Structure of the Murine TRAF1 Gene Ian F

Molecular Immunology 36 (1999) 611±617 www.elsevier.com/locate/molimm

Structure of the murine TRAF1 gene Ian F. Dunn, Raif S. Geha, Erdyni N. Tsitsikov*

Division of Immunology, Children's Hospital and Department of Pediatrics, Harvard Medical School, Ender 8th, 300 Longwood Avenue, Boston, MA 02115, USA Received 10 March 1999; accepted 7 April 1999

Abstract

We have cloned, characterized and sequenced the murine TNF Receptor Associated Factor 1 (TRAF1) gene. Restriction mapping and Southern blotting analysis revealed that the TRAF1 gene comprises 10 exons and 9 intervening introns and spreads over 18 kb of genomic DNA. 5'-RACE analysis of the TRAF1 transcript using mRNA from activated spleen B cells revealed several transcription start sites between positions 42 to +4 relative to the 5'end of the murine TRAF1 cDNA sequence. We also isolated and sequenced the 5'-upstream promoter region, which lacks TATA-like and CAAT-like sites but contains GC-rich sequences. Taken together, these results suggest that the TRAF1 gene promoter is a member of the class of Sp-1-dependent promoters. Near the transcription initiation start site we identi®ed three identical decanucleotide repeats (CCAGCCCAGC) which may play a role in the transcriptional regulation of TRAF1 expression. In addition we show that TRAF1 mRNA is not expressed in non-stimulated lymphocytes but can be induced upon activation with dierent stimuli, including anti-CD3, anti-IgM, anti-CD40 antibodies, LPS, or a combination of phorbol-12-myristate-13-acetate and ionomycin. # 1999 Elsevier Science Ltd. All rights reserved.

Keywords: TRAF1; Gene structure; Promoter sequences

1. Introduction others. All of these receptors are devoid of intristic catalytic activity. Some of them, like TNFR-I and Members of the tumor necrosis factor alpha (TNF) CD95/Fas contain a death domain and bind to the superfamily are pro-in¯ammatory cytokines involved recently identi®ed signal transduction proteins like in a variety of physiological and pathological con- TRADD, FADD/MORT-1 and RIP. Other members ditions. TNF superfamily members include TNF, lym- of the TNFR superfamily, which lack a death domain photoxins a and b, CD30L, CD40L, CD70, CD95/ and include TNFR-II, CD40 and CD30, associate with Fas, 4-1BBL, and others. They interact with the mem- members of the TRAF (TNF Receptor Associated bers of TNF receptor (TNFR) superfamily and play Factor) family of intracellular signal transduction mol- important roles in a wide array of biological processes ecules (Arch et al., 1998). including the acute phase response, cell growth and TRAF molecules were ®rst described due to their apoptosis, in¯amation and lymphocyte activation ability to bind to TNF-RII (Rothe et al., 1994). Six (Baker and Reddy, 1996). The TNFR superfamily TRAF molecules have been identi®ed to date (Cao et includes the following members: TNF-RI, TNF-RII, al., 1996; Cheng et al., 1995; Hu et al., 1994; Ishida et LT-R, CD27, CD30, CD40, CD95, OX-40, 4-1BB, and al., 1996a, b; Mosialos et al., 1995; Nakano et al., 1996; Regnier et al., 1995; Sato et al., 1995). Individual TNFR family members may associate with one or several TRAFs, which in turn could result in a * Corresponding author. Tel.: +1-617-735-8205; fax: +1-617-735- wide spectrum of divergent physiological functions. In 4174. E-mail address: [email protected] (E.N. general, TRAFs are characterized by the presence of Tsitsikov) an N-terminal RING ®nger, several zinc ®ngers and a

