Investigating Adult Stem Cell Lineage Specification in the Freshwater Flatworm Schmidtea Mediterranea

Investigating Adult Stem Cell Lineage Specification in the Freshwater Flatworm Schmidtea mediterranea

Shu Jun Zhu

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy

Department of Molecular Genetics University of Toronto

Shu Jun Zhu Doctor of Philosophy

Molecular Genetics University of Toronto

2018

Abstract

Adult stem cells (ASCs) serve to facilitate tissue turnover during the lifespan of an organism. The goal of my research has been to deepen our understanding of how ASCs become specified towards differentiation to produce physiologically functional cell types. To this end, I have chosen to use the freshwater planarian Schmidtea mediterranea, which possess a large pool of ASCs that supports the constant cell turnover of all their tissues. A transcriptomic approach was used to identify a set of candidate genes to screen for potential regulators and markers of ASC progeny.

Using gene expression characterization and RNAi functional analysis, I have identified a MEX3 homolog (Smed-mex3-1) and a putative MYB-type transcription factor (Smed-myb-1) as regulators of ASC differentiation. This body of work demonstrates that (A) mex3-1 is a critical factor broadly required for ASC differentiation, and (B) myb-1 is a regulator of the early temporal window of epidermal lineage progression.

Acknowledgements

This journey, which has now occupied a quarter of my life, would not have come to pass were it not for Bret’s willingness to take a chance on a new graduate to help him start his lab. Bret, thank you for believing in me, and for your mentorship and support during these many years. This experience has been nothing short of an absolute pleasure.

My time at SickKids has been enriched by a wealth of individuals, and though this thesis needs no further elongation, I would like to offer special thanks to a few. To Dani and Chong, for being so welcoming and helping me get my bearings when I first arrived at SickKids as a new tech. To my committee members Derek and Mike, for their guidance throughout my graduate studies and their feedback on this thesis. To the Derry lab, for graciously accepting their repeated defeats in our yearly competitions of ultimate athleticism - curling. And to all past and present members of the Pearson lab, who have recognized it is what it is. Things would be amiss without particular acknowledgement of Alex and Ko, for nucleating the lab and starting their adventure alongside me; Rose, for her dry humour and even drier oat bars; Dave, for carrying me through Lordran;

Alyssa, for being the safest place there is; and lastly to Steph and Yan, whose friendships and what that has meant for me cannot be overstated.

Thank you to my friends, for the reminders that life exists outside of the lab, and giving me fortitude when it was dearly wanting. And of course, an immense thank you to my wonderful parents, who have never failed to support my endeavours, especially when I decided to leave a job to go back to school. Thank you for everything you’ve done for me.

iii

Table of Contents

Acknowledgements……………………………………………………………………………...iii

Table of Contents………………………………………………………………………………...iv

List of Figures…………………………………………………………………………………..viii

Chapter 1 Introduction…………………………………………………………………………....1

1. Adult stem cells…………………………………………………………………………….....1

2. Schmidtea mediterranea, an in vivo model of adult stem cell biology……………………….2

2.1. Planarians: anatomically complex and highly regenerative...…………………………....2

2.2. Progression of planarian research with molecular biology.……………………………...4

2.3. Molecular analysis of neoblasts……………………………………………………….....5

2.3.1. Molecular markers of neoblasts…………………………………………………...5

2.3.2. Establishing neoblast pluripotency………………………………………………..6

2.3.3. Neoblast lineages………………………………………………………………....7

2.3.4. Identification of neoblast subclasses……………………………………………...9

2.4. Regulation of neoblast cell fates………………………………………………………...11

2.4.1. Strategies of stem cell fate regulation……………………………………………11

2.4.2. Signaling pathways in planarians………………………………………………..12

2.4.3. Potential niche signals from differentiated tissues……………………………….13

2.4.4. Asymmetric neoblast division…………………………………………………...14

2.5. Planarian epidermis……………………………………………………………………..15

2.5.1. A model for neoblast differentiation……………………………………………..15

2.5.2. Epidermal lineage progression…………………………………………………..16

2.5.3. Regulators of epidermal lineage progression……………………………………18

3. Thesis rationale: Using a transcriptomic approach to identify regulators in adult stem cell

fate…………………………………………………………………………………………..19

Chapter 2 A mex3 homolog is required for differentiation during planarian stem cell lineage development …………………………………………………………………………………….21

4. RNAseq analysis of flow cytometry-isolated populations…………………………………...23

4.1. Identification and selection of candidate progeny-enriched genes……………………...23

4.2. Expression analysis by whole-mount in situ hybridization……………………………..27

5. New early progeny and late progeny markers are identified…………………………………33

5.1. Kinetics of irradiation-sensitivity of prog/AGAT-like genes……………………………33

5.2. New progenitor markers are expressed by early or late progeny……………………….34

6. RNAi screening identifies mex3-1 as a regulator of differentiation…………………………39

6.1. mex3-1(RNAi) animals display defects typical of impaired stem cell function…………39

6.2. mex3-1 is required for epidermal progenitor specification……………………………..42

7. Knockdown of mex3-1 results in expansion of the stem cell compartment…………………45

7.1. mex3-1 RNAi does not impair, but increases cell division……………………………..45

7.2. Knockdown of mex3-1 expands the stem cell compartment……………………………47

8. mex3-1 is broadly required for differentiation………………………………………………48

8.1. Epidermal regeneration and homeostatic turnover requires mex3-1……………………48

8.2. mex3-1 is required for differentiation of multiple lineages……………………………..49

8.3. mex3-1 has a broader role than p53 in neoblast differentiation…………………………52

9. RNAseq of mex3-1(RNAi) animals identifies novel progenitor transcripts………………….54

9.1. Transcriptional profiling of mex3-1(RNAi) animals…………………………………….54

9.2. Downregulated genes in mex3-1(RNAi) animals are markers of progenitors…………..56

10. Methods……………………………………………………………………………………..59

10.1. RNA sequencing...... ………………………………………………………...... 59

10.2. Analysis of RNAseq data...... 60

10.3. Phylogenetics and cloning...... 61

10.4. Animal husbandry and RNAi...... 61

10.5. Immunostaining, TUNEL, EdU, BrdU, irradiation, and in situ hybridization...... 62

Chapter 3 Smed-myb-1 specifies the early temporal identity during planarian epidermal differentiation...... 64

11. RNAi screening identifies a role for Smed-myb-1 in specification during epidermal

differentiation...... 65

11.1. Knockdown of myb-1 ablates early epidermal progeny...... 65

11.2. myb-1 is expressed during epidermal lineage development...... 66

11.3. RNAi of myb-1 does not impair neoblast maintenance or progeny survival...... 68

12. Epidermal lineage progression does not require early progenitor gene expression...... 71

12.1. myb-1 RNAi selectively downregulates early progeny markers...... 71

12.2. myb-1(RNAi) animals regenerate late progeny, later progeny, and epidermis...... 74

13. Epidermal differentiation is accelerated after myb-1 knockdown...... 75

13.1. Stem cell descendants enter late progeny, later progeny, and epidermis earlier after

myb-1 knockdown...... 75

13.2. myb-1(RNAi) animals maintain regional epidermal identity...... 78

14. Epidermal lineage progression is spatiotemporally shifted in myb-1(RNAi) animals...... 79

14.1. RNAi of myb-1 temporarily increases progenitor and epidermal cells...... 79

14.2. Late progeny exhibit early progeny characteristics after myb-1 RNAi...... 80

15. Methods...... 83

15.1. Animal care, RNAi, and γ-irradiation...... 83

15.2. In situ hybridization, immunostaining, BrdU labeling, and TUNEL...... 84

15.3. qPCR, RNAseq, and differential expression analysis...... 84

Chapter 4 Discussion...... 86

16. X2 characterization identifies epidermal progenitor markers...... 86

17. mex3-1 as a candidate mediator of asymmetric cell fate in planarians...... 87

17.1. Cell fate regulation by mex3 genes...... 87

17.2. Mechanisms of mex3-1 functions...... 88

17.3. The search for novel progenitor populations...... 89

18. Epidermal differentiation in planarians...... 90

18.1. Temporal regulation of epidermal lineage progression by myb-1...... 90

18.2. Functions of transition states during epidermal differentiation...... 92

18.3. MYB-type transcription factors in differentiation...... 94

19. Future directions...... 95

19.1. Molecular mechanisms of mex3-1 function...... 95

19.2. Role of the early progeny state in epidermal maturation...... 95

19.3. Deciphering the functions of myb-1 in other tissues...... 96

Appendices

20. Characterization of Smed-brg1L in planarians...... 98

20.1. Identification of a planarian brahma homolog as a candidate regulator of

differentiation...... 98

20.2. Reduced differentiation is accompanied by stem cell expansion...... 100

21. Further characterization of myb-1 RNAi phenotype...... 103

21.1. myb-1(RNAi) differentially-expressed transcripts are enriched in gut-specific

genes...... 103

21.2. myb-1(RNAi) animals exhibit altered gut differentiation dynamics...... 105

21.3. RNAi of a peroxidasin homolog results in abnormal posterior morphology...... 107

References...... 109

vii

List of Figures Figure 2.3.4 Neoblast subclasses in planarians Figure 2.5.2 Model of epidermal lineage development in S. mediterranea Figure 4.1.1 Statistical correlations between new and published datasets Figure 4.1.2 Transcriptional analysis to identify candidate progeny-enriched genes Figure 4.1.3 Predicted protein alignments of the PROG family that are irradiation sensitive Figure 4.2.1 Gene expression analysis of candidate progeny genes Figure 4.2.2 WISH analysis of genes with a prog/AGAT-like expression pattern after irradiation Figure 4.2.3 WISH analysis of genes from all expression pattern categories after irradiation Figure 4.2.4 WISH analysis of additional candidate progeny genes after irradiation Figure 5.2.1 Expression of PIWI-1 protein during epidermal lineage progression Figure 5.2.2 prog/AGAT-like genes are expressed in epidermal progenitors Figure 5.2.3 prog/AGAT-like genes are expressed in early progeny or late progeny Figure 5.2.4 Epidermal progeny markers are co-expressed but one may mark a new maturation phase Figure 5.2.5 Analysis of new epidermal progeny markers in zfp-1(RNAi) animals Figure 6.1.1 mex3-1 is required for tissue homeostasis and regeneration Figure 6.1.2 Identification and analysis of MEX3 homologs in S. mediterranea Figure 6.1.3 mex3-1 is expressed in stem cells and epidermal progenitors Figure 6.2.1 Knockdown of mex3-1 ablates epidermal progeny but not stem cells Figure 6.2.2 New epidermal progenitor markers are downregulated after mex3-1 RNAi Figure 6.2.3 mex3-1(RNAi) worms exhibit increased levels of cell death Figure 7.1.1 Knockdown of mex3-1 induced hyperproliferation Figure 7.1.2 Cell cycle progression is not halted in mex3-1(RNAi) animals Figure 7.1.3 mex3-1 RNAi abrogates progeny production during stem cell repopulation Figure 7.2.1 mex3-1(RNAi) animals exhibit expansion of the stem cell compartment Figure 8.1 mex3-1 is required for epidermal turnover and regeneration Figure 8.2.1 Knockdown of mex3-1 reduces production of tissue-specified progenitors Figure 8.2.2 mex3-1 is expressed in neural-specified progenitors Figure 8.2.3 mex3-1 RNAi reduces differentiation of multiple tissues Figure 8.3.1 p53 RNAi reduces epidermal progenitors but not eye or brain

viii

Figure 8.3.2 mex3-1 knockdown shifts the balance between stem cells and postmitotic descendants Figure 9.1.1 RNAseq analysis of mex3-1(RNAi) animals Figure 9.1.2 Comparison of fold change after mex3-1 knockdown to X2 enrichment over irradiated samples Figure 9.2.1 Expression patterns of mex3-1(RNAi) downregulated genes Figure 9.2.2 Expression patterns of additional mex3-1(RNAi) downregulated genes Figure 9.2.3 mex3-1 downregulated genes mark progenitor populations Figure 9.2.4 Characterization of new pharyngeal progenitor marker Figure 11.1.1 myb-1 is a regulator of epidermal lineage specification Figure 11.1.2 myb-1 RNAi reduces the number of late progeny cells Figure 11.2 Expression analysis of myb-1 shows expression during epidermal differentiation Figure 11.3.1 myb-1 RNAi does not expand the stem cell compartment Figure 11.3.2 myb-1(RNAi) exhibit hyperproliferation Figure 11.3.3 myb-1 RNAi does not reduce zeta subclass specification Figure 11.3.4 myb-1 RNAi does not increase apoptosis Figure 12.1.1 Analysis of myb-1 RNAi potency and long-term knockdown Figure 12.1.2 One RNAi feed is sufficient to ablate early progeny gene expression Figure 12.1.3 myb-1 RNAi selectively downregulates early progeny genes Figure 12.2 Knockdown of myb-1 does not abrogate epidermal regeneration Figure 13.1.1 BrdU labelling of stem cells after RNAi Figure 13.1.2 myb-1(RNAi) animals exhibit accelerated epidermal lineage progression Figure 13.1.3 BrdU labelling in non-epidermal tissues after myb-1 RNAi is comparable to controls Figure 13.2 Mature epidermal identities are maintained after myb-1 RNAi Figure 14.1 Epidermal progenitor and epidermal cell densities are temporarily increased after myb-1 RNAi Figure 14.2.1 Knockdown of myb-1 increases detection of PIWI-1 in late progeny Figure 14.2.2 Late progeny are mislocalized in myb-1(RNAi) animals Figure 14.2.3 Irradiation-sensitivity of stem cell, mature tissue, and early progeny genes Figure 14.2.4 Kinetics of epidermal progenitor marker downregulation after irradiation is shifted in myb-1(RNAi) animals Figure 17.2 Model of lineage specification in planarian stem cells Figure 18.1 Model of the role of myb-1 in epidermal lineage development in planarians

Figure 20.1.1 Knockdown of brg1L is lethal and impairs regenerative ability Figure 20.1.2 brg1L is expressed in stem cells and epidermal progenitors Figure 20.1.3 brg1L RNAi selectively downregulates progenitor populations Figure 20.2.1 brg1L RNAi reduces progenitors for other tissue types Figure 20.2.2 brg1L RNAi increases both proliferation and cell death Figure 20.2.3 brg1L(RNAi) animals have increased numbers of stem cells Figure 20.2.3 Stem cell progression to a postmitotic state is reduced after brg1L RNAi Figure 21.1 WISH analysis of myb-1(RNAi) differentially-expressed, irradiation-insensitive genes Figure 21.2.1 myb-1(RNAi) animals maintain gut homeostasis and regenerative ability Figure 21.2.2 Injury-induced neoblast hyperproliferation is diminished in myb-1(RNAi) animals Figure 21.2.3 myb-1(RNAi) animals exhibit increased entry of cells into the gut Figure 21.3 Knockdown of a peroxidasin homolog results in abnormal tail morphology

Introduction

1 Adult stem cells

Tissue turnover over the lifespan of an organism is an approach to maintain organ functionality and integrity during wear and tear. For example, it is estimated that an average of

500 million cells are shed from the human epidermis on a daily basis (Milstone, 2004), and accompanying that loss is an equal influx of new cells into the epidermis. At the heart of sustaining this process are adult stem cells (ASCs), a specialized population defined by two properties: the ability to self-renew, and the ability to generate progeny that can differentiate towards one or more physiologically functional cell types (Siminovitch et al., 1963). Successful tissue turnover necessitates an exquisite balance between these two ASC behaviours, to ensure that cell replacement matches the rate of loss of worn-out mature cells without depleting the stem cell pool (Simons and Clevers, 2011). One of the major questions of ASC biology are, upon stem cell division, how do the daughter cells choose whether to retain stem cell identity or embark on the path of differentiation? And following from the latter choice, once a daughter cell has committed toward differentiation, how is its progression through maturation regulated?

Understanding the regulatory networks that orchestrate how ASCs adopt different cell fates is not only an integral facet in disease research where these processes have become perturbed, such as in premature ageing and tumorigenesis, but is also a prerequisite in actualizing the full potential of stem cell-based therapies for regenerative medicine. Using model organisms from a breadth of evolutionary distances is invaluable in providing insight into conserved fundamental principles of stem cell biology, and moreover, may illuminate novel strategies used that might be applicable to human medicine. One such model that has emerged over the past decade as a promising system to study ASCs in the context of homeostatic tissue turnover and regeneration is the planarian Schmidtea mediterranea.

1 2 Schmidtea mediterranea, an in vivo model of adult stem cell biology

2.1 Planarians: anatomically complex and highly regenerative

Planarians are freshwater, non-parasitic flatworms belonging to the Platyhelminthes phylum and Lophotrochozoa superphylum, the sister group to the Ecdysozoa. There are two strains of S. mediterranea: a sexual hermaphroditic strain which reproduces through cross- fertilization, and an asexual strain that reproduces through transverse fission. Asexuals can be distinguished from sexuals by a chromosomal inversion and absence of a ventral gonopore, and is the predominant strain currently used in laboratories (Reddien and Sánchez Alvarado, 2004).

S. mediterranea are dorsoventrally-flattened, soft-bodied animals that range in size from a few millimetres to upwards of an inch. Their simple outer appearance belies an interior complexity of cell-type diversity among multiple organ systems. Planarians possess a monostratified epidermis, body wall musculature composed of longitudinal, circular, and diagonal fibers, and an excretory system of protonephridia which opens up throughout the dorsal surface. A muscular and innervated pharynx responsible for both food consumption and excretion connects to a blind- ending tri-branched intestine, which is surrounded by enteric muscle. Their nervous system is composed of a bi-lobed cephalic ganglia (brain) which connects to two dorsal eyespots and two ventral nerve cords, and is accompanied by a network of peripheral nerves.

Planarians are masters of regeneration, capable of forming whole worms from very small amputation fragments. Recognition of these potent regenerative properties stretches back over

200 years (Pallas and Christianus Fridericus Voss et, 1767), and the application of experimental analysis dates from the late 19th century onward, which included study from renowned biologist

Thomas Morgan (Morgan, 1898). During the process of regeneration, cell proliferation drives the formation of new tissue called the blastema at the wound site, which over time differentiates to

2 reform missing structures, and then subsequently rescaled alongside pre-existing tissue to regain normal organ proportions (Morgan, 1901). In addition to their extreme regenerative abilities, planarians possess other intriguing traits. They are long-lived organisms that don’t exhibit signs of ageing; all their tissues undergo constant turnover; and they don’t have a fixed adult size, but rather grow or shrink (“degrow”) depending on the availability of resources (Reddien and Sánchez

Alvarado, 2004).

The regenerative abilities and tissue turnover of planarians both rest upon a cell population called neoblasts, the only proliferative cells in the animal (Elliott and Sánchez Alvarado, 2012).

Neoblasts are a morphologically-defined population with the characteristics of small cell size, a large nucleus to cytoplasm ratio, and the presence of cytoplasmic ribonucleoprotein granules called chromatoid bodies (Buchanan, 1933; Randolph, 1897). They constitute a large proportion

(20-30%) of the cells in the animal (Baguñà et al., 1989), and inhabit the mesenchymal space between the intestine and body wall muscles called the parenchyma, surrounding the intestine and brain, but excluded from the pharynx and the margin of the animal. Both feeding (Baguñà, 1974;

Baguñà and Romero, 1981) and tissue loss (Salo and Baguna, 1984) can trigger an increase in neoblast proliferation. The first demonstrations of the vital role of neoblasts in regeneration came from key experiments utilizing irradiation and transplantation. Since neoblasts are the only mitotic cell type, irradiation could be used to selectively ablate neoblasts, and doing so lead to animal death and abolished regenerative ability (Bardeen, 1904; Dubois, 1949). Transplantation of neoblasts, by size selection, into lethally irradiated hosts restored survival and regenerative ability (Baguñà et al., 1989). Neoblasts were thus established as the source of new cells and possessive of pluripotent stem cell activity as a population.

2.2 Progression of planarian research with molecular biology

With the growing development of new techniques in the era of molecular biology, the potential of planarians as a valuable model for ASC biology and regeneration motivated researchers to optimize these tools to this system. One of the most pivotal advancements in moving planarian research forward was the discovery of gene silencing by RNA interference

(RNAi) (Fire et al., 1998). Injection of in vitro synthesized double-stranded RNA (dsRNA) into planarians resulted in potent and systemic gene knockdown, providing a means to test the function for any gene of interest (Sánchez Alvarado and Newmark, 1999). This technique underwent further improvement with a switch to feeding dsRNA-expressing bacteria, resulting in a much more cost-effective and less labour-intensive delivery that paved the way for large-scale RNAi screens (Newmark et al., 2003b; Reddien et al., 2005a).

The development of a fluorescence-activated cell sorting (FACS) protocol, without the requirement of any cell surface markers, enabled the specific isolation of neoblasts (Hayashi et al., 2006). This protocol employed Hoechst staining to segregate cycling cells with greater than

2N DNA (indicative of cycling cells in S/G2/M phases) and lethal irradiation to confirm the selective depletion of neoblasts. The irradiation-sensitive high-DNA gate was termed the “X1” gate, and collection through X1 gating has been widely used for molecular characterization of neoblasts (Labbe et al., 2012; Onal et al., 2012; van Wolfswinkel et al., 2014). A second irradiation-sensitive gate that did not have high-DNA content was also observed by FACS (“X2”), and as described in Chapter 2, was a subject of study for this thesis.

The optimization of in situ hybridization methods for analysis of whole-body gene expression led to vast improvements in cellular resolution and increased sensitivity to detect low

4 abundance transcripts (Brown and Pearson, 2015; King and Newmark, 2013; Pearson et al., 2009).

Together with a growing repertoire of molecular markers, this has allowed researchers to visualize cell and tissue gene expression dynamics during homeostatic turnover and regeneration.

Furthermore, the ability to observe how these dynamics are altered under gene knockdown conditions have been essential to understanding gene function.

The sequencing of the planarian genome has provided a valuable database for gene discovery (Robb et al., 2015; Robb et al., 2008). The continued advancement of sequencing technologies and their falling costs have made RNA sequencing (RNAseq) a very accessible tool, resulting in the creation of multiple transcriptome databases for a range of biological contexts

(Brown et al., 2018; Labbe et al., 2012; Lapan and Reddien, 2012; Scimone et al., 2016). Most recently, the advent of single cell RNAseq (scRNAseq) has been a powerful approach to facilitate the investigation of neoblast population heterogeneity, in silico reconstruction of lineages, and identification of novel cell types (Fincher et al., 2018; van Wolfswinkel et al., 2014; Wurtzel et al., 2015).

2.3 Molecular analysis of neoblasts

2.3.1 Molecular markers

Candidate-based experiments identified the first molecular markers for neoblasts, and they are the most commonly used markers for in situ visualization. Neoblast markers include conserved germline stem cell genes, such as members of the piwi/Argonaute family (piwi-1, piwi-

2), a Bruno-like protein (bruli), and pumilio (Guo et al., 2006; Reddien et al., 2005c; Salvetti et al., 2005), with piwi-1 used as the standard marker of choice. Cell cycle genes also specifically label neoblasts, such as PCNA, histone-2B (h2b), and cyclins (Eisenhoffer et al., 2008; Guo et al.,

2006; Reddien et al., 2005c). Expression analyses of these neoblast markers, as well as others identified from RNAseq profiling of X1-isolated neoblasts (Labbe et al., 2012) showed broad labeling of the entire population. The lack of evidence for heterogeneous labelling or morphological differences within neoblasts, had left open the question of whether neoblasts represented a homogeneous cell population. As discussed below, research since then has established that neoblasts are a heterogeneous group encompassing both pluripotent cells and lineage-specified cells.

