Angiopoietin-2 Is a Site-Specific Factor in Differentiation of Mouse Renal Vasculature

J Am Soc Nephrol 11: 1055–1066, 2000 Angiopoietin-2 Is a Site-Specific Factor in Differentiation of Mouse Renal Vasculature

HAI TAO YUAN,* CHITRA SURI,‡ DAVID N. LANDON,† GEORGE D. YANCOPOULOS,‡ and ADRIAN S. WOOLF* *Nephrourology Unit, Institute of Child Health and †Department of Clinical Neurology, Institute of Neurology, University College London Medical School, London, United Kingdom; and ‡Regeneron Pharmaceuticals Inc, Tarrytown, New York.

Abstract. Angiopoietin-1 (Ang-1) stimulates endothelial and cated in multiple layers of vessel wall cells, extending further vascular network differentiation through the Tie-2 receptor from the endothelium than ␣-smooth muscle actin. The mes- tyrosine kinase, while Ang-2 modulates this activation in em- angium of immature glomeruli also expressed LacZ. In the first bryo and tumor growth. The nephrogenic pattern of Ang-2 was 3 postnatal weeks, a new pattern became evident, with intense documented in a mouse strain that expresses the LacZ reporter X-gal staining in the inner stripe of the outer medulla, where a gene driven by the Ang-2 promoter. Heterozygous animals subset of thin descending limbs of loops of Henle expressed the were healthy with morphologically normal kidneys, and they transgene. This dynamic and developmentally regulated pat- were examined after X-gal staining. At embryonic days 10.5 tern indicates that Ang-2 is an early marker of the renal (E10.5) and E12.0, transgene expression was absent in the pericyte and vascular smooth muscle lineage and is also an mesonephros and metanephros. At E14.0, expression was epithelial-derived growth factor. Because Tie-2 is widely ex- noted in the metanephric artery and its major branches. At pressed by differentiating renal endothelia, this study is con- E19.0 and in neonatal kidneys, expression was maintained in sistent with the hypothesis that Ang-2 has roles in kidney larger renal artery branches, extending to arcuate and smaller vascular maturation. cortical vessels. Histologically, transgene expression was lo-

There is growing interest in the cell lineage of the renal vascula- gesting a nephrogenic role for this gene (13). Tie-1 is ex- ture and in the molecules controlling its construction (1–4). Re- pressed in mouse metanephroi from E11.0 (9), with levels ceptor tyrosine kinases (RTK) direct endothelial differentiation in peaking in the first few weeks after birth (14). When avascular diverse nonrenal vascular beds (5,6). The most investigated group E11.0 Tie-1/LacZ metanephroi were implanted into wild-type includes vascular endothelial growth factor receptors (VEGFR), neonatal kidneys (9), transgene-expressing glomerular and with VEGFR-2 initiating endothelial formation and VEGFR-1 stromal capillaries developed in transplants, demonstrating in modulating vessel assembly (5,6). Both are expressed by mouse situ differentiation from Tie-1-positive precursors (9). Further- renal mesenchyme on embryonic day 11.0 (E11.0) and by endo- more, Tie-1-expressing metanephric capillaries were upregu- thelia later in nephrogenesis (7–9). VEGF is expressed from the lated in hypoxic organ culture (15). No ligand has been re- inception of murine metanephrogenesis (9), and functional exper- ported for Tie-1. iments implicate this ligand in metanephric endothelial prolifera- Tie-2 is a Tie-1 homologue and its ligands are encoded by tion and glomerulogenesis (8,10,11). angiopoietin (Ang) genes. Ang-1 binds Tie-2 eliciting tyrosine Less is known about the Tie genes (tyrosine kinase contain- phosphorylation (16) and, although it does not stimulate endo- ing immunoglobulin-like loops and epidermal growth factor thelial proliferation (16), it prevents apoptosis (17) and causes similar domains), which constitute another class of endothelial sprouting in synergy with VEGF (18). Ang-1 (19) and Tie-2 RTK. As endothelia differentiate, the onset of Tie expression (12,20) null mutant mouse embryos have abnormal vascular postdates VEGFR-2 but precedes maturity (5,6). Tie-1 null network formation with growth-retarded pericytes and vascular embryos die with impaired vessel integrity (12), and mutant smooth muscle precursors. Folkman and D’Amore (21) postu- cells in chimeras fail to contribute to renal vasculature, sug- lated that Tie-2 signaling caused endothelial stabilization with reciprocal, maturational effects on pericytes elicited by endothelial-derived factors such as platelet-derived growth fac- Received August 12, 1999. Accepted October 12, 1999. tor-B. Recent experiments show that Ang-1 is also a hemato- Correspondence to Dr. Hai Tao Yuan, Nephrourology Unit, Institute of Child poietic factor (22). Additional angiopoietins have been cloned Health, University College London, 30 Guilford Street, London WC1N 1EH, (6,23,24). Ang-2 binds Tie-2 in cultured endothelia but does United Kingdom. Phone: ϩ44 020 7242 9789; Fax: ϩ44 020 7916 0011; E-mail [email protected] not cause tyrosine phosphorylation in these cells (23). Instead, 1046-6673/1106-1055 it antagonizes Ang-1-induced Tie-2 phosphorylation, while Journal of the American Society of Nephrology Ang-2 overexpression in vivo causes defects resembling Tie-2 Copyright © 2000 by the American Society of Nephrology and Ang-1 null mutants (23). 1056 Journal of the American Society of Nephrology J Am Soc Nephrol 11: 1055–1066, 2000

