Aegilops Section Sitopsis Species Contains the Introgressive Pola1 Gene with a Closer Relationship to That of Hordeum Than Triticum–Aegilops Species

Breeding Science 59: 602–610 (2009)

Aegilops section Sitopsis species contains the introgressive PolA1 gene with a closer relationship to that of Hordeum than Triticum–Aegilops species

Ikuo Nakamura*1), Bhuwan Rai1), Hiroko Takahashi1), Kenji Kato2), Yo-ichiro Sato3) and Takao Komatsuda4)

1) Graduate School of Horticulture, Chiba University, 648 Matsudo, Matsudo, Chiba 271-8510, Japan 2) Faculty of Agriculture, Okayama University, 1-1-1 Tsushima-Naka, Okayama 700- 8530, Japan 3) Research Institute of Humanity and Nature, Kamigyo, Kyoto 602-0878, Japan 4) National Institute of Agrobiological Sciences, 2-1-2 Kannondai, Tsukuba, Ibaraki 305-8602, Japan

The section Sitopsis in the genus Aegilops includes five species, Ae. speltoides, Ae. longissima, Ae. sharonensis, Ae. searsii, and Ae. bicornis, which share the SS genome. Although extensive molecular studies have indicated Ae. speltoides as a donor of BB or GG genome to polyploid wheat species, the precise relationships among SS, BB, and GG genomes remain unclear. PolA1 is a single-copy nuclear gene encoding the largest subunit of RNA polymerase I. Highly polymorphic PolA1 exon 20 sequences were analyzed for 11 Triticum– Aegilops, 13 Hordeum and three related species. Phylogenetic analyses of the PolA1 gene showed that Triticum–Aegilops and Hordeum species were distinctly separated into two clades. Two related species, Secale cereale and Dasypyrum villosum, were grouped into Triticum and Hordeum clades, respectively. Interestingly, seven accessions of the Sitopsis species were clustered into the Hordeum clade whereas two accessions belonged to the Triticum clade. In contrast, all accessions of Sitopsis species shared the same haplotype of plastid PSID sequences with Triticum–Aegilops species. This inconsistency in phylogeny between nuclear and cytoplasmic sequences suggested that the Sitopsis species probably originated through introgressive hybridization between ancestral species of Triticum–Aegilops and Hordeum.

Key Words: Aegilops, hybrid speciation, introgression, PolA1 gene, Sitopsis, PSID.

Introduction 1988, Miyashita et al. 1994, Wang et al. 1997, Yamane and Kawahara 2005), mitochondrial DNA (Terachi et al. 1990, Triticeae is a tribe within the Pooideae subfamily of grasses Mori et al. 1997), nuclear polymorphic DNA sequences that includes more than 15 genera and 300 species, including (Dvorak and Zhang 1990, Sasanuma et al. 1996, Salina et al. major crop plants such as common wheat (Triticum aestivum 2006), and sequence analysis of genes (Huang et al. 2002, L.), rye (Secale cereale L.), and barley (Hordeum vulgare Provan et al. 2004, Petersen et al. 2006, Kilian et al. 2007, L.). The genus Triticum along with Aegilops contains 36 spe- Golovnina et al. 2007, Chalupska et al. 2008, Salse et al. cies (Eig 1929, Hammer 1980, Tanaka 1983, van Slageren 2008). Despite decades of intensive research, the detailed re- 1994), and the genus Hordeum is comprised of 32 species lationship between BB and GG genomes has not been clari- (Bothmer et al. 1995). These species not only include sever- fied, and therefore, the genome symbol of Ae. speltoides was al important crops, but also provide an excellent model designated as SS (Huang et al. 2002). system for studying the evolution of allopolyploids. Kihara Although earlier studies (e.g. Stebbins 1956) suggested (1944) reported that common wheat (AABBDD) originated that Aegilops and Triticum species should be considered from allopolyploidization between T. turgidum L. (AABB) members of the same genus, van Slageren (1994) argued and Ae. tauschii (DD). However, the origins of two tetra- that these species belonged to two distinct genera, and ploids, T. turgidum and T. timopheevii Zhuk. (AAGG), Ae. speltoides was classified into the section Sitopsis (Jaub. remain unresolved (Gill and Chen 1987, Kilian et al. 2007). & Spach) Zhuk., which also included Ae. longissima, Riley et al. (1958) proposed that ancestral Ae. speltoides Ae. searsii, Ae. bicornis, and Ae. sharonensis. Five Sitopsis was the most likely diploid species for the donor of either species were classified into two subclasses, Ae. speltoides BB and / or GG genomes to polyploid wheat species. This and four species (Sasanuma et al. 1996, 2004, Salina et al. was supported by analyses of crossability (McFadden and 2006). The relationships of Sitopsis species with Triticum Sears 1946), chloroplast DNA (Ogiwara and Tsunewaki and other Aegilops species have been controversial (Salleres and Brown 2004). Although Petersen et al. (2006) recently Communicated by Donghe Xu proposed that Ae. speltoides should be excluded from the ge- Received September 2, 2009. Accepted November 6, 2009. nus Aegilops and classified into the genus Sitopsis (Jaub & *Corresponding author (e-mail: [email protected]) Spach) Á. Löve, none of these reports suggested that Introgressive PolA1 gene of Aegilops section Sitopsis species 603

