like to thank the members of the Cleaver lab for providing a collaborative environment for science. Aly Villasenor was a great resource for exchange of valuable scientific ideas.
    [Show full text]
  • Correction1 4784..4785
    Correction Correction: PCI-24781 Induces Caspase and Reactive Oxygen Species-Dependent Apoptosis In the article on PCI-24781 induces caspase and reactive oxygen species-dependent apoptosis published in the May 15, 2009 issue of Clinical Cancer Research, there was an error in Table 1. Down-regulated genes were incorrectly labeled as up-regulated genes. The correct table appears here. Bhalla S, Balasubramanian S, David K, et al. PCI-24781 induces caspase and reactive oxygen species-dependent apoptosis through NF-nB mechanisms and is synergistic with bortezomib in lymphoma cells. Clin Cancer Res 2009;15:3354–65. Table 1. Selected genes from expression analysis following 24-h treatment with PCI-24781, bortezomib, or the combination (in Ramos cells) Accn # Down-regulated genes 0.25 Mmol/L PCI/3 nmol/L Bor Name PCI-24781 Bortezomib Combination* Cell cycle-related NM_000075 Cyclin-dependent kinase 4 (CDK4) 0.49 0.83 0.37 NM_001237 Cyclin A2 (CCNA2) 0.43 0.87 0.37 NM_001950 E2F transcription factor 4, p107/p130-binding (E2F4) 0.48 0.79 0.40 NM_001951 E2F transcription factor 5, p130-binding (E2F5) 0.46 0.98 0.43 NM_003903 CDC16 cell division cycle 16 homolog (S cerevisiae) (CDC16) 0.61 0.78 0.43 NM_031966 Cyclin B1 (CCNB1) 0.55 0.90 0.43 NM_001760 Cyclin D3 (CCND3) 0.48 1.02 0.46 NM_001255 CDC20 cell division cycle 20 homolog (S cerevisiae; CDC20) 0.61 0.82 0.46 NM_001262 Cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4; CDKN2C) 0.61 1.15 0.56 NM_001238 Cyclin E1 (CCNE1) 0.56 1.05 0.60 NM_001239 Cyclin H (CCNH) 0.74 0.90 0.64 NM_004701
    [Show full text]
  • The Localization of Human Cyclins B1 and B2 Determines CDK1
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by PubMed Central The Localization of Human Cyclins B1 and B2 Determines CDK1 Substrate Specificity and Neither Enzyme Requires MEK to Disassemble the Golgi Apparatus Viji Mythily Draviam,* Simona Orrechia,‡ Martin Lowe,§ Ruggero Pardi,‡ and Jonathon Pines* *Wellcome/Cancer Research Campaign Institute and Department of Zoology, Cambridge CB2 1QR, United Kingdom; ‡Vita Salute University School of Medicine, Scientific Institute San Raffaele, Milan I-20132, Italy; and §Division of Biochemistry, School of Biological Sciences, University of Manchester, Manchester M13 9PT, United Kingdom Abstract. In this paper, we show that substrate specificity confer upon it the more limited properties of cyclin B2. is primarily conferred on human mitotic cyclin-dependent Equally, directing cyclin B2 to the cytoplasm with the kinases (CDKs) by their subcellular localization. The NH2 terminus of cyclin B1 confers the broader properties difference in localization of the B-type cyclin–CDKs of cyclin B1. Furthermore, we show that the disassembly underlies the ability of cyclin B1–CDK1 to cause chromo- of the Golgi apparatus initiated by either mitotic cyclin– some condensation, reorganization of the microtubules, CDK complex does not require mitogen-activated and disassembly of the nuclear lamina and of the Golgi protein kinase kinase (MEK) activity. apparatus, while it restricts cyclin B2–CDK1 to disassem- bly of the Golgi apparatus. We identify the region of Key words: cyclin • CDK • mitosis • protein kinase • cyclin B2 responsible for its localization and show that Golgi apparatus this will direct cyclin B1 to the Golgi apparatus and Introduction Cyclins play a vital role in controlling progress through the or mitosis (M phase) depending on the amount of kinase eukaryotic cell cycle.