2.3.2 Establishing neoblast pluripotency

Unequivocal evidence demonstrating that at least some individual neoblasts possessed pluripotent potential came from a seminal study examining single cell colony formation in vivo, and single cell transplantation (Wagner et al. 2011). Due to the lack of established neoblast cell culture conditions, in order to study the developmental potential of single cells, a sublethal dosage of irradiation was used that permitted some animals to maintain individual surviving neoblasts.

These individual neoblasts were distributed broadly through the animal, and were capable of clonal expansion and differentiation toward multiple lineages. Thus these were termed clonogenic neoblasts (cNeoblasts). Transplantation of single neoblasts isolated from an asexual strain were capable of repopulating lethally irradiated sexual hosts, rescuing tissue turnover and regenerative capacity, ultimately replacing the host cells leading to strain conversion. The molecular identity of these pluripotent cNeoblasts remains elusive from the scientific community, due to the lack of prospective isolation, expansion in vitro, or ability to genetically label planarian cells. Notably, rescue of irradiated hosts by single cell transplant occurred in only a fraction (7/130) of injected animals. This low fraction could have reflected technical challenges of the assay such as cell survivability, but may have also indicated inherent differences in neoblast potential, if neoblasts were comprised of both pluripotent and lineage-restricted cells.

2.3.3 Neoblast lineages

As neoblasts can be selectively ablated by irradiation, progenitor populations would theoretically decline over time without replenishment from neoblasts. Time-course microarray analyses of lethally irradiation worms was used to find transcripts that were downregulated at different time points after irradiation, and this approach identified the first set of markers for neoblast progeny (Eisenhoffer et al., 2008). This established two populations of postmitotic descendants: early progeny and late progeny, named according to how soon gene expression was downregulated after irradiation. Both were found to be enriched in the X2 FACS gate of irradiation-sensitive cells. Two novel genes were markers for early progeny, thereafter named prog-1 and prog-2, and genes involved in metabolism, such as arginine:glycine amidinotransferases (AGAT) and ornithine decarboxylases, were markers for the late progeny population. Though at the time it was unknown to which tissues these progeny populations contribute, or whether they were unspecified, naïve progenitor pools for all tissues, it was eventually established that early and late progeny are progenitors for the epidermis (van

Wolfswinkel et al., 2014).

Such progenitor populations were not uncovered for other tissues, and instead co- expression of tissue-specific markers with either piwi-1 mRNA or PIWI-1 protein was used to identify potential lineage-restricted progenitors. PIWI-1 protein persists for a time after piwi-1 mRNA becomes undetectable (Guo et al., 2006), and has been used as a means to label immediate postmitotic progeny of neoblasts (Wagner et al., 2011). The ability to detect the expression of tissue-specific transcription factors not only in PIWI-1+ cells but piwi-1+ cells as well brought forward the possibility that specification might occur at the neoblast level. The first described lineage-specified “specialized neoblasts” were for the eyespots, detectable during both steady state and in higher numbers during regeneration (Lapan and Reddien 2011 & 2012). These

7 spatially-restricted progenitors were located posterior to the eyespots, expressed markers for the eyespots (such as ovo), and transitioned from a piwi-1+PIWI-1+ to a piwi-1-PIWI-1+ state as they migrated toward the eye and turned on expression of additional eyespot genes. Since then, numerous other studies have shown that tissue-associated transcription factors for protonephria

(Scimone et al. 2011; Vu et al. 2015), neural subtypes (Wenemoser et al. 2012; Currie and Pearson

2013; Cowles et al. 2013 & 2014; Hill and Petersen 2015), pharynx (Adler et al. 2014), and the anterior pole (Scimone et al. 2014; Vasquez-Doorman and Petersen 2014) are expressed in piwi-

1+ neoblasts, and moreover, RNAi against these transcription factors demonstrated they are required for differentiation of tissues in which they are expressed. Additionally, a number of these tissue-associated factors were observed to co-localize with BrdU after short chase periods, or co- localize with cell cycle markers such as h2b or phosphorylated histone 3 (H3P), suggesting that specification can occur in cycling neoblasts.

Transcriptional profiling of X1 cells from regenerating animals demonstrated that this could be generalized to other lineages, with the detection of tissue-associated transcription factors spanning all major tissue types, in small percentages of cycling neoblasts during regeneration

(Scimone et al., 2014). Moreover, co-expression of transcription factors across tissue-types was not observed, arguing against a general non-specific priming of neoblasts for differentiation toward any lineage during regeneration. Together these studies demonstrated that heterogeneity existed within piwi-1+ neoblasts, and new tissue formation during regeneration is at least in part executed by lineage-restricted dividing neoblasts. However, whether these specialized neoblasts are self-renewing or already in their terminal division and will progress directly to differentiation remains unknown.

2.3.4 Identification of neoblast subclasses

The rare but consistent findings of piwi-1+ cells expressing factors involved in differentiation prompted the application of single cell transcriptomics to investigate whether larger scale heterogeneity exists within neoblasts. Using a qPCR-based method on cycling neoblasts isolated from the X1 FACS gate with a panel of 96 potential heterogeneously-expressed genes, evidence for three major subtypes of neoblasts was found (van Wolfswinkel et al., 2014).

The two larger neoblast subclasses were termed sigma and zeta, and a third subclass which could be distinguished within the sigma population was named the gamma subclass (Figure 2.3.4).

These subclasses could be discerned throughout the different phases of the cell cycle, and named based on key genes differentiating the groups: soxP-1 and soxP-2 for sigma; a zinc finger domain- containing protein zfp-1 for zeta; and gata-4/5/6 for gamma.

The subclasses are proposed to represent functionally distinct groups. Specific ablation of zeta neoblasts through knockdown of zfp-1 has provided sound evidence that this subclass is specified toward generating the epidermal lineages. zfp-1 RNAi abrogated the production of early progeny, late progeny, and new epidermal cells, during both homeostasis and regeneration.

Interestingly, even without the formation of an overlaying differentiated epidermis, blastema formation and regeneration of multiple other tissue types proceeded. The specificity of the zfp-1

RNAi phenotype thus resolved the identity of early and late progeny as epidermal progenitors, and the zeta subclass as a specific class of neoblasts.

The gamma subclass of neoblasts is proposed to give rise to intestinal lineages due to expression of evolutionarily-conserved endodermal markers such as hnf4, gata4/5/6, and nkx2.2.

Knockdown of either gata4/5/6 (Gonzalez-Sastre et al. 2017) or nkx2.2 (Forsthoefel et al., 2012) impairs maintenance of intestinal tissue, though it is unknown whether the entire gamma subclass identity was ablated. The sigma subclass is postulated to have broad potential, be the primary respondents for proliferation during regeneration, and be the source from which other subclasses

(including the zeta subclass) are derived. When bulk neoblast-like cells were transplanted from a zfp-1(RNAi) animal, depleted of zeta neoblasts, into irradiated hosts, tissue turnover and regenerative ability could be rescued. Additionally, the zeta gene signature along with epidermal differentiation is re-established during this rescue, leading to the proposition that the pluripotent cNeoblast may reside within or be equivalent to the sigma subclass.

Figure 2.3.4 Neoblast subclasses in planarians The three major neoblast subclasses which have been identified. They are distinguished by the expression of the key genes indicated, and proposed to give rise to different lineages. Untested relationships are indicated by dashed pink arrows.

Subsequent studies using scRNAseq showed clearer separation between sigma, zeta, and gamma neoblasts (Wurtzel et al., 2015), and have even identified a fourth subclass, nu neoblasts, postulated to be a neural-specified population (Molinaro and Pearson, 2016). However, functional analyses for all non-zeta subclasses are still lacking. Without genetic labeling, specific ablation, or prospective isolation of any of the other subclasses, looming questions remain open as to the explicit potentials of each subclass: whether they are bona fide self-renewing cells, represent truly restricted tiers of a stem cell hierarchy, or are flexible states capable of replacing one another.

2.4 Regulation of neoblast cell fates

2.4.1 Strategies of stem cell fate regulation

In all adult stem cell systems, a balance must be struck between stem cell self-renewal and the generation of committed progeny in order to maintain a stable cell population size. This inherent need for asymmetry in cell fate adoption can be met through either extrinsic regulation by stem cell niches, or intrinsic regulation by asymmetric inheritance of cell fate determinants.

Niches are microenvironments which serve to maintain stem cell identity, using through cell-cell contact and short-range secreted factors that initiate signalling on stem cell surface receptors (Morrison and Spradling, 2008; Schofield, 1978). Movement away from the niche resulting in loss of contact or increased distance from secreted niche factors is the determinant to signal cells towards commitment and differentiation. In the mammalian intestinal epithelium,

Paneth cells serve as the niche for Lgr5+ intestinal stem cells by providing short-range signals such as wnt3, egf, tgf-α, and dll4, to maintain stemness. Equipotent stem cell division progeny neutrally compete for access to the niche, and those that lose contact with Paneth cells go on to differentiate (Hsu and Fuchs, 2012; Lopez-Garcia et al., 2010; Sato et al., 2009; Snippert et al.,

2010). ASC niches may also direct division to specifically keep stem cell in the niche over the other. In Drosophila, germline stem cells undergo cell divisions by orienting their mitotic spindles perpendicular to the stem cell-hub interface, ensuring one cell maintains juxtaposed to the hub and the other does not (Yamashita et al., 2007). Thus limited access to the stem cell niche acts to regulate the size of the stem cell population and ensures some stem cells go on to differentiate.

Intrinsic regulation of stem cell fate through asymmetric distribution and inheritance of determinants is another strategy employed in some systems to achieve a balance in cell fate

11 outcomes. This is elegantly described in Drosophila neuroblasts during embryonic neurogenesis, where physical partitioning of the Par complex (Par-3, Par-6, and atypical PKC) to the apical side induces the positioning of differentiation factors such as Prospero, Numb, and Brain tumor to the basal side, allowing the basal daughter cell to repress stem cell identity and commit (Knoblich et al., 1995; Lee et al., 2006; Spana and Doe, 1995). Some stem cell systems are regulated by a combination of extrinsic and intrinsic mechanisms. In intestinal stem cells in the adult Drosophila midgut, integrin adhesion to the basement membrane facilitates asymmetric localization of the

Par complex, which in this scenario acts in a pro-differentiation capacity with Notch signaling to direct intestinal stem cells to be specified into enteroblasts (Goulas et al., 2012).

2.4.2 Signaling pathways in planarians

How planarian neoblasts choose and achieve balance between self-renewal and differentiation is largely a mystery. No components of the neoblast niche, neither the anatomical location or any permissive and or restrictive signals, have been definitively pinned down.

Characterization of major signaling pathways which have been shown to act within niche microenvironments to regulate cell fate decision-making in other stem cell systems, have not yielded any smoking guns in planarians. These studies have shown that the functions of these signalling pathways in axial patterning during embryogenesis in other species has been conserved, and applied to constitutively provide positional information for adult tissue turnover and regeneration (Reddien, 2011). Wnt signaling pathways are crucial mediators in anteroposterior patterning (Gurley et al., 2008; Iglesias et al., 2008; Petersen and Reddien, 2008, 2011) and mediolateral positioning (Adell et al., 2009; Gurley et al., 2010); Fgf signalling pathway also participates in anteroposterior axis patterning, specifically in regulating brain regionalization

(Cebria et al., 2002; Lander and Petersen, 2016; Scimone et al., 2016); and Bmp signaling serves as the major regulatory pathway in dorsoventral patterning in planarians (Gavino and Reddien,

2011; Molina et al., 2007; Reddien et al., 2007). The only phenotype from perturbation of Notch pathway components shows a role in mediolateral polarity regulation (Sasidharan et al., 2017).

2.4.3 Potential niche signals from differentiated tissues

Throughout the years, suggestions as to potential niche locations and molecular signals have arisen, though never conclusively borne out. The central nervous system had been considered as a candidate: hedgehog (hh) is expressed by the central nervous system, and a subset of neoblasts express the receptor patched, and RNAi against hh or ptc resulted in mild reductions or increases in proliferation, respectively (Rink et al., 2009; Yazawa et al., 2009). A closer examination revealed a selective impact on neural progenitors and neurogenesis levels, and not other tissues, under these RNAi conditions (Currie et al., 2016), suggesting the proliferation phenotype is limited to neuronal-specified neoblasts, and not reflective of a population-wide reaction to a global niche signal. Additionally, long-term knockdown of hh signaling was not lethal and did not manifest with morphological phenotypes that would be indicative of a fundamental balance impairment in the stem cell pool.

The intestine has also been put forward as the potential niche, as neoblasts populate the interior-most space surrounding the intestinal branches, and are absent from the peripheral margins of the animal where the gut branches do not reach. Knockdown of nkx2.2, which is expressed predominantly in the intestine, impaired intestinal maintenance and reduced neoblast division during both homeostasis and injury-induced regeneration, resulting in speculation that the gut provides a permissive signal to maintain proliferative capability of neoblasts (Forsthoefel et al., 2012). However, there is also conflicting evidence to suggest that the intestine serves a restrictive role, as knockdown of egfr-1 or its putative ligand nrg-1 impaired differentiation of intestinal tissue and expanded the stem cell pool (Barberán et al., 2016). This expansion was

13 observed across all neoblast subclasses, without seeming to impair differentiation into other tissue types. Though egfr-1 was expressed chiefly in the gut, some egfr-1+ cells in the mesenchyme were PIWI-1+, leaving open the prospect that perturbation of egfr-1 within neoblasts is the primary cause, and independent of loss of gut tissue. If a cell-autonomous role for egfr-1 signalling is the case, that further erodes the proposition of the gut as the niche, since nrg-1 is expressed in unspecified mesenchymal cells and not by the gut.

Lastly, there is evidence which suggests that the intestine serves no niche capacity, either permissive or restrictive. The extensive loss of intestinal tissue upon knockdown of gata4/5/6 surprisingly did not alter the size of the neoblast compartment or levels of neoblast proliferation

(Gonzalez-Sastre et al., 2017).

2.4.3 Asymmetric neoblast division

The extent to which neoblasts employ intrinsic mechanisms to maintain stemness and regulate cell fate is similarly unresolved. No phenotypes have been described for canonical genes involved in asymmetric cell division in other stem cell systems, such as the highly conserved Par complex, even though these genes are present in planarians. Recently, the first and only evidence for asymmetric neoblast division was demonstrated, and has implicated the involvement of EGF signaling (Lei et al., 2016). Immunolabelling for EGFR-3 showed the receptor could be asymmetrically or asymmetrically distributed alongside piwi-1 transcript and chromatoid bodies in H3P+ mitotic pairs. Knockdown of egfr-3 or neuregulin-7, one of the putative ligands for the receptor, resulted in a bias towards symmetric divisions during neoblast repopulation after sublethal irradiation. Unexpectedly, this was accompanied by reduced overall proliferation, a failure of successful neoblast expansion and repopulation, and a reduction in the proportion of epidermal prog-1+ progeny produced after sublethal irradiation. How EGFR-3 protein, piwi-1 transcript, or chromatoid bodies come to be distributed asymmetrically, and whether nrg-7 is a

14 truly restrictive signal, remain to be elucidated. Why the observed increase in symmetric cell divisions would result in a failure of stem cell repopulation instead of expediating the process remains a mystery, with the authors speculating that perhaps some short-lived permissive niche components require replenishment by neoblasts. This is bolstered by analysis of nrg-7 expression, which is expressed in prog-1+ progenitors in addition to PC2+ neurons. It also remains unknown how division modes might be regulated during homeostasis, as knockdown of egfr-3 was not found to impact the ratio of symmetric to asymmetric neoblast divisions in unirradiated animals.

2.5 Planarian epidermis

2.5.1 A model for neoblast differentiation

Progenitors for the epidermis were the first postmitotic neoblast descendants to be identified molecularly in planarians, and thus were widely used as indicators for neoblast differentiation even prior to their assignment to the epidermal lineage (Eisenhoffer et al., 2008).

Since then, epidermal lineage progression remains the most well-described, with an ample number of molecular markers which distinguish multiple distinct spatial and temporal transition states (Tu et al., 2015; van Wolfswinkel et al., 2014; Wurtzel et al., 2017; Zhu et al., 2015). In addition, lineage disruptions typically manifest as easily detectable morphological phenotypes to the worm

(Wagner et al., 2012). These attributes have shaped the epidermal lineage to be a prime paradigm to examine stem cell differentiation in planarians.

The planarian epidermis is a monostratified epithelial layer, separated from the body wall musculature by a basement membrane. Cell turnover is achieved by the migration of cells from the interior mesenchyme and subsequent intercalation into the epithelial layer (Hallez, 1887).

Initial studies on epidermal identities have described three cell types: multiciliated cells, non-

15 ciliated cells, and dorsoventral boundary epidermal cells, with ciliated cells predominantly located on the ventral epidermis to facilitate cilia-driven gliding locomotion (Glazer et al., 2010;

Rompolas et al., 2010; Tazaki et al., 2002). Transcriptional analyses have further molecularly refined this cell type diversity to eight distinct regional identities (Wurtzel et al., 2017), though the discrete physiological functions these cell types fulfil are mostly unknown. Ultrastructural analyses have described rhabdites as a common intracellular structure of epidermal cells (Hyman,

1951). These are released and contribute to the mucus covering the animal, and are thought to contribute to a host of functions such as epidermal barrier integrity, innate immunity, aiding in locomotion and substrate adhesion, and anti-predator mechanisms through generating a noxious taste (Hyman, 1951; Pedersen, 1959, 1963). Another recently described secretory organelle in epidermal cells, named Hyman vesicles, is also proposed to share in some of these roles (Cheng et al., 2018).

2.5.2 Epidermal lineage progression

In the current model of epidermal differentiation, the zeta subclass of epidermal- specialized neoblasts gives rise to post-mitotic descendants which transition through three progenitor phases: early progeny, late progeny, and later progeny (Figure 2.5.2). This lineage has been established from multiple lines of evidence: the sequential pattern of overlapping expression domains, kinetics of cell loss following irradiation, and dynamics of thymidine-analog incorporation (Eisenhoffer et al., 2008; Tu et al., 2015; van Wolfswinkel et al., 2014; Wurtzel et al., 2015). Furthermore, the experimental evidence has been supported by in silico lineage reconstruction with single-cell RNA sequencing, which has recapitulated this lineage progression

(Molinaro and Pearson, 2016; Wurtzel et al., 2017).

Figure 2.5.2 Model of epidermal lineage development in S. mediterranea Stem cell descendants enter a spatiotemporal progression with multiple maturation phases discernable by distinct markers, indicated on the right. Known regulators are indicated on the left. PIWI-1 protein persists temporarily and remains detectable in some progeny.

The spatial domains that each postmitotic transition state inhabit reflect their sequence in terms of lineage progression, which is demonstrated in cross section as well as at the animal margins (Eisenhoffer et al., 2008; Tu et al., 2015). Early progeny are found closer to the interior of the mesenchyme and neoblasts, while late progeny reside in a more restricted and peripheral domain. Later progeny share the subepidermal domain of late progeny and are also present in the epidermis. The kinetics with which progeny markers show downregulation after neoblast depletion by irradiation was also used as evidence to assemble this lineage. Early progeny markers disappear around 48 hours post-irradiation, while late progeny markers persist up to one week, and later progeny markers take up to 10-14 days to be downregulated. Implementation of spatial identity occurs during this path of maturation prior to integration into the epidermis.

Dorsoventral patterning of epidermal identity by bmp signaling is established at the neoblast stage; genes involved in terminal epidermal features, such as cilia components, begin to be expressed as

17 early as the early progeny phase; and marker genes associated with regional identities can be detected in the late progeny phase (Wurtzel et al., 2017).

2.5.3 Regulators of epidermal lineage progression

At the neoblast level, the zinc finger protein zfp-1 (van Wolfswinkel et al., 2014) and transcription factor p53 (Pearson and Sanchez Alvarado, 2010) are master regulators for epidermal specification (Figure 2.5.2). Both genes are part of the zeta neoblast gene signature, and knockdown of either results in a loss of the zeta subclass, a complete loss of epidermal progenitors production, tissue regression, and ventral curling stemming from the lack of epidermal cell replacement (Cheng et al., 2018; Wagner et al., 2012). How the phases of gene expression changes are coordinated downstream of neoblasts in postmitotic progeny have also begun to be pieced together. pax-2/5/8 and soxP-3 transcription factors were found to regulate expression of a subset of early progeny genes, including members of the prog family, but not the early progenitor state as a whole. RNAi against pax-2/5/8 and soxP-3 RNAi animals led a loss of

Hyman vesicles and abnormal rhabdite formation in the epidermis, but epidermal turnover was still maintained with no overt detriment to the animals (Cheng et al., 2018). Reports on the chromatin remodeler chd4 (Scimone et al., 2010) and transcription factor egr-5 (Tu et al., 2015) have demonstrated these genes play a role in facilitating the progression of early progeny into late progeny. Perturbation of chd4 and egr-5 result in a reduction of late progeny and impeded subsequent lineage maturation, ultimately leading to loss of epidermal turnover and integrity.

Concordant with the postulated model for epidermal maturation, RNAi phenotypes with loss of early progeny fates are coupled with a loss of subsequent late progeny fates, whereas loss of late fates can occur without a loss of earlier fates.

3 Thesis rationale: Characterization of candidate progeny genes to identify progeny markers and regulators of adult stem cell fate

Elucidating how non-stem cell fates are specified is a fundamental aspect of understanding the mechanisms of stem cell lineage development. In this thesis, I will present my investigation of this question in the planarian model organism, through exploration of genes enriched in the progeny-associated X2 irradiation-sensitive population.

I hypothesized that regulators that function to promote stem cells toward the postmitotic fate might have enriched expression in progeny. Given that the X2 FACS fraction is enriched with the two prominent progeny populations identified, it followed that such potential regulators may have enriched expression in the X2 gate. Combining a previously generated RNAseq dataset from the lab (Labbe et al., 2012) with a new replicate of sequencing, I selected the top 100 transcripts enriched in the X2 FACS gate to clone out and characterize their expression and function. In an effort to capture any potential progeny populations that do not fall within the X2 flow gate, I also selected and characterized 20 transcripts which were irradiation-sensitive in whole-worm sequencing, but showed neither X1 nor X2 enrichment.

This work proceeded with two overall aims in mind: 1) to explore the potential heterogeneity within this set of candidate progeny genes and identify new markers of progenitor populations, and 2) uncover regulators which mediate the cell fate decision from self-renewal to commitment in planarians. In the first chapter, I will describe the selection and characterization of these 120 candidate transcripts, and the investigation of a mex3 homolog as a critical mediator in achieving asymmetric cell fate in planarian neoblasts. In the second chapter, I will present functional characterization of a putative MYB-type transcription factor demonstrating its role in

19 regulating the dynamics of epidermal lineage progression. In summary, this body of work has elucidated in greater detail the organization of an ASC lineage in planarians, and established crucial genes that participate in ASC commitment and lineage progression.

Chapter 2 A mex3 homolog is required for differentiation during planarian stem cell lineage development

Data and images from this chapter originally appear in the author’s article in the journal eLife.

