Supplemental Table 2. Expression Profile of Cell Cycle Genes in FOXF1 Sirna-Transfected BT549 Cells Vs
Total Page：16
File Type：pdf, Size：1020Kb
Load more
Recommended publications
-
Core Transcriptional Regulatory Circuitries in Cancer
Oncogene (2020) 39:6633–6646 https://doi.org/10.1038/s41388-020-01459-w REVIEW ARTICLE Core transcriptional regulatory circuitries in cancer 1 1,2,3 1 2 1,4,5 Ye Chen ● Liang Xu ● Ruby Yu-Tong Lin ● Markus Müschen ● H. Phillip Koeffler Received: 14 June 2020 / Revised: 30 August 2020 / Accepted: 4 September 2020 / Published online: 17 September 2020 © The Author(s) 2020. This article is published with open access Abstract Transcription factors (TFs) coordinate the on-and-off states of gene expression typically in a combinatorial fashion. Studies from embryonic stem cells and other cell types have revealed that a clique of self-regulated core TFs control cell identity and cell state. These core TFs form interconnected feed-forward transcriptional loops to establish and reinforce the cell-type- specific gene-expression program; the ensemble of core TFs and their regulatory loops constitutes core transcriptional regulatory circuitry (CRC). Here, we summarize recent progress in computational reconstitution and biologic exploration of CRCs across various human malignancies, and consolidate the strategy and methodology for CRC discovery. We also discuss the genetic basis and therapeutic vulnerability of CRC, and highlight new frontiers and future efforts for the study of CRC in cancer. Knowledge of CRC in cancer is fundamental to understanding cancer-specific transcriptional addiction, and should provide important insight to both pathobiology and therapeutics. 1234567890();,: 1234567890();,: Introduction genes. Till now, one critical goal in biology remains to understand the composition and hierarchy of transcriptional Transcriptional regulation is one of the fundamental mole- regulatory network in each specified cell type/lineage. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Nerve Growth Factor Induces Transcription of the P21 WAF1/CIP1 and Cyclin D1 Genes in PC12 Cells by Activating the Sp1 Transcription Factor
The Journal of Neuroscience, August 15, 1997, 17(16):6122–6132 Nerve Growth Factor Induces Transcription of the p21 WAF1/CIP1 and Cyclin D1 Genes in PC12 Cells by Activating the Sp1 Transcription Factor Guo-Zai Yan and Edward B. Ziff Howard Hughes Medical Institute, Department of Biochemistry, Kaplan Cancer Center, New York University Medical Center, New York, New York 10016 The PC12 pheochromocytoma cell line responds to nerve in which the Gal4 DNA binding domain is fused to the Sp1 growth factor (NGF) by gradually exiting from the cell cycle and transactivation domain, indicating that this transactivation do- differentiating to a sympathetic neuronal phenotype. We have main is regulated by NGF. Epidermal growth factor, which is a shown previously (Yan and Ziff, 1995) that NGF induces the weak mitogen for PC12, failed to induce any of these promoter expression of the p21 WAF1/CIP1/Sdi1 (p21) cyclin-dependent constructs. We consider a model in which the PC12 cell cycle kinase (Cdk) inhibitor protein and the G1 phase cyclin, cyclin is arrested as p21 accumulates and attains inhibitory levels D1. In this report, we show that induction is at the level of relative to Cdk/cyclin complexes. Sustained activation of p21 transcription and that the DNA elements in both promoters that expression is proposed to be a distinguishing feature of the are required for NGF-specific induction are clusters of binding activity of NGF that contributes to PC12 growth arrest during sites for the Sp1 transcription factor. NGF also induced a differentiation synthetic -