C-terminal TRAF domain. The eector function of ducts that function cooperatively at the earliest check- TRAF2 requires its ®nger domains whereas the TRAF point to suppress TNFa-mediated apoptosis. Thus, domain is important for hetero- and homotypic inter- TRAF1 is one of the key regulators of the cellular actions with receptors, other TRAF proteins, or other stress response. downstream signal transducers. It was shown in vitro To gain further insight into the TRAF1 function that TRAF2 is required for JNK/SAPK and NF-kB and to understand the molecular mechanisms respon- activation induced by two TNFRs, CD40, CD27, sible for the TRAF1 expression, we have cloned and TRANCE-R, 4-1BB and CD30 (Akiba et al., 1998; characterized the murine TRAF1 gene. Arch and Thompson, 1998; Gedrich et al., 1996; Horie et al., 1998; Jang et al., 1998; Lee et al., 1997; Natoli et al., 1997; Pullen et al., 1998; Rothe et al., 1995; 2. Materials and methods Tsitsikov et al., 1997; Wong et al., 1998; Yamamoto et al., 1998). Gene targeting experiments demonstrated 2.1. Cloning of the mTRAF1 cDNA the crucial importance of the TRAF2 and TRAF3 proteins in cell signaling. Although TRAF2 null mice To obtain the mTRAF1 cDNA we screened the appear normal at birth, then become progressively mouse spleen cDNA Lambda ZAPII library runted and die prematurely. Examination of the (Stratagene) with a 300 bp fragment of the hTRAF1 TRAF2-de®cient cells revealed a severe reduction in described earlier (Tsitsikov et al., 1997). This fragment TNF-mediated JNK/SAPK activation but a surpris- corresponds to the coding region of the hTRAF1 ingly mild eect on NF-kB activation (Yeh et al., cDNA right 5'-upstream of HindIII site. After screen- 1997). Mice lacking TRAF3 exhibited a profound fail- ing of 0.5 Â 106 phage plaques we isolated six positive ure in homeostasis of the hematopoetic system and clones of dierent sizes. other organ systems, and die by 10 days of age (Xu et al., 1996). 2.2. Cloning and characterization of the mTRAF1 gene TRAF1 is a unique member of the TRAF family. It does not have a RING ®nger domain and contains a The mTRAF1 gene was isolated by screening of the single zinc ®nger, N-TRAF and C-TRAF domains. Lambda FIXII library (Stratagene) which was made Originally, the murine TRAF1 was cloned by bio- from the liver of strain 129/Sv female mice. We used a chemical characterization of signal transducers associ- 750 bp piece of the murine cDNA located upstream of ated with the cytoplasmic domain TNF-RII. It was the HindII site as a probe for screening of the genomic puri®ed from the lysate of the murine interleukin-2- library. Screening of approximately 1 Â 106 plaques dependent cytotoxic T cell line by immunoprecipitation using mTRAF1 cDNA probe yielded 14 dierent posi- with human TNF-RII (Rothe et al., 1994). Human tive phages, which were used for further studies. TRAF1 (EB16) was cloned by association with Restriction mapping was carried out by partial diges- Epstein±Barr virus latent infection membrane protein tion and Southern blotting hybridization with T3 and 1 (LMP1) from EBV-transformed lymphoblastoid cell T7 oligonucleotide probes as suggested by manufac- line by the yeast two-hybrid screen (Mosialos et al., turer. After alignment of individual clones, appropriate 1995). We and others have also cloned TRAF1 in ad- DNA fragments were subcloned into pBluescript II KS dition to TRAF2 by yeast two-hybrid screening with (+) (Stratagene). Exons were localized by Southern the cytoplasmic domain of CD30 (Aizawa et al., 1997; blotting hybridization using synthetic oligonucleotides Ansieau et al., 1996; Boucher et al., 1997; Duckett et from dierent parts of the TRAF1 cDNA and exon/ al., 1997; Gedrich et al., 1996; Lee et al., 1996a; intron junctions were sequenced. The sequencing reac- Tsitsikov et al., 1997). Ultimately, it was shown that tions were performed using Sequenase 2.0 kit TRAF1 can be recruited to a variety of distinct mem- (Amersham) or by automatic sequencing in MRRC bers of the TNFR superfamily, including TNF-RII, DNA Sequencing Core facility at Children's Hospital, CD30, 4-1BB, OX-40, HVEM/ATAR, and TRANCE- Boston, MA. The promoter sequence and consensus R. Little is known about TRAF1 function except that nucleotide motif analysis were performed using the when overexpressed in transgenic mice TRAF1 plays GENETYX-MAC software (Software Development, an inhibitory role in antigen-induced apoptosis of Tokyo, Japan). CD8+T lymphocytes (Speiser et al., 1997). A biological role for TRAF1 as a regulator of apoptotic signals 2.3. Northern blotting analysis has been suggested (Lee et al., 1996b). Recently, TRAF1, TRAF2, and the inhibitor-of-apoptosis pro- Anti-CD3 (2C11) and anti-CD40 (HM40-3) were teins (IAP) were identi®ed as gene targets of NF-kB- purchased from Pharmingen. Anti-mouse IgM (mu dependent transcriptional activity (Wang et al., 1998). chain) F(ab')2 fragments were purchased from TRAF1 was in a group of NF-kB-dependent gene pro- Rockland Inc. LPS (Serotype 0111:B4) and PMA were I.F. Dunn et al. / Molecular Immunology 36 (1999) 611±617 613