Based on the journal’s copyright laws, the author retains copyright ownership. The full article can be accessed on the journal’s own website using the link below: http://elifesciences.org/articles/07025

Zhu SJ, Hallows SE, Currie KW, Xu CJ, Pearson BJ (2015). A mex3 homolog is required for differentiation during planarian stem cell lineage development. eLife 2015;4:e07025.

Author contributions were as follows:

SJZ, Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting and revising the article; SEH, KWC, Acquisition of data, Analysis and interpretation of data; CJX,

Conception and design, Analysis and interpretation of data; BJP, Conception and design, Drafting and revising the article.

Rationale and summary

As neoblasts are the only mitotic cell type in planarians, they can be selectively ablated by irradiation, and over time, the immediate progeny of neoblasts eventually disappear as well

(Eisenhoffer et al., 2008; Reddien et al., 2005b). Two irradiation-sensitive cell populations can be visualized by Hoechst-based FACS: X1 and X2. The remaining irradiation-insensitive cells, termed Xins, are assumed to be postmitotic differentiated cell types from ultrastructural and molecular analyses (Hayashi et al., 2006; Higuchi et al., 2007; Reddien et al., 2005b). The X1

21 gate contains cells with high DNA content and is > 90% piwi-1+, and has thus been used as the neoblast fraction in comparative transcriptomic studies (Abril et al., 2010; Eisenhoffer et al., 2008;

Labbe et al., 2012; Onal et al., 2012; Reddien et al., 2005b; Resch et al., 2012; Sandmann et al.,

2011; Solana et al., 2012).

The second irradiation-sensitive population, the X2, is approximately 10-20% piwi-1+

(Eisenhoffer et al., 2008; Reddien et al., 2005c), reflective of neoblasts with 2C DNA content

(neoblasts in G0/G1). Given that the X2 population as a whole is depleted after irradiation, it is thus postulated that the remaining proportion of the X2 gate may be enriched with postmitotic progeny of neoblasts. This notion is supported by the finding that the two established populations of postmitotic progeny, early progeny (marked by prog-1, prog-2) and late progeny (marked by expression of the three planarian AGAT genes and five other genes), together comprise approximately 20% of the X2 population (Eisenhoffer et al., 2008). Indeed, these progeny markers are among the most highly expressed genes in the X2 cell fraction based on RNAseq

(Labbe et al., 2012; Onal et al., 2012; van Wolfswinkel et al., 2014). Although sequencing has been performed on the X2 population, transcripts specific to this population and what cell types are harboured by this FACS gate, had yet to be comprehensively investigated. Irradiation- sensitive transcripts that are not enriched in either the X1 or X2 gate have also not been examined.

I chose 100 X2-enriched transcripts and 20 irradiation-sensitive non-X1/X2-enriched transcripts, for gene expression and RNAi knockdown characterization. I found that while X2- enriched genes represented a heterogeneous mixture of cell types, transcripts expressed in epidermal progenitors comprised the predominant gene signature in the X2 fraction. From the

120 candidate transcripts, I identified 32 new progeny markers and demonstrated that they are expressed predominantly in either prog-1+ or AGAT-1+ epidermal progenitors. In addition, prog-

1 and prog-2 represent members of a larger gene family of unknown function, expressed

22 throughout this epidermal lineage. Through RNAi screening of the 120 candidate transcripts, I identified a homolog to the RNA-binding protein MEX3 (Smed-mex3-1) as a critical regulator required for postmitotic stem cell progeny. Knockdown of mex3-1 completely abolishes regenerative ability and halts the production of prog-1+ and AGAT-1+ postmitotic progeny populations. piwi-1+ stem cells concomitantly increase in number, an increase that was observed across all known neoblast subclasses. Finally, mex3-1(RNAi) worms have impaired contribution to tissue turnover, as evidenced by drastically reduced production of lineage-restricted neoblast descendants and reduced incorporation of new cells into the epidermis and multiple other tissue types. These results suggest that mex3-1 functions to maintain asymmetry in stem cell lineage progression by promoting postmitotic fates and suppressing self-renewal. Due to the function of

MEX3 in mediating asymmetric cell fates during C. elegans embryogenesis (Draper et al., 1996),

I propose that Smed-mex3-1 mediates a similar process in planarian stem cell lineages.

4 RNAseq analysis of flow cytometry-isolated populations

4.1 Identification and selection of progeny-enriched genes

Previously in our lab, 2 replicates of Illumina RNA-deep sequencing (RNAseq) of the X2 cell fraction was performed by Dr. Rose Labbe, to a combined depth of 206 million reads (NCBI

Gene Expression Omnibus accession no: GSE37910) (Labbe et al., 2012). For this study, a third replicate was sequenced to 63 million reads. A very high correlation was found across all of the sequencing replicates, as well as with 2 irradiated samples from a previous study which were then incorporated into this analysis (Figure 4.1.1) (European Bioinformatics Institute accession no:

ERP001079) (Solana et al., 2012).

Figure 4.1.1 Statistical correlations between new and published datasets Scatter plots of transcripts (grey circles) with CPM values of 1000 or less, displayed as log- transformed values. The black diagonal line represents a Pearson correlation coefficient of 1. The corresponding Pearson correlation coefficients are shown at the top of each panel. All correlation- test p-values were found to be equal to 0 (Student’s t-test). As expected, the replicates in each data are highly correlated, and the Pearson correlation coefficients between the replicates in X1 or X2 are greater than 0.95. Furthermore, sequencing from whole irradiated planarians is highly correlated.

To identify transcripts enriched in the X2 cell fraction, DESeq analysis (Anders and

Huber, 2010) was used to compare RNAseq from purified X1 and X2 cells versus whole irradiated animals at 7 days after exposure to 60-100 Gray (Gy) of γ-irradiation (Anders and Huber, 2010;

Fernandes et al., 2014; Solana et al., 2012). This identified 2839 X1 and 1512 X2 transcripts with a p-value ≤ 0.01 (Figure 4.1.2A). It is important to note that X1 and X2 cells shared the majority of their transcriptional profiles, which may be attributed to some degree that between 10-20% of cells in the X2 gate have been previously observed to be neoblasts (Eisenhoffer et al., 2008).

Therefore, to be considered X2-enriched I imposed the additional criterion that the expression ratio of X2/X1 was > 1, to exclude transcripts jointly expressed in both irradiation-sensitive populations. This eliminated previously known stem cell genes such as piwi-1 and -2, PCNA, and cyclinB2 (8th, 45th, 57th, and 80th highest enriched X2 genes, respectively), and reduced the total number of enriched X2 genes to 735 (Eisenhoffer et al., 2008; Orii et al., 2005; Reddien et al.,

2005b). Finally, 66 transcripts were found to be highly expressed in wild-type animals, but exhibited low counts in irradiated worms, X1, and X2 cell fractions (WThighXlow). I hypothesized that the 735 X2-enriched genes and 66 non-X1/X2-enriched irradiation-sensitive transcripts would be enriched for markers of progenitor populations. I chose the top 100 X2-enriched and

20 WThighXlow transcripts for cloning, and subsequent expression and functional analyses (Figure

4.1.2B). Genes were annotated based on the top BLAST hit in mouse, when the Expect value passed the threshold of e-5.

A B

Figure 4.1.2 Transcriptional analysis to identify candidate progeny-enriched genes Irradiation-sensitive cell populations (X1, X2) isolated by FACS, lethally-irradiated whole worms (Irrad), and intact control worms (WT), were analyzed by RNA-deep sequencing (RNAseq). (A) Hierarchical clustering identified transcripts enriched in the X2 population (red box), as well as a group of irradiation-sensitive transcripts which have high expression in intact control worms but

25 low expression in X1, X2, and Irrad populations (purple box, WThighXlow). To improve visualization, the heatmap depicts z-scores scaled to the range of -0.5 to +0.5. (B) Selection of 100 candidate progeny genes from the pool of 735 X2-enriched transcripts, and 20 candidate genes from the pool of 66 WThighXlow transcripts. From the total of 120 candidate genes analyzed, 32 are validated in this study to be expressed in epidermal progenitors (indicated in orange with a dotted line border). >> denotes more than 5-fold enrichment.

Interestingly, the predicted proteins encoded by prog-1 and prog-2 do not have clear homology to genes in other animals, including the genomes of other sequenced flatworms

(Echinococcus multilocularis, Schistosoma mansoni, Macrostomum lignano -- www.macgenome.org) (Berriman et al., 2009; Zheng et al., 2013). However, it was observed that they had low similarity to each other and represented a family of at least 24 distinct members across multiple transcriptomes in S. mediterranea, 15 of which were represented in the top 100

X2-enriched gene set (Currie and Pearson, 2013; Sandmann et al., 2011; Solana et al., 2012; Vogg et al., 2014). Translations of the predicted ORFs (average size 179 amino acids) for these 15 prog-related genes were aligned and analyzed by protein domain prediction software SMART

(Figure 4.1.3) (Letunic et al., 2014; Schultz et al., 1998). The only motif that could be detected was a signal sequence at the N-terminal end of the predicted proteins, suggesting that these proteins are secreted. These prog genes were then named in a numbered sequence based on their closest homolog (e.g. prog-1-1, prog-2-1).

Figure 4.1.3 Predicted protein alignments of the PROG family that are irradiation sensitive An alignment of the 17 PROG family genes used in this study is shown using the tool MUSCLE. Blue shading of residues reflects conservation, which is also plotted below the alignment in the “conservation” plot.

4.2 Expression analysis by whole-mount in situ hybridization

To begin my analysis of the 120 candidate progeny transcripts, whole-mount in situ hybridization (WISH) was performed to elucidate the expression patterns of these genes. I observed that 40/120 transcripts had either no detectable expression or resulted in a ubiquitous and homogenously intense staining, but the remaining 80/120 genes could be grouped into one of four broad categories (Figure 4.2.1). One category (13/120) contained genes with the most intense expression in the bi-lobed brain and nervous system, with low levels of expression elsewhere in the body. A second group of genes (18/120) exhibited a predominantly stem cell-like expression

27 pattern, with or without brain expression, which was confirmed by high expression in the X1 cell fraction. A third subset of genes was expressed in a variety of distinct patterns including the gut, pharynx, peri-pharyngeal region, and neck (17/120).

Finally, the fourth and largest group (32/120) presented with an expression pattern highly similar to that of the known early and late progeny markers (such as prog-1 and AGAT-1), which is dorsal and ventral sub-epidermal localization across the entire animal (Figure 4.2.2) (Eisenhoffer et al.,

2008). Transcripts that displayed a prog/AGAT-like pattern where BLAST did not identify significant similarity were named as postmitotic progeny (pmp’s) with ascending numerals (e.g. pmp-3, pmp-4).

WISH analysis using wild-type and lethally-irradiated (60 Gy) worms demonstrated that genes from each of these expression categories were irradiation-sensitive (Figure 4.2.2, Figure

4.2.3). Genes possessing a stem cell-like pattern as part of their expression exhibited downregulation 24 hours post-irradiation, as anticipated for stem cell markers. However, multiple genes with distinct tissue-specific expression patterns did not change appreciably following irradiation (Figure 4.2.4), and were deemed unlikely to be candidates of progenitor cell types. I subsequently focused on the group of genes exhibiting an epidermal progenitor-like pattern, given their prevalence, and sought to determine whether they were co-expressed in previously described prog-1+ and AGAT-1+ populations, or specified towards other lineages.

Figure 4.2.1 Gene expression analysis of candidate progeny genes WISH was used to determine the gene expression patterns of X2-enriched and WThighXlow genes in intact control worms. Genes for which a reliable and discrete pattern could be obtained are shown. Genes were named based on the best BLASTx result in mouse (when Expect value < 1 × e-5) or based on transcript identity if no homology is found. Genes were categorized as either predominant in the brain (Brain), predominant in a stem cell pattern with or without expression elsewhere (Stem cell-like), or possessing unique patterns (Various). Scale bar, 200 µm.

Figure 4.2.2 WISH analysis of genes with a prog/AGAT-like expression pattern after irradiation Candidate progeny genes which exhibited a prog/AGAT-like expression pattern were assessed by WISH in irradiated worms (60 Gy) at the indicated time points post-irradiation. Genes are grouped as either exhibiting early progeny or late progeny kinetics of downregulation, based on prog-1/2 or AGAT-1/2/3, respectively. Genes which are WThighXlow are indicated in purple text. Anterior, left; scale bar, 200 µm.

Figure 4.2.3 WISH analysis of genes from all expression pattern categories after irradiation Examples of genes expressed in a stem cell-like, brain, various, or a prog/AGAT pattern, are downregulated after irradiation. prog/AGAT-like genes are grouped as either exhibiting early progeny or late progeny kinetics of downregulation. Established lineage markers prog-1, prog-2, and AGAT-1, are included as comparisons and highlighted in blue text. Candidate epithelial progenitor genes with WThighXlow expression are indicated in purple text. Anterior, left; scale bar, 200μm.

Figure 4.2.4 WISH analysis of additional candidate progeny genes after irradiation A subset of genes from brain, stem cell-like, and various categories were assessed in lethally- irradiated worms at the indicated timepoints. Some genes were not downregulated after irradiation. Anterior, left; scale bar, 200μm.

5 New early progeny and late progeny markers are identified

5.1 Kinetics of irradiation-sensitivity of prog/AGAT-like genes

The postmitotic progeny markers (prog-1 and prog-2, and the three AGAT genes) not only have largely non-overlapping expression patterns, but the kinetics of down-regulation following irradiation substantially differ as well (Figure 2A) (Eisenhoffer et al., 2008). prog-1/2 expression is lost within 48 hours post-irradiation while AGAT-1 expression is lost between 48 hours and 7 days, leading to these two cell populations being termed "early" and "late" progeny, respectively.

Combined with evidence from BrdU labeling studies, the early and late progeny populations have been proposed to reflect a spatiotemporal progression along one lineage of ASC differentiation destined for the epidermis, such that prog-1 expression represents the transition state between neoblasts (specifically, the zeta-neoblasts) and AGAT-1+ cells (Eisenhoffer et al., 2008; Pearson and Sanchez Alvarado, 2010; van Wolfswinkel et al., 2014). To demonstrate that the newly identified prog/AGAT-like markers were irradiation-sensitive and to examine their kinetics of downregulation, a time-course of WISH analysis on lethally-irradiated worms was performed.

This revealed that 13/32 transcripts showed similar kinetics of down-regulation as the early progeny markers prog-1 and prog-2, and were almost completely lost by 48 hours post-irradiation

(Figure 4.2.2, 4.2.3). The remaining 19/32 transcripts showed the majority of loss beyond 48 hours post-irradiation, consistent with the kinetics documented for late progeny markers (Figure

4.2.2, 4.2.3). Interestingly, all WThighXlow genes had irradiation-sensitivity kinetics similar to those of late progeny, and moreover, were the only genes with detectable expression at 7 days post-irradiation. The similarities in expression patterns and irradiation-sensitivity kinetics between these new genes and established progeny markers strongly suggested that these genes were also expressed by epidermal progenitors. To ascertain whether that was the case or whether

33 these markers represented novel irradiation-sensitive stem cell progeny, co-localization examined using double fluorescent ISH (dFISH).

5.2 New progenitor markers are expressed in early or late progeny

It has been shown that PIWI-1 protein has a wider expression domain than piwi-1 mRNA, reflecting the temporary persistence of PIWI-1 after piwi-1 transcription is terminated in postmitotic progeny (Guo et al., 2006; Wenemoser and Reddien, 2010). In support of these data,

I found that 17.8% ± 12.2 of prog-1+ cells to be PIWI-1+, while 1.6% ± 1.2 of AGAT-1+ cells had detectable PIWI-1 expression (Figure 5.2.1), which is consistent with the current model positioning early progeny as the immediate descendants of neoblasts, and late progeny as the subsequent transition state

Figure 5.2.1 Expression of PIWI-1 protein during epidermal lineage progression Immunostaining of PIWI-1 with FISH of stem cell, early progeny, and late progeny markers. Percent co-localization is shown at the top of each panel, and is averaged from 3-4 animals. Magenta, percent co-expression in PIWI-1+ cells; green, percent co-expression in cells labelled by FISH. Eyespots are marked by asterisks. Anterior, left.

To determine whether the newly identified progeny markers represented distinct populations of descendant cells outside of prog-1+ early progeny and AGAT-1+ late progeny, I performed pairwise dFISH between the new genes with early or late progeny markers. This

34 revealed that all new progeny markers were expressed in epidermal progenitors, and co- expression with either prog-1 or AGAT-1 correlated with post-irradiation downregulation kinetics.

Genes downregulated at a similar timeline to prog-1 showed extensive overlap with prog-1 and prog-2: for example, prog-1-1 exhibited nearly 100% co-localization with prog-1 (Figure 5.2.2,

5.2.3). Two genes, egr-1 and soxP-3, were expressed in nearly all early progeny cells, but also detected in approximately a quarter of neoblasts (Figure 5.2.2, 5.2.3),

Figure 5.2.2 prog/AGAT-like genes are expressed in epidermal progenitors. Combinatorial dFISH between lineage markers and candidate progeny genes with a prog/AGAT- like expression pattern was performed. Percent co-localization is shown at the top of each panel, and is averaged from 3-4 animals. Magenta, percent co-expression in [row gene]+ cells; green, percent co-expression in [column gene]+ cells. Images from the head, trunk, and tail regions were used for all cell counts, with a minimum of 300 cells counted. Representative confocal projections spanning 4-6 µm of the head region are shown. Eyespots are marked by asterisks. Anterior, left; scale bar, 100 µm.

consistent with their recent identification as markers for the zeta subclass of neoblasts (Wagner et al., 2012). Genes which exhibited irradiation-sensitivity kinetics similar to AGAT-1 were found to be co-expressed with AGAT-1, with overlap ranging from 100% with prog-1-7 to 55.5% with prog-1-4 (Figure 5.2.2, 5.2.3).

One gene had only moderate overlap with AGAT-1: only 20.4% of prog-1-2+ cells expressed AGAT-1 (Figure 5.2.4A). Given that prog-1-2 is expressed in both subepidermal and epidermal cells, I propose that prog-1-2+ cells represent a more differentiated state along the epidermal lineage, and are possibly the subsequent transition for AGAT-1+ cells. I also performed dFISH between newly identified early and late progeny markers, which similarly showed that genes within each category exhibit highly overlapping expression (Figure 5.2.4B).

Knockdown of zfp-1 has been demonstrated to specifically abolish epidermal differentiation but not the differentiation of other tissue types (van Wolfswinkel et al., 2014). A panel of these new epidermal progenitor markers was assessed by WISH in zfp-1(RNAi) worms, and each was observed to be down-regulated compared to control animals, confirming that these genes were indeed expressed in epidermal progenitors (Figure 5.2.5). Together, these findings demonstrated that the newly identified transcripts represent markers of the early and late progeny produced by zeta neoblasts, and comprise the progenitor populations en route to the epidermis

(van Wolfswinkel et al., 2014).

Figure 5.2.3 prog/AGAT-like genes are expressed in early progeny or late progeny Co-expression of candidate progeny markers with established lineage markers prog-1, prog-2, and AGAT-1 using dFISH. Confocal projections spanning 6-10 µm are shown. Smaller panels on the left show individual channels with expression of one gene; larger panels on the right show merged channels. Numbers indicate the percent of magenta-labeled cells which co-express the green-labeled transcript. 200-2000 cells were counted for each dFISH combination. Location of eyespots are marked by asterisks; anterior, up.

A B

Figure 5.2.4 Epidermal progeny markers are co-expressed but one may mark a new maturation phase (A) dFISH shows lower co-expression of the late irradiation-sensitive gene prog-1-2 with AGAT- 1. (B) dFISH of combinations of newly identified epidermal progeny markers. Confocal projections spanning 6-10 µm are shown. Smaller panels on the left show individual channels with expression of one gene; larger panels on the right show merged channels. Numbers indicate the percent of magenta-labeled cells which co-express the green-labeled transcript. Location of eyespots are marked by asterisks; anterior, up.

Figure 5.2.5 Analysis of new epidermal progeny markers in zfp-1(RNAi) animals Transcripts identified as potential markers of epidermal progenitors were assessed by WISH in zfp-1(RNAi) animals. Knockdown of zfp-1 has previously been shown to selectively ablates epidermal differentiation.

6 RNAi screening identifies mex3-1 as candidate regulator of differentiation

6.1 mex3-1(RNAi) animals display defects typical of impaired stem cell function

Knockdown of genes required for differentiation, such as p53, CHD4, and zfp-1, result in the decline of postmitotic progeny without depletion of ASCs, and subsequent defects in tissue homeostasis and regeneration (Pearson and Sanchez Alvarado, 2010; Scimone et al., 2010;

Wagner et al., 2012). To determine whether any of the 120 candidate genes were regulators of postmitotic fates, I performed functional screening of each gene using RNAi knockdown and first screened for morphological defects, observing RNAi animals during homeostasis as well as regeneration after amputation. If any overt abnormalities were seen, further analysis of stem cell and epidermal progenitor markers with WISH was pursued. In agreement with previous data,

RNAi against prog-1 and prog-2 separately or in combination, did not yield any detectable phenotype (Eisenhoffer et al., 2008). Unexpectedly, none of the new epidermal progenitor markers yielded phenotypes upon knockdown either, suggestive of considerable functional redundancy among these genes. Knockdown of a gene encoding a homolog to the RNA-binding protein MEX3, Smed-mex3-1 (mex3-1) produced phenotypes highly suggestive of defective stem cell lineage progression. mex3-1 RNAi was completely penetrant and lethal, resulting in ventral curling, head regression, and dorsal lesioning during homeostasis, as well as loss of regenerative ability after amputation (Figure 6.1.1), indicative of epidermal turnover defects as well as overall

Figure 6.1.1 mex3-1 is required for tissue homeostasis and regeneration (A) Survival curves of mex3-1(RNAi) animals to determine the optimal RNAi dosage. One RNAi feed was sufficient to produce completely penetrant lethality by 27 days. (B) RNAi worms were observed for homeostatic abnormalities after 1-3 feeds. Time point at which animals were imaged are indicated as x days after z feeds (zfdx) (C) Regenerative ability after injury was tested according to the experimental timeline shown. Trunk fragments after pre- and post-pharyngeal amputations are shown.

stem cell impairment (Bardeen, 1904; Reddien et al., 2005a). Using reciprocal BLAST, two other

MEX3 homologs in S. mediterranea were identified (mex3-2 and mex3-3, transcripts

SmedASXL_000637 and SmedASXL_01505, respectively), which both contained two KH RNA- binding domains and had top reciprocal BLAST hits in mouse, fly, and C. elegans. These additional MEX3 homologs were neither irradiation-sensitive nor produced observable phenotypes after knockdown, and thus not investigated further (Figure 6.1.2).

