Gene symbol Cancer associated expression levelGene name Size and Type of ASE ADAM15 1.32+/-0.27 ADAM metallopeptidase domain 15 +75+72exons =+147 APP 1.16+/-0.21 Amyloid beta (A4) precursor protein -57 exon BCAS1 1.30+/-0.20 Breast carcinoma amplified sequence 1 +66 exon BTC 3.06+/-0.87 Betacellulin -147 exon CADM1 (IGSF4) 1.95+/-0.34 Cell adhesion molecule 1 +33 exon CASC4 (H63) 0.53+/-0.11 Cancer susceptibility candidate 4 -168 exon CCL4 N.D. Chemokine (C-C motif) ligand 4 +113 exon CD40 (TNFRSF5) 0.67+/-0.12 CD40 molecule, TNF receptor superfamily member 5 -96 alt 3’ CLIP1 (RSN) N.D. CAP-GLY domain containing linker protein 1 -33 exon CLIP1 (RSN) N.D. CAP-GLY domain containing linker protein 1 +345 (alt3’ and exon) DBF4B (DRF1) 4.28+/-0.91 DBF4 homolog B (S. cerevisiae) +65 alt 3’ DDR1 1.81+/-0.28 Discoidin domain receptor family, member 1 +111 exon DNMT3B 0.32+/-0.07 DNA (cytosine-5-)-methyltransferase 3 beta +189 (2exons) DSC3 5.53+/-1.43 Desmocollin 3 -43 exon ECGF1 1.52+/-0.43 Endothelial cell growth factor 1 +274 intron ECT2 0.81+/-0.49 Epithelial cell transforming sequence 2 oncogene -93 exon F3 0.22+/-0.05 Coagulation factor III (thromboplastin, tissue factor) +160 exon FANCA 28.65+/-7.64 Fanconi anemia, complementation group A -129 exon FGFR2 1.42+/-0.29 Fibroblast growth factor receptor 2 +267 exon FN1 N.D. Fibronectin +267 exon GPR137(C11orf4) 2.88+/-0.76 G protein-coupled receptor 137 -150 exon HMGA1 N.D. High mobility group AT-hook 1 +51 exon HMMR 73.73+/-21.49 Hyaluronan-mediated motility receptor -48 exon INSR 5.33+/-0.86 Insulin receptor -36 exon LIG3 7.11+/-1.11 Ligase III, DNA, ATP-dependent -230 alt 3’ LIG4 0.39+/-0.18 Ligase IV, DNA, ATP-dependent +73 exon MCL1 1.34+/-1.69 Myeloid cell leukemia sequence 1 (BCL2-related) +248 exon NOTCH3 4.89+/-0.87 Notch homolog 3 (Drosophila) -156 exon PAXIP1 2.16+/-0.46 PAX interacting (with transcription-activation domain) protein-71 1 alt 5’ PCSK6 (PACE4) 3.14+/-0.64 Proprotein convertase subtilisin/kexin type 6 -144 exon PLD1 0.14+/-0.02 Phospholipase D1, phosphatidylcholine-specific -114 exon POLB 1.76+/-0.28 Polymerase (DNA directed), beta -58 exon PTPRB 0.11+/-0.02 Protein tyrosine phosphatase, receptor type, B +264 exon RUNX2 9.15+/-2.45 Runt-related transcription factor 2 -66 exon SHC1 1.07+/-0.24 SHC (Src homology 2 domain containing) transforming protein+54 1 exon STIM1 0.42+/-0.06 Stromal interaction molecule 1 -93 exon SYNE2 1.14+/-0.18 Synaptic nuclear envelope protein 2 -69 exon TLK1 0.72+/-0.11 Tousled-like kinase 1 -63 exon TUBA4A 1.76+/-0.26 Tubulin, alpha 1a +223 exon UTRN 1.01+/-0.19 Utrophin -39 exon VLDLR 0.48+/-0.08 Very low density lipoprotein receptor -84 exon Effect of cancer splice Function Inclusion of 49AA in C terminus Cell-cell adhesion as well as in cellular signaling. Removal of 19AA just downstream of KU protease inhibitor domain Transmembrane/secreted Inclusion of 22AA in C terminus Unknown Removal of 49AA in C