Institute of Zoology University of Veterinary Medicine Hannover

Phylogeography and population structure of the European tree frog (Hyla arborea) for supporting effective species conservation

THESIS Submitted in partial fulfilment of the requirements for the degree

DOCTOR OF PHILOSOPHY (PhD)

awarded by the University of Veterinary Medicine Hannover

by Astrid Krug Bruchsal, Germany

Hannover 2012

Supervisor: Prof. Dr. Heike Pröhl

Supervision Group: Prof. Dr. Heike Pröhl PD Dr. Heike Hadrys, Dr. Stefan Könemann (until 09.03.2011) Prof. Dr. Miguel Vences

1st Evaluation: Prof. Dr. Heike Pröhl University of Veterinary Medicine Hannover Institute of Zoology

PD Dr. Heike Hadrys University of Veterinary Medicine Hannover Division of Ecology and Evolution

Prof. Dr. Miguel Vences Technical University of Braunschweig Division of Evolutionary Biology Zoological Institute

2nd Evaluation: Dr. Robert Jehle University of Salford School of Environment & Life Sciences Ecosystems and Environment Research Centre

Date of oral exam: 8th of November 2012

Astrid Krug was sponsored by the Scholarship Programme of the German Federal Environmental Foundation (DBU) # 20007/899.

Research funds were provided by the German Federal Environmental Foundation (DBU), Heidehof-Stiftung # 57129.01.2/3.10, and “Hans-Schiemenz-Fonds“ - Deutsche Gesellschaft für Herpetologie und Terrarienkunde (DGHT).

Table of Contents

Table of Contents Summary..……………………………………………………………………………1 Zusammenfassung……………………………………………………………………3 1 General introduction………………………………………...…………………...…5 1.1 Global amphibian decline……………………………………………………………6 1.2 Conservation genetics………………………………………………………………..6 1.3 The European tree frog………………………………………………………………7 1.3.1 Characteristics……………………………………………………………………….7 1.3.2 Distribution………………………………………………………………………….9 1.3.3 Conservation status and major threats……………………………………………...10 1.3.4 Conservation genetics in the European tree frog…………………………………...11 1.4 Aims of the study…………………………………………………………………...12 1.4.1 Phylogeography in Germany and adjacent areas…………………………………...12 1.4.2 Management Units in Lower Saxony and adjacent areas…………………………..12 2 Defining units for conservation management for the European tree frog (Hyla arborea) in Lower Saxony and adjacent areas……………………………14 2.1 Abstract……………………………………………………………………………..15 2.2 Introduction…………………………………………………………………………16 2.3 Materials and methods……………………………………………………………...17 2.3.1 Sample collection and preparation………………………………………………….17 2.3.2 Statistical analysis…………………………………………………………………..20 2.3.2.1 Historic structure: Analysis of mtDNA……………………………………………..20 2.3.2.2 Recent structure: Analysis of microsatellites……………………………………….21 2.3.2.3 Biogeographic zones………………………………………………………………..22 2.4 Results………………………………………………………………………………23 2.4.1 Mitochondrial sequence analysis…………………………………………………...23 2.4.2 Microsatellite analysis………………………………………………………………24 2.4.3 Biogeographic zones………………………………………………………………..29 2.5 Discussion…………………………………………………………………………..30 2.5.1 Genetic structure and conservation units…………………………………………...31 2.5.2 Genetic diversity……………………………………………………………………33

Table of Contents

2.5.3 Future goals…………………………………………………………………………33 2.5.4 Conclusion and implications for conservation management……………………….34 2.6 Acknowledgement………………………………………………………………….34 3 Phylogeographic structure of the European tree frog (Hyla arborea) in its German distribution area…………………………………………………………36 3.1 Abstract……………………………………………………………………………..37 3.2 Introduction…………………………………………………………………………38 3.3 Material and methods……………………………………………………………….39 3.3.1 Sample collection and preparation………………………………………………….39 3.3.2 Statistical analysis…………………………………………………………………..41 3.3.2.1 Analysis of mtDNA in Germany……………………………………………………41 3.3.2.2 Analysis of microsatellites in Germany…………………………………………….41 3.3.2.3 Analysis of mtDNA in the European context……………………………………….42 3.4 Results………………………………………………………………………………43 3.4.1 Analysis of mtDNA in Germany……………………………………………………43 3.4.2 Analysis of microsatellites in Germany…………………………………………….46 3.4.3 Analysis of mtDNA in the European context……………………………………….49 3.5 Discussion…………………………………………………………………………..51 3.5.1 Distinct genetic lineages in the European tree frog? ……………………………….52 3.5.2 Phylogrographic structures of the tree frog in Germany……………………………52 3.5.3 Genetic diversity……………………………………………………………………53 3.5.4 Conclusion………………………………………………………………………….54 3.6 Acknowledgement………………………………………………………………….54 4 General discussion………………………………………………….……………...56 4.1 Future goals…………………………………………………………………………58 5 References………………………………………………………………………….60 6 Appendix…………………………………………………………………………...70 Affidavit……………………………………………………………………………87 7 Acknowledgment…………………………………………………………………..88

List of Abbreviations

°C degree Celsius

µl microliter

µM micromolar bp base pairs cyt b cytochrome b

DNA deoxyribonucleic acid dNTP’s deoxynucleotide triphosphates

ESU evolutionary significant unit

IUCN International Union for Conservation of Nature km kilometre min minute mM millimolar mtDNA mitochondrial DNA

MU management unit ng nanogram nuDNA nuclear DNA

P probability

PCR polymerase chain reaction s second

SD standard deviation

Taq Thermus aquaticus

U enzyme unit

List of Figures and Tables

List of Figures and Tables Figure 1.1: Calling tree frog male Figure 1.2: Distribution map of the European tree frog (Hyla arborea) Figure 2.1: Current distribution of the European tree frog in Lower Saxony and adjacent areas Figure 2.2: Haplotype network cyt b Lower Saxony Figure 2.3: Distribution of cyt b haplotypes in Lower Saxony Figure 2.4: Isolation by distance plots Figure 2.5: LnPD and delta K

Figure 2.6: STRUCTURE bar plot for K = 7

Figure 2.7: GENELAND map of estimated cluster membership for K = 7 Figure 2.8: Most important barriers to gene flow Figure 3.1: Haplotype network of cytochrome b Germany Figure 3.2: Haplotype distribution and physical map of Germany Figure 3.3: LnPD and delta K Figure 3.4: Distribution of distinct genetic clusters K = 4 Figure 3.5: Haplotype network of cytochrome b Europe Figure 3.6: Distribution of cyt b haplotypes in Europe

Table 2.1: Overview of sample sites Lower Saxony

Table 2.2: Pairwise Dest values and pairwise FST values Table 3.1: Overview of sample sites Germany

Summary

Astrid Krug Phylogeography and population structure of the European tree frog (Hyla arborea) for supporting effective species conservation Many amphibian species around the world are threatened by consequences of habitat degradation and fragmentation. The European tree frog (Hyla arborea) has suffered from dramatic population declines in the last decades and has therefore been categorised as threatened in many Red Data lists. Conservation measures are conducted at many places. To support such measures I conducted molecular studies on two geographic levels to reveal phylogeographic structures and genetic diversity, which are important for effective species conservation management. In Lower Saxony in Germany the current distribution of the tree frog is very patchy with some main occurrences in the lowlands. In order to define management units I sampled 237 individuals at 14 sites (~ 3 - 250 km apart from each other) across the tree frog distribution area in Lower Saxony and adjacent areas. All samples were genotyped with eight microsatellite loci and twelve sites were sequenced for an mtDNA cytochrome b fragment.

While all but one of the microsatellite pairwise Dest and FST values showed significant genetic differentiation (Dest: 0 - 0.46, FST: 0 - 0.18), Bayesian analyses suggested seven distinct genetic clusters. The cytochrome b haplotype distribution highlights the former connection of the currently fragmented populations along the river Elbe. However, to reveal genetic structuring at higher geographic levels, as could have been generated e.g. by different postglacial colonisation routes, I conducted the second study with a sampling network of 31 sites across the tree frogs’ distribution area in Germany. 372 individuals were again analysed by mtDNA cytochrome b sequences and eight microsatellite loci. Sequence divergence between sample sites was low, varying between 0 and 0.4 % (overall 0.2 %), and no distinct genetic lineages were found. Nonetheless, a clear North-South partitioning was revealed by both molecular markers with the Central German Uplands as likely barrier. Furthermore, the influence of the major rivers such as Elbe, Rhine, and Danube on the phylogeographic structure was revealed. In general the genetic diversity was relatively high in both studies. Therefore, each of the sampled tree frog occurrences should have the potential to maintain or recover to a stable population size when applying appropriate local conservation measures. For new resettlement

1 Summary

projects, the identified genetic structures should be considered when choosing source populations. Where possible, reconnection of originally linked occurrences that are now separated in different conservation units due to habitat fragmentation and genetic drift should be facilitated.

2 Zusammenfassung

Astrid Krug Phylogeographie und Populationsstruktur des Europäischen Laubfroschs (Hyla arborea) zur Unterstützung eines effektiven Artenschutzes Weltweit sind viele Amphibienarten, hauptsächlich durch die Folgen von Habitat- Degradierung und Fragmentierung, gefährdet. Der Europäische Laubfrosch (Hyla arborea) hat in den letzten Jahrzehnten immense Bestandsrückgänge erfahren und wurde daher in vielen Roten Listen als gefährdet eingestuft. Naturschutzmaßnahmen werden bereits vielerorts durchgeführt. Um solche Maßnahmen zu unterstützen, habe ich molekulargenetische Studien auf zwei geografischen Ebenen durchgeführt zur Aufdeckung phylogeographischer Strukturen sowie der genetischen Diversität, welche für ein effektives Artenschutzmanagement wichtig sind. In Niedersachsen ist die aktuelle Verbreitung des Laubfroschs sehr verinselt mit einigen Schwerpunktvorkommen im Tiefland. Um Management Units zu beschreiben, habe ich 237 Individuen an 14 Probestellen (~ 3 - 250 km voneinander entfernt) im niedersächsischen sowie angrenzenden Verbreitungsgebiet gesammelt. Alle Proben wurden mit acht Mikrosatelliten-Loci genotypisiert und zwölf Probestellen wurden für ein mtDNA Cytochrome b Fragment sequenziert.

Während bis auf einen alle paarweisen Mikrosatelliten Dest und FST Werte signifikant unterschiedlich waren (Dest: 0 - 0.46, FST: 0 - 0.18), wiesen die Bayesischen Analysen sieben unterschiedliche genetischen Cluster auf. Die Verbreitung der Cytochrom b Haplotypen hebt die ehemalige Verbindung, zurzeit fragmentierter Populationen, entlang der Elbe hervor. Um übergeordnete genetische Strukturen aufzudecken, wie sie durch unterschiedliche nacheiszeitliche Besiedlungslinien entstanden sein können, habe ich die zweite Studie mit einem Netzwerk von 31 Probeorten im deutschen Laubfrosch Verbreitungsgebiet durchgeführt. 372 Individuen wurden wiederum mithilfe von mtDNA Cytochrome b Sequenzen und acht Mikrosatelliten-Loci analysiert. Sequenz Divergenzen zwischen Probeorten waren gering und variierten zwischen 0 und 0,4 % (gesamt: 0,2 %). Es wurden keine unterschiedlichen genetischen Linien gefunden. Dennoch konnte eine klare Nord-Süd Unterteilung mit den deutschen Mittelgebirgen als wahrscheinliche Barriere in beiden molekularen Markern aufgezeigt werden. Des

3 Zusammenfassung

Weiteren wurde der Einfluss von großen Flüssen wie z.B. Elbe, Rhein und Donau auf die phylogeographische Struktur deutlich. Im Allgemeinen war die genetische Diversität in beiden Studien relativ hoch. Daher sollte jedes der beprobten Laubfroschvorkommen das Potential besitzen, eine stabile Populationsgröße wieder zu erlangen bzw. sie zu erhalten, wenn geeignete Naturschutzmaßnahmen vor Ort durchgeführt werden. Im Fall von neuen Wiederansiedlungsprojekten sollten bei der Wahl der Spenderpopulation die gefundenen genetischen Strukturen berücksichtigt werden. Wo es möglich ist, sollte eine Wiedervernetzung von ursprünglich in Verbindung gewesener Vorkommen, welche heute durch Habitatfragmentierung und genetische Drift in unterschiedliche Conservation Units eingeteilt wurden, durchgeführt werden.

General introduction

5 Chapter1 General introduction

1.1 Global amphibian decline In the recent years, increasing attention has been paid to amphibian research and conservation. The reason for this is that there has been a dramatic worldwide decline in amphibians observed in the last decades. In the 2008 IUCN Red List, nearly one-third (32.4 %) of the 6,260 assessed amphibian species were classified as globally threatened or extinct and there is strong evidence that the pace of extinctions is increasing. The data also demonstrate that amphibians are far more threatened than either birds (12 %) or mammals (23 %). (Stuart et al., 2004; IUCN, 2012) Amphibians are often considered as bioindicators for the condition of the biosphere. Their highly permeable skin used for respiration and hydration and their specialized ecology which makes them dependent on both aquatic and terrestrial habitats cause them to be particularly susceptible to environmental perturbations. Habitat loss, fragmentation and degradation are the most significant threats to amphibians (e.g. Beebee and Griffiths, 2005; Temple and Cox, 2009). Numerous consequences of the intensification of agriculture, draining of wetlands, river regulation, and impassable barriers such as urban areas and roads are involved in this decrease. (e.g. Hitchings and Beebee, 1997; Ray et al., 2002; Wood et al., 2003). Because most amphibian species have low dispersal abilities they are particularly affected by the severe effects of habitat fragmentation (see review Cushman, 2006). Pollution, invasive species and the rapid dispersion of diseases such as the chytrid fungus (Batrachochytrium dendrobatidis) and the Ranavirus (FV3) have also accelerated the decline of amphibians (Berger et al., 1998; Daszak et al., 1999; Fisher et al., 2009). This alarming situation induced many studies to investigate the different factors and their correlations to find effective solutions to prevent or reverse amphibian declines (Alford and Richards, 1999; Blaustein and Kiesecker, 2002; Beebee and Griffiths, 2005; Blaustein et al., 2012).

1.2 Conservation genetics Molecular genetic methods have become a tool of increasing importance for species conservation (e.g. Frankham, 2005; Schwartz et al., 2007). Highly diverse molecular markers allow assessing the conservation status and the extinction risk of populations by measuring

6 Chapter1 General introduction

different parameters such as genetic diversity, connectivity, inbreeding, and the effective population size. These methods enable researchers to assess which populations urgently need supportive measures and which populations are or are not the best for effective reintroduction and restocking measures. For example inadvertently using an already inbred population for reintroductions can lead to reduced fitness in the new colonies, as happened in South Australian koalas (Seymour et al., 2001). Additionally, crossing highly genetically differentiated populations can lead to a hybrid breakdown and thus reduced fitness (e.g. Huff et al., 2011). For this purpose populations can be assigned to Management Units (MUs), identified as sets of populations with distinct allele frequencies (Moritz, 1994a; Moritz, 1994b) to which conservation efforts should be directed. Phylogeographic analyses, mostly based on sequencing of mitochondrial DNA (cyt b, d-loop, COI), can reveal distinct genetic lineages, evolved by different glacial refugia or postglacial colonisation routs. For example two distinct Rana temporaria lineages were described in Eastern and Western parts of Europe forming a contact zone in northern Germany. Furthermore, they found evidence for an Irish glacial refugium (Palo et al., 2004; Schmeller et al., 2008; Teacher et al., 2009). The boundaries of such contact zones and genetic lineages are important to know for conservation management to decide the right strategies and not to accidentally mix distinct clades. Another study clarified the status of Pelophylax lessonae in Southern England (Snell et al., 2005). Originally the species has been considered as an introduction into Britain, with Italy as most likely source. However, the genetic analyses supported its native status in Britain with a possible colonisation route via Poland and Hungary. This has prompted a programme for re-establishing the clade in England.

1.3 The European tree frog 1.3.1 Characteristics The family of the tree frogs (Hylidae) is highly diverse, currently containing 40 genera and 901 species (Frost, 2011). In Europe six species of the genus Hyla occur: Hyla arborea (Linnaeus, 1758; European tree frog), Hyla intermedia (Boulenger, 1882; Italian tree frog), Hyla meridionalis (Boettger, 1874; Mediterranean tree frog), Hyla molleri (Bedriaga, 1890;

7 Chapter1 General introduction

Iberian tree frog), Hyla orientalis (Bedriaga, 1890; Shelkovnikov's tree frog), and Hyla sarda (De Betta, 1853; Tyrrhenian tree frog ). In Germany only the European tree frog, also known as the Common tree frog, can be found. The European tree frog is one of the smallest European anurans (Figure 1.1). The body length of adult individuals ranges from 27 mm to 50 mm (Tester, 1990; Friedl and Klump, 1997). Their dorsal skin is smooth and bright green. Depending on temperature, “mood”, and substrate, the coloration varies from yellowish to green, grey, or dark brown. The ventral side and the inner Figure 1.1: Calling tree frog male (Foto: Michael surface of the limbs are whitish to light grey Werner) with granular skin. On both sides a dark lateral stripe goes from the nostrils over the tympanum to the inguinal region, where it forms the inguinal loop. Characteristic for the tree frogs are their finger- and toe tips expanded into microscopic structured discs, which enable them to climb smooth plants. Males can be detected by the yellowish to brownish subgular vocal sac, while females have a white and smooth throat. The breeding season starts between late March and early May and ends between early June and mid-July (Schneider, 1966; Schneider, 1971; Tester, 1990; Grosse, 1994). The breeding ponds are characterized by rich submerged vegetation, shallow areas and exposure to the sun (Grosse and Nöllert, 1993). While males spend several nights at the breeding site, females typically stay for only one night. Friedl and Klump (2005) observed that the duration of male chorus attendance reflects male quality. Females deposit several clumps with a total clutch size of 150 to 450 eggs (Clausnitzer and Clausnitzer, 1984). In Eastern Europe clutch sizes up to 1000 eggs per female were observed (Bannikov et al., 1985). The majority of the tadpoles in Central Europe complete metamorphosis between June and August. After the mating season the tree frogs migrate to their summer habitat, usually within the radius of 500 m of the breeding site. Single individuals, especially juveniles migrate greater distances up to 3400 m (Fog, 1993). They can be found in trees, bushes, perennial plants or riparian vegetation. Important are sunny places with a moist microclimate and a

8 Chapter1 General introduction

complex vegetation structure (Stumpel, 1993). In the autumn the frogs migrate to their winter habitat. Deciduous and mixed forests with dense layers or piles of leaves and brushwood, copses, crevices and caves offer frost free places for hibernation (Nöllert and Nöllert, 1992; Geiger, 1998; Grosse, 2009). The lifespan of European tree frogs can reach in the wild 4 - 6 years (Stumpel and Hanekamp, 1986; Tester, 1990; Friedl and Klump, 1997). In captivity ages up to 22 years have been reported (Bannikov et al., 1985). Year-to-year survival rates were found to range between 20 and 44 % and in cold winters even lower (Tester, 1990; Friedl and Klump, 1997). Tester (1990) determined a population turn over rate of only three years.