To begin elucidating the mechanism by which mex3-1 potentially regulates stem cell lineage progression, I sought to determine in which cell populations mex3-1 is expressed. By

RNAseq, mex3-1 showed >5-fold enrichment in the X2 fraction over Xins but also exhibited significant expression in the X1 stem cell fraction (Figure 6.1.3A). WISH analysis in wild-type worms revealed a stem cell-like expression pattern with substantial expression peripheral to the stem cell compartment (Figure 6.1.3B). Following irradiation, progressively more of the pattern

Figure 6.1.2 Identification and analysis of MEX3 homologs in S. mediterranea (A) Phylogenetic analysis of the mex3 gene family in planarians shows that they are likely the results of planarian-specific duplications. A Bayesian phylogeny was run as outlined in the Materials and Methods. Only posterior probabilities 50% and above are shown. S.mediterranea sequences are in red. Multiple mex3 homologs could not be found in individual species of other flatworms. (B) Expression levels of mex3-2 and mex3-3 in RNAseq of FACS-isolated populations and control intact worms. Expression of mex3 homologs by WISH after lethal irradiation (60 Gy) is shown below. (C) Phenotypes of mex3-2 and mex3-3 RNAi animals during homeostasis (upper panel) and during regeneration after amputation (lower panel). Species sequences used in the phylogeny: Smed = Schmidtea mediterranea; S. mansoni = Schistosoma mansoni; Echinococcus = Echinococcus multiloclularis; Aplysia = Aplysia californica; Ci = Ciona intestinalis; Lg = Lottia gigantea; Dm = Drosophila melanogaster; Tc = Tribolium castaneum; Nvit = Nasonia vitripennis; Mm = Mus musculus; Xt = Xenopus tropicalis; Nvect = Nematostella vectensis; Sp = Strongylocentrotus purpuratus.

Figure 6.1.3 mex3-1 is expressed in stem cells and epidermal progenitors (A) Expression levels of mex3-1 in different FACS populations by RNAseq. Error bars show standard deviation. (B) Whole-mount ISH analysis of mex3-1 in intact worms after 60 Gy irradiation. Scale bar, 200 µm. (C) dFISH was performed to examine mex3-1 expression in stem cells and epidermal progenitors. Numbers indicate the percentage of stem cells, early progeny, or late progeny co-expressing mex3-1 (n > 400 cells per dFISH ± standard error). Scale bar, 10 µm.

was lost over the span of a week, consistent with expression in both stem cell and transient postmitotic progeny populations, and also consistent with previous irradiation data for mex3-1

(Solana et al., 2012). Analysis of mex3-1 using dFISH with lineage markers confirmed that mex3-

1 is widely expressed in stem cells, early progeny, and late progeny (Figure 6.1.3C). Therefore, the homeostasis and regeneration defects described above could result from defects in any one or all of these cell populations, which was subsequently tested.

6.2 mex3-1 is required for epidermal progenitor specification

To determine whether lineage progression was disrupted from impaired stem cell maintenance or differentiation after mex3-1 knockdown, WISH analysis was used to follow stem cell, early progeny, and late progeny population dynamics over time following the initiation of

RNAi. Knockdown of mex3-1 lead to a rapid decline of the two progeny populations but not of stem cells, with the majority of progeny gene expression lost by 6 days after RNAi (Figure 6.2.1).

Figure 6.2.1 Knockdown of mex3-1 ablates epidermal progeny but not stem cells Lineage markers labeling stem cells (piwi-1), early progeny (prog-1, prog-2), and late progeny (AGAT-1) progeny were assessed by WISH after one RNAi feed. The day 12 time point reflects the maximal perturbation to progeny markers prior to obvious health decline in the animal. Scale bar, 200 µm.

I assessed the expression of additional newly identified epidermal progenitor markers as well, and observed that all were similarly abolished, supporting the loss of these two progeny types (Figure

6.2.2).

Figure 6.2.2 New epidermal progenitor markers are downregulated after mex3-1 RNAi. WISH analysis of epidermal progeny markers identified in this study in RNAi animals. Scale bar, 200 µm.

The down-regulation of progeny gene expression without corresponding decreases in the stem cell population suggested a selective defect in specifying committed progeny. However, these results could similarly arise from defective maintenance and survival of progeny; thus, levels of apoptosis were measured with TUNEL during phenotypic progression. Quantification of TUNEL showed that mex3-1(RNAi) animals had comparable levels of cell death to control worms up until 9 days after RNAi, but significantly higher levels from 12 days and onward (Figure

6.2.3). Given that progeny gene expression was mostly ablated by 6 days after RNAi, the loss of progeny populations was likely not attributable to progeny cell death. The cause of the late rise in cell death remains unclear, but is coincident with when morphological homeostatic phenotypes begin to manifest and may be a secondary effect of declining animal health.

Figure 6.2.3 mex3-1(RNAi) worms exhibit increased levels of cell death Whole-animal quantification of TUNEL was performed to measure cell death in RNAi animals. Representative stains and time points after one RNAi feed are shown to the right. Scale bars, 200 µm. Error bars are standard deviations. * p<0.05, ** p<0.01, *** p<0.001 (Student's t test).

7 Knockdown of mex3-1 results in expansion of the stem cell compartment

7.1 mex3-1 RNAi does not impede, but increases cell division

I next investigated whether impaired stem cell proliferation was the underlying cause of reduced progeny production, and performed time-course analysis of phosphorylated histone H3 immunolabeling (H3P). I observed significantly increased levels of proliferation in mex3-

1(RNAi) worms at every time point examined (Figure 7.1.1), which suggested that stem cell division was not impeded by mex3-1 knockdown.

Figure 7.1.1 Knockdown of mex3-1 induced hyperproliferation Whole-animal quantification of H3P immunolabeling was performed to assess cell proliferation after RNAi. Representative stains and time points are shown to the right. Unless otherwise noted, all experimental time points are indicated as after a single RNAi feeding. Scale bars, 200 µm. Error bars are standard deviations. * p<0.05, ** p<0.01, *** p<0.001 (Student's t test).

To exclude the possibility that the heightened H3P+ levels in mex3-1(RNAi) worms reflected an accumulation of cells arrested in G2/M phase and an inability to complete the cell cycle, labeling with the thymidine analog F-ara-EdU was used to measure S-phase progression.

Worms pulsed at either 6 or 9 days after RNAi and fixed 24 hours later showed significantly

45 increased numbers of total EdU-labeled cells in mex3-1(RNAi) animals compared to controls at both pulse time-points (Figure 7.1.2), which showed that a greater number of cells were entering the cell cycle over time.

Figure 7.1.2 Cell cycle progression is not halted in mex3-1(RNAi) animals RNAi animals were fed EdU at 1fd6 or 1fd9 timepoints, and quantification of EdU+ cells was performed 24 hours after feeding. Whole-animal single confocal planes in the middle of the dorsoventral axis were used for quantification. Scale bars, 200 µm. * p<0.05(Student's t test).

Worms exposed to sublethal doses of irradiation initially lose the vast majority of their stem cells and immediate postmitotic descendants; over time, the stem cell and progeny populations gradually recover, offering an easily quantifiable approach to assess both self-renewal and differentiation (Wagner et al., 2012). Sublethally-irradiated mex3-1(RNAi) worms expanded piwi-1+ stem cell numbers over time, but produced disproportionately fewer prog-1+ progeny than control worms (Figure 7.1.3). In summary, these data demonstrated that the loss of early and late progeny marker expression after mex3-1 knockdown could not be attributed to stem cell loss, cell cycle arrest, or increased progeny cell death, but rather result from a failure in cell fate specification.

Figure 7.1.3 mex3-1 RNAi abrogates progeny production during stem cell repopulation mex3-1(RNAi) animals were irradiated with a sublethal dose (16.5 Gy), and stem cells (piwi-1) and progeny (prog-1) were quantified by dFISH at 7 and 9 days after irradiation. The proportion of progeny to stem cells between mex3-1(RNAi) and control worms differed significantly (p < 0.001, ANCOVA). Whole-animal confocal projections are shown. Each point on the graph represents one animal.

7.2 Knockdown of mex3-1 expands the stem cell compartment

The loss of early and late progeny fates in mex3-1(RNAi) animals despite ongoing proliferation brought forward the possibility that stem cell lineage asymmetry was biased in favour of stem cell self-renewal. To test this possibility, piwi-1+ stem cells were quantified in pre-pharyngeal transverse cross sections after RNAi. From 6 days after RNAi onward, mex3-

1(RNAi) animals had a significantly increased number of piwi-1+ cells compared to controls

(Figure 7.2.1A). The expansion of piwi-1+ cells after mex3-1 knockdown could either reflect a global increase in all stem cell subclasses, or reflect an increase in a specific subclass (zeta, sigma, or gamma neoblasts) (van Wolfswinkel et al., 2014). To ascertain whether subclasses were selectively affected, I quantified the number of piwi-1+ stem cells belonging to each subclass using dFISH with the following probes: zfp-1 for the zeta subclass; hnf4 for the gamma subclass; and a pooled mix of soxP-1 and soxP-2 for the sigma subclass. Assessment at 12 days after RNAi revealed that all three subclasses were significantly increased by approximately 50% in mex3-

1(RNAi) animals compared to controls (Figure 7.2.1B). Together these results demonstrated that

the failure to produce epidermal progenitors in mex3-1(RNAi) animals was not due to loss of zeta

neoblasts, and furthermore suggested that the expansion of the stem cell pool was due to an

imbalance in cell fates favoring stem cell self-renewal over differentiation.

A B

Figure 7.2.1 mex3-1(RNAi) animals exhibit expansion of the stem cell compartment (A) Stem cells were quantified in pre-pharyngeal cross sections of intact worms after RNAi by piwi-1 FISH during phenotypic progression. Single confocal planes at 1fd9 are shown; dorsal, top. (B) Quantification of stem cell subclasses in intact worms at 1fd12. Stem cell subclass were determined by piwi-1 labeling and expression of soxP-1 pooled with soxP-2 (sigma subclass), hnf4 (gamma), or zfp-1 (zeta). Diagrams indicate areas of worms quantified, and arrows indicate example double-positive cells. Scale bars, 200 µm in (A) and 50μm in (B). Error bars represent standard deviation. * p<0.05, ** p<0.01, *** p<0.001 (Student's t test).

8 mex3-1 is broadly required for differentiation

8.1 Epidermal regeneration and homeostatic turnover requires mex3-1

The ventral curling defect during homeostasis and ablation of all early and late progeny markers

in mex3-1(RNAi) worms suggested that epidermal turnover was compromised. Pulse-chase

analysis with EdU in RNAi animals showed that 7 days following EdU administration, EdU+ cells

were present in the epidermis of control(RNAi) worms but virtually none had been incorporated

into the epidermis in mex3-1(RNAi) animals (Figure 8.1A). Using FISH analysis of epidermal

progenitor and mature epidermal genes on RNAi animals during regeneration, I observed that

mex3-1(RNAi) worms failed to regenerate any epidermis after amputation (Figure 8.1B). These

48 data demonstrate that during both homeostasis and regeneration, mex3-1 is required for specification and differentiation of epidermal cell types.

Figure 8.1 mex3-1 is required for epidermal turnover and regeneration (A) RNAi animals were administered EdU at 1fd6, and EdU+ cells in the epidermis was quantified after a 7 day chase. Single confocal planes are shown, with EdU+ epidermal cells indicated by arrows. Top panel scale bar, 100 µm; bottom panel scale bar, 50 µm. (B) RNAi animals were amputated at 1fd7 and analyzed at 7 days post-amputation by dFISH for stem cells and epidermal markers. Single confocal planes or projections of head blastemas are shown, with anterior to the left. Dotted lines indicate animal boundary. Scale bar, 100 µm. Error bars represent standard deviation. * p<0.05 (Student's t test).

8.2 mex3-1 is required for differentiation for multiple lineages

Previously, it was shown that selective depletion of zeta neoblasts and epidermal differentiation through zfp-1 RNAi does not prevent regeneration of a blastema containing other differentiated tissues such as brain, protonephridia, intestine, and muscle (van Wolfswinkel et al., 2014). Given that mex3-1(RNAi) animals were unable to produce any regenerative blastema, I hypothesized that mex3-1 may have a crucial role in the broad specification of multiple lineages. To examine this possibility, I assessed mex3-1(RNAi) worms for changes in the number of lineage-specified neoblast progeny for other tissue types. As PIWI-1 protein persists in immediate postmitotic stem cell descendants, co-localization of PIWI-1 with tissue-specific markers was used to identify differentiating progeny. The neural genes, chat and coe, eye-specific transcription factor ovo,

Figure 8.2.1 Knockdown of mex3-1 reduces production of tissue-specified progenitors Lineage-restricted progeny populations were quantified at 1fd12 in intact worms, using PIWI-1 immunolabeling and FISH for ovo (eyes), chat or coe (brain), FoxA (pharynx), and six1/2-2 (protonephridia). Single confocal planes are shown. Arrows indicate example double-positive cells. Magnified areas are indicated by dashed boxes and inset to the right of each image. Scale bar, 50 µm. Error bars represent standard deviation. * p<0.05, ** p<0.01, *** p<0.001 (Student's t test).

pharyngeal marker FoxA, and protonephridial marker six1/2-2 were used as markers to indicate differentiation toward their respective tissues (Adler et al., 2014; Cowles et al., 2013; Lapan and

Reddien, 2012; Scimone et al., 2011; Wagner et al., 2011). Quantification of lineage-restricted neoblast progeny in intact mex3-1(RNAi) worms 12 days after RNAi showed that all cell types were significantly reduced compared to controls (Figure 8.2.1). Intriguingly, virtually all chat+PIWI-1+ cells expressed mex3-1 (Figure 8.2.2), suggesting a direct role for mex3-1 in regulating differentiation outside the epidermal lineage.

Figure 8.2.2 mex3-1 is expressed in neural-specified progenitors mex3-1 and chat dFISH with PIWI-1 immunolabeling. Percentage of chat+PIWI-1+ cells which express mex3-1 is indicated at top-right. Arrows indicate example triple-labeled cells. Dashed box indicates area of magnified panels. Left scale bar, 50 µm; right scale bar, 10 µm.

Concordant with decreased production of lineage-restricted neoblast progeny, it was observed that

5 days following labeling with BrdU, the entry of new cells into brain, intestine, and pharynx was

significantly decreased in mex3-1(RNAi) animals (Figure 8.2.3). These data demonstrate that the

diminished capacity of mex3-1(RNAi) animals to produce differentiated progeny is not specific to

the epidermal lineage, but is characteristic of multiple lineages in planarians.

Figure 8.2.3 mex3-1 RNAi reduces differentiation of multiple tissues BrdU was fed at 1fd6 and examined after a 5 day chase. (A) A large reduction in BrdU labeling in the brain is evident in mex3-1(RNAi) animals compared to controls. (B) Quantification of BrdU incorporation in differentiated tissues with the markers: chat, brain; mat, gut; laminin, pharynx. Arrowheads indicate example double-positive cells. Scale bar, 50 µm. All images are of single confocal planes. Error bars represent standard deviation. * p<0.05, ** p<0.01 (Student's t test).

8.3 mex3-1 has a broader role than p53 in neoblast differentiation

I examined whether impaired differentiation toward multiple tissues could be observed in p53(RNAi) animals as well, as p53 knockdown has previously been shown to deplete prog-1+ progeny and increase stem cell proliferation (Pearson and Sanchez Alvarado, 2010). I found that knockdown of p53 did not alter the numbers of ovo+ eye- or chat+ brain-specified neoblast progeny (Figure 8.3.1), demonstrating a broader role for mex3-1 in differentiation.

Figure 8.3.1 p53 RNAi reduces epidermal progenitors but not eye or brain (A) WISH analysis of stem cells and early progeny in RNAi animals. Scale bar, 200 µm. (B) Eye and neural lineage-restricted neoblast progeny were quantified in RNAi animals by FISH (ovo, eye; chat, brain) with PIWI-1 immunolabeling. Arrows indicate example double-positive cells. Scale bars, 50 µm.

As a measure of whether mex3-1 knockdown resulted in a global impediment in generating postmitotic cells, I used quantification of piwi-1+PIWI-1+ and piwi-1-PIWI-1+ cells to examine the balance between stem cells and postmitotic descendants. I found that mex3-1 RNAi resulted in a significant increase in the number of piwi-1+PIWI-1+ cells and simultaneous decrease in piwi-

1-PIWI-1+ cells compared to controls (Figure 8.3.2), supporting a general reduction in the ability of stem cells to progress to a postmitotic state. From these data demonstrating abrogated production of lineage-restricted stem cell progeny, impaired contribution to the turnover of multiple tissue types, and concomitant increases in all known stem cell subclasses, I propose that mex3-1 is a critical regulator for all differentiating progeny, mediating the adoption of a non-stem cell fate.

Figure 8.3.2 mex3-1 knockdown shifts the balance between stem cells and postmitotic descendants Quantifications of stem cells (piwi-1+PIWI-1+) and immediate postmitotic descendants (piwi-1- PIWI-1+) were performed at 1fd6, in head, pre-pharyngeal, and tail regions. Shown are single confocal planes from the tail region. Magnified areas are indicated by dashed boxes The proportion of postmitotic descendants to stem cells between mex3-1(RNAi) and control worms differed significantly (p < 0.001, non-linear regression analysis). Scale bar, 50 µm on left panels, 10 µm on right panels.

9 RNAseq of mex3-1(RNAi) animals identifies progenitor transcripts

9.1 Transcriptional profiling of mex3-1(RNAi) animals

RNAseq of mex3-1(RNAi) whole animals 12 days after RNAi was performed to provide a broad and comprehensive overview of gene expression changes. Given that mex3-1 RNAi specifically eliminates postmitotic progeny fates, it was hypothesized that this approach may offer a more selective method than X2-FACS enrichment in order to identify additional progenitor- specific transcripts both within and outside the epidermal lineage.

Figure 9.1.1 RNAseq analysis of mex3-1(RNAi) animals (A) RNAseq was performed on RNAi animals at 1fd12, and X1 enrichment is compared to fold change after mex3-1 knockdown. Each grey dot represents one transcript. Established stem cell which were found to be significantly upregulated in mex3-1(RNAi), are highlighted in blue (p < 0.01). The fold changes of a subset of known stem cell genes (involved in proliferation, pan-stem cell gene, or subclass identity) are shown on the right. (B) WISH analysis of PCNA and h2b in mex3-1(RNAi) worms at 1fd6. Scale bars, 200 µm.

In agreement with the data demonstrating hyperproliferation and expansion of the entire stem cell compartment after mex3-1 knockdown, 13 of 59 stem cell-specific transcripts examined were significantly upregulated upon knockdown of mex3-1 (p<0.01, Figure 9.1.1A). These included cell cycle genes, two of which were further confirmed by WISH (Figure 9.1.1B). Importantly, mex3-1(RNAi) worms showed 1.68, 1.59, 1.47-fold increases in soxP-1, zfp-1, and piwi-1 transcript levels, respectively, concordant with the increase in stem cell subclasses observed by cell number quantification.

As anticipated from the effects of mex3-1(RNAi) on the loss of epidermal progeny, all but two of the new early and late progeny markers were downregulated in the RNAseq dataset compared to controls (Figure 9.1.2). A lack of significant downregulation of two genes (soxP-3 and RPC-2) is likely due to expression in stem cells as well as early progeny. Together, the

RNAseq data corroborates the in vivo cell type analyses, where mex3-1 was required to restrict the stem cell compartment and promote differentiation of progenitor fates.

Figure 9.1.2 Comparison of fold change after mex3-1 knockdown to X2 enrichment over irradiated samples Established and new progeny markers identified in this work are indicated. Top uncharacterized mex3-1 downregulated transcripts cloned out for WISH analysis are indicated as well.

9.2 Downregulated genes in mex3-1(RNAi) animals are markers of progenitors

To explore whether transcripts down-regulated following mex3-1 RNAi mark novel progenitor cell types, I chose 21 down-regulated and uncharacterized transcripts for validation by

WISH. By RNAseq, all were irradiation-sensitive but not X2-enriched (Figure 9.1.2), and thus could be classified as WThighXlow. I found that 20/21 transcripts produced a prog/AGAT-like pattern, and exhibited severely reduced expression after mex3-1 knockdown, as anticipated from

RNAseq (Figure 9.2.1, 9.2.2). The remaining transcript, SmedASXL_059179, was highly expressed near the proximal end of the pharynx, in a subset of cells through the pharynx proper, and was similarly dependent on mex3-1 for its expression (Figure 9.2.1).

Figure 9.2.1 Expression patterns of mex3-1(RNAi) downregulated genes WISH was carried out on RNAi animals at 1fd12. Genes were named based on the best BLASTx result to mouse when the Expect value < 1 × e-5, or based on transcript number if no homology was found. Scale bars, 200 µm.

Figure 9.2.2 Expression patterns of additional mex3-1(RNAi) downregulated genes WISH was carried out on RNAi animals at 1fd12. Genes were named based on the best BLASTx result to mouse when the Expect value < 1 × e-5, or based on transcript number if no homology was found. Scale bars, 200 µm.

Three transcripts were confirmed to be irradiation-sensitive by whole-mount ISH (Figure 9.2.3A), and two of these were verified to be additional late progeny markers based on their high degree of co-localization with AGAT-1 expression (Figure 9.2.3B).

Figure 9.2.3 mex3-1 downregulated genes mark progenitor populations (A) Expression of three genes downregulated after mex3-1 RNAi was assessed in lethally irradiated worms by WISH. Scale bar, 200 µm. (B) Expression of two mex3-1(RNAi) downregulated genes in late progeny was examined by dFISH with AGAT-1. Co-expression is indicated as percentages of AGAT-1+ cells. Images shown are confocal projections spanning 4 µm in depth. Scale bar, 100 µm.

I predicted that SmedASXL_059179+ cells may represent a pharyngeal progenitor cell type, and indeed, SmedASXL_059179+ cells near the proximal base of the pharynx were PIWI-1+

(Figure 9.2.4A). However, no regulatory roles were uncovered for this gene, as RNAi against

SmedASXL_059179 did not result in apparent perturbations to pharynx function during homeostasis or regeneration (Figure 9.2.4B,C). Overall, these results further support a role for mex3-1 as a critical regulator of differentiation toward multiple lineages, and also demonstrate the utility of transcriptional analysis of mex3-1(RNAi) in identifying additional markers of tissue- specific progenitor populations, as an alternative to the criteria of irradiation-sensitivity and FACS localization.

A B C

Figure 9.2.4 Characterization of new pharyngeal progenitor marker (A) Assessment of the mex3-1(RNAi) downregulated transcript Smed_ASXL059179 as a marker for a novel pharynx progenitor cell type using FISH and PIWI-1 immunolabeling. Confocal projections in control and mex3-1 RNAi animals are shown. Error bars represent standard deviation. Scale bar, 50µm. ** p<0.01 (Student’s t-test). (B) Expression of SmedASXL_059179 after knockdown was examined by WISH. Scale bar, 200 µm. (C) Pharynx regeneration was assessed in tail fragments of RNAi animals, with WISH analysis of the mature pharynx marker laminin. Scale bar, 200 µm.

10 Materials and Methods

10.1 RNAsesq

Previously, RNAseq of FACS-sorted X1 and X2 cells, and irradiated whole animals, was

performed, where the X2 cell fraction was sequenced to a depth of 206 million reads in 2

biological replicates (Labbe et al., 2012). Here an additional replicate was performed using cells

isolated as previously described (Hayashi et al., 2006; Pearson and Sanchez Alvarado, 2010).