Fig. 1. Genomic organization and restriction map of the murine TRAF1 gene (A). The 10 exons are represented by the closed boxes. Schematic representation of the murine and human TRAF1 genes in comparison with protein structure (B). In the protein, TRAF1 domains are represented by wider boxes and are indicated as zinc ®nger, N-TRAF and C-TRAF, respectively. In the genes, boxes represent exons and connecting lines represent introns. The coding sequences is represented by shaded areas. The hatched areas indicate untranslated sequences. purchased from Sigma. Ionomycin (Io) was purchased CTC GTTTTCATC. PCR products were subcloned from Calbiochem. Splenocytes were prepared from the into pCRII vector (Invitrogen) and sequenced. spleen of 2 months old C57BL/6 mice. Isolated cells were maintained in RPMI1640 medium supplemented with 10% FCS and 50 mM 2-mercaptoethanol and 3. Results and discussion activated overnight with dierent stimuli including anti-CD3 (2 mg/ml), anti-IgM (5 mg/ml), LPS (1 mg/ 3.1. Structure of the murine TRAF1 gene ml), anti-CD40 (1 mg/ml) or combination of PMA (20 ng/ml) and Io (1 mM). Cells of the mouse B cell line To obtain the mTRAF1 cDNA, we screened of M12 were activated overnight with anti-CD40 (1 mg/ 0.5 Â 106 phage plaques and isolated six positive clones ml). Total cellular RNA was prepared with Trisol of dierent sizes. The longest insert was 2.3 kb long (Gibco±BRL), fractionated on a formaldehyde-de- and the shortest one was 0.9 kb. All of them were ana- natured 1% agarose gel and analyzed by Northern lyzed by restriction digestion and partial DNA sequen- blotting with mTRAF1 probe which was used for cing. From one of the clones, a 750 bp fragment screening of the genomic DNA clones. We used a 147 located upstream of HindIII site was used as a bp cDNA probe of the murine constitutively expressed mTRAF1 probe for screening of the genomic library. ribosomal protein L32-3A as RNA loading control. Screening of approximately 1 Â 106 plaques of the genomic library using mTRAF1 cDNA probe yielded 14 dierent positive phages. After restriction mapping 2.4. Identi®cation of the transcription start site analysis generated with eight dierent restriction enzymes, BamHI, EcoRI, HindIII, KpnI, SalI, SpeI, Transcription start site (TSS) was determined by XbaIandXhoI, individual clones were aligned. using the Rapid Ampli®cation of cDNA Ends (RACE) Hybridization with oligonucleotides corresponding to system from (Gibco±BRL). Total RNA was prepared the most 5'- and 3'-end sequences from mTRAF1 from mouse spleen cells activated with anti-CD40 cDNA revealed that full mTRAF1 gene was spread mAb or LPS as described above. First strand cDNA over 18 kb. Exons were localized by Southern blotting was synthesized by priming with mTRAF1 speci®c hybridization using synthetic oligonucleotides from antisense oligonucleotide: GCTCTGACAGGTTCC dierent parts of the mTRAF1 cDNA. The restriction GCT. DNA corresponding to the 5'-end of the map and organization of the mTRAF1 gene are illus- mTRAF1 was ampli®ed by `anchored' PCR with trated in Fig. 1(B). In order to de®ne the exon-intron abridged anchor primer provided by manufacturer and junctions, we subcloned dierent pieces of the phage speci®c antisense oligonucleotide: CCAATTGAAA- DNA into pBluescript and used appropriate primers to 614 I.F. Dunn et al. / Molecular Immunology 36 (1999) 611±617

Table 1 Splice sites in the murine TRAF1 gene. Sequence of the intron/exon/intron boundaries is shown. The ®rst four and the last four nucleotides of each exon are indicated