Sitopsis species originated through hybrid speciation. Materials and Methods Hybridization between species has been considered one of the driving forces for speciation in plants (Mallet 2007). Plant materials and DNA extraction Amphidiplodization provides clear evidence for the involve- Seeds or DNAs of all the accessions of Triticum, ment of hybridization in speciation (hybrid speciation), Aegilops and Hordeum species used in this study were pro- namely, interspecific hybridization and subsequent chromo- vided by Dr. T. Kawahara, National Bio-resources Project, some doubling of a hybrid, although it is difficult to prove Kyoto University, Mozume, Japan, Dr. R.v. Bothmer, Swed- hybrid speciation without chromosomal doubling (homo- ish University of Agricultural Sciences, Alnarp, Sweden, ploid hybrid speciation). Furthermore, if backcrossing Dr. K. Takeda, Research Institute for Bioresources, Okayama (introgressive hybridization) is involved, it is more difficult University, Kurashiki, Japan, and Dr. K. Kato, Faculty of to define the genetic material introduced by the original Agriculture, Okayama University. Seeds of H. bulbosum hybridization. GBC77-1 was kindly provided by Dr. M. Furusho, Fukuoka Nakamura et al. (1997) reported a plastid subtype identity Agriculture Research Center, Chikushino, Fukuoka, Japan. (PSID) sequence, which is a linker between rpl16 and rpl14 DNAs of Lolium elongatum were gifts from Dr. H.W. Cai, genes on plastid DNA. PSID sequences of most land plants Japan Grassland Farming and Forage Seed Association, For- are 100–200 bp in length and can be analyzed using a pair of age Crop Research Institute, Japan. common primers. Hebert et al. (2003) proposed a DNA bar- Nucleotide sequences of exon 20 in PolA1 gene were an- coding system using the mitochondrial cytochrome oxidase alyzed for 26 accessions of 11 Triticum–Aegilops species I (COI) sequence as a tag of eukaryotic species. Although (T. monococcum, T. urartu, Ae. uniaristata, Ae. comosa, these cytoplasmic DNA markers are useful for species iden- Ae. markgrafii, Ae. umbellulata, Ae. tauschii, Ae. bicornis, tification of plants, it is impossible to resolve hybrid spe- Ae. speltoides, Ae. searsii, Ae. longissima), 22 accessions of ciation without analyzing nuclear DNA markers. Many 13 Hordeum species (H. vulgare, H. bulbosum, H. marinum, researchers now prefer phylogenetic analysis using the H. murinum, H. brevisubulatum, H. roshevitzii, H. euclaston, combined sequences of many genes but such analysis will H. intercedens, H. erectifolium, H. chilense, H. pulbiflorum, neglect small numbers of alien genes introduced through H. patagonicum, H. pusillum) and 2 accessions of 2 related introgressive hybridization. Phylogenetic analyses based on species (Secale cereale, Dasypyrum villosum). Two acces- the diffusion equation have been developed for population sions of Lolium elongatum were analyzed as an out-group genetics and neutral evolution of molecular sequences (Table 1). (Kimura 1968) but not for hybrid speciation. Therefore, to Young leaves (ca. 100 mg) of seedlings were frozen in obtain evidence of hybrid speciation by introgression, it is 2-ml plastic tubes with liquid nitrogen and crushed into fine important to find species-specific sequence variations of powder using a MULTI-BEADS SHOCKER (Yasui Kikai single-copy nuclear genes per haploid genome (Sang 2002). Co., Kyoto, Japan). Total genomic DNA was extracted ac- Recently, we found that the PolA1 gene contained highly cording to the CTAB method (Doyle and Doyle 1987) polymorphic sequences in plants. PolA1 encodes the largest subunit of the RNA polymerase I complex, which synthe- PCR amplification and direct sequencing sizes 45S ribosomal RNA, one of most important parts of The DNA fragments containing PolA1 exon 20 sequences the machinery in living cells. Takahashi et al. (2009a) report- were amplified using PCR with a pair of primers, 19ex5P: ed that the DNA sequence of intron 19 shows species- and 5′-AGGGGACATGAATGTCACACTTGG-3′ and 21ex3P: genus-specific variations in the genus Oryza. Sequence vari- 5′-ACCTCAATGTCTTCTGGGCAATCT-3′, which are lo- ability in the same region successfully distinguished closely cated on exon 19 and exon 21 of PolA1 genes, respectively related accessions in Petunia axillaris and P. integrifolia (Fig. 1). For the sequencing of the exon 20, an internal se- complexes, and therefore, this is a promising DNA marker quencing primer 20ex5P (5′-AATCCAGGAAACAAGG for discrimination before blooming (Zhang et al. 2008). GTAAAG-3′) were used. ExTaq DNA polymerase (TaKaRa Furthermore, based on analysis of the intron 19 sequences, Co., Shiga, Japan) was used for PCR according to the manu- Takahashi et al. (2009b) reported that wild and cultivated facturer’s instructions. The PCR amplification was set as 36 subspecies of T. timopheevii had originated by divergence. cycles of 1 min. at 94°C for denaturation, 1 min. at 58°C for They also found that it was difficult to perform phylogenetic annealing, and 2 min. at 72°C for elongation in a PTC200 analysis of the intron 19 sequences between Triticum thermocycler (MJ Research Inc., MA, USA). monococcum (112 bp) and Hordeum vulgare (244 bp) The amplified PCR products were subjected to 1.2% aga- together because of their high divergence. Interestingly, the rose gel electrophoresis and purified using a PCR purifica- Sitopsis species were found to contain the long intron 19 tion kit (QIAquick, Qiagen Inc., CA, USA). DNA sequences (242 bp). of the purified PCR products were determined by direct se- This study was performed to resolve the relationship of quencing with three sequencing primers, 19ex5P, 20ex5P the Sitopsis species with related Triticum, Aegilops, and and 21ex3P, using an automated DNA sequencer ABI310 Hordeum species through comparative analyses of nuclear (Applied Biosystems, CA, USA) with a Big Dye Terminator PolA1 exon 20 and plastid PSID sequences. Cycle Sequencing Kit (Applied Biosystems, USA). 604 Nakamura, Rai, Takahashi, Kato, Sato and Komatsuda

