DOCSLIB.ORG

Induced Synaptotagmin (SYT) Protein Family Binds to Membrane SNAP25 to Facilitate Vesicle Secretion in Murine Granulosa/Cumulus Cells During Ovulation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Induced Synaptotagmin (SYT) Protein Family Binds to Membrane SNAP25 to Facilitate Vesicle Secretion in Murine Granulosa/Cumulus Cells During Ovulation J. Mamm. Ova Res. Vol. 25, 193–200, 2008 193 —Original— Induced Synaptotagmin (SYT) Protein Family Binds to Membrane SNAP25 to Facilitate Vesicle Secretion in Murine Granulosa/Cumulus Cells during Ovulation Noritaka Noma1#, Keiko Nishimatsu2#, Mami Enjoji2, Kei Tabata2, Manami Shitanaka2 and Masayuki Shimada1–3* 1Graduate School of Biosphere Science, 2Faculty of Applied Bioscience, Hiroshima University, 1-4-4 Kagamiyama, Higashi-Hiroshima, Hiroshima 739-8528, Japan Abstract: During ovulation, granulosa cells and facilitate the exocytosis system in granulosa cells and cumulus cells synthesize and secrete a wide variety of cumulus cells during ovulation. factors via the exocytosis system. Exocytosis is Key words: Exocytosis, Ovulation, Granulosa cells, controlled by the SNARE (soluble N-ethylmaleimide- SNARE, Synaptotagmin sensitive fusion protein attachment protein receptor) complex consisting of proteins residing in the vesicle Introduction membrane and the plasma membrane. SNAP25 localizes on the plasma membrane whereas The pituitary surge of luteininzing hormone (LH) acts synaptotagmins (SYT) reside in secretion vesicle on the granulosa cells of preovulatory follicles to membranes. After Ca2+-induced binding of SNAP25 and terminate the follicular program while at the same time SYT, the release of vesicle-contained factors is stimulating the expression of genes required for triggered. Therefore, we sought to determine if ovulation and luteinization [1, 2]. DNA microarray and induction of Syt mRNA and binding of SYT to SNAP25 in granulosa and cumulus cells were involved in exocytosis protein array systems have identified the secreted during ovulation. After hCG stimulation, the expression factors that are expressed in granulosa cells and in levels of Syt1, Syt2, Syt4 and Syt6 were induced cumulus cells following LH/hCG stimulation. One group markedly in granulosa cells, whereas the levels of Syt3 of secreted factors in the Interleukin (IL) family, and Syt7 mRNAs did not change dramatically. The including IL-1β, IL-6, IL-12, IL-17 and IL-18, which are levels of SYT1 protein were also increased 4 hr after expressed in granulosa cells and in cumulus cells hCG injection and remained increased until 16 hr post- during ovulation [3–5]. Addition of IL-1β to LH- hCG. Immunofluorescence using an SYT1 specific containing medium significantly increases the number of antibody showed increased staining for SYT1 in the oocytes ovulated from in vitro-perfused ovaries, granulosa cells and in the cumulus cells of hCG-primed whereas this is completely suppressed by an IL-1 mice. Additionally, the SYT1 antibody receptor antagonist [6]. It has been demonstrated that coimmunoprecipitated SNAP25 in granulosa cell lysates IL-6 regulates hyaluronan synthesis and accumulation collected at 8-16 hr post-hCG. From these results, we within the cumulus cell matrix [7]. The receptor GP130 conclude that the interactions of SYT1 and SNAP25 is also expressed in cumulus cells and in granulosa cells [8]. Thus, secretion of cytokines from cumulus Received: July 17, 2008 cells and granulosa cells, especially IL-1β or IL-6, is Accepted: August 21, 2008 required for oocyte maturation, ovulation and *To whom correspondence should be addressed. fertilization. e-mail: [email protected] #N. Noma and K. Nishimatsu contributed equally to this work. The process of secretion of cytokines is complex but 194 J. Mamm. Ova Res. Vol. 25, 2008 is known to be controlled by SNARE (soluble N- (Osaka, Japan) or Sigma Chemical Co. (Sigma; St. ethylmaleimide-sensitive fusion protein attachment Louis, MO, USA). protein receptor), which is composed of SNARE proteins residing in the vesicle membrane Animals (synaptobrevin) and plasma membrane (syntaxin and Immature female C57BL/6 mice were obtained from SNAP25) [9, 10]. SNAP25 is anchored in the plasma Clea Japan (Tokyo, Japan). At 23 days of age, female membrane by palmitoylation of four cysteines residing mice were injected intraperitoneally (IP) with 4 IU of in the linker region between the two SNARE motifs. In eCG to stimulate follicular growth followed 48 hr later by our previous study [5], we showed that SNAP25 is injection of 5 IU hCG to stimulate ovulation and expressed in granulosa cells and in cumulus cells luteinization [16, 17]. The animals were housed under a during ovulation. Knockdown of Snap25 gene 16-hour light/8-hour dark schedule in the Experiment expression by the siRNA technique significantly Animal Center at Hiroshima University and were suppresses secretion of cytokines from granulosa cells, provided food and water ad libitum. They were treated whereas the transfection does not affect their mRNA in accordance with the NIH Guide for the Care and Use levels [5], suggesting that SNAP25 is involved in the of Laboratory Animals, as approved by the Animal Care exocytosis system in granulosa cells and in cumulus and Use Committee at Hiroshima University. cells during ovulation. After increase of the Ca2+ level in the cells, the RT-PCR analyses secreted vesicle binds to SNAP25 to trigger the release Total RNA was obtained from granulosa cells of vesicle-contained factors [11, 12]. The recovered from eCG-primed ovary or brain tissue using synaptotagmin (SYT) family is known as a Ca2+ censor an RNAeasy mini kit (Qiagen Sciences, Germantown, and localizes on secreted vesicles [13, 14]. Most SYT MD, USA) according to the manufacturer’s instructions. family members have a Ca2+ binding domain and bind to Briefly, total RNA was reverse transcribed using 500 ng SNAP25 in a Ca2+-dependent manner [12]. Other poly-dT and 0.25 U avian myeloblastosis virus-reverse members without a Ca2+ binding domain that bind to transcriptase at 42°C for 75 min and 95°C for 5 min. SNAP23 are involved in Ca2+-independent exocytosis For amplification of the cDNA products, specific primers (non-regulated exocytosis) [15]. Thus, SYT family pairs were selected and analyzed as indicated in Table members plays an important role in Ca2+-induced 1. The amplified products were analyzed by 2% SNAP25 dependent exocytosis however, there is little agarose gel electrophoresis. information available concerning which kind of SYT family is expressed and the roles of the expressed SYT Real-time PCR analyses in granulosa cells and in cumulus cells during ovulation. The granulosa cells were collected at 0 (48 hr post- Therefore, we sought to determine whether induction of eCG), 4 and 8 hr post-hCG. The cDNAs produced by Syt mRNA and binding of SYT1 to SNAP25 in granulosa the above method were also used for real-time PCR and cumulus cells are involved in exocytosis during analysis. The cDNA and