Heterologous Production of 3-Hydroxyvalerate in Engineered Escherichia Coli

Heterologous production of 3-hydroxyvalerate in

engineered Escherichia coli

Dragan Miscevica, Kajan Sriranganb, Teshager Kefalea, Shane Kilpatricka,

Duane A. Chunga, c, d, Murray Moo-Younga, C. Perry Choua, *

a Department of Chemical Engineering University of Waterloo Waterloo, Ontario, Canada N2L 3G1

b Biotechnology Research Institute National Research Council of Canada Montreal, Quebec, Canada H4P 2R2

c Department of Pathology and Molecular Medicine McMaster University Hamilton, Ontario, Canada L8S 4L8

d Neemo Inc. Hamilton, Ontario, Canada L8L 2X2

Keywords: Escherichia coli, glycerol, 3-hydroxyacid, 3-hydroxyvalerate, propionyl-CoA, sleeping beauty mutase

1 Abstract

2 3-Hydroxyacids are a group of valuable fine chemicals with numerous applications, and 3-

3 hydroxybutyrate (3-HB) represents the most common species with acetyl-CoA as a precursor. Due to the

4 lack of propionyl-CoA in most, if not all, microorganisms, bio-based production of 3-hydroxyvalerate (3-

5 HV), a longer-chain 3-hydroxyacid member with both acetyl-CoA and propionyl-CoA as two precursors,

6 is often hindered by high costs associated with the supplementation of related carbon sources, such as

7 propionate or valerate. Here, we report the derivation of engineered Escherichia coli strains for the

8 production of 3-HV from unrelated cheap carbon sources, in particular glucose and glycerol. Activation

9 of the sleeping beauty mutase (Sbm) pathway in E. coli enabled the intracellular formation of non-native

10 propionyl-CoA. A selection of enzymes involved in 3-HV biosynthetic pathway from various

11 microorganisms were explored for investigating their effects on 3-HV biosynthesis in E. coli. Glycerol

12 outperformed glucose as the carbon source, and glycerol dissimilation for 3-HV biosynthesis was

13 primarily mediated through the aerobic GlpK-GlpD route. To further enhance 3-HV production, we

14 developed metabolic engineering strategies to redirect more dissimilated carbon flux from the

15 tricarboxylic acid (TCA) cycle to the Sbm pathway, resulting in an enlarged intracellular pool of

16 propionyl-CoA. Both the presence of succinate/succinyl-CoA and their interconversion step in the TCA

17 cycle were identified to critically limit the carbon flux redirection into the Sbm pathway and, therefore, 3-

18 HV biosynthesis. A selection of E. coli host TCA genes encoding enzymes near the succinate node were

19 targeted for manipulation to evaluate the contribution of the three TCA routes (i.e. oxidative TCA cycle,

20 reductive TCA branch, and glyoxylate shunt) to the redirected carbon flux into the Sbm pathway. Finally,

21 the carbon flux redirection into the Sbm pathway was enhanced by simultaneously deregulating glyoxylate

22 shunt and blocking the oxidative TCA cycle, significantly improving 3-HV biosynthesis. With the

23 implementation of these biotechnological and bioprocessing strategies, our engineered E. coli strains can

1 effectively produce 3-HV up to 3.71 g l-1 with a yield of 24.1% based on the consumed glycerol in shake-

2 flask cultures.

3 Keywords: Escherichia coli, glycerol, 3-hydroxyacid, 3-hydroxyvalerate, propionyl-CoA, sleeping

4 beauty mutase

6 1. Introduction

7 The increasing concerns surrounding climate change and fossil fuel depletion have sparked a growing

8 interest for bio-based production of value-added chemicals and fuels from renewable feedstocks (Bevan

9 and Franssen, 2006). Recent biotechnological progress, particularly in the areas of genetic/genomic

10 engineering, synthetic biology, systems biology, and metabolic engineering, offers novel tools to

11 customize cell factories for bio-based production (Nielsen and Keasling, 2016). Implementation of these