Table 1. Triticeae accessions used in this study Species Accessiona Genome PSID T. monococcum L. ssp. monococcum KT1-1, KT1-5 AA P1 ssp. aegilopoides (Link) Thell. KT3-1, KT3-4 AA P1 T. urartu Tumanian ex Gandilyan PI428181, PI487270 AA P2 Ae. umbellulata Zhuk. KU2760, KU4018 UU P3 Ae. comosa Sm. in Sibth. & Sm. KU17-3, KU5804 MM P1 Ae. markgrafii (Greuter) K.Hammer KU6-2, KU11422 CC P1 Ae. uniaristata Vis. KU19-1, KU11479 NN P1 Ae. tauschii Coss. AT07, AT13, KU20-9 DD P4 Ae. bicornis (Forssk.) Jaub. & Spach. KU3-2, KU14610, KU14615 SbSb P1 Ae. longissima Schweinf. & Muschl. KU14642, KU14648 SlSl P1 Ae. searsii Feldman & Kisselev ex K. Hammer KU4-6, KU5756 SsSs P1 Ae. speltoides Tausch. KT115-6, KT115-8 SS P1 H. vulgare L. ssp. vulgare BA04, BA17 II P5 ssp. spontanum (C. Koch) Thell. OUH602, OUH743 II P5 H. bulbosum L. GBC77-1 II P5 H. marinum Huds. ssp. marinum H41, H515 XaXa P6 ssp. gussoneanum (Parl.) Thell. H823, H826 XaXa P6 H. murinum L. H551, H798 XuXu P6 H. roshevitzii Bowden. H7434, H10070 HH P7 H. brevisubulatum (Trin.) Link. H8788, H10056 (autotetraploid) HHHH nt H. erectifolium Bothmer et al. H1150 HH P7 H. pulbiflorum Hook.f. H1236 HH P7 H. chilense Roem. & Schult. H1816 HH nt H. intercedens Nevski H1941 HH nt H. pusillum Nutt. H2024 HH P7 H. euclaston Steud. H2148 HH P7 H. patagonicum (Hauman) Covas H6852 HH nt Secale cereale L. KU4017 RR P1 Dasypyrum villosum (M. Bieb.) Maire KU3905 VV P1 Lolium elongatum L. (outgroup) IR10-4, PRwz19 EE nt a KT–Kihara institute, Yokohama City Univ.; KU–Kyoto Univ.; OUH–Res. Inst. Biores., Okayama Univ.; H–Swedish Univ., Agric. Sci.; AT, BA and PI–Fac. Agric., Okayama Univ. nt–not tested.

matrices by a Neighbour-Joining (N-J) algorithm using the maximum composite likelihood method with bootstrap analysis using 1,000 replicates in the MEGA4.0 program (Tamura et al. 2007).

Fig. 1. Primers used for PCR amplification and sequencing of PolA1 Comparison of amino acid sequences in PolA1 exon 20 exon 20. DNA sequences of the exon 20 in all accessions were 806-bp The deduced amino acid sequences of exon 20 were in length except two accessions of Ae. bicornis (803-bp). 19ex5P and aligned among Triticum, Aegilops, and Hordeum using web 21ex3P located on the exons 19 and 21, respectively. 20ex5P was used server (http://align.bmr.kyushu-u.ac.jp/mafft/online/server/) as an internal sequencing primer. of Mafft ver. 6.0 (Kato and Toh 2008).

Analysis of plastid subtype identity (PSID) sequences Phylogenetic analyses of PolA1 exon 20 sequences DNA fragments (ca. 350 bp) containing PSID sequences The determined nucleotide sequences of PCR products were amplified by PCR from the total DNA extracts as a were analyzed to assign the positions of donor and acceptor template using a pair of common primers, PSID5P: 5′- sites of the exon 20 in the PolA1 gene using the NCBI web- GTAGC CGTTGTTAAACCAGGTCGAATACTTTATGA based Blast server (http://blast.ncbi.nlm.nih.gov/Blast.cgi, AAT-3′, PSID3P: 5′-ACAGCAACAAT ACGTCACCAAT Altschul et al. 1990) and software (Genetyx Software ver. ATGAGCATATCG-3′ (Nakamura et al. 1997, Takahashi 6.0; Software Development Co., Tokyo, Japan). A rooted et al. 2009b). PCR was performed for 35 cycles of 30 sec. at phylogenetic tree using nucleotide sequences data of the 94°C for denaturation, 30 sec. at 55°C for annealing, and PolA1 exon 20 was constructed from evolutionary distance 1min. at 72°C for elongation. Nucleotide sequences of DNA Introgressive PolA1 gene of Aegilops section Sitopsis species 605

Fig. 2. Agarose gel electrophoresis of PCR products (19ex5P and 21ex3P) containing exon 20 sequences in Triticum monococcum KT3- 1 (lane 1), Secale cereale KU4017 (2), Aegilops bicornis KU3-2 (3), Ae. bicornis KU14615 (4), Ae. speltoides KT115-8 (5), Dasypyrum villosum KU3905 (6), Hordeum vulgare BA4 (7), and Molecular marker (M). fragments were determined by direct sequencing using the same primer for the initial amplification.