primers were added to a 15 µl ovulation. In this study, we analyzed the kinetic total reaction volume containing Power SYBR Green changes of SYT family expressions in granulosa cells PCR Master Mix (Applied Biosystems, Foster City, CA, and in cumulus cells during ovulation. The binding of USA). PCR reactions were then performed using an SYT1 to SNAP25 was detected by immunoprecipitation iCycler thermocycler (Bio-Rad, Hercules, CA, USA). study. The PCR conditions were set to the following parameters: 10 min at 95°C, 45 cycles each of 15 sec at Materials and Methods 95°C and 1 min at 62 or 64°C. Specific primer pairs were selected and analyzed as indicated in Table 1. Materials Equine chorionic gonadotropin, eCG and hCG were Western blot analyses purchased from Asuka Seiyaku (Tokyo, Japan). Protein samples from granulosa cells that were Oligonucleotide poly-(dT) was purchased from GE collected at 0 (48 hr post-eCG), 4, 8 and 16 hr post-hCG Healthcare (Buckinghamshire, UK), and AMV reverse were prepared by homogenization in whole cell extract transcriptase and Taq polymerase were purchased from buffer and then diluted with the same volume of 2X SDS Promega (Madison, WI, USA). Routine chemicals and sample buffer [3]. Extracts (20 µg protein) were reagents were obtained from Nakarai Chemical Co. resolved by SDS polyacrylamide gel (10%) Noma, et al. 195 Table 1. List of primers employed for RT-PCR and the expected size Primer sequence Annealing Product temperature Size (bp) Syt1 F:5'- CTGCCATTCCCTCGTACTGC-3' R:5'- ACAGGAGGCCACACTTTCCA-3' 64 362 Syt2 F:5'-TCTTGCCTCGTCCCTCGTC-3' R:5'-CCACCCAAGCTCCCTTCTT-3' 64 223 Syt3 F:5'- CTCATCTCCTCGAAGCCATAATGT-3' R:5'-CTTGGACAACAGCAAAGAGACAGA-3' 64 255 Syt4 F:5'-CTTGTGCCACTCCCAATTGCT-3' R:5'-TTCGGCTGGACCTAAGTCATACTC-3' 60 155 Syt5 F:5'- GTGGCTCCCAAAGAGGAGCA -3' R:5'- CTGGTCACAGGGCACCTCAA -3 60 264 Syt6 F:5'-TCCCAGAAGTGGGCTCCAAA-3' R:5'-ACCGAGGCTGGTGGTGCTAA-3' 66 266 Syt7 F:5'- AACCCCTCTGCCAACTCCAT-3' R:5'-GCGGCTGAGCTTGTCTTTGT-3' 66 261 Snap23 F:5'-CAACCGAGCCGGATTACAAA-3' R:5'- GGCATTCCTCCTCTGCTCCT-3' 64 387 Snap25 F:5'-GAGATGCAGAGGAGGGCTGAC-3' R:5'- GCTGGCCACTACTCCATCCTG-3' 62 309 L19 F:5'-CTGAAGGTCAAAGGGAATGTG-3' R:5'- GGACACAGTCTTGATGATCTC-3' 60 196 electrophoresis and transferred to PVDF membranes Immunoprecipitation (GE Healthcare). The membranes were blocked in Tris- Protein samples (100 µg) of granulosa cells were buffered saline and Tween 20 (TBST; 10mM Tris incubated with either anti-Synaptotagmin 1 mouse (pH7.5), 150 mM NaCl and 0.05% Tween 20) containing monoclonal antibody diluted at 1:50 or IgG purified from 5% nonfat Carnation instant milk (Nestle Co., Solon, normal mouse serum (Sigma) at 4°C overnight. The OH, USA). Blots were incubated primary antibody at immune complex was then precipitated with Protein A 1:1000 dilution of anti-Synaptotagmin 1 monoclonal sepharose beads (Sigma), and the precipitate was used antibody (R&D Systems, Minneapolis, MN, USA) or a for Western blotting as described above. 1:5000 dilution of anti-β-Actin antibody (AC74, Sigma) overnight at 4°C. After washing in TBST, Enhanced Statistics chemiluminescence (ECL) detection was performed Statistical analyses were carried out for all data from using an ECL detection system according the three or four replicates for comparisons by one-way manufacture’s specifications (GE Healthcare) and by ANOVA followed by Duncan’s multiple-range test appropriate exposure of the blots to FujiFilm X-ray film (Statview; Abacus Concepts, Inc., Berkeley, CA, USA).