1.3.2 Distribution Hyla arborea is widely distributed across the European continent (Figure 1.2). It occurs from North West Iberia and France eastwards to Western Russia and the Caucasian region, and southwards to the Balkans and Turkey. Except for southern and eastern Denmark and extreme southern parts of Sweden it is absent from Scandinavia (Kaya et al., 2009). It is a lowland species that has been recorded at a maximum altitude of 1,000 m a.s.l. in the Carpathian Mountains (Zavadil, 1993).

9 Chapter1 General introduction

Figure 1.2: Distribution map of the European tree frog (Hyla arborea), modified from IUCN (2009).

1.3.3 Conservation status and major threats The European tree frog is listed on Appendix II of the Berne Convention and on Annex IV of the EU Natural Habitats Directive. Therefore, it is subject to a strict protection system. Although the species is listed in the IUCN Red List in the Least Concern category, the overall population shows a decreasing trend (Kaya et al., 2009). While the species is common in suitable habitats in parts of its range, it has been reported to be fragmented and in significant decline over large parts of its Western European distribution (e.g. Fog, 1995; Baker, 1997; Gasc et al., 1997). The species is protected by national legislation in many countries. In the German Red Lists it is categorised in five states as Vulnerable, in six states as Endangered, in three states as Critically Endangered, and in one state (Berlin) as Extinct (Bast et al., 1992; Podloucky and Fischer, 1994; Bitz and Simon, 1996; Jedicke, 1996; Laufer, 1999; Rau et al., 1999; Schlüpmann and Geiger, 1999; Nöllert et al., 2001; Beutler and Rudolph, 2003; Klinge,

10 Chapter1 General introduction

2003; Brandt and Feuerriegel, 2004; Meyer and Buschendorf, 2004; Schneeweiß et al., 2004; Kühnel et al., 2005; Flottmann et al., 2008) The European tree frog is affected by habitat fragmentation and habitat degradation (Grosse, 1994; Tester and Flory, 1995; Pellet et al., 2004a; Pellet et al., 2004b). The loss of calling and breeding sites and the introduction of fish (Filoda, 1981; Clausnitzer, 1983; Bronmark and Edenhamn, 1994) are the main reasons for population decline.

1.3.4 Conservation genetics in the European tree frog Some conservation genetics studies on the European tree frog have already been conducted. One of the first studies used allozymes to investigate the status tree frogs in Sweden (Edenhamn et al., 2000). Low genetic variation was found in comparison with continental populations. The development of species specific microsatellite-primers by Arens (2000) and Berset-Brändli (2008) prompted more studies that assessed the genetic status of tree frog populations in Denmark, the Netherlands, and Switzerland (Andersen et al., 2004; Arens et al., 2006; Angelone and Holderegger, 2009; Dubey et al., 2009; Angelone et al., 2011). Most of these populations suffered from habitat loss and habitat fragmentation which was apparent in the genetic data. The lowest genetic diversity was found in the Danish populations on Lolland and was associated with an increased larval mortality (Andersen et al., 2004). However, in Switzerland the genetic analyses provided compelling evidence for the success of conservation and connectivity measures in the Reuss valley, leading to an enhanced tree frog migration among breeding sites within distances up to 4 km (Angelone and Holderegger, 2009). In a study in 2005 I started to shed light on the genetic situation of tree frogs in Germany. Bayesian analyses indicated that the tree frog occurrences near Hannover were fragmented into four genetically distinct clusters. However, the genetic variation was relatively high compared to the values in the adjacent countries. Moreover, within the Hannover region, I identified a potential source population for an introduced and previously unknown population in southwest Hannover (Krug and Pröhl, submitted). A phylogenetic study of the circum-Mediterranean Hyla species was carried out by Stöck et al. (2008). Their data suggest the Balkan region as a possible Pleistocene refugium with the subsequent colonisation of Middle and Western Europe by a single genetic lineage.

11 Chapter1 General introduction

1.4 Aims of the study The alarming situation in the European tree frog has evoked a great number of conservation measures. My aim is to support such measures with genetic analyses on different geographical levels by providing information for effective and successful management. My thesis consists of two geographic levels of analyses and interpretation which I will describe briefly.

1.4.1 Phylogeography in Germany and adjacent areas For several European amphibian species different postglacial colonisation routes have been described as forming contact zones in the German region amongst others (e.g. Weitere et al., 2004; Schmeller et al., 2008). The borders of such lineages are important for making correct decisions and to develop effective strategies in conservation management of threatened species and therefore need to be delineated for the European tree frog. Stöck et al. (2008) made a first attempt with a European wide analysis. Since their purpose was a wide-ranging phylogenetic study only few sample sites from Germany were included (four individuals from three sites in Germany). Important genetic structures could have been overlooked. Therefore, my goal is – with a more extensive sampling network – to analyse the phylogeographic structure, i.e. the existence of distinct genetic lineages of tree frogs in Germany. The results will be discussed in the context of already published mitochondrial data of other European sample sites.

1.4.2 Management Units in Lower Saxony and adjacent areas In Lower Saxony the current distribution of the European tree frog is very patchy with some larger occurrences in the lowlands. Severe declines have been observed mainly in the second part of the last century (Manzke and Podloucky, 1995). In some places measures for conservation management have already been implemented and initial success has been observed (e.g. Clausnitzer, 2004 (Celle); Buschmann et al., 2006 (Steinhuder Meer); LaReG, 2007 (Braunschweig); Richter and Mügge, 2012 (Diepholz)). Units for conservation management need to be delineated for the European tree frog in order to support these conservation activities.

12 Chapter1 General introduction

The second aim of this study is to perform a large scale conservation genetic survey of the European tree frog across its distribution in Lower Saxony and adjacent areas and to obtain insight into contemporary as well as historical processes. My special interest is to assess genetic diversity and to define units for conservation management.

Defining units for conservation management for the European tree frog (Hyla arborea) in Lower Saxony and adjacent areas

14 Chapter 2 Units for conservation management for the European tree frog

2.1 Abstract The European tree frog Hyla arborea has suffered from dramatic population declines in the last decades and has therefore been categorised as threatened in many Red Data lists. In Lower Saxony in Germany the current distribution of the tree frog is very patchy with some main occurrences in the lowlands. For supporting effective conservation measures this study aims to assess genetic diversity and to define units for conservation management. Across the tree frog distribution area in Lower Saxony and adjacent areas 237 individuals were sampled at 14 sites (~ 3 - 250 km apart from each other). All samples were genotyped with eight microsatellite loci and twelve sites were sequenced for an mtDNA cytochrome b fragment.

While all but one of the microsatellite pairwise Dest and FST values showed significant genetic differentiation (Dest: 0 - 0.46, FST: 0 - 0.18), Bayesian analyses indicated common structures forming seven distinct genetic clusters. The cytochrome b haplotype distribution highlights the former connection of the currently fragmented populations along the river Elbe. Since genetic diversity was relatively high, each of the sampled tree frog occurrences should have the potential to recover to a stable population size when applying appropriate local conservation measures. For new resettlement projects identified genetic structures should be considered for the choice of source populations. Where possible, it would be preferable to reconnect originally linked occurrences that are now separated in different conservation unites due to habitat fragmentation and genetic drift.

15 Chapter 2 Units for conservation management for the European tree frog

2.2 Introduction Amphibian populations around the world are seriously affected by severe declines in the last decades. In Europe habitat loss, fragmentation and degradation are the most significant threats to amphibians (Temple and Cox, 2009). For most of these species intensive conservation efforts are needed to prevent them from further decline and to regain a favourable conservation status. Stabilization of weakened populations can be achieved e.g. by improving the habitat, constructing new breeding ponds and connecting populations to stable networks (e.g. Hyla arborea: Tester and Flory, 2004; Bombina bombina: Brockmüller and Drews, 2009; Triturus cristatus and Pelobates fuscus: Rannap et al., 2009). However, in cases where extreme fragmentation isolates populations, reconnection is difficult. Highly isolated populations already suffering from inbreeding and low genetic diversity can be strengthened by introducing translocated individuals from other populations with the aim of increasing fitness and genetic diversity (e.g. Vipera berus: Madsen et al., 1999). This is a difficult task to undertake because mixing different gene pools can in the best case result in a higher fitness of the offspring (hybrid vigor), but it could also result in outbreeding-effects with fitness depression (hybrid breakdown) in subsequent generations which may drive the population into further decline. For example the introduction of individuals into a small inbred population of Florida panthers (Puma concolor coryi) led to a higher survival rate of hybrid offspring and helped to recover the population (Pimm et al., 2006). On the other hand, mixed- source reintroductions of slimy sculpins (Cottus cognatus) have led to outbreeding depression in second-generation descendents. In this case, source populations were genetically differentiated by an FST of 0.32 (Huff et al., 2011). Therefore, to minimize negative effects when translocations are necessary or mixed- source introductions are planned, it is essential to reveal genetic structures for effective species conservation management. Potential hidden barriers and units for conservation need to be delineated. Units for conservation management have been defined by using genetic analysis for several endangered species such as koalas (Lee et al., 2010), harbour porpoises (Wiemann et al., 2010) or Larch Mountain salamander (Wagner et al., 2005). These studies showed that in all these species limited migration due to natural and anthropogenic barriers formed genetic

16 Chapter 2 Units for conservation management for the European tree frog

distinct units. For purposes of conservation management the studies recommended all handling each unit individually. The European tree frog is a species that showed long-term decline in much of its Western European distribution, mainly caused by habitat loss, fragmentation and degradation. In Lower Saxony in Germany the current distribution of the tree frog is very patchy with some main occurrences in the lowlands (Figure 1). Severe declines have been observed mainly in the second part of the last century (Manzke and Podloucky, 1995). At some places measures for conservation management are already implemented and first successes have become apparent (e.g. Clausnitzer, 2004 (Celle); Buschmann et al., 2006 (Steinhuder Meer); LaReG, 2007 (Braunschweig); Richter and Mügge, 2012 (Diepholz)). For supporting such conservation activities, units for conservation management need to be delineated for the European tree frog. Most genetic analyses of the European tree frog have been conducted on a very local level and measured the genetic structure and diversity in more or less fragmented metapopulation systems (e.g. Edenhamn et al., 2000; Andersen et al., 2004; Arens et al., 2006; Angelone and Holderegger, 2009; Dubey et al., 2009). The aim of my study was to perform a large scale conservation genetic survey of the European tree frog across its distribution in Lower Saxony and adjacent areas. To allow insight on contemporary as well as historical processes I used eight microsatellite loci and mtDNA cytochrome b sequences. My specific aim was to assess genetic diversity and to define units for conservation management.

2.3 Materials and methods 2.3.1 Sample collection and preparation Fourteen sites were sampled across the tree frog distribution in Lower Saxony and adjacent distributions in North Rhine Westphalia and Saxony Anhalt. I chose one sample site in each main occurrence of the tree frog in this region (Figure 2.1). In the occurrence near Hannover however, I sampled four sites: two in the west of Hannover (KZ, KO) and two in the east of Hannover (KH, BH) for a comparison with small scaled spatial distances. In total 237 individuals were sampled with 5 - 22 individuals per sample site (see Table 2.1). Genetic material was collected by tips of tadpole tails and by buccal swabs of adult frogs. The adults

17 Chapter 2 Units for conservation management for the European tree frog

were collected from the choruses during the breeding season in spring 2005 and 2008. Tadpoles were sampled in summer 2007. DNA from the tail clips was fixed in 99 % ethanol and extracted using a proteinase K digestion followed by a Phenol-Chlorophorm protocol (Sambrook et al., 1989) and stored at -20 °C. DNA was extracted from the buccal swabs with an Invisorb Spin Swab Kit (Invitek) following the manufacturer’s protocol and stored at -20 °C.

Figure 2.1: Current distribution of the European tree frog in Lower Saxony and adjacent areas on the basis of TK25-quadrants (grey squares) (1994-2010 in Lower Saxony (NLWKN, 2011), 1993-2006 in North Rhine Westphalia (LANUV and NRW, 2011) and 1990-2000 in Saxony Anhalt (Meyer et al., 2004)). Dashed lines denote state borders, dots denote sample sites.

18 Chapter 2 Units for conservation management for the European tree frog

21 20 20

(0) (0) (0) (4) (1)

(♀)

5 8

12 (1) 20 (1) 11 (0) 20 (0) 20 18 20 (0) 22 (0) 20

: : mean

- -

0.02 0.00 0.06 0.00 0.00 0.13 0.05 0.14 0.08 0.15 0.11 0.05

π [%] π

- -

0.19 0.00 0.54 0.00 0.00 0.53 0.41 0.68 0.61 0.66 0.57 0.42

: expected : heterozygosity, SD:

, R: allelic richnessmean over all loci,

5.64 5.36 4.68 4.46 5.42 4.91 5.21 4.90 6.52 5.49 5.16 5.57

6.63 4.13 3.63 5.50 5.13 4.50 6.50 5.63 5.75 5.50 7.50 6.50 6.13 6.50

1000 permutations

: observed : heterozygosity, H

0.048 0.089 0.191 0.050 0.0 0.072 0.083 0.044 0.038 0.035 0.013 0.004 0.108 0.070

------

):number of included females adult when frogs sampled,were

♀

tadpoles, H

± SD ±

± 0.130 ± ± 0.137 ± 0.157 ± 0.085 ± 0.129 ± 0.085 ± 0.089 ± 0.089 ± 0.090 ± 0.070 ± 0.074 ± 0.084 ± 0.175 ± 0.084 ±

: samples : from

0.728 0.728 0.754 0.754 0.598 0.764 0.679 0.692 0.720 0.701 0.759 0.740 0.800 0.747 0.705 0.766

mean H mean

± SD ±

0.161 0.125

number of sampled individuals, (

± 0.103 ± ±

0.762 ± 0.762 0.813 ± 0.2 ± 0.813 0.211 ± 0.703 0.157 ± 0.800 0.195 ± 0.709 0.220 ± 0.739 0.139 ± 0.778 0.136 ± 0.731 0.788 0.112 ± 0.765 0.157 ± 0.810 0.146 ± 0.744 0.228 ± 0.631 0.819

mean H mean

: Samples : adultfrom frogs,

nucleotide diversity,

π:

Gifhorn

: inbreeding : coefficient boldwith values for significantdifference after

a/t

Overview of sampleof Overview sites

Strothe Sample site Sample Quakenbrück Westerkappeln Espelkamp Zentrum Kananohe Ost Kananohe Kolshorn Beinhorn Bassum Ruschwedel Wolfsburg Neuhaus Amt Salzwedel Wiesen Pevestorfer

haplotype diversity,

ST ID QU WK EK KZ KO KH BH BA RU WG AN SW PW number of alleles of over loci number all standard deviation, F h Table2.1:

19 Chapter 2 Units for conservation management for the European tree frog

For microsatellite analyses 5 - 22 individuals from each sample site were used. A total of eight polymorphic microsatellite loci (WHA1-9, WHA1-20, WHA1-25, WHA1-60, WHA1- 67, WHA1-103, WHA1-104, and WHA1-140) previously isolated by Arens et al. (2000) were amplified following the authors’ protocol, except for the annealing temperature for WHA1- 20, which was changed to 64.6 °C. PCR products were genotyped using the capillary sequencer MegaBace 1000 (Amersham Bioscience). Allele scoring was performed using the software Genetic Profiler v. 2.2. Fragments of 901 bp of cytochrome b (cyt b) of 5 - 20 individuals from each sample site, except KZ and BH in the Hannover population, were amplified via PCR using the primers MVZ 15-L (5′- GAACTAATGGCCCACACWWTACGNAA -3′) and Cytb AR-H (TAWAAGGGTCTT CTACTGGTTG) from Moritz (1992) and Goebel (1999). The PCR reaction (25 µl) consisted of 20 - 100 ng DNA, 1 µl of each primer (10 µM), 0.8 µl dNTP’s (10 mM 5PRIME), 2.5 µl 10x advanced Buffer (5PRIME), 1.25 U Taq DNA Polymerase

(5PRIME), and 17.45 µl H2O. PCR conditions were as follows: an initial denaturation at 94 °C for 3:00 min; 35 cycles at 94 °C for 45 s, annealing temperature of 50 °C for 45 s, extension at 65 °C for 1:00 min. The PCR products were sent to the Macrogen Company (Seoul, South Korea) for purification and sequencing with an ABI3730XL genetic analyzer (Applied Biosystems).

2.3.2 Statistical analysis 2.3.2.1 Historic structure: Analysis of mtDNA Both directions of the cytochrome b sequences were assembled using the computer software SeqMan™ II (DNASTAR, Inc., Konstanz, Germany). Multiple sequence alignments were performed in MEGA 4 (Tamura et al., 2007) using the Muscle algorithm (Edgar, 2004) and all variable sites were confirmed by visual inspection of the chromatograms. The same program was used to calculate p-distances between sample sites (Tamura et al., 2004). Haplotype diversity (h) and nucleotide diversity (π) (Nei, 1987) were determined with

ARLEQUIN v. 3.11 (Excoffier et al., 2005). A haplotype network of the cyt b data set was constructed via the statistical parsimony analysis of the program TCS 1.21 (Clement et al., 2000) using the default settings.

20 Chapter 2 Units for conservation management for the European tree frog

2.3.2.2 Recent structure: Analysis of Microsatellites

Microsatellite-data were checked for null alleles, stuttering and allelic dropout using MICRO-

CHECKER (Van Oosterhout et al., 2004). The program FSTAT v. 2.9.3 (Goudet, 1995) was used to test for genotypic disequilibrium of all pairs of loci in each sample and to calculate average allelic richness per population, which measures the number of alleles per locus corrected for different sample sizes. For the calculation of average allelic richness sample sites with less than ten individuals (QU and WK) were disregarded. For each sample site and locus the observed and expected heterozygosity (Nei, 1987), and deviation from Hardy-Weinberg equilibrium (HWE) (Guo and Thompson, 1992) were determined with ARLEQUIN v. 3.11 (Excoffier et al., 2005). GENEPOP v. 4.1 (Rousset, 2008) was used to test for a global deviation from HWE in each sample site. I calculated the inbreeding coefficient FIS per sample site (Weir and Cockerham, 1984) using GENETIX v. 4.05 (Belkhir et al., 1996-2004) and tested the significance with a permutations test (1,000 permutations).