Results

Amplification of DNA fragments containing PolA1 exon 20 DNA fragments (1.5–2.0 kb) containing PolA1 exon 20 were amplified by PCR using a pair of primers (19ex5P and 21ex3P; Fig. 1), and fractionated by agarose gel electrophoresis. As exon 20 DNA sequences were 806 bp in length in all accessions of Triticum, Aegilops, and Hordeum species as well as Secale, Dasypyrum, and Lolium species with the exception of two accessions (KU3-2, KU14610) of Ae. bicornis (803 bp), size variations of the amplified DNA fragments were due to differences in length of introns 19 and 20 in the PolA1 genes (Fig. 2). Sequence information for PolA1 genes obtained in this study was deposited to DDBJ data bank as accession Nos. AB501216–AB501270. Fig. 3. A phylogenetic tree based on exon 20 nucleotide sequences of PolA1 genes in Triticeae species. The multiple sequence alignments Phylogenetic analysis of the PolA1 exon 20 sequences used to construct the tree were generated using CLUSTALW. A Phylogenetic tree was constructed using nucleotide phylogenetic tree of PolA1 gene was constructed by N-J method in the sequences of PolA1 exon 20 among Triticum, Aegilops, MEGA4.0 software with a bootstrap approach by taking 1,000 repli- Hordeum and two related species using the N-J method in cates (Tamura et al. 2007). The evolutionary distances were computed the MEGA4.0 package (Fig. 3). Phylogenetic analysis of using the Maximum Composite Likelihood method (pairwise deletion PolA1 exon 20 clearly indicated that Triticum–Aegilops and option). Triticum–Aegilops and Hordeum species were distinctly clas- Hordeum species could be separated into Triticum and sified into two clades except seven accessions of the Sitopsis species (indicated by box), those belonged to the Hordeum clade. Two acces- Hordeum clades, respectively. Six accessions in three Sitopsis sions (B1) of Ae. bicornis were clustered into the Triticum clade species, Ae. searsii, Ae. longissima, and Ae. speltoides (SS whereas one accession (B2) belonged to the Hordeum clade. Two genome), were clustered into the Hordeum clade. Although Eurasian and seven American Hordeum species containing HH genome one accession (KU14615) of Ae. bicornis was related to the were clustered into the same clade. Secale cereale and Dasypyrum Hordeum clade, two accessions (KU3-2, KU14610) of villosum were positioned in the Triticum and Hordeum clades, respec- Ae. bicornis were belonged to the Triticum clade. Secale tively. Two accessions of Lolium elongatum were used as an out- cereale belonged to the Triticum clade whereas Dasypyrum group. Genome type of each species was shown in parenthesis. villosum was clustered with the Hordeum clade. In the Triticum clade, two AA genome species, T. monococcum and T. urartu, belonged to the same sub- were clustered into two different subclades. Secale cereale clade, and a group of three species, Ae. markgrafii (CC), (RR) was related to two Ae. bicornis accessions. In the Ae. umbellulata (UU), and Ae. tauschii (DD), and another of Hordeum clade, H. vulgare and H. bulbosum (II genome), two species, Ae. uniaristata (NN) and Ae. comosa (MM), H. murinum (XuXu), and H. marinum (XaXa) were clustered 606 Nakamura, Rai, Takahashi, Kato, Sato and Komatsuda