12 tools can enhance the development of large-scale bio-based production processes, offering an

13 economically feasible alternative to manufacturers (Erickson et al., 2012). In particular, pharmaceutical

14 and drug companies are exploring more efficient and sustainable means for the production of fine

15 chemicals without the use of expensive catalysts (e.g., precious metals), harsh physical conditions, and

16 toxic solvents (Welton, 2015), as well as novel synthesis techniques that can overcome substrate

17 specificity challenges and minimize byproducts (Federsel, 2005). For effective bio-based production, it is

18 thus critical to identify novel metabolic pathways generating target products at a high yield and selectivity

19 for implementation in genetically robust microbial hosts (Jullesson et al., 2015).

20 3-Hydroxyacids are a group of valuable fine chemicals as potential building blocks for the

21 production of various antibiotics, vitamins, pheromones, and aromatic derivatives (Fonseca et al., 2019;

22 Mori, 1981; Nahar et al., 2009; Toshiyuki and Takeshi, 1987), due to their structural nature containing two

23 reactive functional groups, i.e., hydroxyl and carboxyl groups, and the reactivity of introducing an extra

1 chiral carbon. Currently, industrial production of 3-hydroxyacids are primarily conducted via two

2 chemical processes: i.e., (i) selective oxidation through Sharpless’ asymmetric epoxidation and subsequent

3 hydroxylation (Ren et al., 2010; Spengler and Albericio, 2014) and (ii) reduction of 3-ketoesters (Noyori

4 et al., 2004). Additionally, chemical degradation of polyhydroxyalkanoates (PHAs), which are

5 biopolymers naturally made in select microorganisms, via acid methanolysis, fractional distillation, and

6 saponification, has been reported for the preparation of 3-hydroxyacids (de Roo et al., 2002). However,

7 bio-based production of 3-hydroxyacids has recently gained attention due to the development of

8 biocatalysts that can potentially enhance the structural variety, yield, and enantioselectivity of the product.

9 Basically, bio-based production of 3-hydroxyacids is carried out in two ways: i.e., (i) depolymerization of

10 PHAs in natural producing hosts (Anis et al., 2017; Biernacki et al., 2017) and (ii) direct biosynthesis in

11 natural or engineered microorganisms (Tseng et al., 2010; Tseng et al., 2009). Since biological

12 depolymerization of PHAs is a complex and expensive approach, direct biosynthesis of 3-hydroxyacids

13 is regarded as a more feasible option for industrial application. 3-Hydroxybutyrate (3-HB), the monomer

14 of polyhydroxybutyrate (PHB), represents the most common 3-hydroxyacid. Structurally, 3-HB can be

15 directly biosynthesized via Claisen condensation of two acetyl-CoA moieties to form acetoacetyl-CoA

16 followed by subsequent reduction and CoA removal (Fig. 1 & 2), and the associated key enzymes, e.g.,

17 acetoacetyl-CoA thiolase (PhaA) and acetoacetyl-CoA dehydrogenase (PhaB), exist in several natural

18 PHA-producing microorganisms (Table 1) (Taroncher-Oldenburg et al., 2000).

19 While it is generally perceived that longer-chain 3-hydroxyacids are more biologically active than

20 shorter-chain ones, their biosynthesis faces various technological and economic challenges that ultimately

21 limit their industrial applications. In particular, 3-hydroxyvalerate (3-HV), a C5-counterpart of 3-HB,

22 serves as a potential building block for the production of pharmaceuticals, such as renin inhibitors

23 (Williams et al., 1991). It is also desirable to include 3-HV monomers into the PHB chain to form poly(3-

24 hydroxybutyrate-co-3-hydroxyvalerate) (PHBV), a biocopolymer more ductile, flexible, and tougher than

1 the PHB homopolymer (Lau et al., 2014; Snell and Peoples, 2009). Structurally, 3-HV can be derived

2 based on a biosynthetic pathway similar to that of 3-HB (Fig. 1 & 2) except one acetyl-CoA precursor