Expression studies in nonrenal tissues are consistent with the Positive clones were used to create chimeric mice by standard proto- hypothesis that Ang-1 and Ang-2 are expressed by smooth cols (30). This resulted in mice in which the LacZ gene was driven by muscle cells, pericytes, and their precursors, and exert para- the Ang-2 promoter, i.e., Ang-2/LacZ mice. For the current experi- crine effects on Tie-2-expressing endothelia (16,23,25,26). ments, Ang-2/LacZ heterozygous mice and wild-type littermates were However, certain endothelia can express Ang-2 in vitro generated by mating heterozygous males and females. Mice were genotyped by PCR using DNA extracted from embryo heads or (26,27), raising the additional possibility of an autocrine ac- postnatal tail snips (31). Primers were designed to amplify one mu- tion. Ang-2 has also been implicated in hepatocellular carci- tated band (280 bp) or a wild-type band (380 bp), which were nomas and glioblastoma growth (28,29), where it may facilitate visualized after electrophoresis through ethidium bromide-stained sprouting by destabilizing existing capillaries, and in cycling agarose gels. The primers used were: 5ЈGDT: CTGGGATCTTGTCT- ovarian follicles (23). The final effects of Ang-2 probably TGGCC; mL2-intron1US1: CTTCTCTCTGTGACTGCTTTGC; and depend not only on the local expression of Ang-1 and Tie-2, neo3Јds85: GAGATCAGCAGCCTCTGTTCC. but also on the activity of yet other factors such as VEGF PCR was performed for 30 cycles: 1 min denaturing at 95°C, 30 s (6,23). annealing at 63°C, and 30 s extension at 72°C. In this study, we documented the nephrogenic pattern of Mouse gestation lasts 21 d and the vaginal plug day was designated Ang-2 in a mouse strain that expresses the LacZ reporter gene E0.0. Ages examined were E10.5, E12.0, E14.0, E19.0, the day of driven by the Ang-2 promoter. LacZ codes for bacterial ␤-ga- birth (neonatal), and 1, 3, and 8 wk postnatal (P1, P3, and P8). At least six animals (three wild-type and three heterozygous mice) were ex- lactosidase, which is easily localized in tissues by the X-gal amined at each stage from at least two litters, and consistent results reaction (9,15). We demonstrate that Ang-2 is expressed at were reported. To count nephrons in neonatal and P3 mice (32), we critical stages of renal vascular maturation, first by mesenchy- incubated whole kidneys in hydrochloric acid for 10 to 50 min at mal-derived endothelial support cells including pericytes, 37°C, then rinsed them in tap water and stored them overnight at 4°C. smooth muscle cells, and mesangial cells, and second by tu- Glomeruli were counted after mechanical dissociation. bular epithelia near the maturing vasa rectae. X-Gal Staining Materials and Methods Metanephric and postnatal kidneys were fixed in 4% paraformal- Reagents were obtained from Sigma Chemical Co. (St. Louis, MO) ␤ dehyde, 2 mM MgCl2, and 5 mM ethyleneglycol bis( -aminoethyl unless otherwise specified. ether)-N,NЈ-tetra-acetic acid in phosphate-buffered saline (PBS) for 60 min at 4°C and washed 3 times in 1ϫ PBS. Staining was performed ⅐ Ang-2/LacZ Mice by incubation with 5 mM K3Fe(CN)6,5mMK4Fe(CN)6 3H2O, 2 A promoterless LacZ gene and Ang-2 gene fragments were used to mM MgCl2, 0.01% sodium deoxycholate, 0.02% Nonidet P-40, and 1 construct a targeting vector, which was introduced into embryonic mg/ml 4-chloro-5-bromo-3-indolyl-␤-D-galactopyranoside to allow stem cells to disrupt the Ang-2 gene (see Table 1 in reference (6) (C. optimal detection of cytoplasmic reporter gene product while abol- Suri, J. McClain, M. V. Simmons, T. Sato, and G. D. Yancopoulos. ishing background staining from endogenous galactosidase (9,15). manuscript in preparation), as described for Ang-1 null mutants (19). Tissues were examined as whole mounts or were paraffin-embedded and sectioned at 10 ␮m. Sections were counterstained with hematoxylin, and some were subjected to immunohistochemistry, described below. Other tissues were processed for electron microscopy to visu- Table 1. LacZ expression driven by the Ang-2 promoter in a alize intracellular crystals produced by the X-gal reaction (33). Kid- mouse metanephros neys were fixed in 3% glutaraldehyde in pH 7.4 0.1 M sodium cacodylate and 5 mM NaCl. Ultrathin sections were cut on an RTC E10.5 and 12.0 MT6000 ultramicrotome using a Diatome diamond knife (Agar Sci- no expression entific Ltd., Stansted, United Kingdom). Sections were stained with E14.0 25% uranyl acetate in 50% methyl alcohol and Reynold’s lead citrate, pericytes and smooth muscle of main renal artery and its each for 20 min, and grids were examined with a JEOL 1200EX branches electron microscope (Tokyo, Japan). Other sections were examined E19.0 and neonate without uranyl acetate because preliminary experiments revealed that pericytes and smooth muscle of renal artery major X-gal reaction product crystals were visualized more easily in this branches, arcuate, and smaller cortical arteries; manner, albeit with some loss of tissue definition. mesangium; *small medullary vessels; *terminal part of proximal tubule; *descending thin limb of loop of Immunohistochemistry Henle Paraffin sections were treated with trypsin (1 mg/ml) for 10 min at

P1 37°C. Endogenous peroxidase was quenched with 3% H2O2 in meth- as for E19.0-neonatal stages, with more intense expression anol for 30 min at room temperature, and sections were blocked in in medullary structures 10% goat serum with 0.1% Tween 20. They were reacted with an P3 and P8 alkaline phosphatase-conjugated antibody to ␣-smooth muscle actin ␣ downregulation apart from outer medulla tubules near ( -SMA) (1:100; Sigma; A-5691) or a horseradish peroxidase-conju- ␣ vasa recta gated antibody to anti- -SMA (1:100; DAKO; U7033), a vascular wall marker (34); an antibody to aquaporin-1 (a gift from Mark A. a Ang-2, angiopoietin-2; E, embryonic day; P, postnatal week; *, Knepper, National Institutes of Health, Bethesda, MD), a marker of a weak signal. subset of thin descending limbs of loops of Henle and descending vasa J Am Soc Nephrol 11: 1055–1066, 2000 Ang-2 in Mouse Renal Vasculature 1057