5' splice site 3' splice site

Exon 1 ACAG/GTTGGTTGCCCGTCCCCCGC TTTTATCCCCCATTTTACAG/ATAC Exon 2 TGTG/GTGAGTGGGGTGTGGGAAGG TCGCAATCCATTTATTTCAG/ACAT Exon 3 AAAG/GTGAGCCCCATTGTTCCAAA GTCCTCTGCTCTACTTAACA/ACCT Exon 4 TGAG/GTGAGGGGACAAAGCCAAGG ACTTATTCGTGTTTCCCCAG/AGAT Exon 5 GAAG/GTATGTTAGCACAGACTAGA GACACAGTTATCATTTCCAG/GTTC Exon 6 CAAG/GTAAGAAATTGGTAATGNCA TAAAGGCCCTCACTCTGTCA/GGGA Exon 7 GAGG/GTGAGTGAGATGGGCATGTT CTGACCAGCCTTCCCTACAG/GTGG Exon 8 CCAG/GTGACTCCTCCTCGCGGCCA ACACTGGCTTCACCTTGCAG/CTTT Exon 9 CAAG/GATGGGGAGAAGATGGTTTG TTCCTGCCTCTACCCTACAG/GTCA Exon 10

sequence from exon into intron down to known ancestor gene, probably featuring dierent mechanisms restriction enzyme sites and back through exon. The of regulation of expression. results showed that the mTRAF1 gene consists of 10 exons. By comparison the human TRAF1 gene was 3.2. Transcription start sites and promoter region of the found to consist of 6 exons comprising approximately mTRAF1 gene 12 kb. The position of the introns was determined by comparison with the human TRAF1 gene and follow- To determine TSS for the mTRAF1 gene we puri®ed ing the GT/AG splice rule (Mount, 1982). The exon- total RNA from mouse spleen cells activated with intron boundaries and the corresponding splice anti-CD40 mAb or LPS and employed the RACE sys- sequences are shown in Table 1. The nucleotide tem as described in Materials and Methods section. sequences for the exons of the mTRAF1 gene in the We have sequenced more then 12 DNA fragments and 129 Sv mouse strain was in agreement with the pub- all of them have varying lengths of the 5' end. The lished mTRAF1 cDNA sequence (Rothe et al., 1994). four longest fragments started at positions 42, 19, In contrast to human TRAF1 mRNA, the murine 15 and +4, relative to the 5' end of the published TRAF1 mRNA has a very long 5'-UT region which is sequence of the mTRAF1 cDNA. These data indicated encoded by three separate exons (Mosialos et al., 1995; that mTRAF1 mRNA transcription is probably in- Rothe et al., 1994). The fourth exon encodes for the itiated at multiple positions and has several TSS. rest of the 5'-UT end and for the ®rst 40 amino acids Therefore we postulate the 5' end of the published (a.a.), including a part of the zinc-®nger domain. Exon sequence corresponding to the mTRAF1 cDNA as a 5 encodes for a.a. 41±68, including the second part of the zinc-®nger domain. Exon 6 encodes for a.a. 69±91. Exon 7 encodes for a.a. 92±228 and exon 8 encodes a.a. 229±287, respectively. These two exons contain the N-TRAF domain. Exon 9 encodes for a.a. 288±337, including a part of the C-TRAF domain. Exon 10 is the largest one and encodes for a.a. 338±409, including the rest of the C-TRAF domain and 3'-UT region. The human TRAF1 gene was recently cloned (Siemienski et al., 1997). A comparison of the architec- ture of the murine and the human TRAF1 genes is presented in Fig. 1(B). While murine and human TRAF1 proteins share a high degree of primary sequence homology (86%), the murine and human TRAF1 genes have only two conserved exon±intron Fig. 2. Nucleotide sequence of the murine TRAF1 promoter region. splicing sites between exons 7±8 and 9±10, which cor- The numbering indicates the ®rst nucleotide position relative to the responds to sites between exons 2±3 and 4±5 for 5'-end of the published cDNA sequence. This position was assumed human. All other exon±intron splicing sites are dier- to be a transcription start site, designated as +1 and indicated by arrow. The position of the 5'-ends of the 5'-RACE products are ent between human and murine counterparts. These indicated by Ã. The ®rst exon is underlined. The GC-stretch, three observations suggest divergent derivation of the mur- repeats of CCAGCCCAGC and three repeats of GTCCCC are ine and the human TRAF1 genes from a common underlined. I.F. Dunn et al. / Molecular Immunology 36 (1999) 611±617 615