3 moiety is replaced with propionyl-CoA. However, propionyl-CoA is an uncommon metabolic

4 intermediate for the vast majority of microorganisms. As a result, biosynthesis of 3-HV or 3-HV-

5 containing biocopolymers requires supplementation of related, but often expensive, carbons such as

6 propionate, valerate, 3-hydroxynitrile, and levulinate (Martin and Prather, 2009), significantly increasing

7 the production cost. To date, only one metabolic study reported microbial production of 3-HV using

8 unrelated carbon sources by extending the threonine biosynthetic pathway to form propionyl-CoA in

9 bacterium Escherichia coli (Tseng et al., 2010).

10 Herein, we report an alternative approach to engineer E. coli strains for heterologous production

11 of 3-HV from unrelated and cheap carbon sources. A previously derived propanologenic (i.e., 1-propanol-

12 producing) E. coli strain with its genomic Sleeping beauty mutase (Sbm) operon being activated was used

13 as the production host (Srirangan et al., 2013; Srirangan et al., 2014). The Sbm operon consists of four

14 genes, i.e., sbm-ygfD-ygfG-ygfH, whose encoding enzymes are involved in extended dissimilation of

15 succinate for fermentative production of 1-propanol or propionate with propionyl-CoA as a metabolic hub

16 (Fig. 1) (Froese et al., 2009; Haller et al., 2000). Note that propionyl-CoA is a key precursor to 3-HV and

17 does not normally exist in natural microorganisms. Biosynthesis of 3-HV involves three major enzymatic

18 reactions (Fig. 2), i.e., (i) hetero-fusion of acetyl-CoA and propionyl-CoA molecules (i.e., Claisen

19 condensation) via β-ketothiolase, generating 3-ketovaleryl-CoA, (ii) reduction of 3-ketovaleryl-CoA to

20 chiral 3-hydroxyvaleryl-CoA (3-HV-CoA) by an enantiomer-specific dehydrogenase (ESD), and (iii)

21 conversion of 3-HV-CoA to 3-HV via a CoA-removing enzyme. To enhance 3-HV production, we first

22 targeted 3-hydroxyacid biosynthesis pathway by identifying and cloning relevant genes for functional

23 expression. Then, we identified potential genetic, metabolic, and bioprocessing factors limiting 3-HV

24 biosynthesis in E. coli. Finally, we developed metabolic engineering strategies by redirecting more carbon

1 flux toward the Sbm pathway and various key E. coli host genes involved in the tricarboxylic acid (TCA)

2 cycle were manipulated for the carbon flux redirection.

4 2. Materials and Methods

5 2.1 Bacterial strains and plasmids

6 Bacterial strains, plasmids, and DNA primers used in this study are listed in Table S1. Genomic DNA

7 from various bacterial strains was isolated using the Blood & Tissue DNA Isolation Kit (Qiagen, Hilden,

8 Germany). Standard recombinant DNA technologies were applied for molecular cloning (Miller, 1992).

9 All plasmids were constructed by Gibson enzymatic assembly (Gibson et al., 2009). Phusion HF and Taq

10 DNA polymerases were obtained from New England Biolabs (Ipswich, MA, USA). All synthesized

11 oligonucleotides were obtained from Integrated DNA Technologies (Coralville, IA, USA). DNA

12 sequencing was conducted by the Centre for Applied Genomics at the Hospital for Sick Children (Toronto,

13 Canada). E. coli BW25113 was the parental strain for derivation of all mutant strains in this study and E.

14 coli DH5α was used as a host for molecular cloning. The ldhA gene (encoding lactate dehydrogenase) was

15 inactivated in BW25113, generating BW∆ldhA, with the intention of reducing lactate accumulation

16 (Srirangan et al., 2014).