Approximately 1 million X2 cells from 100 animals were isolated on a Becton-Dickinson

FACSaria over multiple sorts. Total RNA was purified and poly-A selected cDNA libraries were

prepped using the TruSeq kits from Illumina. This new X2 sample was multiplexed together with

a new X1 and Irradiated control and each was sequenced to a depth of >63 million single-end 50

base pair reads on an Illumina HiSeq2500 with v4 chemistry. Raw sequence data was uploaded

59 to NCBI GEO under accession number GSE68581. Each sample was aligned to the transcriptome under NCBI BioProject PRJNA215411 using Bowtie2 with no sequence trimming. Mapped reads per million reads (CPM) of each transcript was calculated. Note that kilobase-length of each transcript was not taken into account because in any expression ratio, the length scaling factor cancels out and no inter-transcript comparisons were performed here. To ensure a well-defined statistic in the calculation of fold-change, pseudocounts of +1 were added to every numerator and denominator as a way to not bias differentially-expressed genes to lowly expressed transcripts

(Klattenhoff et al., 2013). The transcripts listed in Supplementary Tables 1-4 can be found in the same transcriptome database. The heatmap was created using the Partek Genomics Suite of software (www.partek.com) with the unsupervised hierarchical clustering algorithm: Pearson's

Absolute Value Dissimilarity. Wild-type transcript levels were averaged from 12 replicates of control(RNAi) and WT experiments and time points using over 700 million sequencing reads

(Currie and Pearson, 2013; Labbe et al., 2012; Lin and Pearson, 2014; Solana et al., 2012; Zhu and Pearson, 2013).

10.2 Analysis of RNAseq data

In order to validate the consistency of the previous and new RNAseq replicates, Pearson correlations were performed with our own data as well as all previously published RNAseq relevant to the current study using reads per million (CPM) for each transcript with CPM < 1000

(Figure 1-figure supplement 1) (Labbe et al., 2012; Onal et al., 2012; Resch et al., 2012; Solana et al., 2012). The program DESeq was used to determine significantly enriched transcripts in the

X2 (FDR < 0.01) or X1 (FDR < 0.001) cell fractions versus irradiated whole animals using the 3 biological replicates for each tissue type. MA plots, Pearson correlations, and log fold change plots were made using R.

10.3 Phylogenetics and cloning

Transcripts identified by differential expression were cloned using forward and reverse primers into a double-stranded RNA expression vector as previously described (Rink et al., 2009).

Riboprobes were made from PCR templates from the same vector (pT4P) (Pearson et al., 2009).

The 3 MEX3 homologs in S. mediterranea were identified with tBLASTn searches of the planarian genome/transcriptomes using MEX3 protein sequences from C. elegans and mouse.

Candidate planarian MEX3 homologs were validated by reciprocal BLASTx against the nr database (NCBI). The predicted proteins of the planarian MEX3 homologs were aligned using the program T-coffee along with MEX3 homologs from other species (Notredame et al., 2000).

The program Geneious (www.geneious.com) was used to run a Bayesian phylogeny using the

MrBayes plugin with the following settings: a WAG substitution model, 25% burnin, subsample frequency of 1000, 1 million replicates, and 4 heated chains (Ronquist and Huelsenbeck, 2003).

The transcripts for mex3-1 and all new progeny markers from this manuscript are listed in

Supplementary Table 2.

10.4 Animal husbandry and RNAi

Asexual Schmidtea mediterranea CIW4 strain were reared as previously described

(Sánchez Alvarado et al., 2002). RNAi experiments were performed using previously described expression constructs and HT115 bacteria (Newmark et al., 2003b). Briefly, bacteria were grown to an O.D.600 of 0.8 and induced with 1mM IPTG for 2 hours. Bacteria were pelleted and mixed with liver paste at a ratio of 500µl of liver per 150ml of original culture volume. Bacterial pellets were thoroughly mixed into the liver paste and frozen as aliquots. The negative control RNAi was to the unc22 sequence from C. elegans as previously described (Reddien et al., 2005a). For

61 the screening of all genes in this study, RNAi food was fed to 7-day starved experimental worms every third day for 5 feedings. Subsequent functional analyses for mex3-1 were performed with

1 feed unless noted otherwise. Time points in figures denote the number of feeds for each gene as well as the number of days after the last feed. For example, 1fd12 corresponds to 1 RNAi feeding and 12 days after that feeding. Amputations were performed 6 days after the final feeding unless noted otherwise. All animals used for immunostaining were 3-4 mm in length and size- matched between experimental and control worms.

10.5 Immunolabeling, TUNEL, EdU, BrdU, irradiation, and in situ hybridization (ISH)

ISH, double fluorescent ISH (dFISH), and immunostaining were performed as previously described (Cowles et al., 2013; Currie and Pearson, 2013; Lauter et al., 2011; Pearson et al., 2009).

Colorimetric ISH and fluorescent phospho-histone H3 (H3P) stains were imaged on a Leica M165 fluorescent dissecting microscope. The rabbit monoclonal antibody to H3ser10p from Millipore

(04-817) was used for all cell division assays (Newmark and Sanchez Alvarado, 2000). TUNEL was performed as previously described (Pellettieri and Alvarado, 2007). Mouse anti-PIWI-1 (gift of Dr. Jochen Rink (Wagner et al., 2011)) was used at 1:1000. H3ser10p and TUNEL were quantified using freely available ImageJ software (http://rsb.info.nih.gov/ij/). Significance was determined by a 2-tailed Student’s t-test unless otherwise noted. All experiments were, at minimum, performed in triplicate with at least 10 worms per stain and per time point (i.e. n > 30).

For irradiation experiments, planarians were exposed to 16.5 or 60 Gray (Gy) of γ-irradiation from a 137Cs source. F-ara-EdU was fed to worms in liver paste at a concentration of 0.05 mg/ml for a 7-day chase (fed at 1fd6) or 0.5 mg/ml for a 24 hour chase (fed at 1fd6 and 1fd9) and stained as previously described following the normal fixation for ISH (Neef and Luedtke, 2011; Pearson

62 et al., 2009). BrdU was fed (at 1fd6) in liver paste at a concentration of 10 mg/mL, and stained as previously described (van Wolfswinkel et al., 2014). Confocal images were acquired on a

Leica DMIRE2 inverted fluorescence microscope with a Hamamatsu Back-Thinned EM-CCD camera and spinning disc confocal scan head, and stitched together for whole-animal images.

Images were post-processed in Adobe Photoshop and figures assembled in Macromedia Freehand.

Chapter 3 Smed-myb-1 specifies the early temporal identity during planarian epidermal differentiation

Understanding the regulatory networks that orchestrate how ASCs adopt different cell fates is an integral facet in ageing, tumorigenesis, and regenerative medicine research. Upon cell division, a daughter cell may preserve stem cell identity or undergo lineage commitment and differentiation to produce physiologically functional cell types. Aberrations in the balance of these two fates can result in hypo- or hyper-proliferative pathological states (Fuchs and Chen, 2013).

The freshwater planarian, S. mediterranea, has been established as model to study ASC cell fate decision-making in vivo. These free-living, constitutive adults possess a large, highly active pool of ASCs called neoblasts, which are collectively pluripotent (Wagner et al., 2011). As the only mitotic cell type, neoblasts support the astonishing regenerative abilities of planarians and the constant homeostatic cell turnover of all their tissues (Reddien and Sanchez Alvarado, 2004).

Previously, I sought to identify cell fate regulators which promoted differentiation over retaining stem cell identity (Zhu et al., 2015). RNAseq was performed on flow cytometry-isolated cells to identify and functionally screen genes differentially expressed in the progeny-enriched cell population. This approach was borne from the hypothesis that genes with enriched expression in progeny may harbour regulators that participate to specify the progeny fate. In this chapter, I report the identification of a MYB-type transcription factor (Smed-myb-1) as a key regulator of the temporal phase of early progenitor specification during epidermal lineage development.

Knockdown of myb-1 resulted in a selective loss of the early progeny fate, causing neoblast progeny directly and prematurely to adopt the late progeny transcriptional profile. From that point, progenitors resumed differentiation, resulting in a heterochronic temporal shift of the lineage and

64 a shortened progression into mature epidermal fates. MYB transcription factors have been found to regulate differentiation in multiple stem cell systems, including mammalian hematopoiesis

(Greig et al., 2008). This study extends our understanding of the evolutionary conservation of

MYB genes in progenitor regulation, while simultaneously revealing unexpectedly high plasticity of planarian epidermal lineage progression.

11 RNAi screening identifies a role for Smed-myb-1 in specification during epidermal differentiation

11.1 Knockdown of myb-1 ablates early progeny

RNAi screening of transcripts upregulated in a progeny-enriched population was performed to identify genes which regulate stem cell differentiation. Genes that yielded morphological phenotypes upon knockdown were investigated by whole-mount in situ hybridization (WISH) analysis using the stem cell marker piwi-1, and the epidermal progenitor markers prog-1 and AGAT-1 as indicators of stem cell output. My aim was to discern between stem cell maintenance versus differentiation defects: the former would manifest as downregulation of both stem cell and progeny genes, while the latter would exhibit selective dysregulation of progeny genes. One of the hits from the screen was a putative transcription factor containing a MYB-type DNA binding domain (Smed-myb-1) (Figure 11.1.1A). Knockdown of myb-1 did not generate severe abnormalities during homeostasis, but resulted in aberrant regeneration after amputation, with smaller blastemas and a high incidence of cyclopic or bridged eyespots (17/30 trunk fragments, 29/30 tail fragments; Figure 11.1.1B). WISH analysis at 3 days after the third feed (3fd3) revealed that myb-1 RNAi ablated expression of the early progenitor marker prog-1, while the late progenitor marker AGAT-1 showed only a mild reduction in staining, attributable to decreased cell numbers (Figure 11.1.1C, 11.1.2). Expression of piwi-1

65 was similar between control(RNAi) and myb-1(RNAi) animals, suggestive of a bona fide defect in differentiation.

Figure 11.1.1 myb-1 is a regulator of epidermal lineage specification (A) A MYB-type DNA binding domain was identified through conserved domain analysis of the translated sequence of Smed-myb-1 (accession: pfam13837, E-value=1.46e-06). (B) Left panel, homeostatic at 3fd7. Right, trunk fragments of worms amputated pre- and post-pharyngeally at 3fd3, and imaged at the indicated time points (days post amputation). Amputation sites indicated by white arrowheads. (C) WISH analysis of stem cells, early progeny, and late progeny after RNAi. Scale bars, 200 µm.

11.2 myb-1 is expressed during epidermal lineage development

WISH of myb-1 in wild-type and irradiated worms revealed widespread irradiation- sensitive expression, suggesting myb-1 was partly expressed in stem cell and/or progeny compartments (Figure 11.2A). Double fluorescent in situ hybridization (dFISH) of myb-1

Figure 11.1.2 myb-1 RNAi reduces the number of late progeny cells Quantification of AGAT-1+ cells was carried out in the head, posterior to the eyespots. ***, p- value<0.001 (Student's t test).

combined with markers of different stages of epidermal development (stem cell marker piwi-1; early progeny marker prog-1; late progeny marker AGAT-1; later progeny marker zpuf-6; epidermal marker vim-1) showed myb-1 expression in the majority of neoblasts and virtually all early and late progeny, with decreasing expression in later progeny, and very low expression in the epidermis (Figure 11.2B). myb-1 expression was also examined in a previously published single-cell sequencing dataset (Wurtzel et al., 2015), which showed expression of myb-1 in the epidermal lineage and neoblast pool, as well as the gut (Figure 11.2C).

Figure 11.2 Expression analysis of myb-1 shows expression during epidermal differentiation (A) WISH of myb-1 in wild-type worms and lethally-irradiated worms (60 Gy) at 7 days post irradiation (dpi). Scale bar, 200 µm. (B) dFISH of myb-1 combined with stem cell and epidermal lineage markers. Quantification of co-localization was performed in the dorsal head region, and expressed as the percentage of stem cells, progenitors, or vim-1+ epidermal cells that co-express myb-1 (n>400 cells per dFISH ± standard deviation). Single confocal planes are shown. Scale bar, 10 µm. (C) Examination of cell type-specific expression of myb-1 using a previously published single cell RNAseq dataset (Wurtzel et al. 2015). myb-1 expression overlaid on a t- distributed stochastic neighbour embedding (tSNE) plot of single cells (dots; low to high expression is indicated by a gradient of blue to red). Cluster labels were previously determined using known markers.

11.3 RNAi of myb-1 does not impair neoblast maintenance or progeny survival

To definitively resolve whether early progenitor loss was specifically a failure of differentiation, I investigated whether deficiencies in stem cell function were responsible.

Quantification of piwi-1+ cells in cross-sections showed myb-1(RNAi) animals had similar numbers of neoblasts compared to controls (Figure 11.3.1), precluding diminished stem cell maintenance as the primary phenotype. The lack of significant expansion to the neoblast pool also ruled out retention of stem cell identity at the expense of differentiation, as observed in previous studies (Pearson and Sanchez Alvarado, 2010; Zhu et al., 2015).

Figure 11.3.1 myb-1 RNAi does not expand the stem cell compartment piwi-1+ cells were quantified in pre-pharyngeal cross sections at the indicated timepoints after RNAi. Single confocal planes are shown. Scale bar, 200 µm.

Immunostaining against phosphorylated histone 3 (H3P), a marker of mitosis, showed that neoblast proliferation was not impaired in myb-1(RNAi) animals, and in fact was significantly increased compared to controls over 18 days post-RNAi (Figure 11.3.2).

Figure 11.3.2 myb-1(RNAi) exhibit hyperproliferation Cell proliferation after RNAi was assessed by whole-animal quantification of H3P+ immunolabelling. Representative images from the time point of maximal difference between control(RNAi) and myb-1(RNAi) animals are shown. *, p-value<0.05; **, p-value<0.01, ***, p- value<0.001 (Student's t test). Scale bars, 200 µm.

zfp-1 is one of the defining genes for the zeta subclass of neoblasts, and loss of the subclass through zfp-1 RNAi is sufficient to halt epidermal lineage production (van Wolfswinkel et al.

2014). To determine whether specification of zeta-neoblasts was impaired after myb-1 RNAi, I quantified zfp-1+piwi-1+ cells at 3fd6. hnf4+piwi-1+ gamma neoblasts, proposed to be specialized for the gut lineages (van Wolfswinkel et al., 2014), were also examined as a control. I found both subclasses were present after myb-1 knockdown (Figure 11.3.3), and furthermore, myb-1(RNAi) animals showed a significantly increased proportion of zfp-1+ neoblasts, indicating that impaired zeta neoblast specification was not underlying loss of early progenitors.

Figure 11.3.3 myb-1 RNAi does not reduce zeta subclass specification Neoblast subclasses were quantified in the dorsal head region of RNAi animals at 3fd6 by piwi-1 dFISH with zfp-1 (zeta) or hnf4 (gamma). *, p-value<0.05 (Student's t test). Scale bars, 20 µm.

To determine whether early progenitors were being generated but undergoing apoptosis,

TUNEL was quantified over time. No increases in apoptotic cells were observed following myb-

1 RNAi (Figure 11.3.4), suggesting that the viability of stem cell descendants was not compromised. Overall, these results suggested that myb-1 acts to specifically regulate the differentiation of early epidermal progenitors, a role that occurs downstream of zeta neoblast specification.

Figure 11.3.4 myb-1 RNAi does not increase apoptosis Cell death after RNAi treatment was measured through whole-animal quantification of TUNEL. Scale bar, 200 µm.

12 Epidermal lineage progression does not require early progeny genes

12.1 myb-1 RNAi selectively downregulates early progeny markers

The persistence of late progeny in myb-1(RNAi) animals was surprising, as late progeny are thought to derive from differentiation of early progeny, and loss of both are observed in impaired epidermal differentiation (Pearson and Sanchez Alvarado, 2010; van Wolfswinkel et al.,

2014; Zhu et al., 2015). Secondly, the lack of severe abnormalities in the epidermis was unusual, as impaired epidermal differentiation typically manifests with lesions and or ventral curling. I examined myb-1 transcript levels by quantitative PCR after RNAi to verify gene knockdown.

With the 3-feed RNAi dosage used, a 16-fold reduction in myb-1 transcript levels at 3fd6 was observed (Figure 12.1.1A). If a 7-feed regimen was implemented, morphological problems began to manifest with ventral curling only in the tail at 7fd10 (40 days after initial RNAi) (Figure

12.1.1B). This was accompanied by depletion of piwi-1 and AGAT-1 expression, predominantly in the posterior half of animals. In worms without tail curling, posterior loss of AGAT-1 expression was not seen.

Figure 12.1.1 Analysis of myb-1 RNAi potency and long-term knockdown (A) Quantification of myb-1 transcript levels after RNAi was measured through qPCR on RNA harvested from whole RNAi animals under homeostatic conditions at 3fd6. *, p-value<0.05 (Student’s t-test). (B) RNAi animals were observed for homeostatic morphological abnormalities during extended RNAi feeding schedules. Abnormalities manifested after a minimum of 7 RNAi feeds. WISH of lineage markers labelling stem cells (piwi-1), early progeny (prog-1), and late progeny (AGAT-1) in animals at 7fd10 when morphological abnormalities were detected.

I also examined reduced feedings to determine the minimal RNAi dosage needed to downregulate early progeny gene expression. I observed that even a single RNAi feed was sufficient to abolish prog-1 expression, a rapid effect seen 3 days after RNAi, and persisted to 20 days after the single dose (Figure 12.1.2). These experiments demonstrated that AGAT-1 expression continued more than a month after prog-1 expression was lost, a timespan sufficient to allow multiple rounds of epidermal maturation, and suggested loss of AGAT-1+ cells only occurred when stem cell maintenance failed. The length of time between stem cell loss and early progeny loss suggested that these were largely independent aspects of the myb-1(RNAi) phenotype. To focus on the role of myb-1 in epidermal differentiation, all further experiments proceeded with the 3-feed dosage unless stated otherwise.

Figure 12.1.2 One RNAi feed is sufficient to ablate early progeny gene expression WISH of lineage markers in animals on a one-feed RNAi schedule. Scale bars, 200 µm.

RNAi of soxP-3 or pax-2/5/8 downregulates a subset of early progeny markers, and the cells remain and are able to progress to the late progeny phase (Cheng et al., 2018). To determine whether a similar phenomenon was occurring after myb-1 RNAi, additional markers of the two temporal phases were examined by WISH at 3fd6. I observed a drastic reduction in the expression of all early progeny markers analyzed to undetectable levels, including soxP-3, which suggested that the early progeny cells were truly ablated, while late progeny marker expression persisted

(Figure 12.1.3A). Examination of the later progeny marker prog-1B revealed the last epidermal transition state was also present in myb-1(RNAi) worms (Figure 12.1.3A). Additionally, whole- animal RNAseq was executed on RNAi animals at the same timepoint. In agreement with the

WISH analyses, all previously identified early progeny markers (without high levels of stem cell expression) were severely downregulated in myb-1(RNAi) worms compared to controls (Figure

12.1.3B), giving confidence that the progenitor state was lost and dynamics of prog-1 expression were representative of the status of that cell fate.

Figure 12.1.3 myb-1 RNAi selectively downregulates early progeny genes (A) WISH analysis of stem cells and epidermal progenitor populations after RNAi. Scale bars, 200 µm. (B) Transcriptional analysis of myb-1(RNAi) animals at 3fd6 by whole-worm RNAseq. Individual transcripts are represented by a dot, and previously established early and late progeny markers are highlighted.

12.2 myb-1(RNAi) animals regenerate late progeny, later progeny, and epidermis

The persistence of late and later progeny gene expression raised the possibility that these progenitor populations were not undergoing turnover or further maturation, and lineage progression was stalled. To explore this scenario, the ability of myb-1(RNAi) animals to regenerate new progenitors after amputation was assayed with WISH analysis of blastemas. I did not observe injury-induced restoration of early progeny expression (Figure 12.2A). Inspection of other epidermal lineage markers showed myb-1(RNAi) animals were capable of regenerating both late and later progeny, as well as fully differentiated epidermis (Figure 12.2A,B). I noted that reductions in late progenitor cell numbers were seen during homeostasis, regeneration, and

RNAseq, which suggested that progression toward these cell fates was not wholly normal following myb-1 knockdown, but nonetheless, epidermal lineage development could progress without the existence of the early progeny state.

Figure 12.2 Knockdown of myb-1 does not abrogate epidermal regeneration (A) Examination of stem cell, early progeny, and late progeny markers by WISH in regenerating trunk fragments in RNAi worms. Animals were amputated pre- and post-pharyngeally at 3fd3, and fixed at 3 and 7 dpa. Scale bar, 200 µm. (B) Analysis of later progeny markers and epidermal markers by FISH in regenerative blastemas of RNAi worms at 5 dpa. Anterior edge of new tissue is demarcated by a white dotted line. Scale bar, 100 µm.

13 Epidermal differentiation is accelerated after myb-1 RNAi

13.1 Stem cell descendants enter late progeny, later progeny, and epidermis earlier after myb-1 knockdown

The possibility that pre-existing epidermal progenitors and differentiated epidermal cells had merely migrated into myb-1(RNAi) blastemas remained open, as epidermal cell spreading is the initial response to cover wounds (Morita and Best, 1974). To definitively establish epidermal turnover after myb-1 knockdown, pulse-chase analyses with the thymidine-analog bromodeoxyuridine (BrdU) were performed. I first assessed BrdU incorporation into the stem cell compartment by quantifying BrdU+piwi-1+ cells. I observed no significant differences between myb-1(RNAi) and control(RNAi) animals: 24 hours following BrdU delivery, the majority (>80%) of BrdU-labelled cells were piwi-1+, and by 48 hours, the percentages decreased to 30-40%, showing that a comparable fraction of labelled cells had exited the piwi-1+ population under both RNAi conditions (Figure 13.1.1). These results demonstrated that myb-1 RNAi did not render post-mitotic populations proliferative nor prevent stem cell differentiation.

Figure 13.1.1 BrdU labelling of stem cells after RNAi RNAi animals were administered BrdU at 3fd4, and BrdU+ labeling in piwi-1+ cells were quantified in the dorsal head region after 24 and 48 hours. Single confocal planes shown. Scale bars 20 µm.

Quantification of BrdU+AGAT-1+ and BrdU+zpuf-6+ cells over time revealed epidermal progenitors of both stages were actively generated, and unexpectedly, BrdU labeling in these populations occurred significantly earlier upon myb-1 knockdown. myb-1(RNAi) animals exhibited maximal labeling of BrdU+ in late progeny at 2 days post-BrdU, whereas maximal BrdU detection occurred at 7 days in control(RNAi) animals (Figure 13.1.2A). Similarly in later progeny, maximal BrdU labeling was observed after a 3 day chase in myb-1(RNAi) worms, whereas control(RNAi) animals displayed heightened labeling from 7 days post-BrdU (Figure

13.1.2B). Examination of BrdU incorporation into the epidermis showed that BrdU+ cells were detectable in the epidermis of myb-1(RNAi) animals after a 4 day chase (Figure 13.1.2C), which

Figure 13.1.2 myb-1(RNAi) animals exhibit accelerated epidermal lineage progression. (A) Generation of late progeny cells was examined by AGAT-1 FISH and BrdU labeling. RNAi animals were fed BrdU at 3fd4 and fixed at the indicated time points, and double-positive cells were quantified. (B) Pulse-chase analysis of BrdU into the zpuf-6+ later progeny population. Quantification of BrdU-labeled cells was performed in the subepidermal domain of zpuf-6 expression. (C) Quantification of BrdU-labeled cells in the epidermis in RNAi animals. All quantifications were performed in the dorsal head region, and images shown are single confocal planes. *, p-value<0.05; **, p-value<0.01, ***, p-value<0.001 (Student's t test). Scale bars, 20 µm in (A, B), 50 µm in (C).

has never been reported so early in control(RNAi) or wildtype worms (Newmark and Sanchez

Alvarado, 2000; Tu et al., 2015; van Wolfswinkel et al., 2014). This led me to test whether accelerated differentiation was a global effect of myb-1 RNAi by examining BrdU incorporation into other tissue types at early timepoints. However, I did not observe differences in BrdU incorporation into muscle (collagen+ cells), eyespots (ovo+), or neuronal (chat+) tissues in myb-

1(RNAi) worms (Figure 13.1.3). From this data it does not appear that myb-1 acts as a master regulator of differentiation in all tissues.