Figure 1. Angiopoietin-2 (Ang-2)/LacZ expression in early nephrogenesis in heterozygous mice. X-gal staining appeared as a cytoplasmic, light blue color. B through D and F through J were stained with hematoxylin. H was also immunostained for ␣-smooth muscle actin (␣-SMA). (A) Embryonic day 10.5 (E10.5) whole mount embryo with forelimb removed demonstrated Ang-2/LacZ expression in cardiac outflow tract (a), liver (b), dorsal aorta (c), and allantois (d). (B) Histology of E10.5 liver. (C) E10.5 mesonephros contained tubules (t) and capillaries (c), which did not express Ang-2/LacZ. (D) E12.0 metanephros contained capillaries (c) around ureteric bud branches (u) and was X-gal-negative. (E) Whole mount of E14.0 abdominal cavity where aorta (a), adrenal glands (b), and metanephroi (c) expressed the transgene. (F) Ang-2/LacZ expression in E14.0 aorta (a), metanephric artery (b), and its branches (c). (G) Multiple layers of transgene-expressing cells in wall of E14.0 aorta. Aortic endothelia also expressed Ang-2/LacZ and some had collapsed into the lumen during processing. (H) As for G, with ␣-SMA immunostaining (red). (I) Transgene-expressing cells in wall of a branch of the E14.0 metanephric artery; its endothelia (arrowheads) did not express Ang-2/LacZ. (J) E14.0 metanephric glomeruli did not express Ang-2/LacZ. Bars: 8 ␮m in B through D and G through I; 24 ␮minF. 1058 Journal of the American Society of Nephrology J Am Soc Nephrol 11: 1055–1066, 2000

Figure 2. Whole mount X-gal staining in late nephrogenesis. All preparations were stained with X-gal. (A) Low-power view of wild-type metanephros (left) and an Ang-2/LacZ heterozygous littermate (right). The former was unreactive with X-gal, whereas the latter was positive. Note similar sizes of the organs. B and C show intermediate and higher-power views of a heterozygous organ with Ang-2/LacZ expression extending to third and fourth order renal artery branches. D and E show intermediate and higher-power views of sectioned heterozygous organs. Transgene-expressing arcuate vessels (letter a in E) at the border of the cortex and medulla, and small cortical vessels were visualized (letter x in E). (F) Whole mount of postnatal week 1 (P1) organ sectioned through the middle of the kidney. Note clusters of transgene-expressing juxtamedullary glomeruli (arrowheads) and arrays of fine structures aligned to the longitudinal axis of the medulla. (G) High power view of F. J Am Soc Nephrol 11: 1055–1066, 2000 Ang-2 in Mouse Renal Vasculature 1059

Table 2. Kidney weights and nephron numbersa At E10.5, the mesonephros contained capillaries and tubules but did not express the transgene (Figure 1C), nor did the Weight per Glomeruli Group Kidney (mg) per Kidney avascular metanephric primordium (not shown). The E12.0 metanephros contained patent capillaries around ureteric bud Neonatal branches but no Ang-2/LacZ expression was detected in het- wild type (n ϭ 6) 5.7 Ϯ 1.3 1,638 Ϯ 168 erozygous organs (Figure 1D). At E14.0, metanephric Ang-2/ heterozygous Ang-2/LacZ 6.5 Ϯ 0.9 1,694 Ϯ 198 LacZ expression was detected in whole mounts (Figure 1E); (n ϭ 40) dorsal aorta and adrenal glands were also positive. Histology P3 (Figure 1F) demonstrated transgene expression around aorta, wild type (n ϭ 8) 57 Ϯ 24 11,325 Ϯ 1,285 renal artery, and its first-order metanephric branches. A high- heterozygous Ang-2/LacZ 60 Ϯ 26 11,867 Ϯ 1,472 power view of the dorsal aorta (Figure 1G) demonstrated (n ϭ 6) multiple layers of Ang-2/LacZ-expressing cells around the a Ϯ lumen. Transgene expression tended to be more extensive than All values are given as mean SD. There was no significant ␣ difference between the wild types and heterozygous data at either for -SMA, which was confined to cells near the endothelium time point. (Figure 1, compare H and G). There was a compact arrangement of X-gal-positive cells around the renal artery and its intrarenal branches (Figure 1I). Endothelial cells in the dorsal recta (35); and an antibody to Tamm-Horsfall glycoprotein (1:50; aorta expressed Ang-2/LacZ (Figure 1, G and H), whereas Europa Bioproducts Ltd., Cambridge, United Kingdom), a marker of those in renal artery branches were negative (Figure 1H). The thick ascending limbs of loops of Henle (36). Bound aquaporin-1 and first metanephric glomeruli formed by E14.0 and were X-gal- Tamm-Horsfall glycoprotein antibodies were detected with the negative (Figure 1J). streptavidin-biotin peroxidase ABC kit (DAKO, High Wycombe, ␣ United Kingdom), producing a brown product. For -SMA, we used Late Nephrogenesis either Fast Red for the Sigma antibody or diaminobenzidine for the DAKO antibody. Both gave essentially similar results apart from the At E19.0 and in neonatal kidneys, a similar and complex vasa recta area, where only the peroxidase technique was sensitive pattern of Ang-2/LacZ transgene expression was found. Wild- enough to detect ␣-SMA immunoreactivity in the pericytes of the type control kidneys showed no X-gal staining and were of descending vasa recta. similar size to heterozygous littermates (Figure 2A). Neither kidney weights nor numbers of glomeruli showed any signif- Statistical Analyses icant difference between the two groups on the first day after Results are given as mean Ϯ SD. Group means were compared birth (Table 2). In whole mounts of heterozygous kidneys, the using the t test. transgene was expressed in renal artery branches, extending to third- and fourth-order vessels (Figure 2, A through C). Sec- Results tioning whole mounts allowed visualization of Ang-2/LacZ The mouse metanephros begins to form on E10.5 when the expression in arcuate vessels at the junction of cortex and ureteric bud branches from the mesonephric duct toward an medulla (Figure 2, D and E). Figure 3, A through C, shows avascular area of intermediate mesoderm, the renal mesen- micrographs of heterozygous neonatal kidneys reacted with chyme (1). At this time, the mesonephric kidneys are more X-gal and immunostained for ␣-SMA. Glomeruli expressed developed and contain tubules and capillaries. By E12.0, the the transgene in the hilum and the mesangium (Figure 3, A and ureteric bud has branched a few times and a capillary network G). Weak Ang-2/LacZ expression was also noted in a few cells appears between metanephric epithelia (1). The first metaneph- in the terminal portions of proximal tubules and descending ric glomeruli form by E14.0, and new layers of nephrons are thin limbs of loops of Henle (Figure 3B), and thinner, parallel generated to P1 (1). In contrast, medullary differentiation is medullary structures considered to be small vessels (Figure most marked in the 3 wk after birth (14). We therefore de- 3C). These organs expressed ␣-SMA in small cortical arteries scribed results in three stages: E10.5 to E14.0 (early nephro- (Figure 3A), afferent glomerular arterioles (not shown), and in genesis), E19.0 to P1 (late nephrogenesis), and P3 to P8 a ladder arrangement of stromal cells between medullary struc- (postnatal maturity). Table 1 shows an overview of transgene tures (Figure 3, B and C). Figure 3, D through F, shows expression. comparable areas of wild-type littermate kidneys demonstrating absent X-gal staining in diverse structures that were mor- Early Nephrogenesis phologically similar to those in heterozygous organs; patterns During E10.5 to 14.0, no X-gal staining was observed in of ␣-SMA were also similar. Heterozygous arcuate vessels wild-type embryos (not shown). Furthermore, the timing and (Figure 3G) expressed Ang-2/LacZ in multiple layers of wall anatomy of early nephrogenesis appeared similar in wild-type cells enveloping endothelia. However, not all cells in a vessel and heterozygous littermates, although this was not quantified. were positive, even though situated at a similar radial distance Figure 1A is a whole mount of an E10.5 Ang-2/LacZ heterozy- from the endothelium (Figure 3G). Transgene expression in gous embryo with transgene expression in cardiac outflow small cortical and arcuate (Figure 3H) arteries extended further tract, liver primordium, dorsal aorta, and allantoic region. outward than ␣-SMA immunostaining, even when the more Histology confirmed that liver cells were positive (Figure 1B). sensitive peroxidase technique was used for immunodetection. 1060 Journal of the American Society of Nephrology J Am Soc Nephrol 11: 1055–1066, 2000