Role of Cyclin-Dependent Kinase 1 in Translational Regulation in the M-Phase
cells Review Role of Cyclin-Dependent Kinase 1 in Translational Regulation in the M-Phase Jaroslav Kalous *, Denisa Jansová and Andrej Šušor Institute of Animal Physiology and Genetics, Academy of Sciences of the Czech Republic, Rumburska 89, 27721 Libechov, Czech Republic; [email protected] (D.J.); [email protected] (A.Š.) * Correspondence: [email protected] Received: 28 April 2020; Accepted: 24 June 2020; Published: 27 June 2020 Abstract: Cyclin dependent kinase 1 (CDK1) has been primarily identified as a key cell cycle regulator in both mitosis and meiosis. Recently, an extramitotic function of CDK1 emerged when evidence was found that CDK1 is involved in many cellular events that are essential for cell proliferation and survival. In this review we summarize the involvement of CDK1 in the initiation and elongation steps of protein synthesis in the cell. During its activation, CDK1 influences the initiation of protein synthesis, promotes the activity of specific translational initiation factors and affects the functioning of a subset of elongation factors. Our review provides insights into gene expression regulation during the transcriptionally silent M-phase and describes quantitative and qualitative translational changes based on the extramitotic role of the cell cycle master regulator CDK1 to optimize temporal synthesis of proteins to sustain the division-related processes: mitosis and cytokinesis. Keywords: CDK1; 4E-BP1; mTOR; mRNA; translation; M-phase 1. Introduction 1.1. Cyclin Dependent Kinase 1 (CDK1) Is a Subunit of the M Phase-Promoting Factor (MPF) CDK1, a serine/threonine kinase, is a catalytic subunit of the M phase-promoting factor (MPF) complex which is essential for cell cycle control during the G1-S and G2-M phase transitions of eukaryotic cells. -
Supplemental Methods Proband and Control Lung Samples Lung Sections from Both the Proband and Age-Matched Controls Were Obtained
Supplementary material J Med Genet Supplemental Methods Proband and Control Lung Samples Lung sections from both the proband and age-matched controls were obtained in the form of fixed formalin paraffin embedded (FFPE) samples. Control lung samples were obtained from the BRINDL biorepository at the University of Rochester(1). RNA expression analyses RNA was obtained for mRNA expression studies using the RNeasy FFPE kit (Qiagen) according to manufacturer’s instructions. cDNA was then generated using iScrpit kit (biorad), and quantitative PCR was done as previously published (2). Primers for qPCR are listed in supplemental table 1. Chromatin Immunoprecipitation of FFPE for Fixed Formalin Paraffin Embedded samples Chromatin immunoprecipitation was done on FFPE sections using a protocol modified from Fanelli and colleagues, Nature Methods, 2011(3) Samples were deparaffinized by incubating 10uM sections in 1ml of Xylene for 10 minutes at room temperature. The tissue was then pelleted at 17,000 x gravity for 3 min at room temperature. This process was repeated 3 times. Samples were then rehydrated by incubating with 1 ml of 100% Ethanol for 10 minutes at RT. Cells were pelleted and resuspended in progressively increasing percentage of water as follows: 95% ethanol, 70% ethanol, 50% ethanol, 20% ethanol. The sample was then resuspended in 1x PBS and the tissue dissociated by sonicating with a Bioruptor (Diagnode, NJ USA) for 30 seconds on the medium setting. Cells then resuspended in Collagenase digestion buffer and treated with collagenase A (Roche 11 088 785 103) to a final concentration of 2mg/ml and digested at 37 C for 45 minutes. -
Daneshshahab.Pdf (3.352Mb)