Fig. 4. Alignment of deduced amino acid sequences of PolA1 exon 20 between Triticum group; Tm: Triticum monococcum KT3-1, At: Aegilops tauschii AT7, SS: Secale cereale KU4017, B1: Ae. bicornis KU3-2, and Hordeum group; B2: Ae. bicornis KU14615, As: Ae. speltoides KT115- 8, Hr: Hordeum roshevitzii H7434, Dv: Dasypyrum villosum, Hv: H. vulgare. Asterisk and X indicated identical amino acid between two groups and amino acid substitution specific to each group, respectively. Ae. bicornis KU14615 and three other Sitopsis species shared the same amino acid sequence. into a single clade. Dasypyrum villosum (VV) was related to Variations of PSID sequences in Triticeae species these species. In contrast, all nine species with the HH ge- Only seven types (P1–P7) of the PSID sequence were nome formed another clade, in which two Eurasian species, found among Triticum, Aegilops and Hordeum species H. brevisubulatum and H. roshevitzii, were closely related (Fig. 5). One base substitution (T to A) at position 32 was to seven American species, H. erectifolium, H. pulbiflorum, found between Triticum–Aegilops (P1–P4) and Hordeum H. chilense, H. intercedens, H. pusillum, H. euclaston, and species (P5–P7). Although one base substitution (C to T) H. patagonicum. at position 46 was found between T. monococcum (P1) and T. urartu (P2), the P1-type sequence was contained in four Amino acid sequences of PolA1 exon 20 between Triticum Sitopsis species as well as three other Aegilops species, and Hordeum groups Ae. comosa, Ae. markgrafii, and Ae. uniaristata. The P1- The deduced PolA1 exon 20 amino acid sequences could type sequence was also found in Secale cereale and be clearly differentiated at 22 positions (indicated by “X” in Dasypyrum villosum. Unique insertions of 1-bp and 7-bp Fig. 4) between the Triticum group (T. monococcum and were detected in Ae. umbellulata (P3) and Ae. tauschii Ae. tauschii) and the Hordeum group (H. vulgare and (P4), respectively. Hordeum vulgare and H. bulbosum H. roshevitzii). Aegilops speltoides, one of the Sitopsis contained the same PSID sequence (P5). The P6 type species, showed the same amino acid substitutions as did sequence was shared by H. marinum and H. murinum. Hordeum group. Interestingly, KU3-2 and KU14610 (one Eurasian H. roshevitzii contained the P7 type, which was amino acid substitution at 101E to 101D, Fig. 4) of Ae. bicornis also found in four American species, H. erectifolium, had the B1 type sequence containing amino acid substitu- H. pulbiflorum, H. pusillum, and H. euclaston (Table 1). tions identical to those of Triticum group, whereas KU14615 contained the B2 type sequence closely related to Discussion Ae. speltoides and Hordeum group. The amino acid substitutions specific to each group were located in the first half of Hybrid speciation by allopolyploidization, as in Triticeae exon 20, whereas variations in the amino acid sequences in and Brassicae, is a basic phenomenon in plant evolution the later half were rather species-specific. Two related spe- (Mallet 2007). Allopolyploid species are reproductively iso- cies, Secale cereale and Dasypyrum villosum, were closely lated from their parental species by ploidy and both parental related to Triticum and Hordeum groups, respectively. species can be recognized by ordinary molecular genetics. On the other hand, recombinational or homoploid hybrid Introgressive PolA1 gene of Aegilops section Sitopsis species 607

Fig. 5. Alignment of four types PSID sequences (P1–P4) in Triticum–Aegilops species and three types (P5–P7) in Hordeum species. One base substitution (T to A) at the position 36 was specific to each group (Arrow). The P1-type sequence was shared by four Sitopsis species, Triticum monococcum, three Aegilops species, Secale cereale, and Dasypyrum villosum (Table 1). Triticum monococcum and T. urartu were differentiated by one base substitution at the positon 46 (Asterisk). Hordeum vulgare and H. bulbosum (II genome) had the P5 type. H. marinum (XaXa) shared the P6 type with H. murinum (XuXu). speciation without changes in chromosome number have sion as illustrated in Fig. 6. Hybridization between Species been considered very rare because there is generally no A (female) and Species B (male) occurs, and the hybrid is reproductive barrier between hybrids and their parental backcrossed with Species A (or related species), followed by species (Rieseberg 1997). One well-documented example several backcrosses with Species A (introgressive hybridiza- of hybrid speciation in plants was three species of desert tion). If an introduced gene fraction (IGF) from Species B by sunflower, Helianthus anomalus, H. deserticola, and introgression encodes common proteins such as housekeep- H. paradoxus, which were hybrid species derived from ing enzymes or storage proteins, the backcrossed progeny hybridization between H. annuus and H. petiolaris (Buerkle will be considered the same as Species A (sympatric intro- et al. 2000, Gross and Rieseberg 2005). These hybrid species gression), whereas if the IGF creates some divergent proper- are differentiated from their parental species by the abilities ties, the hybrid will be distinguished as a subspecies within to survive under conditions of severe drought. If hybrid Species A (allopatric introgression). and parents compete to occupy the same habitat, one may The hybrids arising from hybridization between genera or become extinct, or they may merge into a single species between distantly related species are generally male-sterile. complex. Therefore, extensive backcrossing with pollen donors is nec- Most hybrids between distantly related species are repro- essary to recover self-fertility of the backcrossed progeny. ductively sterile. The sterile hybrids have three choices to As the relationship between the two species is less related to maintain their genetic lineages; 1) propagation as clones, 2) each other, although the IGF of the progeny will be smaller, recovery of fertility by doubling their chromosome number it may have a stronger allopatric effect for the establishment (amphidiploidy), and 3) repeated backcrossing (introgres- of a new species. Many instances of sympatric and allopatric sion) with one of the parental species until self-fertility is introgressions between closely related species have been re- restored. In the first and second cases, hybrids can be easily ported but the origin of species by the intergenus hybridiza- characterized by molecular genetic analysis, but in the third tion and extensive backcrossing (introgressive homoploid case, identification of the DNA sequences introduced by the hybrid speciation) has not been reported. original hybridization is very difficult because the genomes Although it has not been suggested that Aegilops section of the backcrossing parent and backcrossed hybrids will be Sitopsis species originated through hybrid speciation, we identical, except for short stretches of the introduced DNA found signature sequences from Hordeum species in PolA1 sequences. exon 20 of four Sitopsis species (Fig. 3 and Fig. 4). Phylo- Anderson (1953) postulated speciation through introgres- genetic analysis of PolA1 exon 20 sequences indicated that 608 Nakamura, Rai, Takahashi, Kato, Sato and Komatsuda