Figure 3. Histology in late nephrogenesis. A through H were neonatal kidneys and I was a P1 organ. A through C and G through I were heterozygous organs, whereas D through E were wild type. All sections were stained with hematoxylin and X-gal. A through F were also probed for ␣-SMA detected by Fast Red and H by the immunoperoxidase technique. (A) ␣-SMA protein in a small cortical artery in a heterozygous organ. Note Ang-2/LacZ expression in the hilum and mesangial area of a glomerulus. (B) In same organ as A, there was weak transgene expression in a few cells (arrowheads) in the terminal portion of a proximal tubule and the descending thin limb of the loop of Henle surrounded by a network of ␣-SMA-positive stromal cells. (C) Ang-2/LacZ expression in the outer medulla in a small vessel surrounded by a network of ␣-SMA-positive stromal cells. D through F represent matching views of A through C but in a wild-type littermate. Note absent X-gal staining J Am Soc Nephrol 11: 1055–1066, 2000 Ang-2 in Mouse Renal Vasculature 1061

Figure 4. Whole mount X-gal staining in postnatal maturity. All tissues were reacted with X-gal.(A) Wild-type P3 kidney showed no X-gal staining. (B) Heterozygous P3 kidney sectioned through the medulla. Note transgene expression in bundles in the outer medulla with weaker expression in cortical and deep medullary structures. (C) High-power heterozygous organ whole mount looking down on the deep cortex. A deep branch of the main renal artery is obscured in this view but has branched at point x into arcuate (a) and smaller cortical vessels, giving rise to fine afferent arterioles (arrowheads) supplying glomeruli that also express Ang-2/LacZ (arrows). (D) P8 kidney demonstrates persistent transgene expression in outer medulla with diminished expression elsewhere.

One week after birth, heterozygous kidneys exhibited prom- Postnatal Maturity inent medullary Ang-2/LacZ expression in thin structures By 3 wk after birth, the kidney had matured, glomerulogen- aligned radially in the medulla (Figure 2F). Histology revealed esis having ended between P1 and P2 and the vasa recta two types of X-gal-positive elements (Figure 3I): thin struc- bundles having reached their adult conformation. Organs of tures, presumed to be vessels, and thicker epithelial structures wild-type P3 kidneys were of similar weight and contained that may be loops of Henle. Clusters of transgene-expressing similar numbers of glomeruli as heterozygous littermates (Ta- “dots” were noted in the deep cortex (Figure 2, F and G), and ble 2). Wild-type organs were negative after X-gal staining histology demonstrated that these were juxtamedullary glomer- (Figure 4A). In whole mounts of heterozygous P3 organs, uli and smaller vessels (not shown). intense Ang-2/LacZ expression was noted in bundles of struc- in structures, morphologically similar to the heterozygous kidney. (G) Arcuate artery (a) in a heterozygous kidney with transgene expression in multilayers of cells, presumed to be differentiating pericytes and smooth muscle cells: Note that some cells (arrowheads) expressed higher levels of the transgene. The arterial endothelium was negative. The mesangial area of a juxtamedullary glomerulus (g) also expressed Ang-2/LacZ. An adjacent arcuate vein is shown (v). (H) Ang-2/LacZ-expressing cells (in blue; large arrowheads) extended further out from the wall of an arcuate artery (a) and its branches than immunostaining for ␣-SMA (brown). Note that endothelia (small arrowheads) were negative for transgene and ␣-SMA expression. (I) Cross section through the outer medulla of a P1 organ demonstrates two types of X-gal-positive structure: thin-walled profiles, presumed to be vessels (small arrowheads), and profiles with thicker walls (large arrowheads), which were presumed to be a variety of tubule. Bars, 8 ␮m. 1062 Journal of the American Society of Nephrology J Am Soc Nephrol 11: 1055–1066, 2000

Figure 5. Histology in postnatal maturity. All sections were stained with hematoxylin and X-gal. A and B were also immunostained for ␣-SMA detected by Fast Red and C by the peroxidase technique. A, C, E, and G were heterozygous Ang-2/LacZ organs, and B, D, F, and H were wild-type littermates. (A) Low-power view showed bundles of transgene expression in outer medulla. (B) Wild-type kidney. (C) High power of longitudinal section of vasa recta bundle area with thick transgene-expressing tubules (large arrowheads) and thin structures positive for ␣-SMA, which most likely are descending vasa rectae pericytes (small arrowheads). (D) Wild-type kidney at comparable level to C, stained with X-gal. (E) Transverse section of outer medulla immunostained for aquaporin-1. Transgene-expressing profiles were distinct from brown immunostained descending thin limbs of loops of Henle (large arrowheads) and smaller structures, which are most likely descending vasa rectae (small arrowheads). (F) Wild-type kidney stained with aquaporin-1 antibody. (G) Similar section as E, but immunostained for Tamm-Horsfall glycoprotein. Transgene-expressing structures were distinct from immunostained thick ascending limbs of loops of Henle (brown). (H) Wild-type littermate stained for Tamm-Horsfall glycoprotein. Bars: 80 ␮m in A and B; 8 ␮m in C through H. J Am Soc Nephrol 11: 1055–1066, 2000 Ang-2 in Mouse Renal Vasculature 1063