terminus EGF family of growth factors. Inclusion of 11AA inr C terminus Tumour suppressor, Adhesion Removal of 56 AA in C terminus Proto-oncogene Intact in cancer. Normal form frameshifted and lacks chemokine domain. Chemokine receptor Intact in cancer. Normal form truncated lacking cytokine receptor domain Signal transduction Inclusion of 11AA in chromosome segregation domain Kinetochore-microtubule attachments Removal of 115AA in chromosome segregation ATPase domain Kinetochore-microtubule attachments Intact in cancer. Frameshift causes truncation upstream of Zinc finger domain in normal. Progression of both S and M phases Inclusion of 37AA Receptor tyrosine kinases invasion-related signaling Intact in cancer. Normal form lacks 63 AA from methylase domain. De novo methylation Frameshift removes C terminal Cadherin cytoplasmic region Desmosome junction adhesion Longer 5’UTR Angiogenesis Removal of 31AA in N terminus Cytokinesis Proto oncogene Intact in cancer. Frameshift truncates cytokine receptor domain in normal. Blood coagulation receptor Removal of 43AA Genome stability Inclusion of 89AA in immunoglobulin extracellular domain. Mitogenesis and differentiation Inclusion of 89AA in IIICS region Cell adhesion and migration Removal of 50AA Unknown Inclusion of 17AA near C terminus Transcription and metastasis Removal of 16AA from N terminal chromosome segregation ATPase domain Migration Removal of 12AA Glucose uptake Removal of N terminus by downstream initiation Excision repairApoptosis Longer 5’UTR Double-strand break repair through nonhomologous end joining Intact in cancer. Abrogation of Bcl-2 homolgy domain in normal. Long form anti apoptotic, short form pro apoptotic Removal of 52AA around two calcium binding EGF-like domains Intercellular signalling Frameshift disrupting all but extreme N terminus Genome stability, condensation of chromatin and mitotic progression Removal of 48AA from protease associated domain. Tumour progression. Removal of 38AA Regulation of mitosis Frameshift disrupting all but extreme N terminus Base excision repair (BER) DNA maintenance, replication, recombination, and drug resistance Intact in cancer. Loss of one fibronectin type 3 domain in normal. Protein tyrosine phosphatase receptor Removal of 22AA Transcription factor Differentiation. Angiogenesis Intact in cancer. Removal of 18AA from Pleckstrin homology-like domain Apoptosis Removal of 31AA just downstream of chromosome segregation ATPase domain Transmembrane protein Removal of 23AA between Spectrin repeats in C terminus Nuclear anchorage to cytoskeleton Removal of 21AA Serine/threonine kinase chromatin assembly Intact in cancer. Disrupted tubulin in normal. Cytoskeleton Removal of 13AA in C terminus. Tumour supressor neuromuscular junction Removal of 28AA in C terminus. Lipoprotein receptor Identified in ovarian cancer? Normal Ψ Cancer Ψ P-value Forward primer Reverse primers 8.3 29.6 1.51E-07 5'CTGCTGGCACGAGGCACTAA3' 