17 Activation of the genomic Sbm operon in BW∆ldhA to generate propanologenic E. coli CPC-Sbm

18 was described previously (Srirangan et al., 2014). Knockouts of the genes, including glpK, glpD, glpABC,

19 gldA, ptsI, dhaKLM, frdB, aceA, sucD, sdhA, and iclR were introduced into CPC-Sbm by P1 phage

20 transduction (Miller, 1992) using the appropriate Keio Collection strains (The Coli Genetic Stock Center,

21 Yale University, New Haven, CT, USA) as donors (Baba et al., 2006). To eliminate the co-transduced FRT-

22 KmR-FRT cassette, the transductants were transformed with pCP20 (Cherepanov and Wackernagel, 1995),

23 a temperature sensitive plasmid expressing a flippase (Flp) recombinase. Upon Flp-mediated excision of

24 the KmR cassette, a single Flp recognition site (FRT “scar site”) was generated. Plasmid pCP20 was then 6

1 removed by growing cells at 42°C. The genotypes of derived knockout strains were confirmed by colony

2 PCR using the appropriate verification primer sets listed in Table S1.

3 The phaAB operon was amplified by polymerase chain reaction (PCR) using the primer set g-

4 phaAB and the genomic DNA of wild-type Cupriavidus necator ATCC 43291 as the template. The

5 amplified operon was Gibson–assembled (Note that “assembled” is used for subsequent appearance) with

6 the PCR-linearized pTrc99a using the primer set g-pTrc-phaAB to generate pTrc-PhaAB. All genes

7 inserted into pTrc99a vector were under the control of the Ptrc promoter. The DNA fragments phaA and

8 phaB from pTrc-PhaAB were individually PCR-amplified using the primer sets g-phaA and g-phaB, and

9 then assembled with the PCR-linearized pTrc99a using the corresponding primer sets (i.e., g-pTrc-phaA

10 and g-pTrc-phaB), generating pTc-PhaA and pTrc-PhaB, respectively. Plasmid pK-BktB-Hbd-TesB was

11 previously constructed in our lab by PCR-amplifying bktB from C. necator ATCC 43291, hbd from

12 Clostridium acetobutylicum ATCC 824, and tesB from E. coli BW25141 using the corresponding primer

13 sets (i.e., g-bktB, g-hbd, and g-tesB), followed by assembling all three PCR-amplified fragments with the

14 PCR-linearized pK184 using the primer set g-pK-bktB-hbd-tesB. All genes inserted into pK184 vector

15 were under the control of the Plac promoter. To construct pK-TesB, the primer set g-tesB2 was used to

16 PCR-amplify tesB from pK-BktB-Hbd-TesB and the amplicon was subsequently assembled with the PCR-

17 linearized pK184 using the primer set g-pK-tesB. The two-subunit β-ketothiolase gene bktBαβ was PCR-

18 amplified from the genomic DNA of wild-type Haloferax mediterranei ATCC 33500 using the primer set

19 g-bktBαβ. The amplicon was then assembled with the PCR-linearized pK-TesB using the primer set g-

20 pK-bktαβ-tesB, yielding pK-BktBαβ-TesB. The same approach was used with the primer set g-pK-bktB-

21 tesB to generate plasmid pK-BktB-TesB harboring the bktB gene. Plasmid pK-BktB-Hbd was constructed

22 by PCR-amplifying hbd from pK184-BktB-Hbd-TesB using the primer set g-pK-bktB-hbd, followed by

23 assembling the amplicon with the PCR-linearized pK-BktB using the primer set g-pK-bktB. Lastly, to

24 generate plasmids testing CoA removing efficiency (i.e., pK-BktB-Hbd-Ptb-Buk and pK-BktB-Hbd-Pct),

1 the ptb-buk operon from C. acetobutylicum ATCC 824 and pct from Clostridium propionicum DSM 1682

2 were PCR amplified using corresponding primer sets (i.e., g-ptb-buk and g-pct). The ptb-buk and pct

3 amplicons were then individually assembled with PCR linearized pK-BktB-Hbd using g-pK-bktB-hbd-

4 ptb-buk and g-pK-bktB-hbd-pct primer sets, respectively.