Genetic differentiation between the sample sites was calculated as pairwise FST values

(Weir and Cockerham, 1984) in ARLEQUIN (Excoffier et al., 2005). However, since FST depends on marker variability and has been shown to be an imprecise estimate for genetic differentiation when applying microsatellites (Hedrick, 2005; Jost, 2008), I additionally calculated pairwise Dest (Jost, 2008), a substitute measure of genetic differentiation, using the R package DEMEtics (Gerlach et al., 2010). Significance was calculated by 10,000 bootstraps. In order to test for isolation by distance I conducted a mantel test for correlation between pairwise genetic distances (FST and Dest) and pairwise geographic distances, implemented in IBDWS 3.23 (Jensen et al., 2005). As proposed by Rousset (1997) for populations in two-dimensional habitats, geographical distance was log-transformed and genetic distance was expressed as FST /(1 − FST) respectively Dest /(1 − Dest). Significance for r ≤ 0 was assessed via 10,000 bootstraps. Sample site QU was omitted from these analyses because of the small sample size (N = 5). The linear geographic distances among sample sites were calculated in ArcView GIS 3.3 using the Distance Matrix extension (Jenness, 2005). Two Bayesian clustering models were conducted to infer genetic clusters. First I used

STRUCTURE (Pritchard et al., 2000). The aim of this method is to define clusters of individuals

21 Chapter 2 Units for conservation management for the European tree frog

on the basis of their genotypes at multiple loci using a Bayesian procedure. It attempts to find population clusters by reducing linkage disequilibrium and deviations from the Hardy- Weinberg equilibrium within inferred clusters. The user specifies a priori the number of population clusters (K) and estimates the log likelihood Pr(X|K) for this model. For finding the most likely number of genetic clusters the log likelihood Pr(X|K) is always calculated for a series of K values.

All STRUCTURE runs used 50,000 iterations after a burn-in period of 50,000. Because of the patchy distribution of the tree frog occurrences in this region and the large distances between most sample sites, I used the assumption of the no-admixture model and independent allele frequencies. This prior means that allele frequencies are expected in different clusters to be reasonably different from each other. Twenty runs were performed for each K. The range of possible Ks tested was from 1 to 14, according to the number of sampled breeding sites. I calculated the average log likelihood Pr(X|K) (given by the estimated Ln Prob of data = Ln P(D) in the software result output) for each K across all runs. Since it is not always straightforward to detect the true number of K, I included the ΔK statistics proposed by Evanno (2005), using Structure Harvester v.0.6.8 (Earl and vonHoldt, 2012).

Secondly, I applied GENELAND version 3.2.2 (Guillot et al., 2005a; Guillot et al., 2005b). This software uses again a Bayesian method to detect population structure but considers spatial information of the individuals. The number of genetic clusters (K) was determined by independently running the MCMC ten times, allowing K to vary from 1 to 14 to verify the consistency of the inferred K. The number of MCMC iterations was set to 100,000 per run with a thinning of 100. The uncertainty of spatial coordinates was set to 0 km and the uncorrelated frequency model was used without the assumption of null alleles.

2.3.2.3 Biogeographic zones To identify biogeographical boundaries or zones where genetic differences between pairs of populations were largest I used the Monmonier’s algorithm as implemented in Barrier 2.2 (Manni et al., 2004). I computed the first three barriers based on cytochrome b data (p- distances) and on microsatellites (FST values). For the microsatellite data I tested the robustness of the barriers by 100 bootstrapped FST-matrices calculated via the R-package

22 Chapter 2 Units for conservation management for the European tree frog

Hierfstat (Goudet, 2005). I then considered only barriers with more than 50% support. To assess significances in this study I applied sequential Bonferroni corrections (Rice, 1989) to all multiple comparisons.

2.4 Results 2.4.1 Mitochondrial sequence analysis I revealed 11 haplotypes of the cytochrome b fragment which differed by ten variable sites and nine parsimony informative sites (Figure 2.2; Appendix 1 and 2). Most haplotypes were unique to one sample site except haplotype Hy-1, Hy-2, and Hy-5. Hy-1 (blue) and Hy-5 (red) showed a broad distribution almost over the complete sampling area. Haplotype Hy-2 (green) was restricted to five sample sites in the north east (Figure 2.3). P-distances were low, varying between 0 and 0.4 % (Appendix 3). The highest estimates of mtDNA diversity were found in RU (h = 0.68, π = 0.14 %) and AN (h = 0.66, π = 0.15 %). The lowest values were found in QU, EK, and KZ (all: h = 0, π = 0 %).

Figure 2.2: Haplotype network of 11 distinct haplotypes of cyt b of Hyla arborea (901 bp) in Lower Saxony and adjacent areas. Each haplotype is represented by one circle and colour. The size of the circles corresponds to the haplotype frequency. Lines between haplotypes denote mutational steps between sequences.

23 Chapter 2 Units for conservation management for the European tree frog

Figure 2.3: Distribution of cyt b haplotypes in the sample area of Lower Saxony and adjacent areas. Each haplotype is represented by one colour corresponding to the colours in the haplotype network Figure 2.2.

2.4.2 Microsatellite analysis The eight microsatellite markers examined were polymorphic with seven to sixteen alleles per locus. The analysis using Micro-Checker uncovered signs of null alleles for the locus WHA1- 67 in the sample site KO and for the locus WHA1-140 in the sample site SW. As null alleles for the two loci were found at a single sample site only, I did not adjust for null alleles. Furthermore this analysis revealed no evidence for large allele dropout or scoring errors due to stuttering. Deviation from Hardy-Weinberg-Equilibrium was found for WHA1-60 with a significant heterozygosity excess in the sample sites KH, BH and AN. For WHA1-104 a deficiency was found in KH. The global test for HWE over all loci in each population resulted

24 Chapter 2 Units for conservation management for the European tree frog

in no significant deviation. Significant values for the inbreeding coefficient FIS were obtained for the sample sites SW (FIS = 0.108), WK (FIS = -0.191), PW (FIS = -0.070) and KH (FIS = -0.083). No Linkage (genetic) disequilibrium was found between any pair of loci. Since Berset-Brändli et al. (2007) found the locus WHA1-6 to be sex linked with a suppressed recombination in males, I tested its influence on the outcome of all analyses.

Excluding the sex-linked locus increased the FIS values slightly. Only sample site SW showed now significant signs for inbreeding (FIS: 0.130). Expected heterozygosity values however did not change remarkably after excluding WHA1-60 (mean He locus WHA1-60 included: 0.73; excluded: 0.72). An influence of WHA1-60 on the results of all other analyses was not evident. Therefore, I decided to keep this locus in the analyses.

Genetic differentiation calculated as pairwise Dest- and pairwise FST values were significant in all cases except between the two sample sites in the West of Hannover KZ and

KO (Table 2.2). In general Dest values were higher than FST values. The Mantel test for Isolation by distance showed a significant but low correlation between genetic and geographic distances (Figure 2.4; Dest: r = 0.40, P = 0.0007; FST: r = 0.40, P = 0.0003). Indicating, that genetic differentiation is partially explained by geographic distance among sites.

25 Chapter 2 Units for conservation management for the European tree frog

PW 0.067 0.153 0.07 0.096 0.096 0.086 0.092 0.070 0.068 0.063 0.068 0.084 0.079 0

SW 0.091 0.154 0.100 0.096 0.091 0.108 0.118 0.078 0.099 0.082 0.102 0.107 0 0.267

AN 0.091 0.134 0.071 0.097 0.091 0.094 0.117 0.079 0.073 0.073 0.062 0 0.387 0.305

ST 0.087 0.089 0.093 0.088 0.087 0.058 0.075 0.071 0.067 0.050 0 0.233 0.360 0.233

WG 0.054 0.113 0.068 0.088 0.088 0.072 0.080 0.037 0.060 0 0.183 0.293 0.287 0.259

RU 0.112 0.180 0.085 0.125 0.118 0.063 0.092 0.068 0 0.226 0.190 0.250 0.323 0.258

BA 0.046 0.104 0.065 0.075 0.073 0.060 0.081 0 0.229 0.150 0.256 0.282 0.266 0.276

BH 0.110 0.163 0.085 0.105 0.107 0.036 0 0.266 0.277 0.284 0.245 0.371 0.386 0.310

values (upper values between samplematrix) sites;bold difference = significant after sequential

KH 0.117 0.127 0.075 0.087 0.085 0 0.096 0.209 0.194 0.270 0.196 0.312 0.376 0.320

0.001

KO 0.125 0.121 0.043 - 0 0.270 0.325 0.252 0.361 0.334 0.301 0.312 0.248 0.292

0.004

KZ 0.121 0.087 0.051 0 - 0.274 0.313 0.248 0.356 0.331 0.287 0.303 0.259 0.257

EK 0.053 0.108 0 0.147 0.145 0.255 0.275 0.257 0.292 0.307 0.346 0.257 0.335 0.299

values (below and pairwisematrix) F

est

WK 0.114 0 0.285 0.223 0.302 0.348 0.426 0.280 0.464 0.346 0.255 0.372 0.397 0.413

wise D wise

Pair

QU 0 0.198 0.136 0.351 0.387 0.449 0.419 0.219 0.426 0.188 0.327 0.296 0.29 0.273

QU WK EK KZ KO KH BH BA RU WG ST AN SW PW Bonferronicorrection. Table2.2:

26 Chapter 2 Units for conservation management for the European tree frog

Figure 2.4: Isolation by distance plots. (a) Dest /(1 - Dest) versus log geographic distance and (b) FST /(1 - FST) versus Log geographic distance. Lines are the RMA (reduced major axis) regression.

For the STRUCTURE analysis both approaches to determine the correct number of genetic clusters, the ΔK statistics by Evanno (2005) and the average log likelihood- values Pr(X|K), peaked clearly at K = 7 (Figure 2.5; Figure 2.6). One main cluster in the West of Hannover consisted of the sample sites WK, EK, KZ, KO (red). The sample sites KH and BH in the East of Hannover formed an extra cluster (blue) separated from the sites in the West. Sample site WG was admixed with large parts of the cluster build by BA (yellow) and RU and ST (green). The sample sites in the East – SW, PW and AN were separated in three further clusters (orange, grey and light-blue) whereas the latter formed one cluster together with QU in the West of Lower Saxony.

27 Chapter 2 Units for conservation management for the European tree frog

Figure 2.5: Mean values of estimated Ln probability of data (LnPD) for each K (a) and delta K (b)

Figure 2.6: STRUCTURE bar plot for K = 7; QU, WK, EK etc. = sample sites, separated by fine black lines. Each individual is represented by a single vertical line broken into K-coloured segments, with lengths proportional to each of the K-inferred clusters.

In consistency with the STRUCTURE result, in the GENELAND analysis the highest average log posterior probability was found for seven genetic clusters. Cluster 1: WK, EK, KZ, KO; cluster 2: KH, BH; cluster 3: QU, BA, WG; cluster 4: RU, ST; cluster 5: SW; cluster 6: AN; and cluster 7: PW. This is the same clustering as found by the Structure analysis except for the assignment of sample site QU. (Figure 2.7)

28 Chapter 2 Units for conservation management for the European tree frog

Figure 2.7: Map of estimated cluster membership for K = 7 by GENELAND analysis. Each cluster is shaded in a single colour.

2.4.3 Biogeographic zones The most significant genetic discontinuities among sampled locations were estimated on the basis of microsatellite FST-values and cyt b -p-distances. Obtained barriers are marked with lines in figure 2.8. Two barriers were supported by both markers (microsatellites and cyt b). One barrier separated KZ from KH (KO and BH were not considered in sequence analysis), and a second barrier was found between WK and EK.

29 Chapter 2 Units for conservation management for the European tree frog

Figure 2.8: Most important barriers to gene flow from the BARRIER analysis (Manni et al., 2004). Red Lines indicate most significant barriers to gene flow (> 50 % bootstrap support) estimated on microsatellite FST-values. Significance of barriers are given as percent bootstrap. Barriers estimated on the basis of cyt b p-distances are marked with grey lines ranked I-III, in order of decreasing magnitude. In green the Delaunay triangulation, in blue the Voroni tessellation between sample sites, used to calculate borders to neighbouring sample sites.

2.5 Discussion I analysed the broad scaled genetic structure and variation of the Lower Saxonian tree frog occurrences to aid conservation management implementation. Cyt b sequences showed low variation but distinct geographic-genetic pattern was revealed. Using microsatellite analysis I found seven distinct genetic clusters. Genetic diversity was high in most sample sites. For supporting measures of effective conservation management, the identification of conservation units or management units (MUs) is critical (Palsbøll et al., 2007). “Management Units are defined as demographically independent breeding units and are identified as populations having distinctive allele frequencies” (Moritz, 1994b). Their recognition is fundamental to proper short-term management (Moritz, 1994a). The genetic clusters revealed by STRUCTURE and GENELAND can more or less been used to delineate such

30 Chapter 2 Units for conservation management for the European tree frog

management units as conducted e.g. for Koalas in the area of Sidney (Lee et al., 2010). Palsbøll et al. (2007) propose that “MU status should only be assigned when the observed estimate of genetic divergence is significantly greater than a predefined threshold value.” Unfortunately, corresponding studies are missing especially for amphibians defining such a specific threshold value. The only study that defined MUs in an anuran species on a comparable geographic scale was conducted by Dolgener et al. (2012) for yellow bellied toads (Bombina bombina) by applying microsatellites and d-loop sequences. Based on cyt b sequences and RAPD loci Wagner et al. (2005) defined two distinct conservation units in Larch Mountain salamanders in the North and South of the Columbia River. However, since he found distinct monophyletic groups in cyt b the revealed units should be considered on the level of ESU’s (evolutionary significant units) rather than as management units.

2.5.1 Genetic structure and conservation units

Microsatellite pairwise Dest and FST values showed all significant genetic differentiation except the two closest sites in the West of Hannover. However, mtDNA and Bayesian analyses of the microsatellites still display distinct relationships between currently fragmented occurrences. In the Northeast of Lower Saxony, the distribution of the cyt b haplotype Hy-2 (green in Figure 2.3) highlights the former connection of the populations along the river Elbe. In both Bayesian analyses of the microsatellites the localities RU and ST form a common cluster. In earlier distribution maps, a sparse but nearly continuous distribution up into the 1980s was apparent in this area (Appendix 5). However, today both populations are separated by a large gap in the distribution forming demographically independent breeding units and should be considered as separate management units. Interestingly AN, PW, and SW which, in current and former distributions constitute a relatively well connected area, present distinct genetic clusters in the Bayesian analyses. Furthermore, a major barrier to gene flow was revealed around SW and PW. The significant

FIS values found for SW indicate that the separation of this site may have resulted from genetic drift caused by inbreeding. For now AN, PW, and SW should be regarded as separate management units. Nonetheless, efforts should be orientated to a reconnection of this area.

31 Chapter 2 Units for conservation management for the European tree frog

In contrast, the Western occurrences show a relatively strong geographic structure. Because of the common cluster of KZ, KO, EK, and WK in the Bayesian analyses of microsatellites one could assume that there was migration among these populations at least until the recent past. This would imply that these occurrences could be considered as one management unit. However, on the basis of the completely different haplotypes in EK and KZ and the large geographic distance between each other for now both occurrences should be handled as different management units. A male biased dispersal could be a possible explanation for the genetic pattern. However, there are no specific studies on the phenomenon of different dispersal abilities in European tree frogs. A molecular analysis of further sample sites of the tree frog occurrence near EK would be helpful to clarify the relationships between both sites. Additionally, WK should be regarded as an extra management unit considering the observed barriers. The low sample size of five individuals in QU does not allow it to be assigned as a distinct conservation unit in this locality. A more intense sampling in this area is required. A clear assignment to a distinct management unit is warranted for KH and BH in the East of Hannover. Microsatellite and sequence data show a clear separation of the occurrences in the West of Hannover, underlined by strong barriers. Interestingly the genetic divergence of the sample sites KZ and KO in the West of Hannover and the sample sites KH and BH in the East of Hannover into two different clusters is similar to the divergence among other occurrences in lower Saxony separated by much larger geographic distance. This observation raises the question of how fast and by which means such genetic differentiation could be generated? One possibility is that recently constructed motorways in combination with genetic drift due to population bottlenecks contribute to population differentiations which are apparent not only in microsatellite allele frequencies but also in mitochondrial haplotype frequencies. One central question here is whether these relatively young barriers (motorways expanded in the 1960ies, and dense urban areas) are the only reasons leading to this differentiation or whether more ancient and natural circumstances, as can be hypothesised by the mtDNA data, also played a role? Maybe the assumption that these populations were formerly linked (Manzke and Podloucky, 1995) need to be reassessed.

32 Chapter 2 Units for conservation management for the European tree frog

Rather inconclusive is the assignment of WG. In the STRUCTURE analysis this site appears to be an admixture of the adjacent clusters. Very interesting is the similarity between BA and WG apparent in genetic distances and in Bayesian analyses – although they are 140 km apart from each other. A possible explanation is their location in the area of influence of the “Aller Urstromtal” (ice-marginal valley). It is possible that these populations have been connected in the past by migration along this “valley”, which is still evident by the high genetic similarity. However, an anthropogenic influence by translocation of individuals can not be excluded. I would assign BA to its own management unit because of the apparent current demographic independence of WG.

2.5.2 Genetic diversity

Values of expected heterozygosity (He) as a measure for genetic diversity of the sampled populations was found to vary between 0.60 and 0.80 (mean: 0.73). This is comparable but mostly higher as values found in studies on the European tree frog in neighbouring countries.

Here, fragmented as well as more continuous distributions have been investigated. Mean He values are found between 0.39 - 0.59 in the Netherlands (Arens et al., 2006) and 0.54 - 0.68 in Switzerland (Angelone and Holderegger, 2009; Dubey et al., 2009). The lowest values were found in Denmark on the island of Lolland (0.35 - 0.50). This population had already suffered reduced fitness, indicated by increased larval mortality (Andersen et al., 2004). Such low values have not been reached by any of my sampled populations.

2.5.3 Future goals Actually it is not known whether certain genetic distances are originally high or low, whether they are driven by natural environmental effects or by anthropogenic effects such as motorway-barriers, or are e.g. the effect of unknown translocations. The question remains how fast in the case of European tree frogs the revealed genetic differentiations arises, especially, if one considers the populations in the West and East of Hannover which are relatively close to each other. Other sites in Lower Saxony are geographically distant but show similar genetic differentiation. This raises the next question: whether the genetic

33 Chapter 2 Units for conservation management for the European tree frog

differentiation at this level has an impact on the ecological differentiation in the tree frog. Breeding and fitness tests between populations that have genetically diverged to different degrees would be of interest in this respect.