    [Show full text]
  • Gene Regulation Is Governed by a Core Network in Hepatocellular Carcinoma Zuguang Gu, Chenyu Zhang* and Jin Wang*
    Gu et al. BMC Systems Biology 2012, 6:32 http://www.biomedcentral.com/1752-0509/6/32 RESEARCH ARTICLE Open Access Gene regulation is governed by a core network in hepatocellular carcinoma Zuguang Gu, Chenyu Zhang* and Jin Wang* Abstract Background: Hepatocellular carcinoma (HCC) is one of the most lethal cancers worldwide, and the mechanisms that lead to the disease are still relatively unclear. However, with the development of high-throughput technologies it is possible to gain a systematic view of biological systems to enhance the understanding of the roles of genes associated with HCC. Thus, analysis of the mechanism of molecule interactions in the context of gene regulatory networks can reveal specific sub-networks that lead to the development of HCC. Results: In this study, we aimed to identify the most important gene regulations that are dysfunctional in HCC generation. Our method for constructing gene regulatory network is based on predicted target interactions, experimentally-supported interactions, and co-expression model. Regulators in the network included both transcription factors and microRNAs to provide a complete view of gene regulation. Analysis of gene regulatory network revealed that gene regulation in HCC is highly modular, in which different sets of regulators take charge of specific biological processes. We found that microRNAs mainly control biological functions related to mitochondria and oxidative reduction, while transcription factors control immune responses, extracellular activity and the cell cycle. On the higher level of gene regulation, there exists a core network that organizes regulations between different modules and maintains the robustness of the whole network. There is direct experimental evidence for most of the regulators in the core gene regulatory network relating to HCC.
    [Show full text]
  • Prenatal Testing Requisition Form
    BAYLOR MIRACA GENETICS LABORATORIES SHIP TO: Baylor Miraca Genetics Laboratories 2450 Holcombe, Grand Blvd. -Receiving Dock PHONE: 800-411-GENE | FAX: 713-798-2787 | www.bmgl.com Houston, TX 77021-2024 Phone: 713-798-6555 PRENATAL COMPREHENSIVE REQUISITION FORM PATIENT INFORMATION NAME (LAST,FIRST, MI): DATE OF BIRTH (MM/DD/YY): HOSPITAL#: ACCESSION#: REPORTING INFORMATION ADDITIONAL PROFESSIONAL REPORT RECIPIENTS PHYSICIAN: NAME: INSTITUTION: PHONE: FAX: PHONE: FAX: NAME: EMAIL (INTERNATIONAL CLIENT REQUIREMENT): PHONE: FAX: SAMPLE INFORMATION CLINICAL INDICATION FETAL SPECIMEN TYPE Pregnancy at risk for specific genetic disorder DATE OF COLLECTION: (Complete FAMILIAL MUTATION information below) Amniotic Fluid: cc AMA PERFORMING PHYSICIAN: CVS: mg TA TC Abnormal Maternal Screen: Fetal Blood: cc GESTATIONAL AGE (GA) Calculation for AF-AFP* NTD TRI 21 TRI 18 Other: SELECT ONLY ONE: Abnormal NIPT (attach report): POC/Fetal Tissue, Type: TRI 21 TRI 13 TRI 18 Other: Cultured Amniocytes U/S DATE (MM/DD/YY): Abnormal U/S (SPECIFY): Cultured CVS GA ON U/S DATE: WKS DAYS PARENTAL BLOODS - REQUIRED FOR CMA -OR- Maternal Blood Date of Collection: Multiple Pregnancy Losses LMP DATE (MM/DD/YY): Parental Concern Paternal Blood Date of Collection: Other Indication (DETAIL AND ATTACH REPORT): *Important: U/S dating will be used if no selection is made. Name: Note: Results will differ depending on method checked. Last Name First Name U/S dating increases overall screening performance. Date of Birth: KNOWN FAMILIAL MUTATION/DISORDER SPECIFIC PRENATAL TESTING Notice: Prior to ordering testing for any of the disorders listed, you must call the lab and discuss the clinical history and sample requirements with a genetic counselor.