5 2.2 Bacterial cultivation

6 All medium components were obtained from Sigma-Aldrich Co. (St Louis, MO, USA) except glucose,

7 yeast extract, and tryptone which were obtained from BD Diagnostic Systems (Franklin Lakes, NJ, USA).

8 The media were supplemented with antibiotics as required: 25 µg ml-1 kanamycin and 50 µg ml-1

9 ampicillin. E. coli strains, stored as glycerol stocks at -80 °C, were streaked on LB agar plates with

10 appropriate antibiotics and incubated at 37°C for 14-16 hours. Single colonies were picked from LB plates

11 to inoculate 30-ml LB medium (10 g l-1 tryptone, 5 g l-1 yeast extract, and 5 g l-1 NaCl) with appropriate

12 antibiotics in 125-ml conical flasks. The cultures were shaken at 37°C and 280 rpm in a rotary shaker

13 (New Brunswick Scientific, NJ, USA) and used as seed cultures to inoculate 220 ml LB media at 1% (v/v)

14 with appropriate antibiotics in 1-L conical flasks. This second seed culture was shaken at 37°C and 280

15 rpm until an optical density of 0.80 OD600 was reached. Cells were then harvested by centrifugation at

16 9,000 ×g and 20°C for 10 minutes and resuspended in 30-ml modified M9 production media. The

17 suspended culture was transferred into a 125-ml screw-cap or vent-cap plastic production flasks and

18 incubated at either 30 or 37°C at 280 rpm in a rotary shaker. Unless otherwise specified, the modified M9

19 production medium contained 30 g l-1 glycerol or glucose, 2.5 g l-1 succinate, 5 g l-1 yeast extract, 10 mM

th -1 20 NaHCO3, 1 mM MgCl2, 0.2 µM cyanocobalamin (vitamin B12), 5 dilution of M9 salts mix (33.9 g l

-1 -1 -1 th 21 Na2HPO4, 15 g l KH2PO4, 5 g l NH4Cl, 2.5 g l NaCl ), 1,000 dilution of Trace Metal Mix A5 (2.86 g

-1 -1 -1 -1 -1 22 l H3BO3, 1.81 g l MnCl2•4H2O, 0.222 g l ZnSO4•7H2O, 0.39 g l Na2MoO4•2H2O, 79 µg l

-1 23 CuSO4•5H2O, 49.4 µg l Co(NO3)2•6H2O), and supplemented with 0.1 mM isopropyl β-D-1-

24 thiogalactopyranoside (IPTG). All cultivation experiments were performed in triplicate.

1 2.3 Analytical methods

2 Culture samples were appropriately diluted with 0.15 M saline solution for measuring the optical cell

3 density (OD600) using a spectrophotometer (DU520, Beckman Coulter, Fullerton, CA). Cell-free medium

4 was collected by centrifugation of the culture sample at 9,000 ×g and filter sterilized for titer analysis of

5 glucose or glycerol, and various metabolites using a high-performance liquid chromatography (HPLC;

6 LC-10AT, Shimadzu, Kyoto, Japan) with a refractive index detector (RID; RID-10A, Shimadzu, Kyoto,

7 Japan) and a chromatographic column (Aminex HPX-87H, Bio-Rad Laboratories, CA, USA). The HPLC

8 column temperature was maintained at 35°C and the mobile phase was 5 mM H2SO4 (pH 2.0) running at

9 0.6 ml min-1. The RID signal was acquired and processed by a data processing unit (Clarity Lite,

10 DataApex, Prague, Czech Republic).

12 3. Results

13 3.1 Pathway implementation for heterologous 3-HV biosynthesis

14 An essential precursor for 3-HV biosynthesis is propionyl-CoA, which is non-native to E. coli. By

15 activating the Sbm operon in the E. coli host genome, the dissimilation of succinate can be diverted from

16 the TCA cycle into the Sbm pathway to form propionyl-CoA (Fig. 1). To evaluate the feasibility of 3-HV