2.5.4 Conclusion and implications for conservation management The values for heterozygosity in the surveyed areas are relatively high, and therefore I would not expect fitness-depression to occur in most H. arborea populations in Lower Saxony. Measures for population recovery should be in the first instance constructing networks of breeding sites. There are several reports that the European tree frog responds well to new suitable water bodies or their restoration and often colonises them the following breeding season (e.g. Hansen, 2004 (in DK); Zumbach, 2004 (in CH)). Even small and fragmentary relict populations can recover to strong populations of high constancy (Schwartze, 2002). However, if translocations of individuals are necessary e.g. to recover very small and inbred populations or for reintroduction measures, the revealed genetic structures of the Bayesian analyses by GENELAND and STRUCTURE and the identified barriers should be considered, especially as long as it is not known which degree of genetic differentiation could already be enough to cause effects of outbreeding depression. This is an urgent aspect to investigate in future studies. Nonetheless, in the long run a reconnection of originally linked occurrences, which at present are separated into different MUs in consequence of habitat fragmentation and genetic drift, should be achieved.

2.6 Acknowledgement This research was supported by grants from the German Federal Environmental Foundation (DBU), Heidehof-Stiftung, and “Hans-Schiemenz-Fonds“ - Deutsche Gesellschaft für Herpetologie und Terrarienkunde (DGHT). I thank the following Nature conservation authorities for permission for tree frog collection: the biosphere reserve Niedersächsische Elbtalaue, Kreis Minden Lübbecke, Kreis Steinfurt, Landkreis Diepholz, Landkreis Gifhorn, Landkreis Lüneburg, Landkreis Osnabrück, Landkreis Stade, Landkreis Uelzen, Region Hannover, Stadt Wolfsburg, Sachsen Anhalt. I am especially grateful to Annika Ruprecht,

34 Chapter 2 Units for conservation management for the European tree frog

Christina Akman, Frank Weihmann, Günter Krug, Heike Pröhl, Irena Czycholl, Ivonne Meuche, Jana Kirchhoff, Kim Jochum, Matei Balborea, Michael Weinert, and Wiebke Feindt for help during field work. Finally I thank our technician Sabine Sippel for her assistance in the molecular lab.

Phylogeographic structure of the European tree frog (Hyla arborea) in its German distribution area

36 Chapter 3 Phylogeography of the European tree frog in Germany

3.1 Abstract Knowledge about the existence of different genetic lineages within endangered species is important for conservation management. To assess the phylogeographic structure of the European tree frog across its distribution area in Germany, 372 individuals were sampled at 31 sites and sequence analyses of a mitochondrial gene fragment (cytochrome b) and analyses of eight microsatellite loci were carried out. Sequence divergence between sample sites was low varying between 0 and 0.4 % (overall: 0.2 %) and no distinct genetic lineages were found. Nonetheless, a clear North-South partitioning could be revealed by both molecular markers with the Central German Uplands as probable barrier. Furthermore, the influence of the major rivers such as Elbe, Rhine, and Danube on the phylogeographic structure could be revealed. Concerning future conservation measures, the identified genetic structures should be considered, especially for the choice of individuals if resettlements should be necessary.

37 Chapter 3 Phylogeography of the European tree frog in Germany

3.2 Introduction The current genetic structure of many species was fundamentally shaped by the recent glacial periods. Depending on the location and number of glacial refugia and the route of recolonisation of the continent, distinct genetic lineages of a species could have evolved. Especially for threatened species for which conservation measures are planned or are already implemented, the boundaries of different genetic lineages and potential contact zones are important to recognize to decide about strategies to avoid accidentally mixing distinct clades. Besides the general aim to maintain the species genetic diversity and historic integrity, the fitness of hybrid offspring can suffer reduced fitness due to endogenous selection by melding distinctly co-adapted gene complexes (Harrison, 1993). Phylogeographic analyses, mostly based on sequencing of mitochondrial DNA (cyt b, d-loop, COI), can reveal such lineages. In Europe different genetic lineages were described for several species (Taberlet et al., 1998 e.g. Ursus arctos, Crocidura suaveolens, Chorthippus parallelus). Also for amphibian species distinct genetic lineages were described. For example two distinct Rana temporaria lineages were described in Eastern and Western parts of Europe forming a contact zone in northern Germany. Furthermore, evidence was found for an Irish glacial refugium (Palo et al., 2004; Schmeller et al., 2008; Teacher et al., 2009). For the fire salamander (Salamandra salamandra) an Eastern and Western postglacial lineage were described (Steinfartz et al., 2000) forming contact zones in Western Germany (Weitere et al., 2004) The presence of such potential distinct lineages or contact zones needs to be examined for the European tree frog, Hyla arborea, a species that showed long-term decline in much of its Western European distribution, mainly caused by habitat loss, fragmentation and degradation. Conservation measures such as habitat restoration and population resettlements are conducted. Stöck et al. (2008) made a first attempt with a Europe-wide molecular analysis. Since their purpose was a wide-ranging phylogenetic study, only few sample sites in Germany were included (four individuals from three sites in Germany) and therefore important genetic structures could have been overlooked. Therefore, my interest is, with a more extensive sampling network, to analyse the phylogeographic structure of tree frogs in Germany. My main question is if there are two or more genetic lineages of the European tree frog in different areas in Germany. The results will be discussed in the context of already

38 Chapter 3 Phylogeography of the European tree frog in Germany

published mitochondrial data of other European sample sites and the importance of the results for conservation management.

3.3 Material and methods 3.3.1 Sample collection and preparation Thirty-one sites were sampled spanning a coarse net across the tree frog distribution in Germany. In total 372 individuals were sampled with 1 - 22 (mean: 12) individuals per sample site (see Table 3.1). Because of a preliminary study on the relationship of European tree frogs in Lower Saxony the sampling is more detailed in this area. Genetic material was collected by tips of tadpole tails and by buccal swabs of adult frogs. The adults (mostly males) were collected from the choruses during the breeding season in spring 2005, 2008 and 2009. Tadpoles were sampled in summer 2007. DNA from the tail clips was fixed in 99 % ethanol and extracted using a proteinase K digestion followed by a Phenol-Chlorophorm protocol (Sambrook et al., 1989) and stored at -20 °C. From the buccal swabs DNA was extracted with an Invisorb Spin Swab Kit (Invitek) following the manufacturer’s protocol and stored at -20 °C. Fragments of 900 bp of cytochrome b (cyt b) of 1 - 20 individuals from each sample site, except KZ and BH in the Hannover population, were amplified via PCR using the primers MVZ 15-L (5′- GAACTAATGGCCCACACWWTACGNAA -3′) and Cytb AR-H (TAWAAGGGTCTT CTACTGGTTG) from Moritz (1992) and Goebel (1999). The PCR reaction (25 µl) consisted of 20 - 100 ng DNA, 1 µl of each primer (10 µM), 0.8 µl dNTP’s (10mM 5PRIME), 2.5 µl 10x advanced Buffer (5PRIME), 1.25 U Taq DNA Polymerase

39 Chapter 3 Phylogeography of the European tree frog in Germany

a t Table 3.1: Overview of sample sites. : samples from adult frogs, : samples from tadpoles, Ho: observed heterozygosity, He: expected heterozygosity, SD: standard deviation, NA: mean number of alleles over all loci, h: haplotype diversity, π: nucleotide diversity, N: number of sampled individuals for microsatellite respectively sequence analyses

ID Sample site mean Ho ± SD mean He ± SD NA h π [%] Nmsat Nseq BLO Blomnath t 0.750 ± 0.189 0.719 ± 0.147 3.6 0.00 0.00 4 4 HAK Hakendorf a - - - 0.00 0.00 1 2 HKT Hütter Klosterteiche a 0.594 0.737 ± 0.191 4.3 0.67 0.07 4 4 SAZ Sassnitz a - - 3.8 0.83 0.11 3 4 QU Quakenbrück a 0.813 ± 0.242 0.754 ± 0.137 4.1 0.00 0.00 5 5 WK Westerkappeln a 0.703 ± 0.211 0.598 ± 0.157 3.6 0.54 0.06 8 8 EK Espelkamp a 0.800 ± 0.157 0.764 ± 0.085 5.5 0.00 0.00 12 9 KZ Kananohe Zentrum a 0.709 ± 0.195 0.679 ± 0.129 5.1 0.00 0.00 20 19 KO Kananohe Ost a 0.739 ± 0.220 0.692 ± 0.085 4.5 - - 11 0 KH Kolshorn a 0.778 ± 0.139 0.720 ± 0.089 6.5 0.53 0.13 20 20 BH Beinhorn a 0.731 ± 0.136 0.701 ± 0.089 5.6 - - 20 0 BA Bassum t 0.788 ± 0.103 0.759 ± 0.090 5.8 0.41 0.05 20 19 RU Ruschwedel a 0.765 ± 0.112 0.740 ± 0.070 5.5 0.68 0.14 18 16 WG Wolfsburg-Gifhorn 0.810 ± 0.157 0.800 ± 0.074 7.5 0.61 0.08 20 19 ST Strothe a/t 0.762 ± 0.161 0.728 ± 0.130 6.6 0.19 0.02 21 20 AN Amt Neuhaus a 0.744 ± 0.146 0.747 ± 0.084 6.5 0.66 0.15 22 18 SW Salzwedel t 0.631 ± 0.228 0.705 ± 0.175 6.1 0.57 0.11 20 18 PW Pevestorfer Wiesen a 0.819 ± 0.125 0.766 ± 0.084 6.5 0.42 0.05 20 20 AGM Angermünde a 0.583 ± 0.295 0.692 ± 0.306 3.5 0.00 0.00 3 3 SBK Schönebeck a 0.785 ± 0.210 0.711 ± 0.127 4.9 0.54 0.06 10 8 OVH Overhagen a 0.759 ± 0.211 0.796 ± 0.058 5.8 0.20 0.04 10 10 MOZ Modelwitz t 0,638 ± 0,223 0,628 ± 0,211 4.5 0.43 0.10 20 8 SB Steinbrücken a 0.775 ± 0.271 0.775 ± 0.195 5.0 0.60 0.07 5 5 OL Oberlausitz a 0.660 ± 0.279 0.651 ± 0.254 5.5 0.79 0.21 10 8 KOB Koblenz a 0.900 ± 0.120 0.815 ± 0.089 6.3 0.00 0.00 10 10 FS Fabrikschleichach a 0.891 ± 0.104 0.814 ± 0.063 6.0 0.25 0.03 8 8 KAS Karlsruhe Süd a 0.788 ± 0.247 0.828 ± 0.092 7.5 0.69 0.13 10 10 OFF Offenburg a 0.840 ± 0.104 0.773 ± 0.066 5.6 0.50 0.06 9 9 RAV Ravensburg a 0.781 ± 0.129 0.726 ± 0.097 4.6 0.75 0.24 8 8 BGH Burgheim a 0.788 ± 0.173 0.751 ± 0.085 5.9 0.47 0.10 10 10 ISM Isarmuend a 0.713 ± 0.189 0.735 ± 0.117 5.5 0.62 0.10 10 10

40 Chapter 3 Phylogeography of the European tree frog in Germany

Since preliminary analyses revealed low variation of cyt b sequences I included the analysis of eight species specific microsatellite loci (WHA1-9, WHA1-20, WHA1-25, WHA1-60, WHA1-67, WHA1-103, WHA1-104, and WHA1-140) previously isolated by Arens et al. (2000). The microsatellites were amplified for 1-22 individuals from each sample site following the authors’ protocol, except for the annealing temperature for WHA1-20, which was changed to 64.6 °C. PCR products were genotyped using the capillary sequencer MegaBace 1000 (Amersham Bioscience) and ABI 3500 (Applied Biosystems). Allele scoring was performed using the corresponding software Genetic Profiler v2.2 and GeneMapper v4.1.

3.3.2 Statistical analysis 3.3.2.1 Analysis of mtDNA in Germany Both directions of the cyt b sequences were assembled using the computer software SeqMan™ II (DNASTAR, Inc., Konstanz, Germany). Multiple sequence alignments were performed in MEGA 5 (Tamura et al., 2011) using the Muscle algorithm (Edgar, 2004) and all variable sites were confirmed by visual inspection of the chromatograms. The same program was used to calculate p-distances between sample sites (Tamura et al., 2004). A haplotype network of the cyt b data set was constructed via the statistical parsimony analysis of the program TCS 1.21 (Clement et al., 2000) using the default settings. Haplotype diversity

(h) and nucleotide diversity (π) (Nei, 1987) were determined with ARLEQUIN v. 3.11 (Excoffier et al., 2005).

3.3.2.2 Analysis of microsatellites in Germany

Microsatellite-data were checked for null alleles, stuttering and allelic dropout using MICRO-

CHECKER (Van Oosterhout et al., 2004). The program FSTAT v. 2.9.3 (Goudet, 1995) was used to test for genotypic disequilibrium of all pairs of loci in each sample. For each sample site and locus the observed and expected heterozygosity (Nei, 1987) and deviation from Hardy-

Weinberg equilibrium (HWE) (Guo and Thompson, 1992) were determined with ARLEQUIN v. 3.11 (Excoffier et al., 2005). GENEPOP v. 4.1 (Rousset, 2008) was used to test for a global deviation from HWE in each sample site. Genetic differentiation between the sample sites

41 Chapter 3 Phylogeography of the European tree frog in Germany

was calculated as pairwise Dest values (Jost, 2008) using the R package DEMEtics (Gerlach et al., 2010). Significance was calculated by 10,000 bootstraps.

A Bayesian clustering model performed with the program STRUCTURE 2.3.3 (Pritchard et al., 2000) was used to infer genetic clusters. The aim of this method is to define clusters of individuals on the basis of their genotypes at multiple loci using a Bayesian procedure. It attempts to find population clusters by reducing linkage disequilibrium and deviations from the Hardy-Weinberg equilibrium within inferred clusters. The user specifies a priori the number of population clusters (K) and estimates the log likelihood Pr(X|K) for this model. For finding the most likely number of genetic clusters the log likelihood Pr(X|K) is always calculated for a series of K values.

All STRUCTURE runs used 200,000 iterations after a burn-in period of 50,000. Because of the large distances between most sample sites, I used the assumption of the no-admixture model and independent allele frequencies. Fifteen runs were performed for each K. The range of possible Ks tested was from 1 to 31, according to the number of sampled breeding sites. I calculated the average log likelihood Pr(X|K) (given by the estimated Ln Prob of data = Ln P(D) in the software result output) for each K across all runs. Since it is not always straightforward to detect the true number of K, I included the ΔK statistics proposed by Evanno (2005) using Structure Harvester v.0.56.4 (Earl and vonHoldt, 2012). Furthermore,

STRUCTURE provided values of allele-frequency divergence among revealed clusters (net nucleotide distance), computed by using point estimates of P. Because of low sample size populations BLO, AGM, HAK, HKT and SAZ have been excluded from most microsatellite analyses. Sample sites SB and QU were included, nonetheless results should be regarded with caution. To assess significances in this study I applied sequential Bonferroni corrections (Rice, 1989) to all multiple comparisons.

3.3.2.3 Analysis of mtDNA in the European context To put the phylogeographic structure found in Germany in a species-wide context, I compared my data with further 90 cyt b sequences of 30 sample sites of Hyla arborea in Europe which were already published by Stöck et al. (2008; 2011). Another haplotype network was built on the basis of 851 bp fragments.

42 Chapter 3 Phylogeography of the European tree frog in Germany

3.4 Results 3.4.1 Analysis of mtDNA in Germany I revealed 26 haplotypes of the cytochrome b fragment (Appendix 1) which differed by 28 variable sites and 23 parsimony informative sites (Figure 3.1; for detailed information on individual-haplotype-assignment see Appendix 2). Most haplotypes were unique to one sample site except haplotype Hy-1, Hy-2, Hy-5, Hy-12, and Hy-20. Hy-5 (red) was the main haplotype showing a broad distribution almost over the complete sampling area. All other haplotypes differed by only single mutation steps. The second most common haplotype Hy-1 (blue) and its derivates Hy-6, Hy-9, Hy-21, and Hy-22 were restricted to the Northern part of Germany. Hy-2 (green) is shared by five sample sites near the river Elbe and Hy-12 (yellow) by two sample sites near the river Danube. The two sample sites sharing the haplotype Hy-20 (violet) are both located in the Middle East of Germany. (Figure 3.2) P-distances among sample sites were low, varying between 0 and 0.4 % (Appendix 6). The overall distance was 0.2 %. The highest estimates of mtDNA diversity were found in SAZ (h = 0.83, π = 0.11 %) and OL (h = 0.79, π = 0.21 %). The lowest values were found in BLO, HAK, QU, EK, KZ, and AGM (all: h = 0, π = 0 %).

43 Chapter 3 Phylogeography of the European tree frog in Germany

Figure 3.1: Haplotype network of 26 distinct haplotypes of cytochrome b of Hyla arborea (900 bp) in Germany. Each haplotype is represented by one circle. The size of the circles corresponds to the haplotype frequency. Lines between haplotypes denote mutational steps between sequences; black nodes denote inferred intermediate haplotypes between observed haplotypes. AN, BA etc. are abbreviations sample sites where the haplotype was found. Haplotypes shared by different sample sites are marked in strong colours; haplotypes which are present in one sample site only are left blank. For pattern illustration haplotypes with light blue framing mark haplotypes originating from the blue haplotype

44 Chapter 3 Phylogeography of the European tree frog in Germany

Figure 3.2: Haplotype distribution. Physical map of Germany with distribution of cyt b haplotypes in the sampling area in Germany. Each haplotype is represented by one colour corresponding to the colours in the haplotype network (Figure 3.1). Green points denote the current distribution of Hyla arborea on the basis of TK25 modified from: Report on the main results of the surveillance under article 11 for annex II, IV and V species (Annex B) (http://cdr.eionet.europa.eu).

45 Chapter 3 Phylogeography of the European tree frog in Germany

3.4.2 Analysis of microsatellites in Germany The eight microsatellite markers examined were polymorphic with eight to twenty-two alleles per locus. The analysis using Micro-Checker uncovered signs of null alleles for the locus WHA1-67 in the sample site KO, for the locus WHA1-104 in the sample site KAS and for the locus WHA1-140 in the sample sites SW and OVH. As null alleles for the three loci were found only at single sample sites, I did not adjust for null alleles. Furthermore this analysis revealed no evidence for large allele dropout or scoring errors due to stuttering. Deviation from Hardy-Weinberg-Equilibrium was found for WHA1-60 with a significant heterozygosity excess in the sample sites KH, BH and AN. For WHA1-104 a deficiency was found in KH and KAS. The global test for HWE over all loci in each population resulted in no significant deviation. No Linkage (genetic) disequilibrium was found between any pair of loci. Since Berset-Brändli et al. (2007) found the locus WHA1-60 to be sex linked with a suppressed recombination in males, I tested its influence on the outcome of all analyses. Expected heterozygosity values did not change remarkably after excluding WHA1-60 (mean

He locus WHA1-60 included: 0.73; excluded: 0.72). An influence of WHA1-60 on the results of all other analyses was not evident. Therefore, I decided to keep this locus in the analyses.