BMP SIGNALING THROUGH BMPR1A IS REQUIRED FOR ESTABLISHMENT OF PANCREATIC LATERALITY APPROVED BY SUPERVISORY COMMITTEE Ondine Cleaver, Ph.D. Melanie H. Cobb, Ph.D. Raymond J. MacDonald, Ph.D. Eric N. Olson, Ph.D. THIS DISSERTATION IS DEDICATED TO MY FAMILY, PAST, PRESENT AND FUTURE BMP SIGNALING THROUGH BMPR1A IS REQUIRED FOR ESTABLISHMENT OF PANCREATIC LATERALITY by SHAHAB SHAUN MALEKPOUR DANESH DISSERTATION Presented to the Faculty of the Graduate School of Biomedical Sciences The University of Texas Southwestern Medical Center at Dallas In Partial Fulfillment of the Requirements For the Degree of DOCTOR OF PHILOSOPHY The University of Texas Southwestern Medical Center at Dallas Dallas, Texas May, 2009 Copyright by SHAHAB SHAUN MALEKPOUR DANESH, 2009 All Rights Reserved ACKNOWLEDGEMENTS I would like to thank my thesis advisor, Dr. Ondine Cleaver for her guidance and support. Ondine accepted me into her lab as a fifth year graduate student who had already been in three labs and had no background in developmental biology or mouse work. Her undying guidance, motivation and enthusiasm for science have allowed me to grow as a scientist and complete my thesis in two short years. I would like to thank my committee members Dr. Melanie Cobb, Dr. Eric Olson, and especially my thesis chair, Dr. Raymond MacDonald. They have provided invaluable suggestions and guidance that have facilitated my project that has allowed me to complete a substantial amount of work in a short time. I would like to thank the members of the Cleaver lab for providing a collaborative environment for science. Aly Villasenor was a great resource for exchange of valuable scientific ideas. -
Correction1 4784..4785
Correction Correction: PCI-24781 Induces Caspase and Reactive Oxygen Species-Dependent Apoptosis In the article on PCI-24781 induces caspase and reactive oxygen species-dependent apoptosis published in the May 15, 2009 issue of Clinical Cancer Research, there was an error in Table 1. Down-regulated genes were incorrectly labeled as up-regulated genes. The correct table appears here. Bhalla S, Balasubramanian S, David K, et al. PCI-24781 induces caspase and reactive oxygen species-dependent apoptosis through NF-nB mechanisms and is synergistic with bortezomib in lymphoma cells. Clin Cancer Res 2009;15:3354–65. Table 1. Selected genes from expression analysis following 24-h treatment with PCI-24781, bortezomib, or the combination (in Ramos cells) Accn # Down-regulated genes 0.25 Mmol/L PCI/3 nmol/L Bor Name PCI-24781 Bortezomib Combination* Cell cycle-related NM_000075 Cyclin-dependent kinase 4 (CDK4) 0.49 0.83 0.37 NM_001237 Cyclin A2 (CCNA2) 0.43 0.87 0.37 NM_001950 E2F transcription factor 4, p107/p130-binding (E2F4) 0.48 0.79 0.40 NM_001951 E2F transcription factor 5, p130-binding (E2F5) 0.46 0.98 0.43 NM_003903 CDC16 cell division cycle 16 homolog (S cerevisiae) (CDC16) 0.61 0.78 0.43 NM_031966 Cyclin B1 (CCNB1) 0.55 0.90 0.43 NM_001760 Cyclin D3 (CCND3) 0.48 1.02 0.46 NM_001255 CDC20 cell division cycle 20 homolog (S cerevisiae; CDC20) 0.61 0.82 0.46 NM_001262 Cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4; CDKN2C) 0.61 1.15 0.56 NM_001238 Cyclin E1 (CCNE1) 0.56 1.05 0.60 NM_001239 Cyclin H (CCNH) 0.74 0.90 0.64 NM_004701 -
The Localization of Human Cyclins B1 and B2 Determines CDK1
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by PubMed Central The Localization of Human Cyclins B1 and B2 Determines CDK1 Substrate Specificity and Neither Enzyme Requires MEK to Disassemble the Golgi Apparatus Viji Mythily Draviam,* Simona Orrechia,‡ Martin Lowe,§ Ruggero Pardi,‡ and Jonathon Pines* *Wellcome/Cancer Research Campaign Institute and Department of Zoology, Cambridge CB2 1QR, United Kingdom; ‡Vita Salute University School of Medicine, Scientific Institute San Raffaele, Milan I-20132, Italy; and §Division of Biochemistry, School of Biological