17 biosynthesis using this propanologenic host strain, a double plasmid system was employed in strain

18 P3HA11 (Fig. 3). In the first step, hetero-fusion of propionyl-CoA and acetyl-CoA to 3-ketovaleryl-CoA

19 was carried out by PhaA (encoded by phaA) (Fig. 2). Subsequently in the second step, the enantiomer-

20 specific reduction (ESR) of 3-ketovaleryl-CoA into (R)-3-HV-CoA is catalyzed by NADPH-dependent

21 PhaB (encoded by phaB). In the final step, (R)-3-HV is synthesized via hydrolysis of (R)-3-HV-CoA,

22 catalyzed by acyl-CoA thioesterase II (i.e., TesB encoded by tesB). Note that these (R)-3-HV-producing

23 enzymes also have the capacity to generate the C4 counterparts in all steps of the engineered pathway,

24 resulting in the co-production of 3-HV and 3-HB (Fig. 2). To validate the proposed 3-hydroxyacid

1 pathway, P3HA11 was cultivated in a 37°C shake-flask using 30 g l-1 glucose (Fig. 3), producing 0.27 g l-

2 1 3-HB and 0.03 g l-1 3-HV. On the other hand, the control strain CPC-Sbm without the 3-hydroxyacid

3 biosynthetic pathway produced no 3-hydroxyacids, indicating that the implemented pathway was

4 functional. Also, the loss of either one of the 3-hydroxyacid pathway genes resulted in no 3-HV production

5 (see later sections and Fig. 4), suggesting that all these 3-hydroxyacid biosynthetic pathway genes were

6 required for 3-HV production. Furthermore, another control strain BW∆ldhA-3HA11 with the native (i.e.,

7 non-activated) Sbm operon produced 0.94 g l-1 3-HB but no 3HV, suggesting that propionyl-CoA acted as

8 a key precursor for 3-HV biosynthesis.

9 3.2 Manipulation of genes involved in 3-HV biosynthetic pathway

10 As multiple enzymes have been identified to catalyze each of the three steps in the 3-HV biosynthetic

11 pathway (Table 1), the effects of heterologous expression of these enzyme genes, either individually or in

12 combination, on 3-HV production were investigated. For the first step of Claisen condensation, in addition

13 to PhaA which primarily targets short-chain CoA molecules, BktB (encoded by bktB) is another β-

14 ketothiolase with a specificity toward long-chain CoA molecules (Slater et al., 1998). While the control

15 strain P3HA10 produced no 3-hydroxyacids, heterologous expression of either phaA in P3HA11 or bktB

16 in P3HA12 mediated both 3-HV and 3-HB production (Fig. 4), suggesting the catalytic activity of the two

17 β-ketothiolases for the Claisen condensation. Heterologous expression of another PHA-specific β-

18 ketothiolase (i.e., BktBαβ encoded by bktBαβ) in P3HA13 mediated the production of 3-HB only, but not

19 3-HV. Note that BktB appeared to be more effective than PhaA in terms of 3-HV production, potentially

20 due to the promiscuous activity of BktB toward different acyl-CoA moieties (Slater et al., 1998).

21 Interestingly, compared to P3HA11 and P3HA12, coexpression of both β-ketothiolase genes of bktB and

22 phaA in P3HA21 significantly enhanced 3-hydroxacid production up to 0.77 g l-1 3-HB and 0.11 g l-1 3-

23 HV. Due to this synergistic effect, the engineered strains used in all subsequent experiments contained

24 both bktB and phaA genes.