Figure 6. Electron microscopy of vasa rectae bundle area. Electron microscopy of vasa recta bundle area in outer medulla at P3. (A) Heterozygous kidney, unstained with X-gal but stained with uranyl acetate, shows tubules with a relatively thin layer of light cytoplasm and sparse microvilli (arrowheads), which are thin descending limbs of loops of Henle (a), vasa recta capillaries (b), and tubules with a thick layer of mitochondria-rich cytoplasm, which are thick ascending limbs of loops of Henle (c). (B) Similar area from heterozygous mouse, unstained with uranyl acetate, but stained with X-gal with reaction product crystals (small arrowheads) in a thin descending limb of loop of Henle (a) characterized by microvilli (large arrowheads). An adjacent capillary is also shown (b). Bars: 1 ␮minA;0.5␮minB.

tures in the inner part of the outer medulla (Figure 4B). These tein-positive thick ascending limbs of loops of Henle (Figure organs also expressed the transgene in large branches of the 5G). Two points should be noted here. First, in murine species, renal artery (not shown) and in arcuate, smaller cortical and a subset of thin descending limbs of loops of Henle, derived afferent vessels supplying deep glomeruli (Figure 4C). In P8 from short-looped nephrons, are intimately associated with whole mounts (Figure 4D), there was downregulated transgene vasa recta bundles (37). Second, thin descending limbs are expression in cortex and inner medulla, whereas Ang-2/LacZ heterogeneous with respect to aquaporin-1 expression, with expression near vasa rectae remained prominent. short nephrons expressing little or no aquaporin-1 (35). Hence, Figure 5 shows histology at P3. In heterozygous kidneys, our data were consistent with Ang-2/LacZ expression in this Ang-2/LacZ expression was downregulated in glomeruli ver- subset of thin descending limbs. sus neonates and P1, with no expression in outer cortical Electron microscopy of wild-type (not shown) and heterozy- glomeruli (Figure 5A), and low expression in juxtamedullary gous mice showed four profiles in this location (Figure 6A) glomeruli (not shown). In contrast, there was intense Ang-2/ (37): tubules with a thin layer of light cytoplasm and sparse LacZ expression in the inner stripe of the outer medulla (Figure microvilli, which were thin descending limbs of loops of 5, A, C, E, and G). Figure 5, B, D, F, and H are complementary Henle; tubules with a thick layer of mitochondria-rich cyto- views of wild-type littermates: They were X-gal-negative and plasm, which were thick ascending limbs; fenestrated endothe- structurally similar to heterozygous kidneys. Histology with lia with wide lumens, which were ascending vasa rectae; and counterstaining for ␣-SMA, aquaporin-1, and Tamm-Horsfall nonfenestrated endothelia, which were descending vasa rectae. glycoprotein clarified that the most prominent transgene-ex- X-gal staining of heterozygous organs revealed cytoplasmic pressing structures were located near vasa recta bundles and precipitation of reaction product crystals in thin descending were discrete from: (1) ␣-SMA-positive pericytes in descend- limbs of loops of Henle: These crystals were more easily seen ing vasa rectae (Figure 5C); (2) aquaporin-1-positive thin de- in sections in which uranyl acetate staining had been omitted, scending limbs (Figure 5E); and (3) Tamm-Horsfall glycopro- as shown in Figure 6B. 1064 Journal of the American Society of Nephrology J Am Soc Nephrol 11: 1055–1066, 2000