5'AGGTCACCCGATGGGCAC3' Yes 51.8 31.3 3.40E-08 5'ACCACCACCACCACAGAGTC3' 5'GGGCATGTTCATTCTCATCC3' 70.5 91.5 3.77E-05 5'GACCTCAACGAAGGAGATGC3' 5'TCTTCTGCTTGTTCATCTCGG3' Yes 69.1 51.9 1.67E-05 5'ACCACCACACAATCAAAGCG3' 5'TTACGACGTTTCCGAAGAGG3' Yes 9 20.6 7.02E-04 5'CACCACCATCCTTACCATCATC3' 5'AGAATGATGAGCAAGCACAGC3' 46.8 21.4 4.92E-05 5'GCTCAAACTTGGACAGTGAACC3' 5'GCAGGATCCATTTGAAGCTC3' 75.2 90.5 4.26E-06 5'CACCAATACCATGAAGCTCTGC3' 5'GTCCTGAGTATGGAGGAGATGTG3' 24.2 6.5 6.80E-03 5'GGGAGTCAGCAGAGGCCT3' 5'AGTGGGTGGTTCTGGATGG3' 74.3 17.2 2.44E-14 5'ACACGTTAAACAAATTACAGGAAGC3'5'CTCCAAGTCAGAAGACAGCATG3' 75.7 0.4 2.38E-05 5'CATGTCCTGGAATTGGAAGC3' 5'TGGAGTTTGTCAGCTTTGGTC3' 30.1 40 4.51E-06 5'AGACTGAAGGCCCCGTTCCT3' 5'CTGGTATGGTGCATGCTGC3' 49.4 62.9 8.11E-05 5'ACTCCGCTCCCTGTGTCC3' 5'GCACAGCATAGGTGTTGCC3' Yes 20.3 47.1 6.98E-05 5'CAAGAGGGACATCTCACGGT3' 5'AGTGCACAGGAAAGCCAAAG3' 50 34.9 2.52E-05 5'GAGGGCAGGAAACCATTGAA3' 5'AGGACATAATCTTGGGATGGC3' 2.7 9.5 4.51E-05 5'CCGCTCGCATGACCGTGC3' 5'CCGTAGATGGAGCAAGTTGG3' 52.8 9.8 3.43E-05 5'GTGATATTGGTTCAAGAAGCTGG3'5'CAAATTCTTCCACTGACTCCATC3' 75.1 86.5 1.52E-04 5'CTCGGACAGCCAACAATTCA3' 5'CCACTCCTGCCTTTCTACACTT3' Yes 70 57.1 7.63E-04 5'AACCTGAAGCTGATGCTCTTTC3' 5'GAGAGGCACTATGAGGTCTTGC3' Yes 22 31.2 6.32E-03 5'TGCAGATGGGATTAACGTCC3' 5'GTGTCATCCTCATCATCTCCG3' 76.2 80.3 5.86E-02 5'AATAATCAGAAGAGCGAGCCC3' 5'TCTTCATCAGTGCCAACAGG3' 98.8 87.3 5.42E-04 5'ACTCCCTGTTCGTCATCTGC3' 5'TTGTTCCCCAGGTCATTCAC3' 18.5 60.4 1.45E-08 5'CCCAGCCATCACTCTTCC3' 5'GAGATGCCCTCCTCTTCCTC3' 50.1 29.7 4.48E-04 5'ATACTACCTTGCCTGCTTCAGC3' 5'CAGCATTTAGCCTTGCTTCC3' 49.5 26.1 7.07E-06 5'TGAGGATTACCTGCACAACG3' 5'GCTGGTCGAGGAAGTGTTG3' 93.4 78 3.86E-06 5'CGGATTTAAAGAGACAGGCG3' 5'GTTGCTCAGCCATCTCACAG3' 78.8 89.4 1.88E-03 5'AGCTTCAGGCTTGACGTCAG3' 5'AGGAAGAATTAGTCTCATTGCTGG3' Yes 67 82 4.52E-04 5'CCAAGGACACAAAGCCAATG3' 5'TGGAAGAACTCCACAAACCC3' 77.4 64.1 7.09E-03 5'GAACCCCTGTGAGCATGG3' 5'GTCCTGTTCGCAGTGGAAGC3' Yes 22.5 9.7 5.07E-12 5'GGCACACGTTTCTCCACTCT3' 5'GATAACACCTTTCCTCCTGCAC3' 91.1 80.2 1.16E-02 5'AACGAAGGGTGAAGAGACAGG3' 5'GGAGATGGGTCATAATCATTGC3' Yes 28.9 7.1 1.90E-08 5'ACGACGCAGATAGCATCAGC3' 5'TTGCAGTAGTCCTTTCCATGC3' Base excision repair (BER) DNA maintenance, replication, recombination, and drug resistance 63.5 50.1 1.59E-04 5'TCCAAGTCCTGGTACCTCCTT3' 5'CAATTTCTTAGCTTCAGCTCCAC3' 78.5 90.6 1.84E-03 5'TACTCCGTGGTGGTAACAACAG3' 5'ACCCTTAAATAGTCACTCCTGGC3' 62.4 45.4 3.73E-04 5'CCTACCTGAGCCAGATGACG3' 5'GTGAGGGATGAAATGCTTGG3' 39.3 90.8 2.84E-07 5'AATGCCAATCACTCTCACCG3' 5'TGATTCACAGGGTCTTTGGC3' Yes 11.8 0.7 5.12E-11 5'ATCGAGATCCTCTGTGGCTTC3' 5'GAACACTGCTCTGCAGGCTAG3' Yes 55.7 9.1 5.82E-15 5'CTCACGAAGAGGACGAGGAG3' 5'TTGCTTGTAGTGATGCTCGG3' 85.9 29.9 3.13E-05 5'TGGAAGCTTGGGATCTTTAAGT3' 5'AACGGATTGCAGGAGGTATG3' Yes 63.6 85 8.83E-05 5'GACTCAACGTGAGACGCACC3' 5'CTCTTTCCCAGTGATGAGCTG3' Yes 92.9 81.2 9.02E-06 5'CAAACACCCTCGACTTGGTT3' 5'TGGCAATACTGCTGGATGAG3' 47.6 12.3 6.03E-10 5'GGATGTGAATACCTATGCCTGC3' 5'GGAACACTGACCTCTGATACTGC3'