1 For the second step of ESR, in addition to PhaB, we also evaluated another NADH-dependent

2 dehydrogenase, i.e., β-hydroxybutyryl-CoA dehydrogenase (also known as (S)-3-HB-CoA dehydrogenase

3 or Hbd encoded by hbd) and their effects on 3-HV production are summarized in Figure 4. PhaB and Hbd

4 mediate the formation of (R)- and (S)-form hydroxyacid-CoA, respectively (Fig. 2). The control strain

5 P3HA20 without a heterologous dehydrogenase produced no 3-HV though a trace amount of 3-HB at 0.08

6 g l-1 was observed, presumably associated with non-specific dehydrogenases in E. coli. The overall

7 synthesis of (R)-3-HB/HV from PhaB in P3HA21 was approximately 3-fold that of (S)-3-HB/HV from

8 Hbd in P3HA22. Coexpression of phaB and hbd further improved the production of 3-hydroxyacids and,

9 interestingly, the total 3-hydroxyacid titers of P3HA31 (1.07 g l-1 3-HB and 0.19 g l-1 3-HV) were

10 approximately equivalent to the sum of the 3-hydroxyacid titers of P3HA21 (0.77 g l-1 3-HB and 0.11 g l-

11 1 3-HV) and P3HA22 (0.24 g l-1 3-HB and 0.04 g l-1 3-HV), implying the potentially independent

12 enzymatic mechanisms for the two dehydrogenases. Due to the improved 3-HV production in P3HA31,

13 this dehydrogenase duo was used in all subsequent experiments.

14 For the last step, in addition to the native TesB, we also evaluated two other CoA-removing

15 enzymes, including phosphotransbutyrylase (i.e., Ptb encoded by ptb) and butyrate kinase (i.e., Buk

16 encoded by buk) and acetate/propionate CoA-transferase (i.e., Pct encoded by pct), and their effects on 3-

17 HV production are summarized in Figure 4. The Ptb-Buk system is a two-step CoA removal scheme

18 generating a phosphorylated intermediate and has been successfully used for butyrate and 3-HB

19 production (Fischer et al., 2010; Gao et al., 2002). On the other hand, Pct has a broad substrate specificity

20 toward CoA molecules and is capable of converting both (R) and (S) forms of 3-HB-CoA into respective

21 3-HB (Matsumoto et al., 2013). The control strain P3HA30 without a CoA-removing enzyme produced

22 no 3-hydroxyacids. In comparison to P3HA31, expression of ptb-buk in P3HA32 or pct in P3HA33 did

23 not further improve 3-HV biosynthesis. Given the superior CoA removing nature of TesB in comparison

24 to Ptb-Buk and Pct, we chose not to conduct further enzyme co-expression for this step and thus only TesB

1 was used for CoA removal in all subsequent experiments.

2 3.3 Bacterial cultivation for 3-HV production

3 As the metabolic activities of various pathways involved for 3-HV biosynthesis (Fig. 1) can potentially

4 depend on culture environment, we examined the effects of cultivation conditions, specifically

5 temperature and carbon source (Fig. 5), on 3-HV production. While the formation of propionyl-CoA in

6 the fermentative Sbm pathway is favored by anaerobic conditions (Akawi et al., 2015; Srirangan et al.,

7 2014), the hydroxyacid biosynthetic pathway is energetically intensive and presumably favored by aerobic

8 conditions. However, precise control of the oxygenic condition for shaker flask cultivation was difficult

9 though the shaking speed could be adjusted. For consistent operation in this study, the shaking speed was

10 fixed to 280 rpm throughout the entire cultivation. Under both 30°C and 37°C, the control strain CPC-

11 Sbm lacking a 3-hydroxyacid biosynthetic pathway produced neither 3-HB nor 3HV (Table S6). However,

12 the overall yield of odd-chain metabolites, including 3-HV, propionate, and 1-propanol, based on the

13 consumed glucose was significantly higher under a low temperature, i.e., 4.42% under 30°C vs. 1.34%

14 under 37°C. Note that the overall yield of odd-chain metabolites potentially correlates with the level of

15 intracellular propionyl-CoA during cultivation. For P3HA31 with an optimal 3-hydroxyacid biosynthetic

16 pathway, both 3-HB and 3-HV titers of the 30°C culture were significantly higher than those of the 37°C

17 culture. In addition, the overall yield of odd-chain metabolites based on the consumed glucose was favored

18 by a low cultivation temperature, i.e., 6.84% under 30°C vs. 3.74% under 37°C. Notably, for both strains,

19 the low cultivation temperature under 30°C appeared to significantly reduce carbon spill toward acetate

20 and ethanol, therefore enhancing the metabolic availability of acetyl-CoA for 3-hydroxyacid production.