Load more

Recommended publications
  • In Vivo Analysis of Exosome Trafficking and Function in Drosophila Melanogaster
    In vivo analysis of exosome trafficking and function in Drosophila melanogaster Senior thesis Presented to The Faculty of the School of Arts and Sciences Brandeis University Undergraduate Program in Biology Professor Avital A. Rodal, PhD, Advisor In partial fulfillment of the requirements for the degree of Bachelor of Science by Anna Yeh May 11, 2016 Copyright by Anna Yeh Committee members Name: _____________________________ Signature: _____________________________ Name: _____________________________ Signature: _____________________________ Name: _____________________________ Signature: _____________________________ 1 Table of Contents 1 Abstract 4 2 Introduction 5 2.1 Exosomes: function and therapeutic applications 6 2.2 Exosome cargo and targeting specificity 6 2.3 Exosomes and the endocytic process 7 2.3.1 Rab proteins play a role in exosome trafficking in the donor cell 7 2.3.2 SNARE machinery is necessary for exosomal trafficking from the donor cell 8 2.3.3 Exosome uptake by the recipient cell 9 2.4 Drosophila as an in vivo model organism to study exosome function and trafficking 10 2.4.1 Physiological function for neuronal exosomes in Drosophila 10 2.4.2 Organismal level of exosome trafficking 11 2.5 Current methods and techniques in exosome research 12 2.5.1 Biochemical approaches for exosome analysis 13 2.5.2 Genetic and molecular biology approaches for in vivo exosome research 14 Methods 16 3.1 Molecular cloning 16 3.1.1 Construction of pattB-13xLexAop2-Sun-5Myc-spGFP11 16 3.1.2 Construction of pUASt-attB-spGFP1-10-WPRE 16 3.1.3
    [Show full text]
  • Identification of Secretory Granule Phosphatidylinositol 4,5-Bisphosphate- Interacting Proteins Using an Affinity Pulldown Strategy*□S
    Research Identification of Secretory Granule Phosphatidylinositol 4,5-Bisphosphate- interacting Proteins Using an Affinity Pulldown Strategy*□S Shona L. Osborne‡§, Tristan P. Wallis¶ʈ, Jose L. Jimenez**, Jeffrey J. Gorman¶ʈ, and Frederic A. Meunier‡§‡‡ Phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) syn- required for secretion is synthesized on the plasma mem- thesis is required for calcium-dependent exocytosis in neu- brane (4), and the binding of vesicle-associated proteins to rosecretory cells. We developed a PtdIns(4,5)P2 bead pull- PtdIns(4,5)P2 in trans is thought to be important for bringing down strategy combined with subcellular fractionation to the vesicle and plasma membranes together prior to exocy- Downloaded from identify endogenous chromaffin granule proteins that inter- tosis to ensure rapid and efficient fusion upon calcium influx act with PtdIns(4,5)P . We identified two synaptotagmin iso- 2 (5). Putative PtdIns(4,5)P effectors include synaptotagmin 1 forms, synaptotagmins 1 and 7; spectrin; ␣-adaptin; and 2 (Syt1) (6, 7), calcium-activated protein for secretion (CAPS) (8, synaptotagmin-like protein 4 (granuphilin) by mass spec- 9), and rabphilin (10). trometry and Western blotting. The interaction between https://www.mcponline.org CAPS binds to PtdIns(4,5)P2 and is a potential PtdIns(4,5)P2 synaptotagmin 7 and PtdIns(4,5)P2 and its functional rele- vance was investigated. The 45-kDa isoform of synaptotag- effector for priming of secretory granule exocytosis (9). How- min 7 was found to be highly expressed in adrenal chromaf- ever, recent work on the CAPS1 knock-out mouse highlighted fin cells compared with PC12 cells and to mainly localize to an involvement of CAPS1 in the refilling or storage of cate- secretory granules by subcellular fractionation, immunoiso- cholamine in mature secretory granules therefore suggesting lation, and immunocytochemistry.