TSS. The nucleotide sequence of 240 and +119 bp of TSS was determined (Fig. 2). The 5'-¯anking region of the mTRAF1 gene was analyzed for the presence of sequence motifs, which could be responsible for the regulation of TRAF1 gene transcription. We found that the mTRAF1 promoter lacks TATA- or CAAT-like sequences but that it has a GC-rich (75%) region located at positions 82 to +100 relative to TSS. Within this region, we found a 15 bp-long GC-stretch (82 to 68) which might be a potential Sp-1-binding site. Also within this GC-rich region, we found three identical 10 bp long repeats (CCAGCCCAGC) which were separated by 21 and 15 bp. At the 3' downstream sequence relatively to TSS, we also found three 6 bp repeats (GTCCCC) which were separated by 5 and 3 bp. Computer analysis for all these repeats revealed no matching transcriptional factor binding sites. Thus, the absence of TATA or CAAT boxes, the presence Fig. 3. Regulation of TRAF1 gene expression in activated lympho- of a GC-rich region and the identi®cation of several cytes. TRAF1 gene expression was detected by Northern blotting transcription initiation sites for mTRAF1 suggest that analysis. The top panels represent autoradiograph with a mTRAF1 it is probably an Sp-1-dependent promoter. Further cDNA probe. The bottom panels represent autoradiograph with a loading control of L32 cDNA probe. (A) Mouse spleen cells were analysis is necessary to characterize the mTRAF1 left unstimulated or stimulated overnight with dierent stimuli gene promoter and to understand the underlying mol- including anti-CD3 (2 mg/ml), anti-IgM (5 mg/ml), LPS (1 mg/ml), ecular mechanisms of the transcriptional regulation of anti-CD40 (1 mg/ml) or combination of PMA (20 ng/ml) and Io mTRAF1 expression. (1 mM). (B) M12 cells were left unstimulated or stimulated with anti- As mentioned above, the murine TRAF1 mRNA CD40 (1 mg/ml). Cells were harvested at indicated time. has a longer 5'-UT end than its human counterpart. Furthermore, while the corresponding part of the 3.3. TRAF1 mRNA is expressed in activated murine TRAF1 is encoded by four separate exons lymphocytes with one of them containing the coding sequence, the human TRAF1 mRNA 5'-untranslated region end is It was shown that TRAF1 expression is tissue- encoded by one exon, which contains a part of the speci®c: the murine TRAF1 mRNA could only be coding sequence. These dierences in the gene struc- detected in spleen, lung, and testis (Mosialos et al., ture suggest that the murine and the human TRAF1 1995; Rothe et al., 1994). To examine TRAF1 ex- promoters might have completely dierent promoter pression in activated lymphocytes, we performed sequences. Indeed the human TRAF1 5'-upstream Northern blot analyses with total RNA from puri®ed region does not possess any TATA or CAAT boxes, spleen cells activated with dierent stimuli including like the murine TRAF1 promoter. But in contrast to anti-CD3, anti-IgM, LPS, anti-CD40 antibodies and a the murine TRAF1 promoter, the human TRAF1 5'- combination of PMA and ionomycin. Fig. 3(A) shows upstream region does not contain a GC-rich that while TRAF1 mRNA is hardly detectable in sequence. Analysis of the human TRAF1 promoter unstimulated lymphocytes, it is strongly upregulated revealed that it contains two overlapping 044 bp upon activation. Moreover, T cell-speci®c activation long repeats at positions 194 to 152 and 155± (anti-CD3), B cell-speci®c activation (anti-IgM, LPS 113. There is also a poly-A stretch at positions ±223 and anti-CD40), or T and B lymphocyte activation, to 210. One may speculate that there may be a ret- that