and Ae. uniaristata (Table 1 and Fig. 5). The Sitopsis species are morphologically recognized as species in the genus Aegilops (van Slageren 1994). Molecular data indicated that Sitopsis species had a close relationship to polyploid species in the genus Triticum (Petersen et al. 2006, Salina et al. 2006). These results suggest that the Sitopsis species might have originated by ancient hybridization between ancestors of Triticum–Aegilops species (female, B1 type PolA1 in Fig. 4) and Hordeum species (male, B2 type), and presum- ably by backcrossing of the resulting hybrid(s) with ancestors of Triticum–Aegilops. In fact, the intergenus hybridization between diploid Hordeum and diploid Triticum– Aegilops species is impossible today. Even in artificial crossing between hexaploid wheat and Hordeum vulgare, successful production of the hybrids requires 2,4-D treat- ment just after crossing. Petersen et al. (2006) analyzed sequences of two single copy nuclear (DMC1 and EF-G) genes and one plastid (ndhF) gene, and concluded that one of the Sitopsis species, Ae. speltoides, had the BB genome and was the cytoplasmic donor of T. aestivum. Salse et al. (2008) also reported sequence similarity of the SPA gene region between BB and SS genomes. However, Takahashi et al. (2009b) showed that Ae. speltoides was the GG genome donor to T. timopheevii based on analysis of the PolA1 gene. Thus, the PolA1 gene may be a component of IGF, which was probably introduced into an ancestor of Ae. speltoides and other Sitopsis species from Hordeum species by introgression. Dasypyrum villosum may also be an introgressive hybrid species because its PolA1 gene was related to those of Hordeum species, whereas the PSID sequence was of the P1 type found in Triticum–Aegilops species. The relationships of Secale cereale and some Aegilops species should be con- Fig. 6. Schematic representation for the introgressive homoploid hy- firmed from the viewpoint of hybrid speciation because of brid speciation between genera or between distantly related species. inconsistency in phylogenies between PolA1 and PSID se- Hybridization occurs between Species A (female) and Species B quences (Table 1 and Fig. 4). Sasanuma et al. (2004) also re- (male), and hybrid(s) backcross with Species A or related species. An ported the incongruity between chloroplast and nuclear data introduced gene fraction (IGF) from Species B by introgressive hy- in the genus Aegilops. bridization contributes to either differentiation of the backcrossed progeny (allopatric) or not (sympatric), as defined by Anderson Based on the analysis of EF-G gene in Hordeum, (1953). In cases of hybridization between distantly related (intergenus) Komatsuda et al. (1999) reported that II and XuXu genome species, as most hybrids are male-sterile, the IGF will be small species were separated from XaXa and HH genome spe- because of extensive backcrosses with pollen donors to restore the cies. Analysis of thioredoxin-like gene and RPB2 gene self-fertility. But the small IGF may have an allopatric effect for the showed the same patterns (Kakeda et al. 2009, Sun et al. establishment of the progeny as a new species. 2009). In the present study, II, XuXu, and XaXa genome species were clustered into a single clade based on the PolA1 gene (Fig. 3). As the same P6 type PSID sequence two accessions of Ae. bicornis (B1 type) were closely related was shared with XuXu and XaXa genome (Table 1), to S. cereale in the Triticum clade whereas one accession of H. marinum may be a hybrid species. In the HH genome, Ae. bicornis (B2 type) and six accessions of three other two Eurasian species, H. roshevitzii and H. brevisubulatum, Sitopsis species shared the identical amino acid sequence, and seven American species, H. erectifolium, H. pulbiflorum, which was closely related to those of HH genome species, H. chilense, H. intercedens, H. pusillum, H. euclaston, and such as H. roshevitzii, in the Hordeum clade (Fig. 3 and H. patagonicum, were separated into two clades; however, Fig. 4). This phylogeny based on the PolA1 gene was incon- these species were closely related to each other to form a sistent with that based on the PSID sequence because four single monophyletic group (Komatsuda et al. 1999). PSID Sitopsis species showed the P1 type PSID sequence, which sequences of five HH genome species were identical (P7 was shared by T. monococcum, Ae. comosa, Ae. markgrafii, type). These results suggested that the American HH Introgressive PolA1 gene of Aegilops section Sitopsis species 609 genome species were probably introduced from Eurasia small quantities of fresh leaf tissue. Phytochem. Bull. 19: 11–15. (Blattner 2006, 2009) as American black rice was brought Dvorak, J. and H. Zhang (1990) Variation in repeated sequences sheds from Africa during the slave trade in the 17th century light on the phylogeny of the wheat B and G genomes. Proc. Natl. (Carney 2002). Acad. Sci. USA 87: 9640–9644.