Discussion of cells surrounding endothelia of the renal artery and its branches. As Recently, Yuan et al. (14) studied Ang-1, Ang-2, and Tie-2 nephrogenesis proceeded, expression was maintained in the arterial expression from the onset of glomerulogenesis (E14.0) to tree, extending to the arcuate and small cortical vessels. Based on this adulthood in wild-type mice. Using Northern blotting, the dynamic and developmentally regulated pattern, we propose that genes were expressed through this period with peak levels at Ang-2 is a marker for the renal vascular smooth muscle lineage. Not P2 to P3. Using Western blotting, Tie-2 was detected from all cells in a single locus in an arterial wall expressed Ang-2/LacZ, E14.0, with tyrosine-phosphorylated RTK evident from E18.0. even though situated at a similar distance from the endothelium. This By in situ hybridization and immunohistochemistry, Tie-2 was heterogeneity might be explained by the presence of smooth muscle localized to capillaries in nephrogenic cortex, glomerular tufts, cells of varied maturity, as discussed by Ehler et al. (41). Using and vasa rectae. By in situ hybridization, Ang-1 transcripts double labeling for ␣-SMA and Ang-2/LacZ, we found that myofil- were found in condensing cortical mesenchyme, maturing glo- ament immunolocalized to cells adjacent to arterial endothelia, meruli, proximal tubules, and outer medullary tubules. whereas Ang-2 expression tended to extend to loosely arranged Yuan et al. (14) also localized Ang-2 mRNA to maturing outer peripheral cells. However, we cannot rule out weak expression of medulla with a maximal signal at P3 in vasa rectae in the inner ␣-SMA in peripheral cells, which might only be detectable by a more stripe. However, the resolution of the in situ hybridization tech- sensitive method. nique was not optimal for the definitive assignment of Ang-2- Hence, if vascular smooth muscle cells are recruited from expressing cells because of tissue distortion caused by the rigor- surrounding mesenchyme, Ang-2 may be a very early lineage ous preparation required by this method. Furthermore, the marker. However, from our descriptive study alone, it is im- relatively low sensitivity of the nonradioactive in situ technique possible to know whether all such Ang-2-positive cells will be probably only detected cells with the highest levels of Ang-2 incorporated into vessel walls, and it is also possible that some transcripts. We therefore used heterozygous Ang-2/LacZ mice to will die or become interstitial cells. Although we noted weak further define Ang-2 expression during kidney development. transgene expression in small medullary vessels in the first The results of our current study are consistent with several postnatal week, it was not possible to establish whether this previous observations (14), including: (1) upregulation of met- signal originated in endothelial or enveloping cells. anephric Ang-2 expression prenatally; (2) intense expression of Of note, the walls of the developing kidney vasculature show Ang-2 in postnatal outer medulla; and (3) an overall decreased widespread expression of another secreted protein, renin (42). How- expression between P3 an P8. It is important to note that ever, although we found that Ang-2 expression was continuous heterozygous Ang-2/LacZ kidneys underwent normal develop- through the fetal kidney arterial system to the level of small cortical ment, as assessed by the acquisition of glomeruli and complex arteries, albeit not in every cell in a single locus, renin-expressing cells structures such as vasa rectae. Our new data further define the were reported to be discontinuous, for example, localized to nascent nature of Ang-2-expressing cells in the outer medulla and also branch points (42). Interestingly, it was recently reported that aqua- demonstrate Ang-2 promoter activity in renal vasculature and porin-1 immunolocalized to the developing rat renal vasculature in a glomeruli. These aspects are now discussed. broadly similar pattern to Ang-2 (43), although it was not fully established which cells (i.e., endothelial or pericyte/smooth muscle) expressed the water pore. Collectively, these studies demonstrate a Ang-2 in Developing Renal Vessels spectrum of gene expression in the renal vasculature, which is dra- Hungerford and Little (38) have reviewed the ontogeny of matically developmentally regulated. vascular smooth muscle, which differentiates as “fibroblast- like” cells, lacking myofilaments and basement membranes and appearing as aggregates near embryonic endothelium. In Ang-2 Expression in Glomeruli avian embryos, where lineage studies have been performed, Our study further shows that Ang-2/LacZ was expressed in aortic arch vascular smooth muscle cells derive from neural the core of developing glomeruli, most likely in the mesan- crest (i.e., ectoderm), whereas vascular smooth muscle in the gium. Mesangial cells share biosynthetic and structural prop- rest of the embryo may originate from mesoderm. An alterna- erties with vascular smooth muscle cells (44), and Ang-2 tive view was proposed by DeRuiter et al. (39), who showed expression is therefore consistent with this relationship. Our that embryonic avian endothelia from dorsal aorta could trans- unpublished data (H. T. Yuan and A. S.Woolf, personal ob- differentiate into mesenchymal cells, which expressed myofila- servations) show that conditionally immortal mesangial cell ments. Once recruited into the lineage, vessel wall precursors lines isolated from young mice (45) express Ang-2 mRNA in express marker proteins for smooth muscle maturation, with culture. The origin of mesangial cells is unknown, although the highest levels near the endothelial layer. One such protein they appear to derive from endogenous precursors in the met- is heavy caldesmon (40), although this has not been examined anephros (46) and their formation is dependent on platelet- in nephrogenesis. Another structural protein expressed in this derived growth factor-B (47,48). We speculate that Ang-2 from lineage is ␣-SMA, which constitutes up 40% of total protein in developing mesangial cells modulates the growth of adjacent mature cells, and Carey et al. (34) reported that it was widely endothelia, which themselves express Tie-2 (14). In this con- expressed in the developing rat renal vasculature. text, it is of interest that cultured mesangial cells express other Simple capillaries in the E12.0 metanephros did not express Ang- secreted factors that can target endothelia. These include 2/LacZ but, at E14.0, the transgene was expressed in multiple layers VEGF (49) and hepatocyte growth factor (45,50). J Am Soc Nephrol 11: 1055–1066, 2000 Ang-2 in Mouse Renal Vasculature 1065