bypasses cell surface receptor signaling roposed pseudogene in front of the human TRAF1 (PMA+Io), all were able to activate TRAF1 ex- gene. We could not ®nd such homologous repeats in pression in spleen cells. These results demonstrate that the murine TRAF1 promoter. Taken together these TRAF1 mRNA is inducible in both T and B lympho- observations suggest that the murine and the human cytes and suggests that TRAF1 is important for TRAF1 gene might well have dierent ways of tran- further lymphocyte survival and function. scriptional regulation of their expression in these To determine the kinetics of TRAF1 mRNA up- species and further analysis will be needed to under- regulation after activation in B cells, we examined the stand the molecular mechanisms for their transcrip- eect of the anti-CD40 antibody on TRAF1 mRNA tion. expression in a B cell line, M12. Cells were activated 616 I.F. Dunn et al. / Molecular Immunology 36 (1999) 611±617 and harvested at 0, 1, 2, 4 and 10 h and analyzed for D., Yagita, H., Okumura, K., 1998. CD27, a member of the the mTRAF1 mRNA expression by Northern blotting. tumor necrosis factor receptor superfamily, activates NF-kappaB As shown in Fig. 3(B), TRAF1 mRNA was not detect- and stress-activated protein kinase/c-Jun N-terminal kinase via TRAF2, TRAF5, and NF-kappaB-inducing kinase. J. Biol. able in non-stimulated cells (lane 1) but was detectable Chem. 273, 13353±13358. after 2 h of activation (lane 2) and signi®cantly Ansieau, S., Scherahn, I., Mosialos, G., Brand, H., Duyster, J., increased after 10 h (lane 5). Analysis of the constitu- Kaye, K., Harada, J., Dougall, B., Hubinger, G., Kie, E., tively expressed L32 mRNA showed comparable Herrmann, F., Leutz, A., Gruss, H.J., 1996. Tumor necrosis fac- amount of expression in all wells. These results suggest tor receptor-associated factor (TRAF)-1, TRAF-2, and TRAF-3 interact in vivo with the CD30 cytoplasmic domain; TRAF-2 that TRAF1 gene belongs to a class of early expression mediates CD30-induced nuclear factor kappa B activation. Proc. genes which may be necessary for cell activation and Natl Acad. Sci. USA 93, 14053±14058 (retracted by Kie E. In: survival. Originally TRAF1 was cloned from the mur- Proc. Natl Acad. Sci. USA 1997 Nov 11; 94(23): 12732). ine IL-2-dependent T cell line CT6 (Rothe et al., Arch, R.H., Gedrich, R.W., Thompson, C.B., 1998. Tumor necrosis 1994). In our laboratory, we have isolated TRAF1 factor receptor-associated factors (TRAFs)Ða family of adapter from the IL-6-dependent cell line KT-3 while we did proteins that regulates life and death. Genes Dev. 12, 2821±2830. Arch, R.H., Thompson, C.B., 1998. 4-1BB and Ox40 are members not detect it in a Jurkat cell line, which does not of a tumor necrosis factor (TNF)-nerve growth factor receptor require the presence of IL-6 for growth (Tsitsikov et subfamily that bind TNF receptor-associated factors and activate al., 1997). In humans, TRAF1 was described as a pro- nuclear factor kappaB. Mol. Cell Biol. 18, 558±565. tein induced by EBV infection (Liebowitz, 1998; Baker, S.J., Reddy, E.P., 1996. Transducers of life and death: TNF Mosialos et al., 1995). hTRAF1 mRNA was at least 8 receptor superfamily and associated proteins. Oncogene 12, 1±9. fold more abundant in the EBV-infected BL41/B95-8 Boucher, L.M., Marengere, L.E., Lu, Y., Thukral, S., Mak, T.W., 1997. Binding sites of cytoplasmic eectors TRAF1, 2, and 3 on or IB4 cells than in non-infected BL41 cells. CD30 and other members of the TNF receptor superfamily. Particularly, LMP1 plays a central part in this process Biochem. Biophys. Res. Commun. 