The highest genetic diversity, expressed as expected heterozygosity, was found in KAS (He =

0.83) and KOB (He = 0.82). The lowest values were found in WK (He = 0.60) and MOZ (He = 0.63).

Pairwise genetic distances measured as Dest values were found to vary between 0 and 0.7 (Appendix 6). Whereas, except the two closest sites KZ and KO, seven other comparisons were found to be not significantly different. Since all these comparisons include SB – a site with only five sampled individuals – these values should be regarded with caution. In general the highest Dest values (> 0.6) were found when comparing the southern sample sites RAV, BGH, and ISM with the Northern sample sites. For the Bayesian analysis a first peak in ΔK is found at K = 2 (Figure 3.3) separating the southern sample sites KOB, FS, KAS, OFF, RAV, BGH, ISM and additionally MOZ from the Northern sites. Since MOZ shows in the further separation (K = 4) a higher relationship to the northern clusters, as indicated by lower net nucleotide distances (Appendix 8), I conducted no hierarchical analysis.

46 Chapter 3 Phylogeography of the European tree frog in Germany

A sign for a first plateau in Ln P(D) is found at K = 4. One of the four genetic clusters (red) is found in the South of Germany. Two Clusters (blue and green) were found in the North of Germany. The blue cluster encompasses large parts of the Northwest and the green cluster is mainly distributed in the Northeast. A fourth sharply separated cluster is found for the sample site MOZ (grey) (Figure 3.4). Further subclustering is indicated by another peak at K = 8 in ΔK method and larger Ln P(D) values. The southern genetic cluster is further separated into a yellow cluster along the Danube River, an orange cluster in the Upper Rhine Plain, and a red cluster along the Main River. In the North further separation is revealed by a cluster occurring mainly in the sample sites in the West of Hannover (dark blue) and a cluster in light blue occurring mainly in the North eastern part of Lower Saxony. In light green, a cluster separated from the former, mainly occurring in SW and OL in the Northeast (detailed barplots are given in Appendix 7). Again MOZ is sharply separated from all other sites by the grey cluster. This is elucidated furthermore by relatively high network distances in comparison to the other clusters (Appendix 8 and 9).

Figure 3.3: Mean values of estimated Ln probability of data (LnPD) for each K (a) and delta K (b)

47 Chapter 3 Phylogeography of the European tree frog in Germany

= = 8 (right). Each cluster is

= = 4 (left) and

for

rosatellites

of mic

Hyla arborea

by Structure analysis

reenpoints give the ofdistribution

Distribution genetic distinct of clusters reveal

: :

3.4

represented by a differentcolour. Figure

48 Chapter 3 Phylogeography of the European tree frog in Germany

3.4.3 Analysis of mtDNA in the European context Including 90 further cyt b sequences from other sample sites in Europe (Stöck et al., 2008; Stöck et al., 2011) in the network analysis, I found 48 haplotypes which are still very similar (Figure 3.5). Some variation is found in Greece and on Crete. Nonetheless, haplotypes of this branch differ only in few base pairs. Haplotype Hy-5 (red) is widely distributed from Western France to Albania and Romania. Hy-1 (blue) is found in the Netherlands extending the structure found in North Germany further into the Northwest (Figure 3.6).

49 Chapter 3 Phylogeography of the European tree frog in Germany

Figure 3.5: Haplotype network of 48 distinct haplotypes of cytochrome b of Hyla arborea (851 bp) in Europe. Each haplotype is represented by one circle. The size of the circles corresponds to the haplotype frequency. Lines between haplotypes denote mutational steps between sequences; black nodes denote inferred intermediate haplotypes between observed haplotypes. BE, DE, GR etc. denote code of country where the haplotype was found. Haplotypes shared by different sample sites are marked in strong colours; haplotypes which are present in one sample site only are left blank. For pattern illustration haplotypes with light blue framing mark haplotypes originating from the blue haplotype and haplotypes with light brown framing mark the divers branch found in Greece.

50 Chapter 3 Phylogeography of the European tree frog in Germany

Figure 3.6: Distribution of cyt b haplotypes in Europe. Each haplotype is represented by one colour corresponding to the colours in the haplotype network (Figure 3.5). Close sites in Belgium, Croatia, the Netherlands, Romania, and on Crete are grouped together.

3.5 Discussion I conducted a large scale molecular analysis on the European tree frog in its German distribution area to assess the potential for the presence of distinct genetic lineages thought to have evolved due to the postglacial recolonisation of the continent. Sequence divergence between sample sites was low. Nonetheless, a clear North-South partitioning could be

51 Chapter 3 Phylogeography of the European tree frog in Germany

revealed by both molecular markers. Within the phylogeographic structure, the influence of higher mountain ranges and the major rivers becomes apparent.

3.5.1 Distinct genetic lineages in the European tree frog? For several European species distinct genetic lineages could be detected. They evolved by the separation in different glacial refugia and the subsequent recolonisation of the continent. In amphibians for Rana temporaria an Eastern and Western lineage was found (Palo et al., 2004). The mean interlineage divergence between the cyt b haplotypes in the two clades was 3.2 %. For Rana arvalis two main clades were detected differing by 3.6 % cyt b sequence divergence (Babik et al., 2004). It was inferred that these clades survived several glacial cycles. One of these clades showed two further subclades which arose presumably during the last glaciation. They differed by 1 % sequence divergence. For the European tree frog however such a strong genetic structure could not be detected. Cyt b sequence divergence (p-distances) between sample sites in this study was low varying between 0 and 0.4 % (overall: 0.2 %). Indicating that no different genetic lineages are apparent neither in the German, nor in the European distribution area of the European tree frog. So far this supports the hypothesis of Stöck et al. (2008). Since they found European wide homogeneity of mtDNA but higher diversity of nuDNA in the Balkan region they supposed the spread of a single mtDNA lineage from a potential Pleistocene refugium in the Balkan region. The star like haplotype structure found in this study suggests a rapid postglacial colonization of the continent. The results of an mtDNA mismatch distribution analysis of Stöck et al. (in press) on the smaller sample set also pointed to a recent and rapid expansion in this species.

3.5.2 Phylogrographic structures of the tree frog in Germany Although haplotypes are very similar, and mostly diverged in only one base pair, some phylogeographic structure could be detected in the German distribution area. For example a clear North-South partitioning could be revealed by both molecular markers. Haplotype Hy-1 (blue) is widely distributed in Northern Germany and adjacent areas in the Netherlands.

52 Chapter 3 Phylogeography of the European tree frog in Germany

Present only in their own sample site, but originating from Hy-1, are the four haplotypes Hy- 6, Hy-9, Hy-21, Hy-22 (pastel blue Figure 3.1). Interestingly, the border of the distribution of Hy-1 and its descendants (blue branch) is congruent to the border of the Central German Uplands (Figure 3.2) which seemed to have had a major role as migration barrier. It is likely that the mutation between Hy-5 and Hy-1 happened during the colonisation into the North. A rapid distribution in the almost barrier free North German Plain could have led to the widespread pattern. Alternatively this haplotype could have emerged by colonisation of the North via an eastern route. Further analyses of more populations in Eastern Europe could clarify this point. Furthermore, the influence of the major rivers such as Elbe, Rhine, and Danube could be revealed in the phylogeographic structure as regions of higher connection. In the Southwest the mountain ranges of the Swabian Jura and the Black Forest with altitudes of more than 1,000 m and 1,400 m, respectively, should be considered as a separating factor between the orange and yellow genetic cluster revealed in the Bayesian analysis of the microsatellites (Figure 3.4). A special case is apparently the sample site MOZ in the Middle East of Germany. A sharp separation of all other sites is evident in the microsatellite Bayesian analysis, also confirmed by comparatively higher network distances (Appendix 8 and 9). Because of the relationship with OL, indicated by the shared haplotype, it can be assumed that this separation happened in recent years. The dramatic population declines – observed in this area in the 1980ies due to toxin-contaminated waters (Grosse, 2001) – could have led to an intensified genetic drift and furthermore to relatively low heterozygosity values.

3.5.3 Genetic diversity Although values of the Southern and Eastern sample sites should be interpreted with caution because of the low sample sizes, the general pattern of relatively high microsatellite heterozygosity values found in the previous study on the geographical level of Lower Saxony (Chapter 2) was confirmed by analyses in this report. Expected heterozygosity values were found to vary between 0.60 - 0.83 (mean: 0.73). This is comparable, but mostly higher than, values found in population genetic studies of European tree frog occurrences in neighbouring

53 Chapter 3 Phylogeography of the European tree frog in Germany

countries such as the Netherlands, Denmark, and Switzerland. In these places, the genetic diversity of fragmented as well as more continuous distributions has been investigated. Mean

He values ranged from 0.39 - 0.59 in the Netherlands (Arens et al., 2006) to 0.54 - 0.68 in Switzerland (Angelone and Holderegger, 2009; Dubey et al., 2009). The lowest values were found in Denmark on the island of Lolland (0.35 - 0.50). The low genetic diversity seems to have contributed to increased larval mortality, thus resulting in a reduction of fitness

(Andersen et al., 2004). None of my sampled populations showed such low He values.

3.5.4 Conclusion No different genetic lineages were revealed for the European tree frog. Thus there is no risk of unintentionally mixing lineages that have been separated for at least several 100,000 years when conducting responsible-minded translocations for species conservation. Nonetheless, the detected genetic structures and main migration barriers should be considered in future conservation measures. This is important because differentiation caused by substantially shorter time spans can lead to a reduced fitness in the offspring. (e.g. Holleley et al., 2011). As mentioned in my previous study (chapter 2), as long as the degree of genetic differentiation which could cause outbreeding depression is unknown, translocations of individuals should not be conducted without thoroughly assessing the potential consequences for the receiver population. In general heterozygosity values were high in the sampled populations and indicate no alarming situation concerning reduced fitness as a potential consequence of lost genetic diversity.

3.6 Acknowledgement This research was supported by grants from the German Federal Environmental Foundation (DBU), Heidehof-Stiftung, and “Hans-Schiemenz-Fonds“ - Deutsche Gesellschaft für Herpetologie und Terrarienkunde (DGHT). I thank the following Nature conservation authorities for permission for tree frog collection: the biosphere reserve Niedersächsische Elbtalaue, Kreis Minden Lübbecke, Kreis Steinfurt, Kreis Soest, Landkreis Diepholz, Landkreis Gifhorn, Landkreis Lüneburg, Landkreis Osnabrück, Landkreis Stade, Landkreis

54 Chapter 3 Phylogeography of the European tree frog in Germany

Uelzen, Region Hannover, Stadt Gera, Stadt Wolfsburg, Oberbayern, Niederbayern, Haßberge, Baden-Württemberg, Brandenburg, Rheinland-Pfalz, Sachsen, Sachsen Anhalt, Schleswig-Holstein. I am especially grateful to Annika Ruprecht, Axel Kwet, Christina Akman, Frank Weihmann, Günter Krug, Hans-Dieter Bast, Heike Pröhl, Herbert Schnabel, Hubert Laufer, Irena Czycholl, Ivonne Meuche, Jana Kirchhoff, Johannes Penner, Kim Jochum, Kristine Heißler, Matei Balborea, Michael Weinert, Oscar Brusa, Oscar Klose, Thomas Schoger-Ohnweiler, Wiebke Feindt, and Wolf-Rüdiger Große for help during field work or sending samples. Finally I thank our technician Sabine Sippel for her assistance in the molecular lab and Sönke von den Berg for technical support.

General discussion

56 Chapter 4 General discussion

The aim of this doctoral thesis was to investigate phylogeographic structures of an endangered amphibian species, the European tree frog (Hyla arborea), on different geographic scales. I will summarise the main outcomes of my analyses and discuss their importance for species conservation management.

On the large scale geographic level encompassing sample sites across the German distribution area my aim was to assess the potential for the presence of distinct genetic lineages thought to have evolved due to postglacial recolonisation of the continent from multiple refugia. Distinct postglacial genetic clades or lineages were previously detected for other amphibian species such as Rana arvalis (Babik et al., 2004), Rana temporaria (Palo et al., 2004), and Salamandra salamandra (Steinfartz et al., 2000). However, different genetic lineages could not be revealed for the European tree frog in my studies. In contrast to the previous studies, differentiation at the mitochondrial gene Cyt b was low. The main haplotype was the same that was found to occur between Western France and Albania (Stöck et al., 2008; Stöck et al., 2011) supporting the hypothesis of Stöck et al. (2008), who suggest that a single mtDNA lineage spread from a potential Pleistocene refugium in the Balkan region. Nonetheless, some phylogeographic structure in the German distribution could be detected by cyt b and microsatellite data. One haplotype and its descendants were found only in Northern part of Germany and adjacent areas in the Netherlands (Stöck et al., 2011) with the Central German Uplands as a distribution border. Additionally, the Bayesian microsatellite analysis supports the separation of Southern sample sites to those in the North. Furthermore, the influence of major rivers such as Rhine, Main, Elbe, and Danube and mountain ranges in the Southwest was evident. Since no different genetic lineages were revealed for the European tree frog there is no risk of unintentionally mixing lineages that have been separated for at least several 100,000 years. However, for species conservation measures such as translocation of individuals from larger to smaller populations, the detected genetic structures and main migration barriers should be considered. This is important because differentiation caused by substantially shorter time spans can lead to a reduced fitness in the offspring. (e.g. Holleley et al., 2011).

57 Chapter 4 General discussion

Therefore, I conducted the study on a medium scale level on the distribution of the tree frog in Lower Saxony and adjacent areas. My aim was to describe management units (MUs) and genetic diversity for supporting effective conservation management for the tree frog in Lower Saxony. Cyt b sequences showed low differentiation but a distinct geographic-genetic pattern was revealed. Using microsatellite analysis I found seven distinct genetic clusters. As a consequence of the patchy distribution of the tree frog in this area most sample sites were assigned to individual management units. Also for the occurrences in the Eastern part of the sampling area along the river Elbe where the former and present-day distribution has been more continuous, I found a current separation in distinct MUs. Although I recommend treating each genetic cluster as one or more management units, in the long run the originally linked occurrences which are presently separated into different MUs as a consequence of habitat fragmentation and genetic drift, should be reconnected. In general heterozygosity values as a measure for genetic diversity were high, not only in Lower Saxony, but also in most German sample sites. This suggests that reduced fitness as a potential consequence of lost genetic diversity is not a current problem in my study area. Therefore, inital measures for population recovery should be to construct networks of breeding sites. There are several reports that the European tree frog responds well to new suitable water bodies or their restoration and often colonises them the following breeding season (e.g. Hansen, 2004 (in DK); Zumbach, 2004 (in CH)) . However, if translocations of individuals are necessary e.g. to recover very small and inbred populations or for reintroduction measures, the revealed genetic structures and the identified barriers should be considered, especially as long as it is not known what degree of genetic differentiation can cause effects of outbreeding depression.

4.1 Future goals For future studies I emphasize the urgent need of breeding and fitness tests between populations that have genetically diverged to different degrees. Because, as is discussed for both studies, it is currently not known what degree of genetic differentiation could be enough to cause effects of outbreeding depression.

58 Chapter 4 General discussion

The inference of management units was conducted in this study in an area where the distribution of the European tree frog was very patchy. Consequentially almost each sample site was assigned to a separate management unit. For comparison it would be interesting to reveal the structure of the management units in an area with more continuous distribution of the European tree frog such as in Mecklenburg-Western Pomerania or in parts of Bavaria. In this study cyt b was not very differentiated and the main haplotype is widely distributed across Europe. Most other haplotypes are unique for one sample site and are typically only one mutation step apart from the main haplotype. Historic relationships of populations could be assessed for few sites only. The suitability of microsatellites is limited for the purpose of historic relationships since artefacts like homoplasy could lead to incorrect similarities. Therefore, for future studies in the European tree frog the analysis of the hypervariable mtDNA d-loop would probably give better resolution for the historic structure and relationships aspects, at least for the delineation of management units. Although the cyt b differentiation was low, I was able to reveal distinct phylogeographic structures with importance for conservation measures. Similar studies including other amphibian species are important since this taxon is highly endangered. Breeding experiments could shed light on the association between the degree genetic differentiation and in- or outbreeding depression. Especially, more studies are necessary that reveal that relationship between barriers to gene flow, degree of habitat fragmentation, genetic divergence and fitness consequences and long-term survivorship.

References

60 Chapter 5 References

Alford, R.A., Richards, S.J. (1999): Global amphibian declines: A problem in applied ecology. Annu. Rev. Ecol. Syst. 30: 133-165. Andersen, L.W., Fog, K., Damgaard, C. (2004): Habitat fragmentation causes bottlenecks and inbreeding in the European tree frog (Hyla arborea). Proc. R. Soc. Lond. B 271: 1293-1302. Angelone, S., Holderegger, R. (2009): Population genetics suggests effectiveness of habitat connectivity measures for the European tree frog in Switzerland. J. Appl. Ecol. 46: 879-887. Angelone, S., Kienast, F., Holderegger, R. (2011): Where movement happens: scale-dependent landscape effects on genetic differentiation in the European tree frog. Ecography 34: 714-722. Arens, P., Westende, W.V.t., Bugter, R., Smulders, M.J.M., Vosman, B. (2000): Microsatellite markers for the European tree frog Hyla arborea. Mol. Ecol. 9: 1944-1946. Arens, P., Bugter, R., van't Westende, W., Zollinger, R., Stronks, J., Vos, C.C., Smulders, M.J.M. (2006): Microsatellite variation and population structure of a recovering Tree frog (Hyla arborea L.) metapopulation. Conserv. Genet. 7: 825-835. Babik, W., Branicki, W., Sandera, M., Litvinchuk, S., Borkin, L.J., Irwin, J.T., Rafinski, J. (2004): Mitochondrial phylogeography of the moor frog, Rana arvalis. Mol. Ecol. 13: 1469-1480. Baker, J. (1997): Stability for Swedish treefrogs? FrogLog 20: 2-3. Bannikov, A.G., Dennisova, A., Darewski, I.S., Ischtschenko, W.G., Rustamov, A.K., Serbak, N.N. (1985): Zizn zivotnych. Zemnovodnye presmykajusiesja. 2 Edition. Moskva. Bast, H.D., Bredow, D., Labes, R., Nehring, H., Nöllert, A., Winkler, A. (1992): Rote Liste der gefährdeten Amphibien und Reptilien Mecklenburg-Vorpommerns. Schwerin. Bedriaga, J.v. (1890): Die Lurchfauna Europas. I. Anura. Froschlurche. Bulletin de la Société Impériale des Naturalistes de Moscou. Nouvelle série 3: 466-622. Beebee, T.J.C., Griffiths, R.A. (2005): The amphibian decline crisis: A watershed for conservation biology? Biol. Cons. 125: 271-285. Belkhir, K., Borsa, P., Chikhi, L., Raufaste, N., Bonhomme, F. (1996-2004): GENETIX 4.05, logiciel sous Windows TM pour la génétique des populations, Laboratoire Génome, Populations, Interactions, CNRS UMR 5171, Université de Montpellier II, Montpellier (France), p. Berger, L., Speare, R., Daszak, P., Green, D.E., Cunningham, A.A., Goggin, C.L., Slocombe, R., Ragan, M.A., Hyatt, A.D., McDonald, K.R., Hines, H.B., Lips, K.R., Marantelli, G., Parkes, H. (1998): Chytridiomycosis causes amphibian mortality associated with population declines in the rain forests of Australia and Central America. Proc. Natl. Acad. Sci. U.S.A. 95: 9031-9036. Berset-Brändli, L., Jaquiery, J., Perrin, N. (2007): Recombination is suppressed and variability reduced in a nascent Y chromosome. J. Evol. Biol. 20: 1182-1188. Berset-Brändli, L., Jaquiery, J., Broquet, T., Perrin, N. (2008): Isolation and characterization of microsatellite loci for the European tree frog (Hyla arborea). Mol. Ecol. Resour. 8: 1095-1097. Beutler, A., Rudolph, U. (2003): Rote Liste gefährdeter Kriechtiere (Reptilia) Bayerns. Schriftenreihe Bayerisches Landesamt für Umweltschutz 166: 45-47.