Figure 13.1.3 BrdU labelling in non-epidermal tissues after myb-1 RNAi is comparable to controls BrdU in differentiated tissues (ovo, eyespots; collagen, muscle; chat, brain) was examined at the indicated time points after BrdU delivery. Quantification of ovo+ cells were performed in the eyespots, collagen+ in the dorsal head region, and chat+ in the anterior ventral brain lobes. Examples of double-positive cells are indicated by white arrows. Single confocal planes are shown. Scale bars, 20 µm.

13.2 myb-1(RNAi) animals maintain regional epidermal identity

Given the shortened transit time to epidermal integration, I evaluated whether mature epidermal fates were maintained in myb-1(RNAi) animals. Co-labeling of vim-1 in epidermal

BrdU+ cells showed accelerated cells had undergone sufficient maturation to express a differentiated epidermal marker (Figure 13.2A). Multiple epidermal genes show regionally distinct expression patterns, highlighting the substantial cell-type diversity present in this tissue

(Glazer et al., 2010; Tazaki et al., 2002; Wurtzel et al., 2017). I performed WISH analysis of a panel of these genes to gauge if the establishment of proper epidermal spatial identities was compromised. I found that myb-1 knockdown did not downregulate expression of these genes, and furthermore, the regional organization of these markers showed no overt abnormalities

(Figure 13.2B). Given the quickened progression of stem cell progeny through the epidermal lineage, and the lack of substantial overt abnormalities in the epidermis, I hypothesized that knockdown of myb-1 temporally shifted the entire epidermal lineage, with neoblasts skipping the early state and immediately progressing to the late progeny state and onward.

Figure 13.2 Mature epidermal identities are maintained after myb-1 RNAi (A) Expression of the epidermal marker vim-1 in BrdU+ cells in the epidermis of RNAi animals was assessed 7 days post-BrdU by FISH in the dorsal head region. (B) Expression of epidermal markers with regionally distinct patterns, as well as the broadly expression marker vim-1, were examined by WISH in RNAi animals at 4fd7. Single confocal planes are shown. Scale bars, 20 µm in (A), 200 µm in (B).

14 Epidermal lineage progression is spatiotemporally shifted in myb-

1(RNAi) animals

14.1 RNAi of myb-1 temporarily increases progenitor and epidermal density

Within the premise of a shifted lineage, I hypothesized that at the onset of myb-1 RNAi, the late progenitor pool might temporarily consist of pre-existing “normal” late progeny and prematurely specified “accelerated” late progeny, resulting in a greater number of late progeny for a couple of day compared to control worms. I quantified late progeny during early timepoints to attempt to capture this window and observed that at 3 days after the initial RNAi feed (1fd3), myb-1(RNAi) worms had significantly increased numbers of late progeny compared to control(RNAi) animals (Figure 14.1A). This increase was transient, and by 6 days after initial

RNAi (2fd3), numbers of late progeny were comparable between the two RNAi conditions. This trend was reflected in the significantly increased density of nuclei in the epidermis 6 days after

Figure 14.1 Epidermal progenitor and epidermal cell densities are temporarily increased after myb-1 RNAi. (A) AGAT-1+ and pmp-11+ late progeny were visualized by FISH and quantified at early time points after the commencement of RNAi, at 3 days (1fd3) and 6 days (2fd3) after the first RNAi feed. Confocal projections spanning a depth of 30 µm are shown. (B) Epidermal density after RNAi was measured through quantification of nuclei. Images shown are single confocal planes. All quantifications were performed in the dorsal head region. *, p-value<0.05; **, p-value<0.01, ***, p-value<0.001 (Student's t test). Scale bars, 20 µm.

initial RNAi (Figure 14.1B). Epidermal density in myb-1(RNAi) animals remained significantly greater for a longer span of time before returning to control levels, likely attributable to the ~20 day lifespan of a differentiated epidermal cell.

14.2 Late progeny exhibit early progeny characteristics after myb-1 RNAi

If the late progeny state had shifted to become the transition state immediately downstream of neoblasts, I reasoned that late progenitors in myb-1(RNAi) worms should exhibit characteristics of early progenitors in control(RNAi) worms. PIWI-1 protein has been shown to persist for a short time after piwi-1 transcription ceases, and thus can be detected in some immediate post-mitotic neoblast descendants (Guo et al., 2006). While 8-17% of early progeny have been reported to be

PIWI-1+, only ~2% of late progeny are PIWI-1+, reflective of the temporal distances these two cell populations have with respect to the piwi-1+ neoblasts (Zhu et al., 2015). Quantification of

AGAT-1+PIWI-1+ cells at 3fd3 revealed a significantly increased incidence of double-positive cells in myb-1(RNAi) worms (Figure 14.2.1), supporting the hypothesis that neoblast progeny were being immediately specified as late progeny.

Epidermal maturation also involves a spatial component, with the domain of early progeny cells located 2-3 cell diameters (10-15µm) closer to the interior than late progeny (Figure 14.2.2A)

(Tu et al., 2015). Examination of AGAT-1 in cross sections after RNAi revealed late progeny were

Figure 14.2.1 Knockdown of myb-1 increases detection of PIWI-1 in late progeny PIWI-1 immunolabeling in combination with AGAT-1 FISH in RNAi worms at 3fd3. Single confocal planes are shown. The percentage of AGAT-1+ cells that are double-positive was quantified in the dorsal head region. ***, p-value<0.001 (Student's t-test). Scale bars, 10 µm.

extended toward the interior of myb-1(RNAi) animals, resulting in a significantly increased average distance of AGAT-1+ late progeny from the epidermis from 35.9 ±1.6 µm to 51.3 ±3.0

µm (Figure 14.2.2B).

Figure 14.2.2 Late progeny are mislocalized in myb-1(RNAi) animals (A) Localization of stem cells, early progeny, and late progeny by immunostaining and dFISH, in pre-pharyngeal cross section. (B) Spatial localization of AGAT-1+ cells in RNAi animals at 3fd3. Distance of late progeny to the epidermis was measured from the center of the cell nucleus to the epidermal basement membrane. Measurements were performed in the mid-dorsal region of cross- sections. ***, p-value<0.001 (Student's t-test). Scale bars, 200 µm.

Each transition phases during epidermal lineage progression can also be separated by their distinct kinetics of marker loss following lethal irradiation (Eisenhoffer et al., 2008; Tu et al.,

2015). After selective depletion of mitotic neoblasts, transient progenitor populations disappear over time, with markers of more differentiated states persisting longer, reflective of the proximity of a population to the neoblast as well as the lifespan of the cellular identity. If neoblasts were immediately entering the late progeny state, I predicted that the downregulation kinetics of late and later progeny markers would be shifted earlier. RNAi worms were lethally irradiated at 3fd3 and then analyzed for cell population markers by WISH. Examination of piwi-1 and mat, a marker for differentiated gut, showed comparable irradiation-sensitivity between control and myb-1

RNAi conditions (Figure 14.2.3).

Figure 14.2.3 Irradiation-sensitivity of stem cell, mature tissue, and early progeny genes (A) Expression of the stem cell marker piwi-1 and differentiated gut marker mat in RNAi animals after irradiation was examined by WISH at the indicated time points. Worms were irradiated at 3fd3. (B) WISH of early progeny markers in lethally-irradiated wild-type worms. Scale bars, 200 µm.

When assessing irradiation-sensitivity of epidermal progenitor genes, late progeny markers in myb-1(RNAi) animals exhibited down-regulation kinetics characteristic of early progeny genes seen in control(RNAi) animals (Figure 14.2.3B), with a reduction of gene

82 expression evident at 24 hours post-irradiation, and almost complete downregulation after 48 hours (Figures 14.2.4). Later progeny markers, which normally persist beyond 7 days after irradiation, showed decreased expression starting at 48 hours post-irradiation and became undetectable at 7 days post-irradiation in myb-1(RNAi) animals, mirroring the downregulation kinetics typical of late progeny genes in control(RNAi) worms (Figure 14.2.4). These data supported the conclusion that after myb-1 knockdown, the remaining late and later progenitor states have temporally-shifted closer to the stem cell state.

Figure 14.2.4 Kinetics of epidermal progenitor marker downregulation after irradiation is shifted in myb-1(RNAi) animals Irradiation-sensitivity of late and later epidermal progenitor markers in RNAi animals was assessed by WISH. Worms were lethally irradiated at 3fd3 and fixed at the indicated days post- irradiation. Scale bars, 200 µm.

15. Materials and Methods

15.1 Animal care, RNAi, and γ-irradiation

The asexual clonal CIW4 strain of S. mediterranea was cultivated as previously described

(Sanchez Alvarado et al., 2002). Briefly, animals were maintained in supplemented Instant Ocean

Aquarium Salt in the dark at 20°C and fed weekly with homogenized organic calf liver. RNAi was performed as previously described (Newmark et al., 2003a), with the modification of mixing liver paste to bacteria at a ratio of 500 µL of liver per 150 mL of original culture volume. For negative control RNAi, the gfp sequence was used as previously described (Cowles et al., 2013).

RNAi feedings were delivered to week-starved worms, and spaced three days apart. For the extended feeding regimen, feeds subsequent to the third were delivered twice a week. Timepoints are indicated by x number of feeds and y number of days after the last feed (xfdy). Amputations were performed 3 days after the last feed. For irradiation experiments, a lethal dose of 60 Gray of

γ-radiation was delivered to animals with a 137Cs source.

15.2 ISH, immunostaining, BrdU labeling, and TUNEL

Whole-mount ISH (WISH), fluorescent ISH (FISH), and immunostaining were performed as previously described (Pearson et al., 2009; Zhu et al., 2015). Rabbit anti-H3ser10p (Millipore 04-

817) was used at 1:1000, and mouse anti-PIWI-1 (gift of Dr. Jochen Rink) was used at 1:1000.

BrdU (Sigma B5002) was fed at a concentration of 10 mg/mL in liver paste to salt-adapted RNAi animals at 3fd4, detected with mouse anti-BrdU (Millipore MAB3222) at 1:300, and stained as previously described (Zhu et al., 2015). TUNEL was performed as previously described (Lin and

Pearson, 2017; Pellettieri et al., 2010). WISH, TUNEL, and H3P stains were imaged using a Leica

M165 fluorescent dissecting microscope. All other stains were imaged using a Leica DMIRE2 inverted fluorescence microscope with a Hamamatsu Back-Thinned EM-CCD camera and spinning disc confocal scan head. H3P, TUNEL, and FISH cell counts and measurements were done with ImageJ software (http://rsb.info.nij.gov/ij/). Images were post-processed with Adobe

Photoshop and assembled in Macromedia Freehand.

15.3 qPCR, RNAseq, and differential expression analysis

Total RNA was purified from intact RNAi animals at 3fd6 in biological triplicate. qPCR was performed as previously described (Lin and Pearson, 2017). Briefly, SYBR Green PCR Master

Mix (Roche) was used according to manufacturer’s instructions on a Bio-Rad CFX96 Touch Real-

Time PCR Detection System in technical triplicate. The 2-ΔΔCT method was used to determine relative fold change, using GAPDH as the housekeeping gene (Eisenhoffer et al., 2008). The following primers were used for myb-1: 5’ATCAAATTGTCGGCTATGTC (forward);

5’ACACCACGAGTAAGGATGAC (reverse). For RNAseq, samples were sequenced to a depth of 40 million single-end 50 base pair reads per sample, and multiplexed on an Illumina HiSeq2500 with v4 chemistry. Samples were aligned to the SmedASXL transcriptome assembly under NCBI

BioProject PRJNA215411 using Bowtie2, with no sequence trimming. To identify differentially expressed genes in myb-1(RNAi) animals compared to control(RNAi), DEseq2 (Love et al., 2014) was used with raw mapped counts, with fold change ≥1.5 and false discovery rate <0.01. MA and log-fold change plot was generated using R. Raw RNAseq data and counts can be downloaded at the NCBI GEO accession number XXXXX.

Chapter 4 Discussion

When this study was conceived, knowledge on the second irradiation-sensitive X2 FACS cell fraction was scant, as most efforts had focused on the neoblast-specific X1 population. What had been established was that the two known progeny populations were enriched in the X2 gate, and the handful of known markers for these cell types were most highly expressed in this fraction

(Eisenhoffer et al., 2008; Labbe et al., 2012). Exploration of X2-enriched genes identified a panel of progeny markers which helped define two transition states for epidermal lineage development, and identified two genes which regulate stem cell commitment and differentiation: the RNA binding protein mex3-1 and the putative transcription factor myb-1.

16 X2 characterization identifies epidermal progenitor markers

Analysis of X2-enriched transcripts revealed a heterogeneous mixture of patterns, but the prog/AGAT expression pattern was dominant in representation. Examination of whether these transcripts marked novel progenitor types revealed that all were expressed in the two previously discovered progeny populations. From co-expression quantification, a clear pattern emerged: genes either showed high co-localization with an early progeny marker (prog-1 and prog-2), or with a late progeny marker (AGAT-1). The findings of a clear dichotomy in expression pattern, and the expansion in the number of markers for these two populations, support the recognition of early and late progeny as two distinct, major transition states. In view of the discovery that zeta neoblasts comprise the largest known lineage-specified neoblast subclass in planarians (van

Wolfswinkel et al., 2014), epidermal progenitors are likely the most plentiful population among the postmitotic output of stem cells, resulting in a strong bias in sequencing readouts in the X2 population.

17 mex3-1 as a candidate mediator of asymmetric cell fate in planarians

17.1 Cell fate regulation by mex3 genes

Through RNAi screening of the 120 candidate progeny transcripts, I identified mex3-1 as a critical factor in cell fate decision-making. mex3-1 was required not only for all epidermal progenitor fates, but also all other tested lineage-restricted stem cell progeny, and to restrict the expansion of the stem cell compartment. MEX3 is an RNA-binding translational repressor discovered in C. elegans with embryonic and post-embryonic developmental roles (Draper et al.,

1996). MEX3 is a fundamental regulator of asymmetry, mediating one of the earliest steps of cell fate determination in C. elegans by restricting expression of the cell fate determinant pal-1 transcription factor to the posterior blastomere of the early embryo (Draper et al., 1996; Huang et al., 2002). In adult C. elegans, MEX3 participates in the maintenance of germline stem cells

(GSCs) by promoting proliferation, and interestingly, is not required for GSCs to differentiate and undergo meiosis (Ariz et al., 2009). Four mex3 homologs (MexA-D) are present in vertebrates, which remain poorly characterized (Buchet-Poyau et al., 2007). Work on MEX3A in murine intestinal cell culture showed that the master intestinal differentiation factor Cdx2, one of the vertebrate homologs of pal-1, is a target of MEX3A translational inhibition, and MEX3A overexpression increased levels of ISC markers such as Bmi1 and Lgr5 (Pereira et al., 2013). A recent in vivo study showed Mex3a expression is heterogeneous in Lgr5+ cells, and high Mex3a expression was associated with slower cycling ISCs which were more resistant to radiation than

Lgr5+ cells as a whole, suggesting Mex3a marks a reserve population of ISCs (Barriga et al.,

2017). From these results, it is tempting to propose an important role for Mex3a in regulating intestinal stem cell fate and promoting stemness, though such a notion will need to await further in vivo experimentation where Mex3a function is perturbed. Overall, these findings combined

87 with these results in planarians suggest a conserved ancestral function for mex3 genes in cell fate choice.

17.2 Mechanisms of mex3-1 functions

The precise mechanisms by which mex3-1 exerts its effects in planarians are unresolved.

Although both zfp-1 and mex3-1 are required for specification of epidermal progenitors, unlike zfp-1(RNAi) worms, mex3-1(RNAi) worms completely lose the ability to form any regenerative blastema. mex3-1 was further needed to prevent the expansion of the stem cell compartment across the known subclasses, which suggests that mex3-1 acts to mediate stem cell lineage asymmetry in the general stem cell pool and regulate all postmitotic lineages. As both C. elegans and vertebrate MEX3 proteins have been shown to be translational repressors, it is likely that this molecular function has been conserved in planarians. Thus, I propose a model of stem cell lineage progression with mex3-1 acting as a repressor of stem cell identity and self-renewal genes in postmitotic progenitors to promote differentiation (Figure 17.2).

Figure 17.2 Model of lineage specification in planarian stem cells mex3-1 is a key determinant in balancing stem cell self-renewal and differentiation, acting as a promoter of postmitotic cell fates and commitment toward multiple lineages.

During early C. elegans embryogenesis, the asymmetric distribution of both mex3 mRNA and protein underlies the asymmetric expression of pal-1 (Draper et al., 1996). While mex3-1 mRNA does not appear to show such asymmetry and is expressed in both neoblasts and neoblast progeny, it is possible that asymmetric distribution or activation of MEX3-1 protein leads to the execution of its function in progeny only. An example of such a mechanism is Prospero in

Drosophila neuroblasts, where it is transcribed and translated in stem cells and daughter cells, but is segregated to and functions in progeny in a classic example of intrinsic asymmetric cell division

(Doe et al., 1991). Alternatively, MEX3-1 may have multiple cell type-specific roles and cell type-specific mRNA targets. No planarian homolog to the conserved MEX3 target Cdx2/pal-1 could be found in existing transcriptomes or genomic sequence (Abril et al., 2010; Fernandes et al., 2014; Labbe et al., 2012; Onal et al., 2012; Resch et al., 2012; Robb et al., 2008; Sánchez

Alvarado et al., 2003; Sandmann et al., 2011; Solana et al., 2012). Given the evidence supporting its conserved role in cell fate regulation, elucidating the RNA targets of MEX3-1 may provide an opportunity to uncover novel RNA targets in other organisms and adult stem cell systems.

17.3 The search for novel progenitor populations

With the evidence described in this study supporting mex3-1 as a regulator of multiple progenitors for other tissues, transcriptional analysis of mex3-1(RNAi) animals may be a fruitful avenue to discover novel progenitor markers for other lineages. The identification of one of the transcripts downregulated after mex3-1 knockdown, SmedASXL_059179, as a pharyngeal progenitor marker demonstrates the utility of this strategy. Additionally, it also reveals that novel lineage-restricted progenitors are present outside the X2 gate, as SmedASXL_059179 exhibits

WThighXlow expression, with little expression in the X1 or X2 fractions. However, a new approach likely to take center stage in facilitating the discovery of new progenitor types is the use of single

89 cell sequencing. In silico reconstitution of lineages can be used to predictive transition states between neoblasts and terminally differentiated cell types, and the reconstitution of a pharyngeal lineage corroborated SmedASXL_059179 as a marker for pharyngeal progenitors (Fincher et al.,

2018). Combining transcripts identified through single cell sequencing with expression analysis in mex3-1(RNAi) worms could expediate the validation of genes as markers for progenitor populations.

18 Epidermal differentiation in planarians

18.1 Temporal regulation of epidermal lineage progression by myb-1

Ensuring stem cell descendants undergo the correct transcriptional changes at the appropriate time is an important aspect of lineage progression. In the current framework of planarian epidermal maturation, a progression of post-mitotic progeny through multiple transition states has been established. However, little is known about what regulatory networks orchestrate these transcriptional shifts. In this study, I identified myb-1 as an important regulator of the step- wise transitions during epidermal differentiation. Upon knockdown of myb-1, the early progeny transcriptional program fails to activate, and in its place the late progeny transcriptional program is implemented, resulting in a spatiotemporal shift in epidermal lineage progression. Maturation proceeds normally from this second progenitor transition state, resulting in a shortened transit time before integrating into the epidermis. I propose a model in which myb-1 serves to specify the early progeny cell fate in the immediate post-mitotic descendants of zeta neoblasts, and either directly or indirectly, ensures that the subsequent late progeny genes are expressed at the correct time (Figure 18.1).

Figure 18.1 Model of the role of myb-1 in epidermal lineage development in planarians myb-1 serves to specify zeta neoblast descendants toward the early progeny transition state. Impairment of myb-1 activity through RNAi results in a failure of early progeny specification and premature progression into the late progeny transition state and subsequent stages of epidermal maturation.

An alternative conclusion from the data which warrants consideration is that early progeny represent a separate lineage from late and later progeny; hence loss of the former would not necessitate loss of the latter two. In this alternative model of epidermal lineages, knockdown of myb-1 leads to specification of the late progeny identity at the expense of the early progeny identity in this separate lineage of descendants, resulting in the shuttling of an extra lineage into the late progeny lineage. This alternative would be concordant with neoblasts directly transitioning into late progeny, as well as the increased numbers of late progeny and epidermal density seen in myb-1 RNAi animals. However, other aspects of the myb-1 RNAi phenotype are inconsistent with this notion. The increase in late progeny in myb-1(RNAi) worms is short-lived and thereafter is reduced compared to control worms, which is more suggestive of slightly impaired lineage progression than the addition of cells from another lineage. More strongly, the shortened durations of the late and later progeny phases, as shown by analyses of BrdU and irradiation-sensitivity kinetics, are indicative of a spatiotemporal shift and lineage compression

91 after myb-1 RNAi, which ultimately led to the exclusion of a model for separate epidermal progenitor lineages.

It remains unknown through what mechanism(s) myb-1 exerts its regulatory effects on gene expression, whether as an activator of early progeny genes, repressor of late progeny genes, or both. Differentiating between the possibilities will require identification of the direct binding targets of myb-1, either through the development of an antibody or analysis of the consensus binding sequence of the DNA binding domain. While myb-1 is not required for zeta neoblasts to be specified, part of the functions of myb-1 are carried out within this compartment. soxP-3, an early progeny marker which is also expressed in neoblasts and is part of the zeta gene signature

(van Wolfswinkel et al., 2014), is downregulated in both compartments in myb-1(RNAi) worms.

As soxP-3 has been previously shown to be a positive regulator for a subset of early progeny transcripts (Cheng et al., 2018), this suggests myb-1 acts in part by deploying other transcription factors that promote early progeny gene expression. The phenotype of egr-5(RNAi) animals also provides key insight into how transcriptional changes during epidermal differentiation are regulated. Knockdown of egr-5 impairs progression beyond late progeny, and more intriguingly, results in an expansion of late progeny markers more interiorly and inappropriate co-expression in early progeny (Tu et al., 2015). These results support a repression of late progeny genes in the immediate neoblast descendants, until the time is appropriate for their expression.