Sciences, University of Manchester, Manchester M13 9PT, United Kingdom Abstract. In this paper, we show that substrate specificity confer upon it the more limited properties of cyclin B2. is primarily conferred on human mitotic cyclin-dependent Equally, directing cyclin B2 to the cytoplasm with the kinases (CDKs) by their subcellular localization. The NH2 terminus of cyclin B1 confers the broader properties difference in localization of the B-type cyclin–CDKs of cyclin B1. Furthermore, we show that the disassembly underlies the ability of cyclin B1–CDK1 to cause chromo- of the Golgi apparatus initiated by either mitotic cyclin– some condensation, reorganization of the microtubules, CDK complex does not require mitogen-activated and disassembly of the nuclear lamina and of the Golgi protein kinase kinase (MEK) activity. apparatus, while it restricts cyclin B2–CDK1 to disassem- bly of the Golgi apparatus. We identify the region of Key words: cyclin • CDK • mitosis • protein kinase • cyclin B2 responsible for its localization and show that Golgi apparatus this will direct cyclin B1 to the Golgi apparatus and Introduction Cyclins play a vital role in controlling progress through the or mitosis (M phase) depending on the amount of kinase eukaryotic cell cycle. -
Gene Regulation Is Governed by a Core Network in Hepatocellular Carcinoma Zuguang Gu, Chenyu Zhang* and Jin Wang*
Gu et al. BMC Systems Biology 2012, 6:32 http://www.biomedcentral.com/1752-0509/6/32 RESEARCH ARTICLE Open Access Gene regulation is governed by a core network in hepatocellular carcinoma Zuguang Gu, Chenyu Zhang* and Jin Wang* Abstract Background: Hepatocellular carcinoma (HCC) is one of the most lethal cancers worldwide, and the mechanisms that lead to the disease are still relatively unclear. However, with the development of high-throughput technologies it is possible to gain a systematic view of biological systems to enhance the understanding of the roles of genes associated with HCC. Thus, analysis of the mechanism of molecule interactions in the context of gene regulatory networks can reveal specific sub-networks that lead to the development of HCC. Results: In this study, we aimed to identify the most important gene regulations that are dysfunctional in HCC generation. Our method for constructing gene regulatory network is based on predicted target interactions, experimentally-supported interactions, and co-expression model. Regulators in the network included both transcription factors and microRNAs to provide a complete view of gene regulation. Analysis of gene regulatory network revealed that gene regulation in HCC is highly modular, in which different sets of regulators take charge of specific biological processes. We found that microRNAs mainly control biological functions related to mitochondria and oxidative reduction, while transcription factors control immune responses, extracellular activity and the cell cycle. On the higher level of gene regulation, there exists a core network that organizes regulations between different modules and maintains the robustness of the whole network. There is direct experimental evidence for most of the regulators in the core gene regulatory network relating to HCC. -
Prenatal Testing Requisition Form