    [Show full text]
  • Synaptotagmin 7 Switches Short-Term Synaptic Plasticity from Depression
    www.nature.com/scientificreports OPEN Synaptotagmin 7 switches short‑term synaptic plasticity from depression to facilitation by suppressing synaptic transmission Takaaki Fujii1, Akira Sakurai1, J. Troy Littleton2 & Motojiro Yoshihara1* Short‑term synaptic plasticity is a fast and robust modifcation in neuronal presynaptic output that can enhance release strength to drive facilitation or diminish it to promote depression. The mechanisms that determine whether neurons display short‑term facilitation or depression are still unclear. Here we show that the Ca2+‑binding protein Synaptotagmin 7 (Syt7) determines the sign of short‑term synaptic plasticity by controlling the initial probability of synaptic vesicle (SV) fusion. Electrophysiological analysis of Syt7 null mutants at Drosophila embryonic neuromuscular junctions demonstrate loss of the protein converts the normally observed synaptic facilitation response during repetitive stimulation into synaptic depression. In contrast, overexpression of Syt7 dramatically enhanced the magnitude of short‑term facilitation. These changes in short‑term plasticity were mirrored by corresponding alterations in the initial evoked response, with SV release probability enhanced in Syt7 mutants and suppressed following Syt7 overexpression. Indeed, Syt7 mutants were able to display facilitation in lower [Ca2+] where release was reduced. These data suggest Syt7 does not act by directly sensing residual Ca2+ and argues for the existence of a distinct Ca2+ sensor beyond Syt7 that mediates facilitation. Instead, Syt7 normally suppresses synaptic transmission to maintain an output range where facilitation is available to the neuron. Synaptotagmins (Syts) are a large family of Ca2+ binding proteins, with the Syt1 isoform functioning as the major Ca2+ sensor for synchronous synaptic vesicle (SV) fusion1. Ca2+ also controls presynaptic forms of short-term plasticity, with other Syt isoforms representing promising candidates to mediate these processes.
    [Show full text]
  • Communication Between the Endoplasmic Reticulum and Peroxisomes in Mammalian Cells
    Communication between the Endoplasmic Reticulum and Peroxisomes in Mammalian Cells by Rong Hua A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Biochemistry University of Toronto © Copyright by Rong Hua (2017) ii Communication between the Endoplasmic Reticulum and Peroxisomes in Mammalian Cells Rong Hua Doctor of Philosophy Department of Biochemistry University of Toronto 2017 Abstract Peroxisomes are important metabolic organelles found in virtually all eukaryotic cells. Since their discovery, peroxisomes have long been seen in close proximity to the endoplasmic reticulum (ER). The interplay between the two organelles is suggested to be important for peroxisome biogenesis as the ER may serve as a source for both lipids and peroxisomal membrane proteins (PMPs) for peroxisome growth and maintenance. On the other hand, various lipid molecules are exchanged between them for the biosynthesis of specialized lipids such as bile acids, plasmalogens and cholesterol. However, how proteins and lipids are transported between the two organelles is not yet fully understood. Previously, the peroxisomal biogenesis factor PEX16 was shown to serve as a receptor for PMPs in the ER and also as a mediator of the subsequent transport of these ER-targeted PMPs to peroxisomes. Here, I extended these results by carrying out a comprehensive mutational analysis of PEX16 aimed at gaining insights into the molecular targeting signals responsible for its ER-to-peroxisome trafficking and the domain(s) involved in its PMP recruitment function at the ER. I also showed that the recruitment function of PEX16 is conserved in plants. To gain further mechanistic insight into PEX16 function, the proteins proximal to iii PEX16 were identified using the proximity-dependent BioID analysis.