61 Chapter 5 References

Bitz, A., Simon, L. (1996): Die neue "Rote Liste der bestandsgefährdeten Lurche und Kriechtiere in Rheinland Pfalz". In: Die Amphibien und Reptilien in Rheinland Pfalz, p. 615-618. Bitz, A., Fischer, K., Simon, L., Thiele, R., Veith, M., Eds., Landau, Gesellschaft für Naturschutz und Ornithologie. Blaustein, A.R., Kiesecker, J.M. (2002): Complexity in conservation: lessons from the global decline of amphibian populations. Ecol. Lett. 5: 597-608. Blaustein, A.R., Gervasi, S.S., Johnson, P.T.J., Hoverman, J.T., Belden, L.K., Bradley, P.W., Xie, G.Y. (2012): Ecophysiology meets conservation: understanding the role of disease in amphibian population declines. Philos. Trans. R. Soc. B-Biol. Sci. 367: 1688-1707. Boettger, O. (1874): Reptilien von Marocco und von den canarischen Inseln. Abhandlungen der Senckenbergischen naturforschenden Gesellschaft 9: 121-192. Boulenger, G.A. (1882): Catalogue of the Batrachia Salientia s. Ecaudata in the Collection of the British Museum. 2nd Edition. London, Taylor and Francis. Brandt, I., Feuerriegel, K. (2004): Artenhilfsprogramm und Rote Liste. Amphibien und Reptilien in Hamburg - Verbreitung, Bestand und Schutz der Herpetofauna im Ballungsraum Hamburg, Freie und Hansestadt Hamburg - Behörde für Stadtentwicklung und Umwelt, Naturschutzamt. Brockmüller, N., Drews, H. (2009): Management of fire-bellied toad populations in the Baltic region. Molfsee, Stiftung Naturschutz Schleswig-Holstein. Bronmark, C., Edenhamn, P. (1994): Does the Presence of Fish Affect the Distribution of Tree Frogs (Hyla arborea)? Cons. Biol. 8: 841-845. Buschmann, H., Scheel, B., Brandt, T. (2006): Amphibien und Reptilien im Schaumburger Land und am Steinhuder Meer. Rangsdorf, Natur und Text. Clausnitzer, H.-J. (2004): Die Entwicklung zweier Laubfrosch-Populationen bei unterschiedlichen Bedingungen. In: Der Europäische Laubfrosch (Hyla arborea), p. 63-71. Glandt, D., Kronshage, A., Eds., Bielefeld, Laurenti-Verlag. Clausnitzer, H.J. (1983): Zum gemeinsamen Vorkommen von Amphibien und Fischen. Salamandra 19: 158-162. Clausnitzer, H.J., Clausnitzer, C. (1984): Erste Ergebnisse einer Wiederansiedlung des Laubfrosches Hyla arborea (L.) im Landkreis Celle (Niedersachsen). Salamandra 20: 50-55. Clement, M., Posada, D., Crandall, K.A. (2000): TCS: a computer program to estimate gene genealogies. Mol. Ecol. 9: 1657-9. Cushman, S.A. (2006): Effects of habitat loss and fragmentation on amphibians: A review and prospectus. Biol. Cons. 128: 231-240. Daszak, P., Berger, L., Cunningham, A.A., Hyatt, A.D., Green, D.E., Speare, R. (1999): Emerging infectious diseases and amphibian population declines. Emerg. Infect. Dis 5: 735-748. De Betta, F.E. (1853): Erpetologia delle Provincie Venete e de Tirolo Meridionale. Memorie dell'Accademia d'Agricoltura, Arti e Commercio di Verona 35: 1-354. Dolgener, N., Schröder, C., Schneeweiss, N., Tiedemann, R. (2012): Genetic population structure of the Fire- bellied toad Bombina bombina in an area of high population density: implications for conservation. Hydrobiologia 689: 111-120.

62 Chapter 5 References

Dubey, S., Ursenbacher, S., Pellet, J., Fumagalli, L. (2009): Genetic differentiation in two European tree frog (Hyla arborea) metapopulations in contrasted landscapes of western Switzerland. Amphibia-Reptilia 30: 127-133. Earl, D.A., vonHoldt, B.M. (2012): STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv. Genet. Resour. 4: 359-361. Edenhamn, P., Hoggren, M., Carlson, A. (2000): Genetic Diversity and Fitness in Peripheral and Central Populations of the European Tree Frog Hyla arborea. Hereditas 133: 115-122. Edgar, R.C. (2004): MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32: 1792-1797. Evanno, G., Regnaut, S., Goudet, J. (2005): Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Mol. Ecol. 14: 2611-2620. Excoffier, L., Laval, G., Schneider, S. (2005): Arlequin (version 3.0): An integrated software package for population genetics data analysis. Evol. Bioinform. 1: 47-50. Filoda, H. (1981): Das Vorkommen von Amphibien in Fischgewässern des östlichen Teils Lüchow- Dannenbergs. Beitr. Naturk. Nieders. 34: 185-189. Fisher, M.C., Garner, T.W.J., Walker, S.F. (2009): Global Emergence of Batrachochytrium dendrobatidis and Amphibian Chytridiomycosis in Space, Time, and Host. In: Annual Review of Microbiology, p. 291- 310. Palo Alto, Annual Reviews. Flottmann, H.-J., Bernd, C., Gerstner, J., Flottmann-Stoll, A. (2008): Rote Liste der Amphibien und Reptilien des Saarlandes (Amphibia, Reptilia). In: Rote Liste gefährdeter Pflanzen und Tiere des Saarlandes, p. 307-328. Saarbrücken, Ministerium für Umwelt und Delattinia Fog, K. (1993): Migration in the tree frog Hyla arborea. In: Ecology and Conservation of the European Tree Frog; Proceedings of the 1st International Workshop on Hyla arborea, 13-14 February 1992, Potsdam, Germany, p. 55-64. Stumpel, A.H.P., Tester, U., Eds. Fog, K. (1995): Amphibian conservation in Denmark. FrogLog 13: 1-2. Frankham, R. (2005): Genetics and extinction. Biol. Cons. 126: 131-140. Friedl, T.W.P., Klump, G.M. (1997): Some aspects of population biology in the European treefrog, Hyla arborea. Herpetologica 53: 321-330. Friedl, T.W.P., Klump, G.M. (2005): Sexual selection in the lek-breeding European treefrog: body size, chorus attendance, random mating and good genes. Anim. Behav. 70: 1141-1154. Frost, D.R. (2011): Amphibian Species of the World: an online reference. Version 5.5 (31 January, 2011). Electronic Database accessible at . American Museum of Natural History, New York, USA. Downloaded on 17 July 2012. Gasc, J., Cabela, A., Crnobrnja-Isailovic, J., Dolmen, D., Grossenbacher, K., Haffner, P., Lescure, J., Martens, H., Martinez Rica, J.P., Maurin, H., Oliveira, M.E., Sofianidou, T.S., Veith, M., Zuiderwijk, A. (1997): Atlas of Amphibians and Reptiles of Europe. Paris, Societas Europea Herpetologica. Museum National D’Histoire Naturelle.

63 Chapter 5 References

Geiger, A. (1998): Das Artenhilfsprogramm Laubfrosch im Artenschutzprogramm NRW. LÖBF-Jahresbericht 1997: 121-125. Gerlach, G., Jueterbock, A., Kraemer, P., Deppermann, J., Harmand, P. (2010): Calculations of population differentiation based on G(ST) and D: forget G(ST) but not all of statistics! Mol. Ecol. 19: 3845-3852. Goebel, A.M., Donnelly, J.M., Atz, M.E. (1999): PCR primers and amplification methods for 125 ribosomal DNA, the control region, cytochrome oxidase I, and cytochrome b in bufonids and other frogs, and an overview of PCR primers which have amplified DNA in amphibians successfully. Mol. Phylogenet. Evol. 11: 163-199. Goudet, J. (1995): FSTAT (Version 1.2): A computer program to calculate F-statistics. J. Hered. 86: 485-486. Goudet, J. (2005): HIERFSTAT, a package for R to compute and test hierarchical F-statistics. Mol. Ecol. Notes 5: 184-186. Grosse, W.-R., Nöllert, A. (1993): The aquatic habitat of the European tree frog, Hyla arborea. In: Ecology and Conservation of the European Tree Frog; Proceedings of the 1st International Workshop on Hyla arborea, 13-14 February 1992, Potsdam, Germany, p. 37-46. Stumpel, A.H.P., Tester, U., Eds. Grosse, W.-R. (1994): Der Laubfrosch: Hyla arborea. Magdeburg, Westarp Wissenschaften. Grosse, W.-R. (2001): Die Elster-Luppe-Aue bei Schkeuditz (Sachsen): historische Entwicklung und Konsequenzen für die Amphibienfauna. Z. Feldherpetol. 8: 215-226. Grosse, W.-R. (2009): Der Laubfrosch: Hyla arborea. 2nd Edition. Hohenwarsleben, Westarp Wissenschaften. Guillot, G., Estoup, A., Mortier, F., Cosson, J.F. (2005a): A spatial statistical model for landscape genetics. Genetics 170: 1261-1280. Guillot, G., Mortier, F., Estoup, A. (2005b): GENELAND: a computer package for landscape genetics. Mol. Ecol. Notes 5: 712-715. Guo, S.W., Thompson, E.A. (1992): Performing the exact test of Hardy-Weinberg proportion for multiple alleles. Biometrics 48: 361-372. Hansen, F. (2004): Verbreitung und Gefährdung des Laubfrosches (Hyla arborea) auf Bornholm (Dänemark) und Maßnahmen zur Lebensraumoptimierung. In: Der Europäische Laubfrosch (Hyla arborea), p. 133- 143. Glandt, D., Kronshage, A., Eds., Bielefeld, Laurenti-Verlag. Harrison, R.G. (Ed.) (1993): Hybrid Zones and the Evolutionary Process, Oxford University Press. Hedrick, P.W. (2005): A standardized genetic differentiation measure. Evolution 59: 1633-1638. Hitchings, S.P., Beebee, T.J.C. (1997): Genetic substructuring as a result of barriers to gene flow in urban Rana temporaria (common frog) populations: implications for biodiversity conservation. Heredity 79: 117- 127. Holleley, C.E., Nichols, R.A., Whitehead, M.R., Gunn, M.R., Gupta, J., Sherwin, W.B. (2011): Induced dispersal in wildlife management: experimental evaluation of the risk of hybrid breakdown and the benefit of hybrid vigor in the F1 generation. Conserv. Genet. 12: 31-40. Huff, D.D., Miller, L.M., Chizinski, C.J., Vondracek, B. (2011): Mixed-source reintroductions lead to outbreeding depression in second-generation descendents of a native North American fish. Mol. Ecol. 20: 4246-4258.

64 Chapter 5 References

IUCN (International Union for Conservation of Nature), Conservation International & NatureServe (2009): Hyla arborea. In: IUCN 2011. IUCN Red List of Threatened Species. Version 2011.2 IUCN (2012): The IUCN Red List of Threatened Species. Version 2012.1. . Downloaded on 20 July 2012. Jedicke, E. (1996): Rote Liste der Säugetiere, Reptilien und Amphibien Hessens, Teil III: Amphibien. In: Rote Liste der Säugetiere, Reptilien und Amphibien Hessens,. Hessisches Ministerium des Inneren und für Landwirtschaft, Forsten und Naturschutz, Ed., Wiesbaden. 39-52 Jenness, J. (2005): Distance Matrix (dist_mat_jen.avx) extension for ArcView 3.x, v. 2. Jenness Enterprises. Available at: Jensen, J.L., Bohonak, A.J., Kelley, S.T. (2005): Isolation by distance, web service. BMC Genet. 6: 6. Jost, L. (2008): G(ST) and its relatives do not measure differentiation. Mol. Ecol. 17: 4015-4026. Kaya, U., Agasyan, A., Avisi, A., Tuniyev, B., Isailovic, J.C., Lymberakis, P., Andrén, C., Cogalniceanu, D., Wilkinson, J., Ananjeva, N., Üzüm, N., Orlov, N., Podloucky, R., Tuniyev, S., Kaya, U. (2009): Hyla arborea. In: IUCN 2011. IUCN Red List of Threatened Species. Version 2011.2. . Downloaded on 02 May 2012. Klinge, A. (2003): Die Amphibien und Reptilien Schleswig-Holsteins - Rote Liste. 3rd Edition. Kiel, LANU SH- Natur 62. Krug, A., Pröhl, H. Population genetics in a fragmented population of the European tree frog (Hyla arborea). submitted. Kühnel, K.-D., Krone, A., Biehler, A. (2005): Rote Liste und Gesamtartenliste der gefährdeten Amphibien und Reptilien von Berlin. In: Rote Listen der gefährdeten Pflanzen und Tiere von Berlin. Der Landesbeauftragte für Naturschutz und Landschaftspflege / Senatsverwaltung für Stadtentwicklung Berlin, Ed., CD-Rom. LANUV, NRW (2011): Laubfrosch - Hyla arborea.Stand 2006. . Downloaded on 05. Dez. 2011. LaReG (2007): Wiederansiedlung des Laubfrosches Hyla arborea (L. 1758) in Braunschweig - Bericht 2007. Braunschweig, Gutachten im Auftrag der Stadt Braunschweig. Laufer, H. (1999): Die Roten Listen der Amphibien und Reptilien Baden Württembergs (3. Fassung, Stand 31.10.1998). Naturschutz und Landschaftspflege Baden-Württemberg 73: 103-134. Lee, T., Zenger, K.R., Close, R.L., Jones, M., Phalen, D.N. (2010): Defining spatial genetic structure and management units for vulnerable koala (Phascolarctos cinereus) populations in the Sydney region, Australia. Wildl. Res. 37: 156-165. Linnaeus, C. (1758): Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. 10th Edition. Holmiae, Impensis Direct. Laurentii Salvii. Madsen, T., Shine, R., Olsson, M., Wittzell, H. (1999): Conservation biology - Restoration of an inbred adder population. Nature 402: 34-35. Manni, F., Guerard, E., Heyer, E. (2004): Geographic patterns of (genetic, morphologic, linguistic) variation: How barriers can be detected by using Monmonier's algorithm. Hum. Biol. 76: 173-190.

65 Chapter 5 References

Manzke, U., Podloucky, R. (1995): Der Laubfrosch Hyla arborea L. in Niedersachsen und Bremen - Verbreitung, Lebensraum, Bestandssituation. In: Der Laubfrosch (Hyla arborea) - Ökologie und Artenschutz. - Mertensiella 6, p. 57-72. Geiger, A., Ed., Bonn. Meyer, F., Buschendorf, J. (2004): Rote Liste der gefährdeten Lurche und Kriechtiere. In: Die Lurche und Kriechtiere Sachsen-Anhalts - Supplement der Zeitschrift für Feldherpetologie, p. 195-206. Meyer, F., Buschendorf, J., Zuppke, U., Braumann, F., Schädler, M., Grosse, W.R., Eds., Laurenti-Verlag. Meyer, F., Buschendorf, J., Zuppke, U., Braumann, F., Schädler, M., Grosse, W.R. (2004): Die Lurche und Kriechtiere Sachsen-Anhalts. Verbreitung, Ökologie, Gefährdung und Schutz. Bielefeld, Laurenti- Verlag. Moritz, C., Schneider, C.J., Wake, D.B. (1992): Evolutionary relationships within the Ensatina eschscholtzii complex confirm the ring species interpretation. Syst. Biol. 41: 273-291. Moritz, C. (1994a): Defining 'Evolutionarily Significant Units' for conservation. Trends Ecol. Evol. 9: 373-375. Moritz, C. (1994b): Applications of mitochondrial DNA analysis in conservation: a critical review. Mol. Ecol. 3: 401-411. Nei, M. (1987): Molecular Evolutionary Genetics. New York, Columbia University Press. Nöllert, A., Nöllert, C. (1992): Die Amphibien Europas: Bestimmung, Gefährdung, Schutz. Stuttgart, Franckh- Kosmos. Nöllert, A., Scheidt, U., Serfling, C., Uthleb, H. (2001): Rote Liste der Lurche (Amphibia) Thüringens. In: Naturschutzreport Heft 18 - Rote Listen Thüringens, p. 43-46. Jena. Palo, J.U., Schmeller, D.S., Laurila, A., Primmer, C.R., Kuzmin, S.L., Merila, J. (2004): High degree of population subdivision in a widespread amphibian. Mol. Ecol. 13: 2631-2644. Palsbøll, P.J., Berube, M., Allendorf, F.W. (2007): Identification of management units using population genetic data. Trends Ecol. Evol. 22: 11-16. Pellet, J., Guisan, A., Perrin, N. (2004a): A concentric analysis of the impact of urbanization on the threatened European tree frog in an agricultural landscape. Cons. Biol. 18: 1599-1606. Pellet, J., Hoehn, S., Perrin, N. (2004b): Multiscale determinants of tree frog (Hyla arborea L.) calling ponds in western Switzerland. Biodivers. Conserv. 13: 2227-2235. Pimm, S.L., Dollar, L., Bass, O.L. (2006): The genetic rescue of the Florida panther. Anim. Conserv. 9: 115-122. Podloucky, R., Fischer, C. (1994): Rote Liste der gefährdeten Amphibien und Reptilien in Niedersachsen und Bremen. Inf.dienst Nat.schutz Nieders. 14: 109-120. Pritchard, J.K., Stephens, M., Donnelly, P. (2000): Inference of Population Structure Using Multilocus Genotype Data. Genetics 155: 945-959. Rannap, R., Lohmus, A., Briggs, L. (2009): Restoring ponds for amphibians: a success story. Hydrobiologia 634: 87-95. Rau, S., Steffens, R., Zöphel, U. (1999): Rote Liste Wirbeltiere Sachsens. Dresden, Materialien zu Naturschutz und Landschaftspflege. Ray, N., Lehmann, A., Joly, P. (2002): Modeling spatial distribution of amphibian populations: a GIS approach based on habitat matrix permeability. Biodivers. Conserv. 11: 2143-2165.