233, 592±600. by mimicking members of the TNFR family and Cao, Z., Xiong, J., Takeuchi, M., Kurama, T., Goeddel, D.V., 1996. induces the expression of TRAF1 along with many TRAF6 is a signal transducer for interleukin-1. Nature 383, 443± other proteins in EBV-negative Burkitt lymphoma 446. Cheng, G., Cleary, A.M., Ye, Z.S., Hong, D.I., Lederman, S., BL41 cells, thereby transmitting growth signals from Baltimore, D., 1995. Involvement of CRAF1, a relative of the cell membrane to the nucleus of the transformed TRAF, in CD40 signaling. Science 267, 1494±1498. cell. Moreover, TRAF1 proved to be absent from all Duckett, C.S., Gedrich, R.W., Gil®llan, M.C., Thompson, C.B., resting lymphocytes as well as from macrophages and 1997. Induction of nuclear factor kappaB by the CD30 receptor accessory cells and present in a few perifollicular and is mediated by TRAF1 and TRAF2. Mol. Cell Biol. 17, 1535± intrafollicular lymphoid blasts (Durkop et al., 1999). 1542. Durkop, H., Foss, H.D., Demel, G., Klotzbach, H., Hahn, C., Stein, In contrast, there was a high and consistent TRAF1 H., 1999. Tumor necrosis factor receptor-associated factor 1 is expression in EBV-induced lymphoproliferations and overexpressed in reed-sternberg cells of Hodgkin's disease and Hodgkin's disease. Taken together, these data support Epstein±Barr virus-transformed lymphoid cells. Blood 93, 617± the idea that TRAF1 expressed in activated lympho- 623 (In Process Citation). cytes and its expression may be necessary for the regu- Gedrich, R.W., Gil®llan, M.C., Duckett, C.S., Van Dongen, J.L., Thompson, C.B., 1996. CD30 contains two binding sites with lation of signal transduction by the members of TNFR dierent speci®cities for members of the tumor necrosis factor superfamily, including CD30, 4-1BB, OX40, HVEM/ receptor-associated factor family of signal transducing proteins. J. ATAR or TRANCE-R. Biol. Chem. 271, 12852±12858. Horie, R., Aizawa, S., Nagai, M., Ito, K., Higashihara, M., Ishida, T., Inoue, J., Watanabe, T., 1998. A novel domain in the CD30 cytoplasmic tail mediates NFkappaB activation. Int. Immunol. Acknowledgements 10, 203±210. Hu, H.M., O'Rourke, K., Boguski, M.S., Dixit, V.M., 1994. A novel Supported by AI42031 and AR-43985 from RING ®nger protein interacts with the cytoplasmic domain of National Institute of Allergy and Infectious Diseases, CD40. J. Biol. Chem. 269, 30069±30072. USA. Ishida, T., Mizushima, S., Azuma, S., Kobayashi, N., Tojo, T., Suzuki, K., Aizawa, S., Watanabe, T., Mosialos, G., Kie, E., Yamamoto, T., Inoue, J., 1996a. Identi®cation of TRAF6, a novel tumor necrosis factor receptor-associated factor protein References that mediates signaling from an amino-terminal domain of the CD40 cytoplasmic region. J. Biol. Chem. 271, 28745±28748. Aizawa, S., Nakano, H., Ishida, T., Horie, R., Nagai, M., Ito, K., Ishida, T.K., Tojo, T., Aoki, T., Kobayashi, N., Ohishi, T., Yagita, H., Okumura, K., Inoue, J., Watanabe, T., 1997. Tumor Watanabe, T., Yamamoto, T., Inoue, J., 1996b. TRAF5, a novel necrosis factor receptor-associated factor (TRAF) 5 and TRAF2 tumor necrosis factor receptor-associated factor family protein, are involved in CD30-mediated NFkappaB activation. J. Biol. mediates CD40 signaling. Proc. Natl Acad. Sci. USA 93, 9437± Chem. 272, 2042±2045. 9442. Akiba, H., Nakano, H., Nishinaka, S., Shindo, M., Kobata, T., Jang, I.K., Lee, Z.H., Kim, Y.J., Kim, S.H., Kwon, B.S., 1998. Atsuta, M., Morimoto, C., Ware, C.F., Malinin, N.L., Wallach, Human 4-1BB (CD137) signals are mediated by TRAF2 and acti- I.F. Dunn et al. / Molecular Immunology 36 (1999) 611±617 617