    [Show full text]
  • A Minimum-Labeling Approach for Reconstructing Protein Networks Across Multiple Conditions
    A Minimum-Labeling Approach for Reconstructing Protein Networks across Multiple Conditions Arnon Mazza1, Irit Gat-Viks2, Hesso Farhan3, and Roded Sharan1 1 Blavatnik School of Computer Science, Tel Aviv University, Tel Aviv 69978, Israel. Email: [email protected]. 2 Dept. of Cell Research and Immunology, Tel Aviv University, Tel Aviv 69978, Israel. 3 Biotechnology Institute Thurgau, University of Konstanz, Unterseestrasse 47, CH-8280 Kreuzlingen, Switzerland. Abstract. The sheer amounts of biological data that are generated in recent years have driven the development of network analysis tools to fa- cilitate the interpretation and representation of these data. A fundamen- tal challenge in this domain is the reconstruction of a protein-protein sub- network that underlies a process of interest from a genome-wide screen of associated genes. Despite intense work in this area, current algorith- mic approaches are largely limited to analyzing a single screen and are, thus, unable to account for information on condition-specific genes, or reveal the dynamics (over time or condition) of the process in question. Here we propose a novel formulation for network reconstruction from multiple-condition data and devise an efficient integer program solution for it. We apply our algorithm to analyze the response to influenza in- fection in humans over time as well as to analyze a pair of ER export related screens in humans. By comparing to an extant, single-condition tool we demonstrate the power of our new approach in integrating data from multiple conditions in a compact and coherent manner, capturing the dynamics of the underlying processes. 1 Introduction With the increasing availability of high-throughput data, network biol- arXiv:1307.7803v1 [q-bio.QM] 30 Jul 2013 ogy has become the method of choice for filtering, interpreting and rep- resenting these data.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Effects of Neonatal Stress and Morphine on Murine Hippocampal Gene Expression
    0031-3998/11/6904-0285 Vol. 69, No. 4, 2011 PEDIATRIC RESEARCH Printed in U.S.A. Copyright © 2011 International Pediatric Research Foundation, Inc. Effects of Neonatal Stress and Morphine on Murine Hippocampal Gene Expression SANDRA E. JUUL, RICHARD P. BEYER, THEO K. BAMMLER, FEDERICO M. FARIN, AND CHRISTINE A. GLEASON Department of Pediatrics [S.E.J., C.A.G.], Department of Environmental and Occupational Health Sciences [R.P.B., T.K.B., F.M.F.], University of Washington, Seattle, Washington 98195 ABSTRACT: Critically ill preterm infants experience multiple to severe impairment occurring in close to 50% of ex- stressors while hospitalized. Morphine is commonly prescribed to tremely LBW infants (4). Autism, attention deficit disorder, ameliorate their pain and stress. We hypothesized that neonatal and school failure also occur more frequently in NICU stress will have a dose-dependent effect on hippocampal gene survivors (5). Although some degree of impairment might expression, and these effects will be altered by morphine treat- ment. Male C57BL/6 mice were exposed to five treatment condi- be inevitable, it is likely that the stress and treatments these tions between postnatal d 5 and 9: 1) control, 2) mild stress ϩ infants undergo impact neurologic outcome. Improved un- saline, 3) mild stress ϩ morphine, 4) severe stress ϩ saline, and derstanding of these factors will provide the basis of better 5) severe stress ϩ morphine. Hippocampal RNA was extracted treatments and subsequent improvement in outcomes. and analyzed using Affymetrix Mouse Gene 1.0 ST Arrays. Single Many preterm infants receive opiates for sedation or gene analysis and gene set analysis were used to compare groups analgesia during their NICU stay.