Introgressive homoploid hybrid speciation may be a rath- Eig, A. (1929) Monographisch-kritische Uebersicht der Gattung Aegilops. Rep. Spec. Nov. Reg. Veget. Berh. 55: 1–228. er common mechanism responsible for the establishment of Gill, B.S. and P.D. Chen (1987) Role of cytoplasmic specific introgres- a significant number of species in Triticeae. The develop- sion in the evolution of the polyploid wheats. Proc. Natl. Acad. Sci. ment of a new methodology will be required to resolve intro- USA 84: 6800–6804. gressive hybrid speciation. Although full genome sequenc- Golovnina, K., S. Gluskov, A. Blinov, V. Myorov, L. Adkison and ing may be a straightforward way to identify chromosomal N.Goncharov (2007) Molecular phylogeny of the genus Triticum L. fragments introduced by introgression, such analysis using Plant Syst. Evol. 264: 195–216. limited numbers of species or accessions may lead to mis- Gross, B.L. and L.H. Rieseberg (2005) The ecological genetics of leading phylogenetic reconstruction. Because PolA1 gene homoploid hybrid speciation. J. Hered. 96: 241–252. contains species- or genus-specific variations (Zhang et al. Hammer, K. (1980) Zur Taxonomie und Nomenklatur der Gattung 2008, Takahashi et al. 2009a, Takahashi et al. 2009b), in ad- Aegilops. Feddes Repert 91: 225–258. dition to ordinary phylogenetic analyses using many genes Hebert,P.D.N., A.Cywinska, S.L.Ball and J.R.deWaard (2003) Bio- logical identifications through DNA barcodes. Proc. R. Soc. Lond. or DNA markers, comparative analysis of nuclear PolA1 B Biol. Sci. 270: 313–321. exon 20 and plastid PSID sequences will be useful to find Huang, S., A. Sirikhachornkit, X. Su, J. Faris, B. Gill, R. Haselkorn and evidence of introgressive homoploid hybrid speciation. If P. Gornicki (2002) Genes encoding plastid Acetyl-CoA Carboxy- the tiny IGF in the Sitopsis genome was involved in their lase and 3-Phosphoglycerate kinase of the Triticum/Aegilops com- speciation, the Sitopsis species will be an excellent model in plex and the evolutionary history of polyploid wheat. Proc. Natl. which to examine a novel mechanism of speciation of plants. Acad. Sci. USA 99: 8133–8138. Kakeda, K., S. Taketa and T. Komatsuda (2009) Molecular phylogeny Acknowledgements of the genus Hordeum using thioredoxin-like gene sequences. Breed. Sci. 59: 595–601.

We are grateful to Professor M. Mii of Chiba University for Kato,K. and H.Toh (2008) Recent developments in the MAFFT mul- his encouragement and helpful advice on this research. The tiple sequence alignment program. Brief. Bioinf. 9: 286–298. Kihara, H. (1944) Discovery of the DD-analyser, one of the ancestors authors thank Dr. K. Sasanuma, Yamagata University, Dr. of Triticum vulgare. Agric. Hort. 19: 13–14. N. Mori, Kobe University and Dr. T. Kawahara, Kyoto Uni- Kilian, B., H. Özkan, O. Deusch, S. Effgen, A. Brandolini, J. Kohl, versity for the valuable supports to this study. This work was W.Martin and F. Salamini (2007) Independent wheat B and G supported by Sato Project, Research Institute of Humanity genome origins in outcrossing Aegilops progenitor haplotypes. and Nature (Contribution No. 17 of Sato Project, RIHN). Mol. Biol. Evol. 24: 217–227. Kimura, M. (1968) Evolutionary rate at the molecular level. Nature Literature Cited 217: 624–626. Komatsuda, T., K. Tanno, B. Salomon, T. Bryngelsson and R.v. Bothmer Altschul, S., W. Gish, W. Miller, E. Myers and D. Lipman (1990) Basic (1999) Phylogeny in the genus Hordeum based on nucleotide se- local alignment search tool. J. Mol. Biol. 215: 403–410. quences closely linked to the vrs1 locus (row number of spikelets). Anderson, E. (1953) Introgressive hybridization. Biol. Rev. 28: 280– Genome 42: 973–981. 307. Mallet, J. (2007) Hybrid speciation. Nature 446: 279–283. Blattner, F. (2006) Multiple intercontinental dispersals shaped the dis- McFadden, E.S. and E.R. Sears (1946) The origin of Triticum spelta tribution area of 250 Hordeum (Poaceae). New Phytol. 169: 603– and its free-threshing hexaploid relatives. J. Hered. 37: 81–89, 614. 107–116. Blattner, F. (2009) Progress in phylogenetic analysis and a new infra- Miyashita, N., N. Mori and K. Tsunewaki (1994) Molecular variation in generic classification of the barley genus Hordeum (Poaceae: chloroplast DNA regions in ancestral species of wheat. Genetics Triticeae). Breed. Sci. 59: 471–480. 137: 883–889. Bothmer, R.v., N. Jacobsen, C. Baden, R.B. Jørgensen and I. Linde- Mori, N., N.T. Miyashita, T. Terachi and C. Nakamura (1997) Variation Laursen (1995) An ecogeographical study of the genus Hordeum. in coxII intron in the wild ancestral species of wheat. Hereditas 2nd ed. Systematic and Ecogeographic Studies on Crop Genepools. 126: 281–288. 7. International Plant Genetic Resources Institute, Rome. Nakamura, I., N. Kameya, Y. Kato, S. Yamanaka, H. Jomori and Y.-I. Buerkle, C.A., R.J. Morris, M.A. Asmussen and L.H. Rieseberg (2000) Sato (1997) A proposal for identifying the short ID sequence which The likelihood of homoploid hybrid speciation. Heredity 84: 441– addresses the plastid subtype of higher plants. Jpn. Breed. Sci. 47: 451. 385–388. Carney, J.A. (2002) Black Rice: The African origins of rice cultivation Ogiwara, Y. and K. Tsunewaki (1988) Diversity and evolution of chlo- in the Americas. Harvard University Press, p. 256. roplast DNA in Triticum and Aegilops as revealed by restriction Chalupska, D., H.Y. Lee, J.D. Faris, A. Evrard, B. Chalhoub, R. Haselkorn fragment analysis. Theor. Appl. Genet. 76: 321–332. and P. Gornicki (2008) Acc homoeoloci and the evolution of wheat Petersen, G., O. Seberg, M. Yde and K. Berthelsen (2006) Phylogenetic genomes. Proc. Natl. Acad. Sci. USA 105: 9691–9696. relationships of Triticum and Aegilops and evidence for the origin Doyle, J.J. and J.D. Doyle (1987) A rapid DNA isolation procedure for of the A, B, and D genomes of common wheat (Triticum aestivum). 610 Nakamura, Rai, Takahashi, Kato, Sato and Komatsuda