Ang-2 Expression and the Vasa Recta 3. Woolf AS, Loughna S: Origin of glomerular capillaries: Is the We found low levels of Ang-2/LacZ expression in proximal verdict in? Exp Nephrol 6: 17–21, 1998 tubules and thin descending limbs of loops of Henle in the 4. Abrahamson DR, Robert B, Hyink DP, St. John PL, Daniel TO: neonatal period, consistent with our previous in situ hybridiza- Origins and formation of microvasculature in the developing tion data (14). In the same study, Yuan et al. (14) reported a kidney. Kidney Int Suppl 67: S7–S11, 1998 5. Risau W: Mechanisms of angiogenesis. Nature 387: 671–674, strong in situ hybridization in outer medullary vasa recta bun- 1997 dles at P3, by which time these structures have acquired a 6. Gale NW, Yancopoulos GD: Growth factors acting via endothe- mature configuration. However, the resolution of that tech- lial cell-specific receptor tyrosine kinases: VEGFs, angiopoi- nique did not allow the definitive assignment of positive cells. etins, and ephrins in vascular development. Genes Dev 13: 1055– Our current analysis of the outer medulla in P3 heterozygous 1066, 1999 Ang-2/LacZ kidneys demonstrated prominent transgene ex- 7. Robert B, St. John PL, Hyink DP, Abrahamson DR: Evidence pression in tubular structures incorporated into the vasa recta that embryonic kidney cells expressing flk-1 are intrinsic, vas- bundle. Based on reasoning outlined in the Results section, we culogenic angioblasts. Am J Physiol 271: F744–F753, 1996 suggest that these represent a subset of thin descending limbs 8. Tufro-McReddie A, Norwood VF, Aylor KW, Botkin SJ, Carey of loops of Henle, which are aquaporin-1-negative and are RM, Gomez RA: Oxygen regulates vascular endothelial growth derived from short-looped nephrons. We are aware that Park et factor-mediated vasculogenesis and tubulogenesis. Dev Biol 183: 139–149, 1997 al. (51) reported that pericytes envelop descending vasa rectae 9. Loughna S, Hardman P, Landels E, Jussila L, Alitalo K, Woolf and, mindful of our observation that Ang-2 is expressed by this AS: A molecular and genetic analysis of renal glomerular cap- lineage elsewhere in the kidney, we cannot exclude the possi- illary development. Angiogenesis 1: 84–101, 1997 bility that these cells also express Ang-2 below the current 10. Kitamoto Y, Tokunaga H, Tomita K: Vascular endothelial limit of detection. growth factor is an essential molecule for mouse kidney development: Glomerulogenesis and nephrogenesis. J Clin Invest 99: Conclusion 2351–2357, 1997 We first propose that Ang-2 protein is secreted by vascular 11. Gerber H-P, Hillan KJ, Ryan AM, Kowalski J, Keller G-A, Rangell L, Wright BD, Radtke F, Aguet M, Ferrara N: VEGF is wall cells during kidney development, where it would cause required for growth and survival in neonatal mice. Development paracrine modulation of Ang-1-induced activation of Tie-2 126: 1149–1159, 1999 RTK in nearby endothelial cells. Second, Ang-2 expressed 12. Sato TN, Tozawa Y, Deutsch U, Wolburg-Buchholz K, Fujiwara within glomeruli may affect the maturation of glomerular cap- Y, Gendron-Maguire M, Gridley T, Wolburg H, Risau W, Qin Y: illary loops, and immature glomeruli are known sites of Ang-1 Distinct roles of the receptor tyrosine kinases Tie-1 and Tie-2 in expression (14). In contrast, vascular maturation in the outer blood vessel formation. Nature 376: 70–74, 1995 medulla may be primarily modulated by Ang-2 secreted from 13. Partanen J, Puri MC, Schwartz L, Fischer KD, Bernstein A, epithelia rather than from the smooth muscle lineage. In fact, as Rossant J: Cell autonomous functions of the receptor tyrosine Ang-2 transcripts and Ang-2/LacZ expression are upregulated kinase TIE in a late phase of angiogenic capillary growth and in this location in the first few postnatal weeks, the Ang-1 endothelial cell survival during murine development. Develop- mRNA in situ signal decreases (14), observations consistent ment 122: 3013–3021, 1996 14. Yuan HT, Suri C, Yancopoulos GD, Woolf AS: Expression of with the hypothesis that Ang-2 terminates capillary maturation angiopoietin-1, angiopoietin-2 and the Tie-2 receptor tyrosine stimulated by Ang-1. Certainly, Tie-2 is widely expressed in kinase during mouse kidney maturation. J Am Soc Nephrol 10: endothelia during nephrogenesis (14), but formal proof for a 1722–1736, 1999 role of Ang-2 demands functional as well as descriptive ex- 15. Loughna S, Yuan HT, Woolf AS: Effects of oxygen on vascular periments. Currently, we are analyzing kidneys from null patterning in Tie1/LacZ metanephric kidneys in vitro. Biochem Ang-2 mice to address these questions. Biophys Res Commun 247: 361–366, 1998 16. Davis S, Aldrich TH, Jones PF, Acheson A, Compton DL, Jain Acknowledgments V, Ryan TE, Bruno J, Radziejewski C, Maisonpierre PC, Yan- copoulos GD: Isolation of angiopoietin-1, a ligand for the TIE2 This work was supported by the Kidney Research Aid Fund and receptor, by secretion trap expression cloning. Cell 87: 1161– Wellcome Trust Project Grant 058005. We thank Brian Young (Institute 1170, 1996 of Neurology, University College London Medical School, London, 17. Papapetropoulos A, Garcia-Cardena G, Dengler TJ, Maisonpi- United Kingdom) for assistance with electron microscopy and Mark A. erre PC, Yancopoulos GD, Sessa WC: Direct actions of angio- Knepper (Laboratory of Kidney and Electrolyte Metabolism, National poietin-1 on human endothelium: Evidence for network stabili- Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, zation, cell survival and interaction with other angiogenic growth MD) for the kind gift of the aquaporin-1 antibody. factors. Lab Invest 79: 213–223, 1999 18. Koblizek TI, Weiss C, Yancopoulos GD, Deutsch U, Risau W: References Angiopoietin-1 induces sprouting angiogenesis in vitro. Curr 1. Loughna S, Landels E, Woolf AS: Growth factor control of Biol 8: 529–532, 1998 developing kidney endothelial cells. Exp Nephrol 4: 112–118, 19. Suri C, Jones PF, Patan S, Bartunkova S, Maisonpierre PC, Davis 1996 S, Sato TN, Yancopoulos GD: Requisite role of angiopoietin-1, 2. Gomez RA, Norwood VF, Tufro-McReddie A: Development of a ligand for the TIE2 receptor, during embryonic angiogenesis. the kidney vasculature. Microsc Res Tech 39: 254–260, 1997 Cell 87: 1171–1180, 1996 1066 Journal of the American Society of Nephrology J Am Soc Nephrol 11: 1055–1066, 2000