18.2 Functions of transition states during epidermal differentiation

From these findings, the question remains of why a hierarchical sequence of multiple transition states marked by transient transcriptional signatures exists for epidermal differentiation in planarians. Such an extended progression has been not found for other lineages in planarians,

92 but whether that accurately reflects differences in differentiation paradigms or merely difficulty in detection remains to be determined. While this work has shown that adhering to the normal sequence of transcriptional changes does not appear to be required, more intriguingly, it appears an entire progenitor state can be dispensed with for epidermal turnover. Whatever epidermal character that is established specifically by early progeny genes does not seem to be a prerequisite for continued lineage progression. This likely includes Hyman vesicles, secreted organelles found in epidermal progenitors and epidermal cells whose formation depends on soxP-3 activity (Cheng et al., 2018). PROG proteins have been hypothesized to be the major component of Hyman vesicles, supported by the localisation of PROG-2-5 by immunolabeling to this compartment, and the loss of Hyman vesicles after downregulation of a subset of prog genes in soxP-3(RNAi) worms. The function of Hyman vesicles is only speculative at this time, and its contents has been proposed to contribute to epidermal integrity, barrier function, and predator repulsion through chemical scent (Tyler 1976; Coward and Piedilato, 1972). Long-term soxP-3 knockdown and loss of Hyman vesicles did not carry any observable detriment, which the authors reasoned was due to the absence of environmental stresses the animals encounter under laboratory conditions.

The purpose of multiple transition states may not necessarily be solely to facilitate epidermal differentiation per se, but allow cells to carry out non-epidermal-related functions during transit to the exterior of the worm. For example, it has been hypothesized that the expression of AGAT genes (L-arginine:glycine amidinotransferases) by late progeny serves as a source to provide creatine for the surrounding muscle, given the proximity of late progeny to the subepidermal musculature (Eisenhoffer et al., 2008; Tu et al., 2015). Other genes involved in carrying out metabolic processes, including ornithine decarboxylases and cytochrome p450 enzymes, are also enriched in late progeny (Tu et al., 2015). It remains to be elucidated whether

93 the early progeny phase serves any other purposes aside from the production of Hyman vesicles, both within and outside the context of epidermal function.

18.3 MYB-type transcription factors in differentiation

The first MYB gene, c-myb, was identified as the cellular source of the oncogenic agent in leukemia-inducing avian retroviruses. Since then, c-myb has been recognized as an essential transcription factor regulating mammalian hematopoiesis, where it is required for progenitor function in multiple hematopoietic lineages, regulating specification, proliferation, and progressive differentiation (reviewed in Ramsay and Gonda 2008; Greig et al. 2008). Although c-myb also functions at multiple stages within specific hematopoietic lineages, the expression levels of c-myb are highest in the immature progenitors and wane as lineage progression occurs.

MYB-type transcription factors, characterized by the MYB DNA binding domain, have now been recognized to be widespread in both animals and plants, and have been uncovered to have roles in regulating differentiation in a variety of contexts. Examples include supporting the proliferation and differentiation of progenitors in the mammalian colon (Malaterre et al. 2007), differentiation of basal epithelial progenitors in the mammalian airway (Pan et al. 2014), and root meristem differentiation into endodermis in Arabidopsis thaliana (Liberman et al. 2015). Here I have shown that the use of MYB proteins in regulating progenitor specification and cell function has been shared in the planarian ASC system, deepening our understanding of MYB-type transcription factors outside of stem cell systems with proliferative progenitors. The use of a

MYB gene in a model with post-mitotic lineage development shows that the regulatory roles of

MYB genes in early progenitors extends beyond proliferation control, and reinforces how context- specific the genes regulated by MYB-type transcription factors are.

19 Future Directions

19.1 Molecular mechanisms of mex3-1 function

Moving forward, one of the key questions to address is precisely through what molecular mechanisms mex3-1 functions to promote stem cell commitment. An important tool to develop would be an antibody against planarian MEX3-1, which would enable the application of techniques like RNA co-immunoprecipitation to identify its target transcripts. Additionally, an antibody would permit the examination of MEX3-1 at the protein level and definitively establish in which cell types MEX3-1 carries out its function. Though mex3-1 mRNA is in both the neoblast and progeny populations, it is possible the protein has preferential localization to just one of the two compartments. Of particular interest would be to assess the distribution of MEX3-1 during cell division, given that asymmetric cell division has recently been described in planarians. It would also be an intriguing avenue to explore whether the distribution of known asymmetrically distributed components (piwi-1 mRNA, chromatoid bodies, EGFR-3 protein) and the ratio of symmetric to asymmetric cell divisions has been impacted in mex3-1(RNAi) animals, to determine if the role of mex3-1 in mediating cell fate is carried out through regulation of asymmetric neoblast division.

19.2 Role of the early progeny state in epidermal maturation

Though myb-1 has a crucial role in specification of an entire progenitor state, epidermal differentiation in planarians is flexible enough for the lineage to move forward in the absence of that state. Although no overt abnormalities in the epidermis of myb-1 RNAi animals could be discerned, future endeavours could aim to discover whether there are in fact any mature epidermal cell types that require progression through the early progeny phase. Analysis of downregulated genes in RNAseq of myb-1(RNAi) worms may reveal the loss of any specific terminal epidermal

95 identities. Alternatively, sequencing of isolated epidermis could provide a more precise assessment of changes to cell type diversity, potentially identifying low-read transcripts whose dilution in whole-worm sequencing may be obscuring significant changes to gene expression levels. More in-depth evaluation of the epidermis, such as ultrastructural analysis, efficacy in wound healing, and mucus deposition, could illuminate what physiological consequences arise from chronic accelerated epidermal differentiation in myb-1(RNAi) animals.

19.3 Deciphering the functions of myb-1 in other tissues

The underlying cause for the eventual stem cell loss resulting from long-term myb-1 knockdown remains unknown. This aspect of the RNAi phenotype could arise from cell- autonomous functions that myb-1 carries out in the stem cell compartment, as myb-1 is expressed in neoblasts. It is also possible that chronic abnormal epidermal lineage organization and the absence of signaling from early progeny back to neoblasts secondarily leads to impaired stem cell maintenance. For example, it was reported that nrg-7, the putative ligand for egfr-3 and shown to regulate asymmetric neoblast repopulation after sublethal irradiation, is expressed by prog-1+ early progeny (Lei et al., 2016).

However, the considerably lengthier timescale at which the phenotype manifests could be more suggestive of impairment of a differentiated compartment that requires time to turn over. In addition to the epidermal lineage and neoblasts, myb-1 is also expressed widely in the gut. As perturbations of intestinal genes has been shown to affect neoblast dynamics, it is enticing to speculate that myb-1 regulates intestinal differentiation, and stem cell depletion is a non-cell autonomous consequence from abnormal gut function in RNAi worms. Genes differentially expressed after myb-1 knockdown would be prime candidates for further scrutiny in elucidating the potential functions of myb-1 in other cell compartments. Functional characterization of myb-

1 target genes could delineate which genes contribute to the different facets of the myb-1 RNAi phenotype.

Appendix I

20 Characterization of Smed-brg1L in planarians

One of the positive hits from the RNAi functional screening of X2-enriched genes is a planarian homolog to the chromatin remodeller brahma (brahma-related gene in vertebrates;

Smed-brg1L). In this appendix, I will describe the preliminary characterization of Smed-brg1L as a potential regulator of stem cell differentiation in planarians.

20.1 Identification of a planarian brahma homolog as a candidate regulator of differentiation

RNAi against brg1L generated morphological phenotypes which were suggestive of a disruption in stem cell lineage development. Regenerative ability after amputation was impaired, and homeostatic worms manifested head regression and ventral curling before ultimately succumbing to death (Figure 20.1.1). Analysis of brg1L expression by WISH in wildtype and lethally-irradiated worms indicated brg1L is expressed in stem cells and or progeny, which was

Figure 20.1.1 Knockdown of brg1L is lethal and impairs regenerative ability Left, homeostatic RNAi animals at 5fd4. Right, trunk fragments of RNAi animals amputated pre- and post-pharyngeally at 3fd3, and imaged at the indicated days post-amputation. White arrowheads indicate amputation site.

98 confirmed by dFISH of brg1L in combination with lineage markers (Figure 20.1.2). An examination of markers for stem cells and epidermal progenitors using WISH revealed that progenitors were selectively reduced (Figure 20.1.3), indicating a defect in stem cell differentiation and not maintenance.

Figure 20.1.2 brg1L is expressed in stem cells and epidermal progenitors Left, WISH analysis of brg1L in wild-type worms after lethal irradiation. Right, dFISH analysis of brg1L and stem cell, early progeny, and late progeny markers. The percentage of stem cell and progenitor populations that co-express brg1L are indicated on the right. Scale bar, 10µm.

Figure 20.1.3 brg1L RNAi selectively downregulates progenitor populations WISH analysis of stem cell, early progeny, and late progeny markers in RNAi animals at 3fd6. Scale bar, 200 µm.

20.2 Reduced differentiation is accompanied by stem cell expansion

Production of progenitors for other tissue types were investigated as well. The trail of ovo+ eye progenitors and the newly described pharynx progenitor marker SmedASXL_059179 were examined by FISH and WISH, respectively, after RNAi. Eye progenitors were ablated and

SmedASXL_059179+ pharynx progenitors were reduced (Figure 20.2.1A,B), showing that brg1L is also needed for differentiation of tissue types other than the epidermis.

Figure 20.2.1 brg1L RNAi reduces progenitors for other tissue types (A) Examination of ovo+ eye progenitors by FISH in RNAi animals at 2fd10. Examples of progenitors are indicated by arrows. (B) Examination of pharyngeal progenitors using WISH of ASXL059179 in intact RNAi animals at 3fd3.

To assess the prospect that reduction in postmitotic progeny was due to a cessation of neoblast cell division, quantification of H3P staining was performed. A time-course analysis in intact worms revealed that knockdown of brg1L did not impair neoblast proliferation, but actually resulted in hyperproliferation (Figure 20.2.2A). To determine whether brg1L was required for progeny survival, levels of apoptosis were measured using quantification of TUNEL. A time-

100 course analysis after RNAi demonstrated that apoptosis increased over time in brg1L(RNAi) worms compared to controls (Figure 20.2.2B), raising the possibility brg1L promotes survival in progeny populations.

Figure 20.2.2 brg1L RNAi increases both proliferation and cell death (A) Whole-worm quantification of proliferation by H3P immunostaining. (B) Quantification of apoptosis by TUNEL+ cells. *, p-value<0.05; **, p-value<0.01, ***, p-value<0.001 (Student's t test).

WISH analysis of piwi-1 expression in intact RNAi animals showed increased staining anterior to the photoreceptors in brg1(RNAi) animals compared to controls. Given that knockdown of mex3-1 results in an expansion of neoblasts at the expense of postmitotic progeny,

I investigated whether a similar process was also contributing to the phenotype of brg1L(RNAi) animals. Quantification of piwi-1+ cells in pre-pharyngeal cross-sections in RNAi animals revealed an increase in the size of the stem cell pool in brg1L(RNAi) animals compared to controls

(Figure 20.2.3), consistent with the increased levels of proliferation. The populations of piwi-

1+PIWI-1+ and piwi-1-PIWI-1+ cells were quantified, as a measure of the ability of neoblasts to progress to a postmitotic state. Knockdown of brg1L resulted in disproportionately fewer piwi-1-

101

Figure 20.2.3 brg1L(RNAi) animals have increased numbers of stem cells piwi-1+ cells were quantified in pre-pharyngeal cross sections at the indicated time points after RNAi. *, p-value<0.05 (Student's t test).

PIWI-1+ cells (Figure 20.2.4). In summary, these results together point toward a function for brg1L in stem cell differentiation and perhaps survival of stem cell progeny.

Figure 20.2.3 Stem cell progression to a postmitotic state is reduced after brg1L RNAi PIWI-1 immunolabelling in combination with piwi-1 FISH. piwi-1+PIWI-1+ and piwi-1-PIWI-1+ cells were quantified in the head of RNAi animals at 3fd7.

102

Appendix II

21 Further characterization of myb-1 RNAi phenotype

Exploration of genes differentially expressed after myb-1 knockdown was undertaken to elucidate whether defects in mature cell identities resulted from abnormal epidermal lineage progression, and potentially illuminate the underlying cause of stem cell loss after extended RNAi feedings. These results suggest that myb-1 may have a role in intestinal differentiation, and identifies a peroxidasin homolog as a contributor to the morphological phenotype in myb-1(RNAi) worms.

21.1 myb-1(RNAi) differentially-expressed transcripts are enriched in gut- specific genes

myb-1(RNAi) animals lose early progeny within three days after knockdown commences, yet sustain epidermal turnover without detriment for a lengthy period. To elucidate whether the absence of the early progeny phase alters epidermal functionality through changes in the differentiation of mature epidermal identities, such as the loss of a specific cell type or bias towards another, differentially expressed genes identified by RNAseq of RNAi animals were cloned out for analysis. To select for markers of mature cell types, differentially expressed genes in RNAseq of myb-1(RNAi) worms which showed little to no irradiation-sensitivity (RNAseq counts in WT/Irrad≤1.1) were chosen for cloning. A total of 15 upregulated and 8 downregulated genes were cloned out, and WISH analysis of these genes was performed. This showed that 10 upregulated genes and 6 downregulated genes had a clear expression pattern, and WISH performed on RNAi animals confirmed their differential expression levels in myb-1(RNAi) animals compared to controls (Figure 21.1A,B). Interestingly, 10 of the total 16 genes analysed showed an intestine-specific expression pattern. Analysis of myb-1 expression by WISH and in

103 a single cell sequencing dataset had shown that, in addition to epidermal progenitors, myb-1 is also expressed in the intestine and in gamma neoblasts (Figure 11.2C). These findings prompted me to explore whether myb-1 has a role in regulating differentiation of gut tissue.

Figure 21.1 WISH analysis of myb-1(RNAi) differentially-expressed, irradiation-insensitive genes (A) WISH of genes which showed upregulated in myb-1(RNAi) RNAseq. (B) WISH of myb- 1(RNAi) downregulated genes. Genes with no BLASTx homology were labelled as UP (for upregulated) or D (for downregulated).

104

21.2 myb-1(RNAi) animals exhibit altered gut differentiation dynamics

I first examined whether overall gut organization was compromised under homeostatic conditions. WISH analysis of the gut marker mat in intact RNAi animals did not show any overt loss of gut tissue after myb-1 knockdown, even at a late timepoint when stem cell loss has started to occur, using an extended feeding schedule (Figure 21.2.1A). Expression of mat was next assayed after amputation, to determine whether myb-1 RNAi impairs intestinal regeneration.

WISH analysis after amputation showed gut tissue could be regenerated and the pre-existing gut branches remodelled as well (Figure 21.2.1B). However, at 7 days post amputation, the regenerated gut appeared less extensive in myb-1(RNAi) worms, and overall, blastemas were smaller than those of control worms.

A B

Figure 21.2.1 myb-1(RNAi) animals maintain gut homeostasis and regenerative ability (A) FISH analysis of gut (mat) and stem cells (piwi-1) in homeostatic RNAi worms at the indicated timepoints. Images shown are confocal stacks spanning 15 µm in depth. (B) Regeneration of the gut after pre- and post-pharyngeal amputations was assayed by WISH analysis of mat. RNAi animals were amputated at 3fd3, and fixed at the indicated days post- amputation. Top row, head fragments; middle, trunk; bottom, tail.

105

To determine the cause of smaller blastemas, I examined if myb-1 RNAi diminished the stereotypical hyperproliferative response to injury. A mitotic peak induced by tissue loss occurs by 48 hours after injury (Wenemoser and Reddien, 2010), so timepoints encompassing that response were chosen. Quantification of H3P staining in amputated RNAi animals showed that myb-1(RNAi) animals had significantly reduced levels of proliferation spanning 24 hours to 72 hours, compared to controls (Figure 21.2.2). This suggested the slowed gut regeneration was due to defective neoblast responses to injury, and not specific to gut differentiation.

Figure 21.2.2 Injury-induced neoblast hyperproliferation is diminished in myb-1(RNAi) animals RNAi animals were amputated pre- and post-pharyngeally at 3fd3, and trunk fragments were fixed at the indicated timepoints (hours post amputation) for H3P immunolabelling and quantification. **, p-value<0.01, ***, p-value<0.001 (Student's t test).

Given that epidermal lineage progression is shortened after myb-1 knockdown, I next investigated whether a similar process was occurring in the gut, using pulse-chase analyses with

BrdU. Based on the past findings of observing low levels of BrdU+ cells in the intestine at 5 days post-BrdU (Figure 8.2.3B), I used this timepoint as a reference and examined BrdU labelling in mat+ intestinal cells at 4 and 7 day chase lengths. Significantly increased numbers of BrdU- labelled cells were present in myb-1(RNAi) animals compared to controls after a 4 day chase

(Figure 21.2.3), suggesting neoblast descendants were taking less time to differentiate and

106 incorporate into the gut. These results bring up the possibility that myb-1 participates in regulating the temporal progression of gut differentiation in addition to epidermal differentiation.

***

Figure 21.2.3 myb-1(RNAi) animals exhibit increased entry of cells into the gut BrdU was fed to RNAi animals at 3fd4, and labelling in the gut assessed at the indicated timepoints after BrdU, by mat FISH and BrdU immunolabelling. ***, p-value<0.001 (Student's t test).

21.3 RNAi of a peroxidasin homolog results in abnormal posterior morphology

In light of the intestine-specific genes differentially expressed after myb-1 knockdown, and previous reports that perturbation of intestine-specific genes affects stem cell dynamics, I sought to explore the possibility that stem cell loss in myb-1(RNAi) animals resulted from abnormalities in differentiated tissues. I performed functional analysis of the downregulated genes with an extended RNAi feeding schedule (>7 feeds) and observed for morphological defects. Knockdown of a peroxidasin homolog (PXDN-2), which are secreted proteins that function in extracellular matrix formation (Péterfi and Geiszt, 2014), generated defects in tail morphology (Figure 21.3). WISH analysis of mat expression showed a narrowing of the space between the two posterior gut branches. Interestingly, WISH analysis showed piwi-1+ and prog-

1+ cells were present in the posterior of PXDN-2(RNAi) worms. As lethally-irradiated wild-type

107 worms do not manifest morphological defects until over a full week after stem cells are ablated, this precluded impaired stem cell function as a cause for the tail phenotype. This finding challenged my previous notion that the morphological tail phenotype after myb-1 RNAi was due to stem cell loss and impaired lineage production in that region.

Figure 21.3 Knockdown of a peroxidasin homolog results in abnormal tail morphology Left, live imaging of RNAi animals during homeostasis at 13fd3. Right; WISH analysis of stem cells, early progeny, and gut at 10fd6.

108

References

Abril, J.F., Cebria, F., Rodriguez-Esteban, G., Horn, T., Fraguas, S., Calvo, B., Bartscherer, K., and Salo, E. (2010). Smed454 dataset: unravelling the transcriptome of Schmidtea mediterranea. BMC Genomics 11, 731.

Adell, T., Salo, E., Boutros, M., and Bartscherer, K. (2009). Smed-Evi/Wntless is required for betacatenin-dependent and -independent processes during planarian regeneration. Development 136, 905- 910.

Adler, C.E., Seidel, C.W., McKinney, S.A., and Sanchez Alvarado, A. (2014). Selective amputation of the pharynx identifies a FoxA-dependent regeneration program in planaria. Elife (Cambridge) 3, e02238.

Anders, S., and Huber, W. (2010). Differential expression analysis for sequence count data. Genome Biol 11, R106.

Ariz, M., Mainpal, R., and Subramaniam, K. (2009). C. elegans RNA-binding proteins PUF-8 and MEX- 3 function redundantly to promote germline stem cell mitosis. Dev Biol 326, 295-304.

Baguñà, J. (1974). Dramatic mitotic response in planarians after feeding, and a hypothesis for the control mechanism. J Exp Zool 190, 117-122.

Baguñà, J., and Romero, R. (1981). Quantitative analysis of cell types during growth, degrowth and regeneration in the planarians Dugesia mediterranea and Dugesia tigrina. Hydrobiologia 84, 181-194.

Baguñà, J., Saló, E., and Auladell, C. (1989). Regeneration and pattern formation in planarians. III. Evidence that neoblasts are totipotent stem cells and the source of blastema cells. Development 107, 77- 86.

Barberán, S., Fraguas, S., and Cebrià, F. (2016). The EGFR signaling pathway controls gut progenitor differentiation during planarian regeneration and homeostasis. Development 143, 2089-2102.

Bardeen, C.R., and Baetjer, F.H. (1904). The inhibitive action of the Roentgen rays on regeneration in planarians. J Exp Zool 1, 191-195.

Barriga, F.M., Montagni, E., Mana, M., Mendez-Lago, M., Hernando-Momblona, X., Sevillano, M., Guillaumet-Adkins, A., Rodriguez-Esteban, G., Buczacki, S.J.A., Gut, M., et al. (2017). Mex3a Marks a Slowly Dividing Subpopulation of Lgr5+ Intestinal Stem Cells. Cell Stem Cell 20, 801-816.e807.

Berriman, M., Haas, B.J., LoVerde, P.T., Wilson, R.A., Dillon, G.P., Cerqueira, G.C., Mashiyama, S.T., Al-Lazikani, B., Andrade, L.F., Ashton, P.D., et al. (2009). The genome of the blood fluke Schistosoma mansoni. Nature 460, 352-358.

Brown, D.D.R., Molinaro, A.M., and Pearson, B.J. (2018). The planarian TCF/LEF factor Smed-tcf1 is required for the regeneration of dorsal-lateral neuronal subtypes. Developmental Biology 433, 374-383.

Brown, D.D.R., and Pearson, B.J. (2015). One FISH, dFISH, Three FISH: Sensitive Methods of Whole- Mount Fluorescent In Situ Hybridization in Freshwater Planarians, Vol 99 (New York: Springer Science).

Buchanan, J.W. (1933). Regeneration in Phagocata gracilis (Leidy). Physiological Zoology 6, 185-204.

Buchet-Poyau, K., Courchet, J., Le Hir, H., Seraphin, B., Scoazec, J.Y., Duret, L., Domon-Dell, C., Freund, J.N., and Billaud, M. (2007). Identification and characterization of human Mex-3 proteins, a

109 novel family of evolutionarily conserved RNA-binding proteins differentially localized to processing bodies. Nucleic Acids Res 35, 1289-1300.

Cebria, F., Kobayashi, C., Umesono, Y., Nakazawa, M., Mineta, K., Ikeo, K., Gojobori, T., Itoh, M., Taira, M., Sanchez Alvarado, A., et al. (2002). FGFR-related gene nou-darake restricts brain tissues to the head region of planarians. Nature 419, 620-624.

Cheng, L.-C., Tu, K.C., Seidel, C.W., Robb, S.M.C., Guo, F., and Sánchez Alvarado, A. (2018). Cellular, ultrastructural and molecular analyses of epidermal cell development in the planarian Schmidtea mediterranea. Developmental Biology 433, 357-373.

Cowles, M.W., Brown, D.D., Nisperos, S.V., Stanley, B.N., Pearson, B.J., and Zayas, R.M. (2013). Genome-wide analysis of the bHLH gene family in planarians identifies factors required for adult neurogenesis and neuronal regeneration. Development 140, 4691-4702.

Currie, K.W., Molinaro, A.M., and Pearson, B.J. (2016). Neuronal sources of hedgehog modulate neurogenesis in the adult planarian brain. eLife 5, e19735.

Currie, K.W., and Pearson, B.J. (2013). Transcription factors lhx1/5-1 and pitx are required for the maintenance and regeneration of serotonergic neurons in planarians. Development 140, 3577-3588.