Mol. Phylogenet. Evol. 39: 70–82. lution and phylogeny of the RPB2 gene in the genus Hordeum. Provan, J., P. Wolters, K.H. Caldwell and W. Powell (2004) High reso- Ann. Bot. 103: 975–983. lution organellar genome analysis of Triticum and Aegilops sheds Takahashi, H., T. Sato, Y.-I. Sato and I. Nakamura (2009a) Genome- new light on cytoplasm evolution in wheat. Theor. Appl. Genet. type-specific variation of the 19th intron sequence within the RNA 108: 1182–1190. polymerase I largest subunit gene in the genus Oryza. Plant Syst. Rieseberg, L.H. (1997) Hybrid origins of plant species. Annu. Rev. Evol. DOI 10.1007/s00606-009-0172-x. Ecol. Syst. 28: 359–389. Takahashi, H., B. Rai, K. Kato and I. Nakamura (2009b) Divergent evo- Riley, R., J. Unrau and V. Chapman (1958) Evidence on the origin of lution of wild and cultivated subspecies of Triticum timopheevii as the B genome of wheat. J. Hered. 49: 91–98. revealed by the study of PolA1 gene. Genet. Resour. Crop Evol. Salina, E.A., K.Y. Lim, E.D. Badaeva, A.B. Shcherban, I.G. Adonina, DOI 10.1007/s10722-009-9454-y. A.V. Amosova, T.E. Samatadze, T.Y. Vatolina, S.A. Zoshchuk and Tamura, K., J. Dudely, M. Nei and S. Kumar (2007) MEGA4: Molecu- A.R. Leitch (2006) Phylogenetic reconstruction of Aegilops section lar evolutionary genetics analysis (MEGA) software Version 4.0. Sitopsis and the evolution of tandem repeats in the diploids and Mol. Biol. Evol. 24: 1596–1599. derived wheat polyploids. Genome 49: 1023–1035. Tanaka, M. (1983) Geographical distribution of Aegilops species based Salse, J., V. Chagué, S. Bolot, G. Magdelenat, C. Huneau, C. Pont, on collection at the Plant Germplasm Institute, Kyoto Univ., Proc. H.Belcram, A. Couloux, S. Gardais, A. Evrard et al. (2008) New VI Int. Wheat Genet. Symp. Kyoto. insights into the origin of the B genome of hexaploid wheat. Terachi, T., Y. Ogiwara and K. Tsunewaki (1990) The molecular basis Evolutionary relationships at the SPA genomic region with the S of genetic diversity among cytoplasms of Triticum and Aegilops. genome of the diploid relative Aegilops speltoides. BMC Biol. 9: Theor. Appl. Genet. 80: 366–373. 555. DOI 10.1186/1471-2164-9-555 van Slageren, M.W. (1994) Wild wheats: a monograph of Aegilops L. Sallares, R. and T.A. Brown (2004) Phylogenetic analysis of complete and Amblyopyrum (Jaub & Spach) Eig (Poaceae). Joint publication 5′ external transcribed spacers of the 18S ribosomal RNA genes of of ICARDA, Aleppo, Syria and Wageningen Agricultural Univer- diploid Aegilops and related species (Triticeae, Poaceae). Genet. sity, The Netherlands. Res. and Crop Evol. 51: 701–712. Wang, G., N. Miyashita and K. Tsunewaki (1997) Plasmon analysis of Sang, T. (2002) Utility of low-copy nuclear gene sequences in plant Triticum (wheat) and Aegilops: PCR-single-strand conformational phylogenetics. Crit. Rev. Biochem. Mol. Biol. 37: 121–147. polymorphism (PCR-SSCP) analyses of organellar DNAs. Proc. Sasanuma, T., K. Miyashita and K. Tsunewaki (1996) Wheat phylogeny Natl. Acad. Sci. USA 94: 14570–14577. determined by RFLP analysis of nuclear DNA.3. Intra- and inter- Yamane, K. and T. Kawahara (2005) Intra- and interspecific phylo- specific variations of five Aegilops Sitopsis species. Theor. Appl. genetic relationships among diploid Triticum-Aegilops species Genet. 92: 928–934. (Poaceae) based on base-pair substitutions, indels and microsatel- Sasanuma, T., K. Chabane, T.R. Endo and J. Valkoun (2004) Character- lites in chloroplast noncoding sequences. Am. J. Bot. 92: 1887– ization of genetic variation in and phylogenetic relationships 1898. among diploid Aegilops species by AFLP: incongruity of chloro- Zhang, X.W., H. Takahashi, I. Nakamura and M. Mii (2008) Molecu- plast and nuclear data. lar discrimination among taxa of Petunia axillaris complex and Stebbins, G.L. (1956) Taxonomy and the evolution of genera with P. integrifolia complex based on PolA1 sequence analysis. Breed. special reference to the family Gramineae. Evolution 10: 235–245. Sci. 58: 71–75. Sun, G., M. Pourkheirandish and T. Komatsuda (2009) Molecular evo-