66 Chapter 5 References

Rice, W.R. (1989): Analyzing Tables of Statistical Tests. Evolution 43: 223-225. Richter, M., Mügge, G. (2012): Bestandsentwicklung und Schutz des Laubfroschs (Hyla arborea) im Landkreis Diepholz/Niedersachsen. Z. Feldherpetol. 19: 79-90. Rousset, F. (1997): Genetic differentiation and estimation of gene flow from F-statistics under isolation by distance. Genetics 145: 1219-1228. Rousset, F. (2008): GENEPOP ' 007: a complete re-implementation of the GENEPOP software for Windows and Linux. Mol. Ecol. Resour. 8: 103-106. Sambrook, J., Fritsch, E.F., Maniatis, T. (1989): Molecular Cloning: A Laboratory Manual. 2nd Edition. Cold Spring Harbor, N.Y., Cold Spring Harbor Laboratory Press. Schlüpmann, M., Geiger, A. (1999): Rote Liste der gefährdeten Kriechtiere (Reptilia) und Lurche (Amphibia) in Nordrhein-Westfalen. In: Rote Liste der gefährdeten Pflanzen und Tiere in Nordrhein-Westfalen, 17:p. 375-404. LÖBF/LAfAO NRW, Ed., Recklinghausen, LÖBF- Schr.-R. Schmeller, D.S., Palo, J.U., Merilä, J. (2008): A contact zone between two distinct Rana temporaria lineages in northern Germany. Alytes 25: 93-98. Schneeweiß, N., Krone, A., Baier, R. (2004): Rote Listen und Artenlisten der Lurche (Amphibia) und Kriechtiere (Reptilia) des Landes Brandenburg. Naturschutz und Landschaftspflege in Brandenburg 13. Schneider, H. (1966): Die Paarungsrufe der einheimischen Froschlurche (Discoglossidae, Pelobatidae, Bufonidae, Hylidae). Z. Morph. Oekol. Tiere 57: 119-136. Schneider, H. (1971): Die Steuerung des täglichen Rufbeginns beim Laubfrosch, Hyla arborea arborea (L.). Oecologia 8: 310-320. Schwartz, M.K., Luikart, G., Waples, R.S. (2007): Genetic monitoring as a promising tool for conservation and management. Trends Ecol. Evol. 22: 25-33. Schwartze, M. (2002): Neuanlage und Verbesserungen von Kleingewässern für den Laubfrosch und andere Amphibien - eine Untersuchung im östlichen Münsterland (NRW). Z. Feldherpetol. 9: 61-73. Seymour, A.M., Montgomery, M.E., Costello, B.H., Ihle, S., Johnsson, G., St John, B., Taggart, D., Houlden, B.A. (2001): High effective inbreeding coefficients correlate with morphological abnormalities in populations of South Australian koalas (Phascolarctos cinereus). Anim. Conserv. 4: 211-219. Snell, C., Tetteh, J., Evans, I.H. (2005): Phylogeography of the pool frog (Rana lessonae Camerano) in Europe: evidence for native status in Great Britain and for an unusual postglacial colonization route. Biol. J. Linnean Soc. 85: 41-51. Steinfartz, S., Veith, M., Tautz, D. (2000): Mitochondrial sequence analysis of Salamandra taxa suggests old splits of major lineages and postglacial recolonizations of Central Europe from distinct source populations of Salamandra salamandra. Mol. Ecol. 9: 397-410. Stöck, M., Dubey, S., Klütsch, C., Litvinchuk, S.N., Scheidt, U., Perrin, N. (2008): Mitochondrial and nuclear phylogeny of circum-Mediterranean tree frogs from the Hyla arborea group. Mol. Phylogenet. Evol. 49: 1019-1024.

67 Chapter 5 References

Stöck, M., Horn, A., Grossen, C., Lindtke, D., Sermier, R., Betto-Colliard, C., Dufresnes, C., Bonjour, E., Dumas, Z., Luquet, E., Maddalena, T., Sousa, H.C., Martinez-Solano, I., Perrin, N. (2011): Ever-Young Sex Chromosomes in European Tree Frogs. PLoS Biol. 9: 9. Stöck, M., Dufresnes, C., Litvinchuk, S.N., Lymberakis, P., Biollay, S., Berroneau, M., Borzée, A., Ghali, K., Ogielska, M., Perrin, N. (in press): Cryptic diversity among Western Palearctic tree frogs: Postglacial range expansion, range limits, and secondary contacts of three European tree frog lineages (Hyla arborea group). Mol. Phylogenet. Evol. (2012), Stuart, S.N., Chanson, J.S., Cox, N.A., Young, B.E., Rodrigues, A.S.L., Fischman, D.L., Waller, R.W. (2004): Status and trends of amphibian declines and extinctions worldwide. Science 306: 1783-1786. Stumpel, A.H.P., Hanekamp, G. (1986): Habitat and Ecology of Hyla arborea in The Netherlands. In: Studies in Herpetology, p. 409-411. Rocek, Z., Ed., Prague, Charles University. Stumpel, A.H.P. (1993): The terrestrial habitat of Hyla arborea. In: Ecology and Conservation of the European Tree Frog; Proceedings of the 1st International Workshop on Hyla arborea, 13-14 February 1992, Potsdam, Germany, p. 47-54. Stumpel, A.H.P., Tester, U., Eds. Taberlet, P., Fumagalli, L., Wust-Saucy, A.G., Cosson, J.F. (1998): Comparative phylogeography and postglacial colonization routes in Europe. Mol. Ecol. 7: 453-464. Tamura, K., Nei, M., Kumar, S. (2004): Prospects for inferring very large phylogenies by using the neighbor- joining method. Proc. Natl. Acad. Sci. U.S.A. 101: 11030-11035. Tamura, K., Dudley, J., Nei, M., Kumar, S. (2007): MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24: 1596-1599. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S. (2011): MEGA5: Molecular Evolutionary Genetics Analysis Using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Mol. Biol. Evol. 28: 2731-2739. Teacher, A.G.F., Garner, T.W.J., Nichols, R.A. (2009): European phylogeography of the common frog (Rana temporaria): routes of postglacial colonization into the British Isles, and evidence for an Irish glacial refugium. Heredity 102: 490-496. Temple, H.J., Cox, N.A. (2009): European Red List of Amphibians, Luxembourg: Office for Official Publications of the European Communities. Tester, U. (1990): Artenschützerisch relevante Aspekte zur Ökologie des Laubfroschs (Hyla arborea L.). Basel. Tester, U., Flory, C. (1995): Zur Bedeutung des Biotopverbundes beim Schutz des Laubfrosches (Hyla arborea L.). In: Der Laubfrosch (Hyla arborea) - Ökologie und Artenschutz. - Mertensiella 6, p. 27-40. Geiger, A., Ed., Bonn. Tester, U., Flory, C. (2004): Ergebnisse des Pro Natura-Programms "Laubfrosch" im Aargauer Reusstal (Schweiz). In: Der Europäische Laubfrosch (Hyla arborea), p. 165-173. Glandt, D., Kronshage, A., Eds., Bielefeld, Laurenti-Verlag. Van Oosterhout, C., Hutchinson, W.F., Wills, D.P.M., Shipley, P. (2004): MICRO-CHECKER: software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 4: 535-538.

68 Chapter 5 References

Wagner, R.S., Miller, M.P., Crisafulli, C.M., Haig, S.M. (2005): Geographic variation, genetic structure, and conservation unit designation in the Larch Mountain salamander (Plethodon larselli). Can. J. Zool.-Rev. Can. Zool. 83: 396-406. Weir, B.S., Cockerham, C.C. (1984): Estimating F-Statistics for the Analysis of Population-Structure. Evolution 38: 1358-1370. Weitere, M., Tautz, D., Neumann, D., Steinfartz, S. (2004): Adaptive divergence vs. environmental plasticity: tracing local genetic adaptation of metamorphosis traits in salamanders. Mol. Ecol. 13: 1665-1677. Wiemann, A., Andersen, L.W., Berggren, P., Siebert, U., Benke, H., Teilmann, J., Lockyer, C., Pawliczka, I., Skora, K., Roos, A., Lyrholm, T., Paulus, K.B., Ketmaier, V., Tiedemann, R. (2010): Mitochondrial Control Region and microsatellite analyses on harbour porpoise (Phocoena phocoena) unravel population differentiation in the Baltic Sea and adjacent waters. Conserv. Genet. 11: 195-211. Wood, P.J., Greenwood, M.T., Agnew, M.D. (2003): Pond biodiversity and habitat loss in the UK. Area 35: 206- 216. Zavadil, V. (1993): Vertikale Verbreitung der Amphibien in der Tschechoslowakei. Salamandra 28: 202-222. Zumbach, S. (2004): Die Laubfrösche (Hyla arborea und Hyla intermedia) in der Schweiz – Verbreitung, Gefährdung und Schutz. In: Der Europäische Laubfrosch (Hyla arborea), p. 183-192. Glandt, D., Kronshage, A., Eds., Bielefeld, Laurenti-Verlag.

Appendix

70 Chapter 6 Appendix

List of Appendices Appendix 1: Haplotype sequences Appendix 2: Detailed overview on individual and haplotype assignment Appendix 3: Estimates of evolutionary divergence over cytochrome b sequence pairs between sample sites Appendix 4: Geographic distances (km) among sample sites Appendix 5: Former and present distribution of Hyla arborea in Lower Saxony

Appendix 6: Genetic Distances: cyt b p-distances among sample sites and pairwise Dest

Appendix 7: STRUCTURE bar plot for K = 4, K = 8 and K = 10 Appendix 8: Allele-frequency divergence among revealed clusters Appendix 9: Allele-frequency divergence among revealed clusters

Appendix 10: GeneBank Sequences of cytochrome b used in this study and their assignment to haplotype term used in this study

71 Chapter 6 Appendix

Appendix 1: Haplotype sequences

26 Haplotypes 900 bp

> Hy-1 GCACCATCTAACTTATCCTCATGATGAAACTTTGGCTCCCTACTCGGAGTTTGCCTTATCTTGCAAATCGCAACT GGGTTGTTCCTAGCAATACACTACACAGCGGACACCTCAATAGCTTTTTCATCGGTAGCCCACATCTGTCGAGAT GTGAACAATGGTTGGCTTCTACGAAATTTACATGCAAACGGGGCCTCATTTTTCTTCATTTGCATCTACCTTCAT ATTGGGCGGGGAATGTACTATGGATCCTTCCTATTTAAAGAAACATGAAATGTTGGAGTCGTACTTCTATTCCTA GTCATAGCAACAGCCTTTGTTGGATACGTCCTACCATGAGGCCAAATATCCTTCTGAGGAGCTACGGTAATTACC AACCTTCTCTCAGCCGCCCCCTACGTTGGAACCGAACTAGTACAATGAATCTGAGGCGGGTTCTCAGTGGATAAC GCCACCTTAACCCGATTCTTTACATTCCACTTCATCTTGCCGTTTATTATTGCGGGGGCCTCAATAATCCATCTC TTATTCCTTCACCAAACCGGCTCATCCAACCCAATTGGATTAAACTCCAACTCAGACAAAATCCCCTTCCATGCC TACTACTCTTACAAAGACGCATTCGGATTCGCTGTACTCTTAGCCCTACTAGCCGCACTGTCTACATTTGCTCCG AACATTCTGGGTGACCCTGATAACTTTATCCCCGCCAACCCCCTAGTTACCCCTCCTCACATCAAACCTGAGTGA TACTTCTTGTTTGCCTACGCCATTCTTCGGTCAATCCCAAATAAATTAGGCGGTGTCCTAGCCCTCTTATTCTCA ATTATAATCCTATTCCTTCTACCTATCCTTCACACATCAAATCAACGAACCTCTACCTTCCGGCCTCTAGCTAAA

> Hy-2 ...... C...... A......

> Hy-3 ...... A...... A......

72 Chapter 6 Appendix

> Hy-4 ...... A...... C......

> Hy-5 ...... A......

> Hy-6 ...... G......

> Hy-7 ...... G...... A...... T......

73 Chapter 6 Appendix

> Hy-8 ...... G...... A......

> Hy-9 ...... T......

> Hy-10 ...... G...... A......

> Hy-11 ...... A...... A......

74 Chapter 6 Appendix

> Hy-12 ...... G...... T...... A......

> Hy-13 ...... A...... A......

> Hy-14 ...... A...... C......

> Hy-15 ...... A...... A......

75 Chapter 6 Appendix

> Hy-16 ...... A...... C......

> Hy-17 ...... A...... T......

> Hy-18 ...... A...... C...... T......

> Hy-19 ...... A...... C......

76 Chapter 6 Appendix

> Hy-20 ...... A...... A...... T......

> Hy-21 ...... G......

> Hy-22 ...... G......

> Hy-23 ...... A...... G...... T...... A...... A......

77 Chapter 6 Appendix

> Hy-24 ...... A...... G......

> Hy-25 ...... A...... A......

> Hy-26 ...... A...... A......

78 Chapter 6 Appendix

Number of Haplotype Individuals belonging to Haplotype sequences Hy-1 AN01, AN03, AN08, AN12, AN13, AN17, AN20, AN22, KZ01, KZ02, KZ03, 67 KZ21, KZ22, KZ23, KZ25, KZ26, KZ27, KZ28, KZ29, KZ30, KZ31, KZ32, KZ33, KZ34, KZ35, KZ36, KZ37, OL06, OL08, OL14, PW11, PW12, PW18, PW19, QU01, QU02, QU03, QU04, QU05, RU09, SB02, SB03, SBK04, SBK05, SBK06, SBK08, SBK10, SW02, SW03, SW04, SW05, SW13, SW15, SW18, WG01, WG03, WG09, WG10, WG11, WG12, WG13, WG14, WG19, WG20, WK01, WK02, WK07 Hy-2 AN02, AN06, AN07, AN10, AN15, AN18, AN19, PW16, RU01, RU04, ST02, 22 ST06, SW01, SW06, SW07, SW08, SW09, SW10, SW11, SW12, SW14, SW20 Hy-3 AN05, AN09, AN16 3 Hy-4 BA01, BA07, BA10, BA12, BA18 5 Hy-5 AGM01, AGM02, AGM03, BA02, BA03, BA04, BA05, BA06, BA08, BA09, 134 BA13, BA14, BA15, BA16, BA17, BA19, BA20, BGH03, BGH05, BGH09, BLO01, BLO02, BLO03, BLO04, FS02, FS03, FS04, FS05, FS06, FS07, FS08, HAK02, HAK03, HKT07, HKT08, ISM03, ISM06, KAS01, KAS04, KAS05, KAS06, KAS09, KH03, KH05, KH22, KH23, KH28, KOB01, KOB02, KOB03, KOB04, KOB05, KOB06, KOB08, KOB09, KOB10, KOB11, MOZ08, MOZ09, MOZ10, MOZ12, MOZ14, MOZ17, OFF01, OFF02, OFF03, OFF04, OFF06, OFF07, OL04, OVH01, PW01, PW02, PW03, PW04, PW05, PW06, PW07, PW08, PW09, PW10, PW13, PW14, PW15, PW17, PW20, RAV01, RAV03, RAV06, RAV07, RU03, RU05, RU10, RU12, RU14, SAZ09, SAZ10, SB01, SB04, SB05, SBK01, SBK07, SBK09, ST01, ST03, ST04, ST05, ST07, ST08, ST09, ST10, ST11, ST12, ST14, ST15, ST16, ST17, ST18, ST19, ST20, ST21, SW19, WG02, WG06, WG07, WG08, WG15, WG17, WG18, WK03, WK04, WK05, WK06, WK08 Hy-6 EK11, EK12, EK13, EK14, EK15, EK16, EK17, EK18, EK19 9 Hy-7 KH01, KH04, KH08, KH16, KH18, KH20, KH24, KH25, KH26, KH27, KH31, 13 KH33, KH34 Hy-8 KH02, KH21 2 Hy-9 RU02, RU06, RU07, RU13, RU15, RU16, RU17, RU18 8 Hy-10 WG04 1 Hy-11 WG05 1 Hy-12 BGH01, BGH02, BGH04, BGH06, BGH07, BGH08, BGH10, RAV05 8 Hy-13 FS01 1 Hy-14 HKT05, HKT06 2 Hy-15 ISM01, ISM02, ISM04, ISM05, ISM08, ISM09 6 Hy-16 ISM07, ISM10 2 Hy-17 KAS02, KAS03, KAS10 3 Hy-18 KAS07, KAS08 2 Hy-19 OFF05, OFF08, OFF09 3 Hy-20 OL05, OL07, OL10, MOZ13, MOZ19 5 Hy-21 OL09 1 Hy-22 OVH02, OVH03, OVH04, OVH05, OVH06, OVH07, OVH08, OVH09, OVH10 9 Hy-23 RAV02, RAV08 2 Hy-24 RAV04 1 Hy-25 SAZ07 1 Hy-26 SAZ08 1 Appendix 2: Detailed overview on individual and haplotype assignment

79 Chapter 6 Appendix

PW 0

SW 0 0.001

distances)

AN 0 0.001 0.001

0 ST 0.001 0.001 0.000

0.001 WG 0 0.001 0.001 0.001

0.001 RU 0 0.001 0.002 0.002 0.001

sequence pairs between sample sites

0.000 BA 0 0.002 0.001 0.001 0.001 0.001

0.002 KH 0 0.002 0.003 0.002 0.003 0.003 0.002

0.001 KZ 0 0.003 0.001 0.001 0.001 0.001 0.001 0.001

0 0.002 EK 0.001 0.004 0.003 0.002 0.002 0.002 0.002 0.002

0.002 0.001 WK 0 0.001 0.002 0.001 0.001 0.001 0.001 0.001 0.001

Estimates evolutionaryof divergence over cytochrome

0.001 0.001 QU 0 0.001 0.000 0.003 0.001 0.001 0.001 0.001 0.001 0.001

EK ST QU WK KZ KH BA RU WG AN SW PW Appendix Appendix 3

80 Chapter 6 Appendix

40.48 88.04 51.77 24.53

244.29 124.28 254.05 203.12 138.06 135.75 126.83 188.28 133.14

86.17 99.39 88.33 47.60 43.49 42.06 40.48

214.32 221.51 168.42 101.84 161.85 124.69

.27

42.06 86.47 30.35 24.53

225 114.01 236.57 187.71 125.14 123.05 117.07 167.94 108.84

89.62 43.49 98.15 96.27 93.08 84.08 73.62 30.35 51.77

194.94 206.53 158.58 137.64

49.22 47.60 68.55 65.97 49.76 73.62 86.47 88.04

186.98 189.68 134.27 142.67 134.01

0 0

87.65 84.08

145.74 115.08 124.69 165.05 135.51 107.7 107.77 118.84 134.01 108.84 133.14

.08

59.60 98 77.42 57.94 79.20 81.32 99.81 87.65

161.85 142.67 137.64 167.94 188.28

3.94

86.17 85.18 19.80 17.33 98.08 49.22 89.62

138.18 140.47 115.08 114.01 124.28

3.94

88.33 84.52 20.80 18.53 99.81 49.76 93.08

138.45 140.04 118.84 117.07 126.83

2.59

17.33 99.39 69.52 18.53 81.32 65.97 96.27

121.07 124.18 107.77 123.05 135.75

0 5

2.59

19.80 66.97 20.80 79.20 68.5 98.15

118.51 101.84 121.60 107.70 125.14 138.06

59.36 85.18 55.80 66.97 69.52 84.52 57.94

168.42 135.51 134.27 158.58 187.71 203.12

24.89 55.80 77.42

140.47 221. 121.60 124.18 140.04 165.05 189.68 206.53 236.57 254.05

24.89 59.36 59.60

Geographic distances (km) among sample sites.