    [Show full text]
  • Identification of Key Genes and Pathways Involved in Response To
    Deng et al. Biol Res (2018) 51:25 https://doi.org/10.1186/s40659-018-0174-7 Biological Research RESEARCH ARTICLE Open Access Identifcation of key genes and pathways involved in response to pain in goat and sheep by transcriptome sequencing Xiuling Deng1,2†, Dong Wang3†, Shenyuan Wang1, Haisheng Wang2 and Huanmin Zhou1* Abstract Purpose: This aim of this study was to investigate the key genes and pathways involved in the response to pain in goat and sheep by transcriptome sequencing. Methods: Chronic pain was induced with the injection of the complete Freund’s adjuvant (CFA) in sheep and goats. The animals were divided into four groups: CFA-treated sheep, control sheep, CFA-treated goat, and control goat groups (n 3 in each group). The dorsal root ganglions of these animals were isolated and used for the construction of a cDNA= library and transcriptome sequencing. Diferentially expressed genes (DEGs) were identifed in CFA-induced sheep and goats and gene ontology (GO) enrichment analysis was performed. Results: In total, 1748 and 2441 DEGs were identifed in CFA-treated goat and sheep, respectively. The DEGs identi- fed in CFA-treated goats, such as C-C motif chemokine ligand 27 (CCL27), glutamate receptor 2 (GRIA2), and sodium voltage-gated channel alpha subunit 3 (SCN3A), were mainly enriched in GO functions associated with N-methyl- D-aspartate (NMDA) receptor, infammatory response, and immune response. The DEGs identifed in CFA-treated sheep, such as gamma-aminobutyric acid (GABA)-related DEGs (gamma-aminobutyric acid type A receptor gamma 3 subunit [GABRG3], GABRB2, and GABRB1), SCN9A, and transient receptor potential cation channel subfamily V member 1 (TRPV1), were mainly enriched in GO functions related to neuroactive ligand-receptor interaction, NMDA receptor, and defense response.
    [Show full text]
  • Lipid Droplets Protect Human Β Cells from Lipotoxic-Induced Stress and Cell
    bioRxiv preprint doi: https://doi.org/10.1101/2021.06.19.449124; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lipid droplets protect human β cells from lipotoxic-induced stress and cell identity changes Xin Tong1 and Roland Stein1,2 1Department of Molecular Physiology and Biophysics, Vanderbilt University, Nashville, TN 2Corresponding author: [email protected]; Tel: 615-322-7026 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.19.449124; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract (200 words) Free fatty acids (FFAs) are often stored in lipid droplet (LD) depots for eventual metabolic and/or synthetic use in many cell types, such a muscle, liver, and fat. In pancreatic islets, overt LD accumulation was detected in humans but not mice. LD buildup in islets was principally observed after roughly 11 years of age, increasing throughout adulthood under physiologic conditions, and also enriched in type 2 diabetes. To obtain insight into the role of LDs in human islet β cell function, the levels of a key LD structural protein, perilipin2 (PLIN2), were manipulated by lentiviral-mediated knock-down (KD) or over-expression (OE) in EndoCβH2-Cre cells, a human cell line with adult islet β-like properties.
    [Show full text]
  • Figure S1. SYT1 and SYT3 Are Induced Under Abiotic Stress (Related to Figure 1)
    Figure S1. SYT1 and SYT3 are induced under abiotic stress (related to Figure 1). (A) Phylogenetic clustering of the Arabidopsis protein coding sequence of SYT1, SYT2, SYT3, SYT4, SYT5 and the Homo sapiens E-Syt1. Phylogenetic tree was inferred using the Neighbor-Joining method. The optimal tree with the sum of branch length = 3.26 is shown. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the p-distance method and are in the units of the number of amino acid differences per site. This analysis involved 11 amino acid sequences. All ambiguous positions were removed for each sequence pair (pairwise deletion option). There were a total of 1752 positions in the final dataset. Evolutionary analyses were conducted using MEGA X (Kumar et al., 2018). (B) Gene expression profiles based on RNA-seq analysis of SYT1, SYT2, SYT3, SYT4, and SYT5 in vegetative tissues at different developmental stages from TRAVA database http://travadb.org/). Each dot represent a RNAseq value and the bar represent the median. (C) Gene expression profiles based on RNA-seq analysis of SYT1, SYT3, and SYT5 in eFP-seq Browser after various abiotic stresses (https://bar.utoronto.ca/eFP-Seq_Browser/).https://bar.utoronto.ca/eFP- Seq_Browser/). (D) Heatmap representing the expression responses to abiotic stress of SYT1, SYT3 and SYT5. Expression levels genes are represented as the fold-change relative to the control. Red represents a gene that is induced, and blue represents a gene that is repressed in response to the indicated abiotic stress.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Supplementary Materials
    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
    [Show full text]