    [Show full text]
  • Cyclin a Triggers Mitosis Either Via Greatwall Or Cyclin B
    bioRxiv preprint doi: https://doi.org/10.1101/501684; this version posted December 20, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Cyclin A triggers Mitosis either via Greatwall or Cyclin B Nadia Hégarat(1)*, Adrijana Crncec(1)*, Maria F. Suarez Peredoa Rodri- guez(1), Fabio Echegaray Iturra(1), Yan Gu(1), Paul F. Lang(2), Alexis R. Barr(3), Chris Bakal(4), Masato T. Kanemaki(5), Angus I. Lamond(6), Bela Novak(2), Tony Ly(7)•• and Helfrid Hochegger(1)•• (1) Genome Damage and Stability Centre, School of Life Sciences, University of Sussex, Brighton BN19RQ, UK (2) Department of Biochemistry, University of Oxford, South Park Road, Oxford OX13QU, UK (3) MRC London Institute of Medical Science, Imperial College, London W12 0NN, UK (4) The Institute of Cancer Research, London SW3 6JB, UK (5) National Institute of Genetics, Research Organization of Information and Sys- tems (ROIS), and Department of Genetics, SOKENDAI (The Graduate University of Advanced Studies), Yata 1111, Mishima, Shizuoka 411-8540, Japan. (6) Centre for Gene Regulation and Expression, School of Life Sciences, University of Dundee, Dundee DD1 5EH, UK (7) Wellcome Trust Centre for Cell Biology, University of Edinburgh, Edinburgh EH9 3BF, UK * Equal contribution ** Correspondence: Tony Ly: [email protected]; Helfrid Hochegger: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/501684; this version posted December 20, 2018.
    [Show full text]
  • Cdk5rap1 (NM 025876) Mouse Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR209175 Cdk5rap1 (NM_025876) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Cdk5rap1 (NM_025876) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Cdk5rap1 Synonyms: 2310066P17Rik Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Cdk5rap1 (NM_025876) Mouse Tagged ORF Clone – MR209175 ORF Nucleotide >MR209175 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCATCCTTTACGGTGTGTCCTCCAAGTACAGAGGTTGTCAGCACCATTCACCTCCATGTGCTGGGTGT TGCTTAGGACCTGCAGAGCACAAAGCAGTGTGTCCAGCACTCCTTGTCCCAGTCCAGAGGCGAAGAGCTC AGAAGCTCAGAAGGACTTCAGCTCCAGGCTAGCCACTGGACCGACTTTTCAGCATTTTTTAAGAAGTGCT TCAGTTCCTCAAGAGAAACCATCTTCTCCAGAGGTGGAGGACCCACCTCCCTATCTCTCGGGGGATGAAC TTCTAGGAAGGCAGAGAAAAGTCTACCTCGAGACCTATGGCTGTCAGATGAACGTGAACGACACAGAGAT AGCCTGGTCCATCTTACAGAAGAGTGGCTACCTTCGGACCAGCAACCTCCAAGAGGCTGATGTGATCCTT CTTGTCACGTGTTCTATCAGGGAGAAGGCCGAGCAGACCATCTGGAACCGCTTACATCAGCTCAAAGTCC TGAAGACAAAGCGGCCACGCTCTCGAGTACCTCTGAGGATTGGGATTCTAGGCTGCATGGCTGAGAGGCT GAAGGGAGAGATCCTCAACAGGGAGAAGATGGTAGATCTCTTGGCTGGTCCAGACGCCTACCGAGACCTT
    [Show full text]