BAYLOR MIRACA GENETICS LABORATORIES SHIP TO: Baylor Miraca Genetics Laboratories 2450 Holcombe, Grand Blvd. -Receiving Dock PHONE: 800-411-GENE | FAX: 713-798-2787 | www.bmgl.com Houston, TX 77021-2024 Phone: 713-798-6555 PRENATAL COMPREHENSIVE REQUISITION FORM PATIENT INFORMATION NAME (LAST,FIRST, MI): DATE OF BIRTH (MM/DD/YY): HOSPITAL#: ACCESSION#: REPORTING INFORMATION ADDITIONAL PROFESSIONAL REPORT RECIPIENTS PHYSICIAN: NAME: INSTITUTION: PHONE: FAX: PHONE: FAX: NAME: EMAIL (INTERNATIONAL CLIENT REQUIREMENT): PHONE: FAX: SAMPLE INFORMATION CLINICAL INDICATION FETAL SPECIMEN TYPE Pregnancy at risk for specific genetic disorder DATE OF COLLECTION: (Complete FAMILIAL MUTATION information below) Amniotic Fluid: cc AMA PERFORMING PHYSICIAN: CVS: mg TA TC Abnormal Maternal Screen: Fetal Blood: cc GESTATIONAL AGE (GA) Calculation for AF-AFP* NTD TRI 21 TRI 18 Other: SELECT ONLY ONE: Abnormal NIPT (attach report): POC/Fetal Tissue, Type: TRI 21 TRI 13 TRI 18 Other: Cultured Amniocytes U/S DATE (MM/DD/YY): Abnormal U/S (SPECIFY): Cultured CVS GA ON U/S DATE: WKS DAYS PARENTAL BLOODS - REQUIRED FOR CMA -OR- Maternal Blood Date of Collection: Multiple Pregnancy Losses LMP DATE (MM/DD/YY): Parental Concern Paternal Blood Date of Collection: Other Indication (DETAIL AND ATTACH REPORT): *Important: U/S dating will be used if no selection is made. Name: Note: Results will differ depending on method checked. Last Name First Name U/S dating increases overall screening performance. Date of Birth: KNOWN FAMILIAL MUTATION/DISORDER SPECIFIC PRENATAL TESTING Notice: Prior to ordering testing for any of the disorders listed, you must call the lab and discuss the clinical history and sample requirements with a genetic counselor. -
Cyclin a Triggers Mitosis Either Via Greatwall Or Cyclin B
bioRxiv preprint doi: https://doi.org/10.1101/501684; this version posted December 20, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Cyclin A triggers Mitosis either via Greatwall or Cyclin B Nadia Hégarat(1)*, Adrijana Crncec(1)*, Maria F. Suarez Peredoa Rodri- guez(1), Fabio Echegaray Iturra(1), Yan Gu(1), Paul F. Lang(2), Alexis R. Barr(3), Chris Bakal(4), Masato T. Kanemaki(5), Angus I. Lamond(6), Bela Novak(2), Tony Ly(7)•• and Helfrid Hochegger(1)•• (1) Genome Damage and Stability Centre, School of Life Sciences, University of Sussex, Brighton BN19RQ, UK (2) Department of Biochemistry, University of Oxford, South Park Road, Oxford OX13QU, UK (3) MRC London Institute of Medical Science, Imperial College, London W12 0NN, UK (4) The Institute of Cancer Research, London SW3 6JB, UK (5) National Institute of Genetics, Research Organization of Information and Sys- tems (ROIS), and Department of Genetics, SOKENDAI (The Graduate University of Advanced Studies), Yata 1111, Mishima, Shizuoka 411-8540, Japan. (6) Centre for Gene Regulation and Expression, School of Life Sciences, University of Dundee, Dundee DD1 5EH, UK (7) Wellcome Trust Centre for Cell Biology, University of Edinburgh, Edinburgh EH9 3BF, UK * Equal contribution ** Correspondence: Tony Ly: [email protected]; Helfrid Hochegger: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/501684; this version posted December 20, 2018. -
Cdk5rap1 (NM 025876) Mouse Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR209175 Cdk5rap1 (NM_025876) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Cdk5rap1 (NM_025876) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Cdk5rap1 Synonyms: 2310066P17Rik Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Cdk5rap1 (NM_025876) Mouse Tagged ORF Clone – MR209175 ORF Nucleotide >MR209175 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCATCCTTTACGGTGTGTCCTCCAAGTACAGAGGTTGTCAGCACCATTCACCTCCATGTGCTGGGTGT TGCTTAGGACCTGCAGAGCACAAAGCAGTGTGTCCAGCACTCCTTGTCCCAGTCCAGAGGCGAAGAGCTC AGAAGCTCAGAAGGACTTCAGCTCCAGGCTAGCCACTGGACCGACTTTTCAGCATTTTTTAAGAAGTGCT TCAGTTCCTCAAGAGAAACCATCTTCTCCAGAGGTGGAGGACCCACCTCCCTATCTCTCGGGGGATGAAC TTCTAGGAAGGCAGAGAAAAGTCTACCTCGAGACCTATGGCTGTCAGATGAACGTGAACGACACAGAGAT AGCCTGGTCCATCTTACAGAAGAGTGGCTACCTTCGGACCAGCAACCTCCAAGAGGCTGATGTGATCCTT CTTGTCACGTGTTCTATCAGGGAGAAGGCCGAGCAGACCATCTGGAACCGCTTACATCAGCTCAAAGTCC TGAAGACAAAGCGGCCACGCTCTCGAGTACCTCTGAGGATTGGGATTCTAGGCTGCATGGCTGAGAGGCT GAAGGGAGAGATCCTCAACAGGGAGAAGATGGTAGATCTCTTGGCTGGTCCAGACGCCTACCGAGACCTT