Doe, C.Q., Chu-LaGraff, Q., Wright, D.M., and Scott, M.P. (1991). The prospero gene specifies cell fates in the Drosophila central nervous system. Cell 65, 451-464.

Draper, B.W., Mello, C.C., Bowerman, B., Hardin, J., and Priess, J.R. (1996). MEX-3 is a KH domain protein that regulates blastomere identity in early C. elegans embryos. Cell 87, 205-216.

Dubois, F. (1949). Contribution a l'etude de la migration des cellules de regeneration chez les Planaires dulcicoles. Bull Biol Fr Belg 83, 213-283.

Eisenhoffer, G.T., Kang, H., and Sanchez Alvarado, A. (2008). Molecular analysis of stem cells and their descendants during cell turnover and regeneration in the planarian Schmidtea mediterranea. Cell Stem Cell 3, 327-339.

Elliott, S.A., and Sánchez Alvarado, A. (2012). The history and enduring contributions of planarians to the study of animal regeneration. Wiley Interdisciplinary Reviews: Developmental Biology, n/a-n/a.

Fernandes, A.D., Reid, J.N., Macklaim, J.M., McMurrough, T.A., Edgell, D.R., and Gloor, G.B. (2014). Unifying the analysis of high-throughput sequencing datasets: characterizing RNA-seq, 16S rRNA gene sequencing and selective growth experiments by compositional data analysis. Microbiome 2, 15.

Fincher, C.T., Wurtzel, O., de Hoog, T., Kravarik, K.M., and Reddien, P.W. (2018). Cell type transcriptome atlas for the planarian Schmidtea mediterranea. Science (New York, NY).

Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E., and Mello, C.C. (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391, 806.

Forsthoefel, D.J., James, N.P., Escobar, D.J., Stary, J.M., Vieira, A.P., Waters, F.A., and Newmark, P.A. (2012). An RNAi screen reveals intestinal regulators of branching morphogenesis, differentiation, and stem cell proliferation in planarians. Dev Cell 23, 691-704.

Fuchs, E., and Chen, T. (2013). A matter of life and death: self‐renewal in stem cells. EMBO reports 14, 39-48.

Gavino, M.A., and Reddien, P.W. (2011). A Bmp/Admp regulatory circuit controls maintenance and regeneration of dorsal-ventral polarity in planarians. Curr Biol 21, 294-299.

110

Glazer, A.M., Wilkinson, A.W., Backer, C.B., Lapan, S.W., Gutzman, J.H., Cheeseman, I.M., and Reddien, P.W. (2010). The Zn finger protein Iguana impacts Hedgehog signaling by promoting ciliogenesis. Dev Biol 337, 148-156.

Gonzalez-Sastre, A., de Sousa, N., Adell, T., and Salo, E. (2017). The pioneer factor Smed-gata456-1 is required for gut cell differentiation and maintenance in planarians. Int J Dev Biol 61, 53-63.

Goulas, S., Conder, R., and Knoblich, Juergen A. (2012). The Par Complex and Integrins Direct Asymmetric Cell Division in Adult Intestinal Stem Cells. Cell Stem Cell 11, 529-540.

Greig, K.T., Carotta, S., and Nutt, S.L. (2008). Critical roles for c-Myb in hematopoietic progenitor cells. Seminars in Immunology 20, 247-256.

Guo, T., Peters, A.H., and Newmark, P.A. (2006). A bruno-like Gene Is Required for Stem Cell Maintenance in Planarians. Dev Cell 11, 159-169.

Gurley, K.A., Elliott, S.A., Simakov, O., Schmidt, H.A., Holstein, T.W., and Sanchez Alvarado, A. (2010). Expression of secreted Wnt pathway components reveals unexpected complexity of the planarian amputation response. Dev Biol 347, 24-39.

Gurley, K.A., Rink, J.C., and Sánchez Alvarado, A. (2008). Beta-catenin defines head versus tail identity during planarian regeneration and homeostasis. Science 319, 323-327.

Hallez, P. (1887). Embryogénie des Dendrocles d'eau douce (Paris :: O. Doin).

Hayashi, T., Asami, M., Higuchi, S., Shibata, N., and Agata, K. (2006). Isolation of planarian X-ray- sensitive stem cells by fluorescence-activated cell sorting. Dev Growth Differ 48, 371-380.

Higuchi, S., Hayashi, T., Hori, I., Shibata, N., Sakamoto, H., and Agata, K. (2007). Characterization and categorization of fluorescence activated cell sorted planarian stem cells by ultrastructural analysis. Dev Growth Differ.

Hsu, Y.-C., and Fuchs, E. (2012). A family business: stem cell progeny join the niche to regulate homeostasis. Nature Reviews Molecular Cell Biology 13, 103.

Huang, N.N., Mootz, D.E., Walhout, A.J., Vidal, M., and Hunter, C.P. (2002). MEX-3 interacting proteins link cell polarity to asymmetric gene expression in Caenorhabditis elegans. Development 129, 747-759.

Hyman, L.H. (1951). The invertebrates vol 2 : Platyhelminthes and rhynchocoela the acoelomate bilateria ([S.l.]: McGraw-Hill).

Iglesias, M., Gomez-Skarmeta, J.L., Salo, E., and Adell, T. (2008). Silencing of Smed-betacatenin1 generates radial-like hypercephalized planarians. Development 135, 1215-1221.

King, R.S., and Newmark, P.A. (2013). In situ hybridization protocol for enhanced detection of gene expression in the planarian Schmidtea mediterranea. BMC Dev Biol 13, 8.

Klattenhoff, C.A., Scheuermann, J.C., Surface, L.E., Bradley, R.K., Fields, P.A., Steinhauser, M.L., Ding, H., Butty, V.L., Torrey, L., Haas, S., et al. (2013). Braveheart, a long noncoding RNA required for cardiovascular lineage commitment. Cell 152, 570-583.

Knoblich, J.A., Jan, and Nung Jan, Y. (1995). Asymmetric segregation of Numb and Prospero during cell division. Nature 377, 624.

111

Labbe, R.M., Irimia, M., Currie, K.W., Lin, A., Zhu, S.J., Brown, D.D., Ross, E.J., Voisin, V., Bader, G.D., Blencowe, B.J., et al. (2012). A comparative transcriptomic analysis reveals conserved features of stem cell pluripotency in planarians and mammals. Stem Cells 30, 1734-1745.

Lander, R., and Petersen, C.P. (2016). Wnt, Ptk7, and FGFRL expression gradients control trunk positional identity in planarian regeneration. eLife 5, e12850.

Lapan, S.W., and Reddien, P.W. (2012). Transcriptome analysis of the planarian eye identifies ovo as a specific regulator of eye regeneration. Cell Rep 2, 294-307.

Lauter, G., Soll, I., and Hauptmann, G. (2011). Two-color fluorescent in situ hybridization in the embryonic zebrafish brain using differential detection systems. BMC Dev Biol 11, 43.

Lee, C.Y., Robinson, K.J., and Doe, C.Q. (2006). Lgl, Pins and aPKC regulate neuroblast self-renewal versus differentiation. Nature 439, 594-598.

Lei, K., Thi-Kim Vu, H., Mohan, Ryan D., McKinney, Sean A., Seidel, Chris W., Alexander, R., Gotting, K., Workman, Jerry L., and Sánchez Alvarado, A. (2016). Egf Signaling Directs Neoblast Repopulation by Regulating Asymmetric Cell Division in Planarians. Developmental Cell 38, 413-429.

Letunic, I., Doerks, T., and Bork, P. (2014). SMART: recent updates, new developments and status in 2015. Nucleic Acids Res.

Lin, A.Y., and Pearson, B.J. (2014). Planarian yorkie/YAP functions to integrate adult stem cell proliferation, organ homeostasis and maintenance of axial patterning. Development 141, 1197-1208.

Lin, A.Y.T., and Pearson, B.J. (2017). Yorkie is required to restrict the injury responses in planarians. PLOS Genetics 13, e1006874.

Lopez-Garcia, C., Klein, A.M., Simons, B.D., and Winton, D.J. (2010). Intestinal Stem Cell Replacement Follows a Pattern of Neutral Drift. Science 330, 822-825.

Love, M.I., Huber, W., and Anders, S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology 15, 550.

Milstone, L.M. (2004). Epidermal desquamation. Journal of Dermatological Science 36, 131-140.

Molina, M.D., Salo, E., and Cebria, F. (2007). The BMP pathway is essential for re-specification and maintenance of the dorsoventral axis in regenerating and intact planarians. Dev Biol 311, 79-94.

Molinaro, A.M., and Pearson, B.J. (2016). In silico lineage tracing through single cell transcriptomics identifies a neural stem cell population in planarians. Genome Biology 17, 87.

Morgan, T.H. (1898). Experimental studies of the regeneration of Planaria maculata. Arch Entw Mech Org 7, 364-397.

Morgan, T.H. (1901). Regeneration (New York: The Macmillan Company).

Morita, M., and Best, J.B. (1974). Electron microscopic studies of planarian regeneration. II. Changes in epidermis during regeneration. J Exp Zool 187, 345-373.

Morrison, S.J., and Spradling, A.C. (2008). Stem Cells and Niches: Mechanisms That Promote Stem Cell Maintenance throughout Life. Cell 132, 598-611.

Neef, A.B., and Luedtke, N.W. (2011). Dynamic metabolic labeling of DNA in vivo with arabinosyl nucleosides. Proc Natl Acad Sci U S A 108, 20404-20409.

112

Newmark, P.A., Reddien, P.W., Cebria, F., and Sanchez Alvarado, A. (2003a). Ingestion of bacterially expressed double-stranded RNA inhibits gene expression in planarians. Proc Natl Acad Sci U S A 100 Suppl 1, 11861-11865.

Newmark, P.A., Reddien, P.W., Cebria, F., and Sánchez Alvarado, A. (2003b). Ingestion of bacterially expressed double-stranded RNA inhibits gene expression in planarians. Proc Natl Acad Sci U S A 100 Suppl 1, 11861-11865.

Newmark, P.A., and Sanchez Alvarado, A. (2000). Bromodeoxyuridine specifically labels the regenerative stem cells of planarians. Dev Biol 220, 142-153.

Notredame, C., Higgins, D.G., and Heringa, J. (2000). T-Coffee: A novel method for fast and accurate multiple sequence alignment. J Mol Biol 302, 205-217.

Onal, P., Grun, D., Adamidi, C., Rybak, A., Solana, J., Mastrobuoni, G., Wang, Y., Rahn, H.P., Chen, W., Kempa, S., et al. (2012). Gene expression of pluripotency determinants is conserved between mammalian and planarian stem cells. Embo J 31, 2755-2769.

Orii, H., Sakurai, T., and Watanabe, K. (2005). Distribution of the stem cells (neoblasts) in the planarian Dugesia japonica. Dev Genes Evol 215, 143-157.

Pallas, P.S., and Christianus Fridericus Voss et, f. (1767). Spicilegia zoologica : quibus novae imprimis et obscurae animalium species iconibus, descriptionibus atque commentariis illustrantur, Vol fasc. 1-10 (Berolini :: Prostant apud Gottl. August. Lange).

Pearson, B.J., Eisenhoffer, G.T., Gurley, K.A., Rink, J.C., Miller, D.E., and Sanchez Alvarado, A. (2009). Formaldehyde-based whole-mount in situ hybridization method for planarians. Dev Dyn 238, 443-450.

Pearson, B.J., and Sanchez Alvarado, A. (2010). A planarian p53 homolog regulates proliferation and self-renewal in adult stem cell lineages. Development 137, 213-221.

Pedersen, K.J. (1959). Cytological studies on the planarian neoblast. Z Zellforsch Mikrosk Anat 50, 799- 817.

Pedersen, K.J. (1963). Slime-secreting cells of planarians. Ann N Y Acad Sci 106, 424-443.

Pellettieri, J., and Alvarado, A.S. (2007). Cell turnover and adult tissue homeostasis: from humans to planarians. Annu Rev Genet 41, 83-105.

Pellettieri, J., Fitzgerald, P., Watanabe, S., Mancuso, J., Green, D.R., and Sanchez Alvarado, A. (2010). Cell death and tissue remodeling in planarian regeneration. Dev Biol 338, 76-85.

Pereira, B., Sousa, S., Barros, R., Carreto, L., Oliveira, P., Oliveira, C., Chartier, N.T., Plateroti, M., Rouault, J.P., Freund, J.N., et al. (2013). CDX2 regulation by the RNA-binding protein MEX3A: impact on intestinal differentiation and stemness. Nucleic Acids Res 41, 3986-3999.

Péterfi, Z., and Geiszt, M. (2014). Peroxidasins: novel players in tissue genesis. Trends in Biochemical Sciences 39, 305-307.

Petersen, C.P., and Reddien, P.W. (2008). Smed-betacatenin-1 is required for anteroposterior blastema polarity in planarian regeneration. Science 319, 327-330.

Petersen, C.P., and Reddien, P.W. (2011). Polarized notum activation at wounds inhibits Wnt function to promote planarian head regeneration. Science 332, 852-855.

113

Randolph, H. (1897). Observations and experiments on regeneration in Planarians. Archiv für Entwicklungsmechanik der Organismen 5, 352-372.

Reddien, P.W. (2011). Constitutive gene expression and the specification of tissue identity in adult planarian biology. Trends Genet 27, 277-285.

Reddien, P.W., Bermange, A.L., Kicza, A.M., and Sanchez Alvarado, A. (2007). BMP signaling regulates the dorsal planarian midline and is needed for asymmetric regeneration. Development 134, 4043-4051.

Reddien, P.W., Bermange, A.L., Murfitt, K.J., Jennings, J.R., and Sánchez Alvarado, A. (2005a). Identification of genes needed for regeneration, stem cell function, and tissue homeostasis by systematic gene perturbation in planaria. Dev Cell 8, 635-649.

Reddien, P.W., Oviedo, N.J., Jennings, J.R., Jenkin, J.C., and Sanchez Alvarado, A. (2005b). SMEDWI- 2 is a PIWI-like protein that regulates planarian stem cells. Science 310, 1327-1330.

Reddien, P.W., Oviedo, N.J., Jennings, J.R., Jenkin, J.C., and Sánchez Alvarado, A. (2005c). SMEDWI- 2 is a PIWI-like protein that regulates planarian stem cells. Science 310, 1327-1330.

Reddien, P.W., and Sanchez Alvarado, A. (2004). Fundamentals of planarian regeneration. Annu Rev Cell Dev Biol 20, 725-757.

Reddien, P.W., and Sánchez Alvarado, A. (2004). Fundamentals of planarian regeneration. Annu Rev Cell Dev Biol 20, 725-757.

Resch, A.M., Palakodeti, D., Lu, Y.C., Horowitz, M., and Graveley, B.R. (2012). Transcriptome analysis reveals strain-specific and conserved stemness genes in Schmidtea mediterranea. PLoS One 7, e34447.

Rink, J.C., Gurley, K.A., Elliott, S.A., and Sanchez Alvarado, A. (2009). Planarian Hh signaling regulates regeneration polarity and links Hh pathway evolution to cilia. Science 326, 1406-1410.

Robb, S.M., Gotting, K., Ross, E., and Sanchez Alvarado, A. (2015). SmedGD 2.0: The Schmidtea mediterranea genome database. Genesis 53, 535-546.

Robb, S.M., Ross, E., and Sánchez Alvarado, A. (2008). SmedGD: the Schmidtea mediterranea genome database. Nucleic Acids Res 36, D599-606.

Rompolas, P., Patel-King, R.S., and King, S.M. (2010). An outer arm Dynein conformational switch is required for metachronal synchrony of motile cilia in planaria. Mol Biol Cell 21, 3669-3679.

Ronquist, F., and Huelsenbeck, J.P. (2003). MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572-1574.

Salo, E., and Baguna, J. (1984). Regeneration and pattern formation in planarians. I. The pattern of mitosis in anterior and posterior regeneration in Dugesia (G) tigrina, and a new proposal for blastema formation. J Embryol Exp Morphol 83, 63-80.

Salvetti, A., Rossi, L., Lena, A., Batistoni, R., Deri, P., Rainaldi, G., Locci, M.T., Evangelista, M., and Gremigni, V. (2005). DjPum, a homologue of Drosophila Pumilio, is essential to planarian stem cell maintenance. Development 132, 1863-1874.

Sánchez Alvarado, A., and Newmark, P.A. (1999). Double-stranded RNA specifically disrupts gene expression during planarian regeneration. Proc Natl Acad Sci U S A 96, 5049-5054.

114

Sanchez Alvarado, A., Newmark, P.A., Robb, S.M., and Juste, R. (2002). The Schmidtea mediterranea database as a molecular resource for studying platyhelminthes, stem cells and regeneration. Development 129, 5659-5665.

Sánchez Alvarado, A., Newmark, P.A., Robb, S.M., and Juste, R. (2002). The Schmidtea mediterranea database as a molecular resource for studying platyhelminthes, stem cells and regeneration. Development 129, 5659-5665.

Sánchez Alvarado, A., Reddien, P.W., Newmark, P., and Nusbaum, C. (2003). Proposal for the Sequencing of a New Target Genome: White Paper for a Planarian Genome Projet.

Sandmann, T., Vogg, M.C., Owlarn, S., Boutros, M., and Bartscherer, K. (2011). The head-regeneration transcriptome of the planarian Schmidtea mediterranea. Genome Biol 12, R76.

Sasidharan, V., Marepally, S., Elliott, S.A., Baid, S., Lakshmanan, V., Nayyar, N., Bansal, D., Sánchez Alvarado, A., Vemula, P.K., and Palakodeti, D. (2017). The miR-124 family of microRNAs is crucial for regeneration of the brain and visual system in the planarian Schmidtea mediterranea. Development 144, 3211-3223.

Sato, T., Vries, R.G., Snippert, H.J., van de Wetering, M., Barker, N., Stange, D.E., van Es, J.H., Abo, A., Kujala, P., Peters, P.J., et al. (2009). Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature 459, 262-265.

Schofield, R. (1978). The Relationship Between the Spleen Colony-forming Cell and the Haematopoietic Stem Cell, Vol 4.

Schultz, J., Milpetz, F., Bork, P., and Ponting, C.P. (1998). SMART, a simple modular architecture research tool: identification of signaling domains. Proc Natl Acad Sci U S A 95, 5857-5864.

Scimone, M.L., Cote, L.E., Rogers, T., and Reddien, P.W. (2016). Two FGFRL-Wnt circuits organize the planarian anteroposterior axis. eLife 5, e12845.

Scimone, M.L., Kravarik, Kellie M., Lapan, Sylvain W., and Reddien, Peter W. (2014). Neoblast Specialization in Regeneration of the Planarian Schmidtea mediterranea. Stem Cell Reports 3.

Scimone, M.L., Meisel, J., and Reddien, P.W. (2010). The Mi-2-like Smed-CHD4 gene is required for stem cell differentiation in the planarian Schmidtea mediterranea. Development 137, 1231-1241.

Scimone, M.L., Srivastava, M., Bell, G.W., and Reddien, P.W. (2011). A regulatory program for excretory system regeneration in planarians. Development 138, 4387-4398.

Siminovitch, L., McCulloch, E.A., and Till, J.E. (1963). The distribution of colony‐forming cells among spleen colonies. Journal of Cellular and Comparative Physiology 62, 327-336.

Simons, B.D., and Clevers, H. (2011). Strategies for homeostatic stem cell self-renewal in adult tissues. Cell 145, 851-862.

Snippert, H.J., van der Flier, L.G., Sato, T., van Es, J.H., van den Born, M., Kroon-Veenboer, C., Barker, N., Klein, A.M., van Rheenen, J., Simons, B.D., et al. (2010). Intestinal crypt homeostasis results from neutral competition between symmetrically dividing Lgr5 stem cells. Cell 143, 134-144.

Solana, J., Kao, D., Mihaylova, Y., Jaber-Hijazi, F., Malla, S., Wilson, R., and Aboobaker, A. (2012). Defining the molecular profile of planarian pluripotent stem cells using a combinatorial RNA-seq, RNAi and irradiation approach. Genome Biol 13, R19.

115

Spana, E.P., and Doe, C.Q. (1995). The prospero transcription factor is asymmetrically localized to the cell cortex during neuroblast mitosis in Drosophila. Development 121, 3187-3195.

Tazaki, A., Kato, K., Orii, H., Agata, K., and Watanabe, K. (2002). The body margin of the planarian Dugesia japonica: characterization by the expression of an intermediate filament gene. Dev Genes Evol 212, 365-373.

Tu, K.C., Cheng, L.C., Tk Vu, H., Lange, J.J., McKinney, S.A., Seidel, C.W., and Sanchez Alvarado, A. (2015). Egr-5 is a post-mitotic regulator of planarian epidermal differentiation. Elife 4. van Wolfswinkel, J.C., Wagner, D.E., and Reddien, P.W. (2014). Single-cell analysis reveals functionally distinct classes within the planarian stem cell compartment. Cell Stem Cell 15, 326-339.

Vogg, M.C., Owlarn, S., Perez Rico, Y.A., Xie, J., Suzuki, Y., Gentile, L., Wu, W., and Bartscherer, K. (2014). Stem cell-dependent formation of a functional anterior regeneration pole in planarians requires Zic and Forkhead transcription factors. Dev Biol 390, 136-148.

Wagner, D.E., Ho, J.J., and Reddien, P.W. (2012). Genetic regulators of a pluripotent adult stem cell system in planarians identified by RNAi and clonal analysis. Cell Stem Cell 10, 299-311.

Wagner, D.E., Wang, I.E., and Reddien, P.W. (2011). Clonogenic neoblasts are pluripotent adult stem cells that underlie planarian regeneration. Science 332, 811-816.

Wenemoser, D., and Reddien, P.W. (2010). Planarian regeneration involves distinct stem cell responses to wounds and tissue absence. Dev Biol 344, 979-991.

Wurtzel, O., Cote, L.E., Poirier, A., Satija, R., Regev, A., and Reddien, P.W. (2015). A Generic and Cell-Type-Specific Wound Response Precedes Regeneration in Planarians. Dev Cell 35, 632-645.

Wurtzel, O., Oderberg, I.M., and Reddien, P.W. (2017). Planarian Epidermal Stem Cells Respond to Positional Cues to Promote Cell-Type Diversity. Developmental Cell 40, 491-504.e495.

Yamashita, Y.M., Mahowald, A.P., Perlin, J.R., and Fuller, M.T. (2007). Asymmetric Inheritance of Mother Versus Daughter Centrosome in Stem Cell Division. Science 315, 518-521.

Yazawa, S., Umesono, Y., Hayashi, T., Tarui, H., and Agata, K. (2009). Planarian Hedgehog/Patched establishes anterior-posterior polarity by regulating Wnt signaling. Proc Natl Acad Sci U S A 106, 22329-22334.

Zheng, H., Zhang, W., Zhang, L., Zhang, Z., Li, J., Lu, G., Zhu, Y., Wang, Y., Huang, Y., Liu, J., et al. (2013). The genome of the hydatid tapeworm Echinococcus granulosus. Nat Genet 45, 1168-1175.

Zhu, S.J., Hallows, S.E., Currie, K.W., Xu, C., and Pearson, B.J. (2015). A mex3 homolog is required for differentiation during planarian stem cell lineage development. Elife 4.

Zhu, S.J., and Pearson, B.J. (2013). The Retinoblastoma pathway regulates stem cell proliferation in freshwater planarians. Dev Biol 373, 442-452.

116