vate nuclear factor-kappa B. Biochem. Biophys. Res. Commun. mediated activation of NF-kappa B by TNF receptor 2 and 242, 613±620. CD40. Science 269, 1424±1427. Lee, S.Y., Kandala, G., Liou, M.L., Liou, H.C., Choi, Y., 1996a. Rothe, M., Wong, S.C., Henzel, W.J., Goeddel, D.V., 1994. A novel CD30/TNF receptor-associated factor interaction: NF-kappa B family of putative signal transducers associated with the cyto- activation and binding speci®city. Proc. Natl Acad. Sci. USA 93, plasmic domain of the 75 kDa tumor necrosis factor receptor. 9699±9703. Cell 78, 681±692. Lee, S.Y., Park, C.G., Choi, Y., 1996b. T cell receptor-dependent Sato, T., Irie, S., Reed, J.C., 1995. A novel member of the TRAF cell death of T cell hybridomas mediated by the CD30 cyto- family of putative signal transducing proteins binds to the cytoso- plasmic domain in association with tumor necrosis factor recep- lic domain of CD40. FEBS Lett. 358, 113±118. tor-associated factors. J. Exp. Med. 183, 669±674. Siemienski, K., Peters, N., Scheurich, P., Wajant, H., 1997. Lee, S.Y., Reichlin, A., Santana, A., Sokol, K.A., Nussenzweig, Organization of the human tumour necrosis factor receptor-as- M.C., Choi, Y., 1997. TRAF2 is essential for JNK but not NF- sociated factor 1 (TRAF1) gene and mapping to chromosome kappaB activation and regulates lymphocyte proliferation and 9q33-34. Gene 195, 35±39. survival. Immunity 7, 703±713. Speiser, D.E., Lee, S.Y., Wong, B., Arron, J., Santana, A., Kong, Liebowitz, D., 1998. Epstein±Barr virus and a cellular signaling Y.Y., Ohashi, P.S., Choi, Y., 1997. A regulatory role for TRAF1 pathway in lymphomas from immunosuppressed patients. N. in antigen-induced apoptosis of T cells. J. Exp. Med. 185, 1777± Engl. J. Med. 338, 1413±1421 (see comments). 1783. Mosialos, G., Birkenbach, M., Yalamanchili, R., Vanarsdale, T., Tsitsikov, E.N., Wright, D.A., Geha, R.S., 1997. CD30 induction of Ware, C., Kie, E., 1995. The Epstein±Barr virus transforming human immunode®ciency virus gene transcription is mediated by protein LMP1 engages signaling proteins for the tumor necrosis TRAF2. Proc. Natl Acad. Sci. USA 94, 1390±1395. factor receptor family. Cell 80, 389±399. Wang, C.Y., Mayo, M.W., Korneluk, R.G., Goeddel, D.V., Baldwin Mount, S.M., 1982. A catalogue of splice junction sequences. Jr, A.S., 1998. NF-kappaB antiapoptosis: induction of TRAF1 Nucleic Acids Res. 10, 459±472. and TRAF2 and c-IAP1 and c-IAP2 to suppress caspase-8 acti- Nakano, H., Oshima, H., Chung, W., Williams-Abbott, L., Ware, vation. Science 281, 1680±1683. C.F., Yagita, H., Okumura, K., 1996. TRAF5, an activator of NF-kappaB and putative signal transducer for the lymphotoxin- Wong, B.R., Josien, R., Lee, S.Y., Vologodskaia, M., Steinman, beta receptor. J. Biol. Chem. 271, 14661±14664. R.M., Choi, Y., 1998. The TRAF family of signal transducers Natoli, G., Costanzo, A., Ianni, A., Templeton, D.J., Woodgett, mediates NF-kappaB activation by the TRANCE receptor. J. J.R., Balsano, C., Levrero, M., 1997. Activation of SAPK/JNK Biol. Chem. 273, 28355±28359. by TNF receptor 1 through a noncytotoxic TRAF2-dependent Xu, Y., Cheng, G., Baltimore, D., 1996. Targeted disruption of pathway. Science 275, 200±203. TRAF3 leads to postnatal lethality and defective T-dependent Pullen, S.S., Miller, H.G., Everdeen, D.S., Dang, T.T.A., Crute, J.J., immune responses. Immunity 5, 407±415. Kehry, M.R., 1998. CD40-tumor necrosis factor receptor-associ- Yamamoto, H., Kishimoto, T., Minamoto, S., 1998. NF-kappaB ac- ated factor (TRAF) interactions: regulation of CD40 signaling tivation in CD27 signaling: involvement of TNF receptor-associ- through multiple TRAF binding sites and TRAF hetero-oligo- ated factors in its signaling and identi®cation of functional region merization. Biochemistry 37, 11836±11845. of CD27. J. Immunol. 161, 4753±4759. Regnier, C.H., Tomasetto, C., Moog-Lutz, C., Chenard, M.P., Yeh, W.C., Shahinian, A., Speiser, D., Kraunus, J., Billia, F., Wendling, C., Basset, P., Rio, M.C., 1995. Presence of a new con- Wakeham, A., de la Pompa, J.L., Ferrick, D., Hum, B., Iscove, served domain in CART1, a novel member of the tumor necrosis N., Ohashi, P., Rothe, M., Goeddel, D.V., Mak, T.W., 1997. factor receptor-associated protein family, which is expressed in Early lethality, functional NF-kappaB activation, and increased breast carcinoma. J. Biol. Chem. 270, 25715±25721. sensitivity to TNF-induced cell death in TRAF2-de®cient mice. Rothe, M., Sarma, V., Dixit, V.M., Goeddel, D.V., 1995. TRAF2- Immunity 7, 715±725.