20. Dumont DJ, Gradwohl G, Fong G-H, Puri MC, Gerstenstein M, loop descending thin limbs and in descending vasa recta in rat Auerbach A, Breitman ML: Dominant-negative and targeted kidney. Am J Physiol 268: F1023–F1037, 1995 null-mutations in the endothelial receptor tyrosine kinase, tek, 36. Hoyer JR, Resnick JS, Michael AF, Vernier RL: Ontogeny of reveal a critical role in vasculogenesis of the embryo. Genes Dev Tamm-Horsfall urinary glycoprotein. Lab Invest 30: 757–761, 8: 1897–1909, 1994 1974 21. Folkman J, D’Amore PA: Blood vessel formation: What is its 37. Tisher CC, Madsen KM: Anatomy of the kidney. In: The Kidney, molecular basis? Cell 87: 11153–1155, 1996 5th Ed., edited by Brenner BM, Philadelphia, Saunders, 1996, pp 22. Takakura N, Huang XL, Naruse T, Hamguchi I, Dumont DJ, 3–71 Yancopoulos GD, Suda T: Critical role of the TIE2 endothelial 38. Hungerford JE, Little CD: Developmental biology of the vascu- cell receptor in the development of definitive hematopoiesis. lar smooth muscle cell: Building a multilayered vessel wall. Immunity 9: 677–686, 1998 J Vasc Res 36: 2–27, 1999 23. Maisonpierre PC, Suri C, Jones PF, Bartunkova S, Wiegand SJ, 39. DeRuiter MC, Poelmann RE, Van Munsteren JC, Mironov V, Radziejewski C, Compton D, McClain J, Aldrich TH, Papado- Markwald RR, Gitternberger-de Groot AC: Embryonic endothe- poulos N, Daly TJ, Davis S, Sato TN, Yancopoulos GD: Angio- lial cells transdifferentiate into mesenchymal cells expressing poietin-2, a natural antagonist for Tie2 that disrupts in vivo smooth muscle actins in vivo and in vitro. Circ Res 80: 444–451, angiogenesis. Science 277: 55–60, 1997 1997 24. Valenzuela DM, Griffiths JA, Rojas J, Aldrich TH, Jones PF, 40. Frid MG, Shekhonin BV, Koteliansky VE, Glukhova MA: Phe- Zhou H, McClain J, Copeland NG, Gilbert DJ, Jenkins NA, notypic changes of human smooth muscle cells during develop- Huang T, Papadopoulos N, Maisonpierre PC, Davis S, Yanco- ment: Late expression of heavy caldesmon and calponin. Dev poulos GD: Angiopoietins 3 and 4: Diverging gene counterparts Biol 153: 185–193, 1992 in mice and humans. Proc Natl Acad Sci USA 96: 1904–1909, 41. Ehler E, Jat PS, Noble MD, Citi S, Draeger A: Vascular smooth 1999 muscle cells of H-2Kb-tsA58 transgenic mice: Characterisation 25. Witzenbichler B, Maisonpierre PC, Jones P, Yancopoulos GD, of cell lines with distinct properties. Circulation 92: 3289–3296, Isner JM: Chemotactic properties of angiopoietin-1 and -2, li- 1995 gands for the endothelial-specific receptor tyrosine kinase Tie2. 42. Reddi V, Zaglul A, Pentz ES, Gomez RA: Renin-expressing cells J Biol Chem 273: 18514–18521, 1998 are associated with branching of the developing kidney vascula- 26. Mandriota SJ, Pepper MS: Regulation of angiopoietin-2 mRNA ture. J Am Soc Nephrol 9: 63–71, 1998 levels in bovine microvascular endothelial cells by cytokines and 43. Kim J, Kim WY, Han KH, Knepper MA, Nielsen S, Madsen hypoxia. Circ Res 19: 852–859, 1998 KM: Developmental expression of aquaporin 1 in the rat renal 27. Oh H, Takagi H, Suzuma K, Otani A, Matsumura M, Honda Y: vasculature. Am J Physiol 276: F498–F509, 1999 Hypoxia and vascular endothelial growth factor selectively up- 44. Dubey RK, Jackson EK, Rupprecht HD, Sterzel RB: Factors regulate angiopoietin-2 in bovine microvascular endothelial controlling growth and matrix production in vascular smooth cells. J Biol Chem 274: 15732–15739, 1999 muscle and glomerular mesangial cells. Curr Opin Nephrol Hy- 28. Stratmann A, Risau W, Plate KH: Cell type-specific expression pertens 6: 88–105, 1997 of angiopoietin-1 and angiopoietin-2 suggests a role in glioblas- 45. Kolatsi-Joannou M, Woolf AS, Hardman P, Gordge M, White toma angiogenesis. Am J Pathol 153: 1459–1466, 1998 SJ, Henderson R: The hepatocyte growth factor/scatter factor 29. Tanaka S, Mori M, Sakamoto Y, Makuuchi M, Sugimachi K, Wands JR: Biological significance of angiopoietin-2 expression receptor, met, transduces a morphogenetic signal in renal glo- in human hepatocellular carcinoma. J Clin Invest 103: 341–345, merular fibromuscular mesangial cells. J Cell Sci 108: 3703– 1999 3714, 1995 30. DeChiara TM, Bowen DC, Valenzuela DM, Simmons MV, 46. Hyink DP, Tucker DC, St. John PL, Leardkamolkarn V, Ac- Poueymirou WT, Thomas S, Kinetz E, Compton DL, Rojas E, cavitti MA, Abrass CK, Abrahamson DR: Endogenous origin of Park JS, Smith C, DiStefano PS, Glass DJ, Burden SJ, Yanco- glomerular endothelial and mesangial cells in grafts of embry- poulos GD: The receptor tyrosine kinase MuSK is required for onic kidneys. Am J Physiol 270: F886–F899, 1996 neuromuscular junction formation in vivo. Cell 85: 501–512, 47. Soriano P: Abnormal kidney development and hematological ␤ 1996 disorders in platelet derived growth factor -receptor mutant 31. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A mice. Genes Dev 8: 1888–1896, 1994 Laboratory Manual, Cold Spring Harbor, NY, Cold Spring Har- 48. Alpers CE, Seifert RA, Hudkins KL, Johnson RJ, Bowen-Pope bor Laboratory Press, 1989 DF: Developmental patterns of PFGF B-chain, PDGF-receptor, 32. Lelievre-Pegorier M, Vilar J, Ferrier M-L, Moreau E, Freund N, and ␣-actin expression in human glomerulogenesis. Kidney Int Gilbert T, Merlet-Benichou C: Mild vitamin A deficiency leads 42: 390–399, 1992 to inborn nephron deficit in the rat. Kidney Int 54: 1455–1462, 49. Gruden G, Thomas S, Burt D, Zhou W, Chusney G, Gnudi L, 1998 Viberti G: Interaction of angiotensin II and mechanical stretch on 33. Snyder EY, Deitcher DL, Walsh C, Arnold-Aldea S, Hartwieg vascular endothelial growth factor production by human mesan- EA, Cepko CL: Multipotent neural cell lines can engraft and gial cells. J Am Soc Nephrol 10: 730–737, 1999 participate in development of mouse cerebellum. Cell 68: 33–51, 50. Grant DS, Kleinman HK, Goldberg ID, Bhargava MM, Nick- 1992 oloff BJ, Kinsella JL, Polverini P, Rosen EM: Scatter factor 34. Carey AV, Carey RM, Gomez RA: Expression of alpha-smooth induces blood vessel formation in vivo. Proc Natl Acad Sci USA muscle actin in the developing kidney vasculature. Hypertension 90: 1937–1941, 1993 19[2 Suppl]: II168–II175, 1992 51. Park F, Mattson DL, Roberts LA, Cowley AW Jr: Evidence for 35. Nielsen S, Pallone T, Smith BL, Christensen EI, Agre P, the presence of smooth muscle alpha-actin within pericytes of the Maunsbach AB: Aquaporin-1 water channels in short and long renal medulla. Am J Physiol 273: R1742–R1748, 1997