138.18 214.32 118.51 121.07 138.45 145.74 186.98 194.94 225.27 244.29

QU BH SW WK EK KZ KO KH BA RU WG ST AN PW Appendix Appendix 4:

81 Chapter 6 Appendix

Appendix 5: Former and present distribution of Hyla arborea in Lower Saxony (data till: 1991), modified from Manzke and Podloucky (1995). Data of the Region Amt Neuhaus which belongs today to Lower Saxony (former DDR and Mecklenburg-Western Pomerania) are not shown in this map.

82 Chapter 6 Appendix

ISM 0.001 0.001 0.002 0.002 0.002 0.001 0.003 0.002 0.003 0.001 0.002 0.002 0.001 0.002 0.002 0.001 0.001 0.002 0.003 0.002 0.001 0.003 0.001 0.001 0.002 0.001 0.003 0.003 0

BGH 0.002 0.002 0.002 0.002 0.003 0.002 0.004 0.003 0.003 0.002 0.003 0.002 0.002 0.003 0.003 0.002 0.002 0.002 0.004 0.002 0.002 0.003 0.002 0.002 0.003 0.002 0.002 0 0.410

.002

RAV 0.002 0 0.002 0.002 0.003 0.002 0.004 0.003 0.003 0.002 0.003 0.002 0.002 0.003 0.003 0.002 0.002 0.002 0.004 0.002 0.002 0.003 0.002 0.002 0.003 0.002 0 0.272 0.524

OFF 0.000 0.000 0.001 0.001 0.002 0.001 0.003 0.002 0.002 0.001 0.002 0.001 0.001 0.002 0.002 0.001 0.000 0.001 0.0 0.001 0.001 0.002 0.000 0.001 0.001 0 0.635 0.515 0.425

KAS 0.001 0.001 0.001 0.001 0.002 0.001 0.003 0.002 0.003 0.001 0.002 0.002 0.001 0.002 0.002 0.001 0.001 0.002 0.003 0.001 0.001 0.003 0.001 0.001 0 0.209 0.403 0.359 0.363

FS 0.000 0.000 0.001 0.001 0.001 0.001 0.003 0.001 0.002 0.000 0.002 0.001 0.000 0.001 0.001 0.000 0.000 0.001 0.002 0.001 0.001 0.002 0.000 0 0.333 0.473 0.533 0.332 0.431

values among sample sites

KOB 0.000 0.000 0.001 0.001 0.001 0.000 0.002 0.001 0.002 0.000 0.001 0.001 0.000 0.001 0.001 0.000 0.000 0.001 0.002 0.001 0.000 0.002 0 0.243 0.234 0.327 0.39 0.324 0.393

est

003

OL 0.002 0.002 0.002 0.002 0.002 0.002 0. 0.002 0.003 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.003 0.002 0.002 0 0.376 0.520 0.366 0.406 0.622 0.562 0.459

SB 0.000 0.000 0.001 0.001 0.001 0.001 0.002 0.001 0.002 0.001 0.00 0.001 0.001 0.001 0.001 0.001 0.000 0.001 0.002 0.001 0 0.202 0.230 0.260 0.324 0.441 0.547 0.506 0.355

MOZ 0.001 0.001 0.001 0.001 0.002 0.001 0.003 0.002 0.002 0.001 0.002 0.001 0.001 0.002 0.002 0.001 0.001 0.001 0.003 0 0.467 0.397 0.497 0.527 0.548 0.575 0.519 0.644 0.666

383

OVH 0.002 0.002 0.003 0.003 0.001 0.002 0.002 0.001 0.004 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0 0.487 0.186 0.450 0.424 0. 0.387 0.453 0.551 0.503 0.605

SBK 0.001 0.001 0.001 0.001 0.000 0.001 0.002 0.000 0.002 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0 0.384 0.479 0.152 0.376 0.424 0.318 0.344 0.553 0.599 0.499 0.558

AGM 0.000 0.000 0.001 0.001 0.001 0.000 0.002 0.001 0.002 0.000 0.001 0.001 0.000 0.001 0.001 0.000 0

PW 0.000 0.000 0.001 0.001 0.001 0.001 0.002 0.001 0.002 0.001 0.001 0.001 0.000 0.001 0.001 0 0.244 0.367 0.526 0.153 0.384 0.373 0.388 0.367 0.439 0.683 0.620 0.465

SW 0.001 0.001 0.002 0.002 0.001 0.001 0.003 0.001 0.003 0.001 0.002 0.001 0.001 0.001 0 0.267 0.386 0.361 0.516 0.207 0.390 0.415 0.420 0.569 0.593 0.599 0.665 0.546

lower diagonal: pairwise microsatellite D

AN 0.001 0.001 0.002 0.002 0.001 0.001 0.003 0.001 0.003 0.002 0.002 0.001 0.001 0 0.387 0.305 0.199 0.316 0.540 0.153 0.323 0.373 0.415 0.436 0.529 0.612 0.585 0.587

.000

ST 0 0.000 0.001 0.001 0.001 0.001 0.003 0.001 0.002 0.000 0.002 0.001 0 0.233 0.360 0.233 0.279 0.367 0.402 0.095 0.360 0.371 0.388 0.403 0.478 0.591 0.587 0.394

WG 0.001 0.001 0.001 0.001 0.001 0.001 0.002 0.001 0.002 0.001 0.001 0 0.183 0.293 0.287 0.259 0.305 0.362 0.390 0.211 0.335 0.353 0.302 0.267 0.459 0.522 0.514 0.480

RU 0.001 0.001 0.002 0.002 0.001 0.001 0.002 0.001 0.003 0.002 0 0.226 0.190 0.250 0.323 0.258 0.311 0.364 0.510 0.210 0.276 0.471 0.390 0.441 0.458 0.659 0.666 0.4

BA 0.000 0.000 0.001 0.001 0.002 0.001 0.003 0.002 0.002 0 0.229 0.150 0.256 0.282 0.266 0.27 0.333 0.310 0.414 0.148 0.246 0.307 0.293 0.330 0.429 0.497 0.552 0.509

368

BH 0 0.266 0.277 0.284 0.245 0.371 0.386 0.310 0. 0.389 0.385 0.371 0.353 0.383 0.417 0.455 0.471 0.676 0.603 0.530

distances among sample sites;

196

KH 0.002 0.002 0.002 0.002 0.003 0.002 0.004 0.003 0 0.096 0.209 0.194 0.270 0. 0.312 0.376 0.320 0.371 0.368 0.365 0.240 0.300 0.394 0.433 0.444 0.482 0.576 0.652 0.492

.434

KO 0 0.270 0.325 0.252 0.361 0.334 0.301 0.312 0.248 0.292 0.384 0.220 0.521 0.148 0.380 0.377 0.541 0.503 0 0.657 0.634 0.561

0.004

KZ 0.001 0.001 0.002 0.002 0.000 0.001 0.001 0 - 0.274 0.313 0.248 0.356 0.331 0.287 0.303 0.259 0.257 0.419 0.232 0.490 0.154 0.412 0.420 0.532 0.492 0.419 0.609 0.670 0.598

EK 0.002 0.002 0.003 0.003 0.001 0.002 0 0.147 0.145 0.255 0.275 0.257 0.292 0.307 0.346 0.257 0.335 0.299 0.301 0.195 0.437 0.176 0.302 0.312 0.463 0.308 0.329 0.535 0.532 0.484

WK 0.000 0.000 0.001 0.001 0.001 0 0.285 0.223 0.302 0.348 0.426 0.280 0.464 0.346 0.255 0.372 0.397 0.413 0.428 0.332 0.503 0.206 0.467 0.516 0.466 0.487 0.598 0.703 0.672 0.611

228

QU 0.001 0.001 0.002 0.002 0 0. 0.181 0.384 0.444 0.432 0.385 0.226 0.422 0.235 0.354 0.330 0.332 0.294 0.233 0.288 0.445 0.196 0.405 0.303 0.224 0.204 0.443 0.612 0.468 0.471

SAZ 0.001 0.001 0.001 0

HKT 0.001 0.001 0

Genetic Distances. Upper diagonal: cyt

HAK 0.000 0

BLO 0

BLO HAK HKT SAZ QU WK EK KZ KO KH BH BA RU WG ST AN SW PW AGM SBK OVH MOZ SB OL KOB FS KAS OFF RAV BGH ISM

Appendix Appendix 6:

83 Chapter 6 Appendix

ual is is ual

inferred clusters.

= = 10BLO, (c); WK, = EK sites,sample etc. separated by blackfine lines. Each individ

coloured segments, lengthswith proportional to theeach of K

= = 8 (b) and

= = 4 (a),

barplotfor

TRUCTURE

represented a single by vertical brokenline into K Appendix Appendix 7:

84 Chapter 6 Appendix

Appendix 8: Allele-frequency divergence among revealed clusters (Net nucleotide distance), computed using point estimates of P. For K = 4 blue green grey red blue - 0.0196 0.0455 0.0602 green 0.0196 - 0.0518 0.053 grey 0.0455 0.0518 - 0.068 red 0.0602 0.053 0.068 -

Appendix 9: Allele-frequency divergence among revealed clusters (Net nucleotide distance), computed using point estimates of P. For K = 8 blue light blue green light green grey red orange yellow blue - 0.033 0.037 0.034 0.077 0.051 0.058 0.094 light blue 0.033 - 0.030 0.036 0.065 0.045 0.056 0.089 green 0.037 0.030 - 0.032 0.083 0.039 0.044 0.074 light green 0.034 0.036 0.032 - 0.072 0.046 0.062 0.085 grey 0.077 0.065 0.083 0.072 - 0.074 0.086 0.106 red 0.051 0.045 0.039 0.046 0.074 - 0.035 0.041 orange 0.058 0.056 0.044 0.062 0.086 0.035 - 0.046 yellow 0.094 0.089 0.074 0.085 0.106 0.041 0.046 -

85 Chapter 6 Appendix

Appendix 10: GeneBank Sequences of cytochrome b used in this study and their assignment to haplotype term used in this study Haplotype GenBank Haplotype GenBank number Acc.-Nr. Country number Acc.-Nr. Country Hy-1 JF318073 Netherlands Hy-5 JF318108 Romania Hy-1 JF318074 Netherlands Hy-5 JF318109 Poland Hy-1 JF318075 Netherlands Hy-5 JF318110 Poland Hy-1 JF318076 Netherlands Hy-5 JF318111 Poland Hy-1 JF318077 Netherlands Hy-5 JF318114 Poland Hy-1 JF318078 Netherlands Hy-5 JF318115 Poland Hy-1 JF318079 Netherlands Hy-23 JF318068 Belgium Hy-1 JF318080 Netherlands Hy-25 JF318105 Romania Hy-1 JF318081 Netherlands Hy-27 JF318065 Belgium Hy-1 JF318082 Netherlands Hy-27 JF318118 Belgium Hy-4 JF318063 Croatia Hy-27 JF318120 Belgium Hy-5 FJ226861 Switzerland Hy-27 JF318121 Belgium Hy-5 FJ226862 Switzerland Hy-28 JF318119 Belgium Hy-5 FJ226863 Germany Hy-29 JF318086 Poland Hy-5 FJ226864 Germany Hy-29 JF318087 Poland Hy-5 FJ226865 France Hy-29 JF318088 Poland Hy-5 FJ226866 France Hy-29 JF318089 Poland Hy-5 FJ226869 Germany Hy-29 JF318112 Poland Hy-5 FJ226913 France Hy-29 JF318113 Poland Hy-5 FJ226914 France Hy-29 JF318116 Poland Hy-5 FJ226921 Germany Hy-29 JF318117 Poland Hy-5 JF318055 Albania Hy-30 JF318104 Romania Hy-5 JF318056 Netherlands Hy-31 JF318102 Romania Hy-5 JF318064 Belgium Hy-32 FJ226870 Croatia Hy-5 JF318066 Belgium Hy-32 FJ226871 Croatia Hy-5 JF318067 Belgium Hy-32 FJ226922 Croatia Hy-5 JF318069 Belgium Hy-32 JF318095 Poland Hy-5 JF318070 Belgium Hy-33 JF318094 Poland Hy-5 JF318071 Belgium Hy-34 JF318061 Greece Hy-5 JF318072 Belgium Hy-34 JF318062 Greece Hy-5 JF318084 Poland Hy-35 FJ226868 Greece Hy-5 JF318085 Poland Hy-35 JF318060 Greece Hy-5 JF318090 Poland Hy-36 JF318059 Greece Hy-5 JF318091 Poland Hy-37 JF318058 Croatia Hy-5 JF318092 Poland Hy-38 JF318057 Croatia Hy-5 JF318093 Poland Hy-39 JF318054 Greece Hy-5 JF318096 Poland Hy-40 JF318053 Greece Hy-5 JF318097 Poland Hy-41 JF318051 Greece Hy-5 JF318098 Poland Hy-42 JF318050 Greece Hy-5 JF318099 Poland Hy-43 JF318049 Greece Hy-5 JF318100 Poland Hy-44 JF318048 Greece Hy-5 JF318101 Romania Hy-45 FJ226920 Greece Hy-5 JF318103 Romania Hy-46 FJ226873 Greece Hy-5 JF318106 Romania Hy-47 FJ226872 Greece Hy-5 JF318107 Romania Hy-48 FJ226867 Greece

86 Affidavit

Affidavit I herewith declare that I autonomously carried out the PhD-thesis entitled “Phylogeography and population structure of the European tree frog (Hyla arborea) for supporting effective species conservation”.

No third party assistance has been used.

I did not receive any assistance in return for payment by consulting agencies or any other person. No one received any kind of payment for direct or indirect assistance in correlation to the content of the submitted thesis.

I conducted the project at the following institution:

Institute of Zoology, University of Veterinary Medicine Hannover

The thesis has not been submitted elsewhere for an exam, as thesis or for evaluation in a similar context.

I hereby affirm the above statements to be complete and true to the best of my knowledge.

______

26.09.2012, Astrid Krug

Acknowledgement

88 Chapter 7 Acknowledgement

First, I would like to thank my main supervisor Prof. Dr. Heike Pröhl for her support. She always had an open door to listen and discuss problems that cropped up throughout the time of my thesis. I would also like to thank my co-supervisors Dr. Stefan Könemann, PD Dr. Heike Hadrys and Prof. Dr. Miguel Vences for their constructive comments.

I am thankful for the scholarship and further research funds provided by the German Federal Environmental Foundation (DBU), Heidehof-Stiftung, and “Hans-Schiemenz-Fonds“ - Deutsche Gesellschaft für Herpetologie und Terrarienkunde (DGHT).

I thank the following Nature conservation authorities for permission for tree frog collection: the biosphere reserve Niedersächsische Elbtalaue, Kreis Minden Lübbecke, Kreis Steinfurt, Kreis Soest, Landkreis Diepholz, Landkreis Gifhorn, Landkreis Lüneburg, Landkreis Osnabrück, Landkreis Stade, Landkreis Uelzen, Region Hannover, Stadt Gera, Stadt Wolfsburg, Oberbayern, Niederbayern, Haßberge, Baden-Württemberg, Brandenburg, Rheinland-Pfalz, Sachsen, Sachsen Anhalt, Schleswig-Holstein.

I am especially grateful to the following persons for their help during field work or for sending samples: Annika Ruprecht, Axel Kwet, Christina Akman, Frank Weihmann, Günter Krug, Hans-Dieter Bast, Heike Pröhl, Herbert Schnabel, Hubert Laufer, Irena Czycholl, Ivonne Meuche, Jana Kirchhoff, Johannes Penner, Kim Jochum, Kristine Heißler (it was a great week), Matei Balborea, Matthias Scharf, Michael Weinert, Oscar Brusa, Oscar Klose, Thomas Schoger-Ohnweiler, Wiebke Feindt, and Wolf-Rüdiger Große.

I got valuable information on tree frog occurrences from Dieter Rosenbohm, Hubert Laufer, Jan Kanzelmeier, Maike Wilhelm, Michael Weinert, Ralf Knapp, Richard Podloucky, Stephan Geschke, Ulrich Sinsch.

I thank our technician Sabine Sippel for her assistance in the molecular lab and Sönke von den Berg for his support when having troubles with the graphic software and figures.

89 Chapter 7 Acknowledgement

Many thanks go to Sharon Kessler for the final proofreading and polishing the English.

Thanks to all the other colleges and friends not mentioned above for distractive coffee breaks, constructive discussions or just a great time. Mathias Craul, Augustin Probst, Corinna Dreher, Johara Bourke, Konstantin Knorr, Hella Breitrück, Anna Bastian, Ines Petri and the “rest” of the lunch-break-group etc. (and all who I might not mentioned).

I thank my brother Jörn for renting the family car for field season.

My parents for their support in many ways and as well for sometimes refuelling the car during field season.

André, thanks for your support, your patience, and for just being there.