21 Furthermore, the overall glucose consumption and cell growth were also more effective under a low

22 temperature of 30°C.

23 Given the abundance as a byproduct of biodiesel production, glycerol has become a promising

24 feedstock for bio-based production (Gonzalez et al., 2008; Yazdani and Gonzalez, 2007). Since glycerol

1 possesses a high degree of reductance (κ = 4.67), its glycolytic degradation generates approximately twice

2 the number of reducing equivalents compared to xylose and glucose (κ = 4.00) (Murarka et al., 2008).

3 Cultivation of P3HA31 with glycerol at 30°C resulted in a high 3-HV titer of 2.29 g l-1, which is

4 approximately 2-fold that of the corresponding glucose culture. Similarly, cultivation of P3HA31 with

5 glycerol at 37°C resulted in a 3-HV titer of 1.71 g l-1, which is approximately 9-fold that of the

6 corresponding glucose culture, further confirming both the temperature and carbon source effects on 3-

7 HV production. Importantly, the overall yield of odd-chain metabolites was elevated with glycerol as the

8 carbon source, i.e., 16.31% under 30°C and 15.63% under 37°C. These results are consistent with our

9 previous reports that glycerol is a more efficient carbon source in stimulating the Sbm pathway (Akawi et

10 al., 2015; Srirangan et al., 2016a). Hence, cultivation with glycerol as the sole carbon source under 30°C

11 was adopted for all subsequent experiments.

12 3.4 Metabolic engineering to enhance 3-HV production

13 Propionyl-CoA, a key precursor for 3-HV biosynthesis, is derived via a partial carbon flux diversion of

14 the TCA cycle at the node of succinyl-CoA into the Sbm pathway (Fig. 1). To enhance 3-HV biosynthesis,

15 we developed various metabolic strategies by manipulating a selection of TCA genes to increase such

16 carbon flux redirection and the results are summarized in Figure 6. We first supplemented the culture of

17 P3HA31 with succinate and observed that propionate and 3-HV titers were increased upon succinate

18 supplementation, suggesting that the carbon flux redirection into the Sbm pathway could be limited by

19 succinate availability. We then targeted several TCA genes encoding enzymes near the succinate note

20 (designated in red in Fig. 1) for manipulation. Consequently, we derived various mutants by individually

21 blocking the three major TCA routes, i.e. oxidative TCA cycle, reductive TCA branch, and glyoxylate

22 shunt. Compared to the control strain P3HA31, inactivation of the reductive TCA branch gene of frdB in

23 P3HA31∆frdB significantly reduced 3-HV titer and yield, whereas 3-HV production was slightly reduced

24 upon the inactivation of the glyoxylate shunt gene of aceA in P3HA31∆aceA or the oxidative TCA cycle

1 gene of sdhA in P3HA31∆sdhA. The results suggest that the carbon flux redirected toward the Sbm

2 pathway was primarily derived from the reductive TCA branch. Simultaneous inactivation of the reductive

3 TCA branch and glyoxylate shunt in the double mutant P3HA31∆frdB∆aceA further reduced 3-HV

4 production with an 8-fold reduction in the total odd-chain yield compared to the control P3HA31, further

5 suggesting a minimal contribution from the oxidative TCA cycle for the carbon flux redirection.

6 Importantly, disruption of sucD caused a complete abolishment in biosynthesis of all odd-chain

7 metabolites, including 3-HV, 1-propanol, and propionate, suggesting the key role that this succinate-

8 succinyl-CoA interconversion step played for the carbon flux redirection into the Sbm pathway. Given

9 that succinate appears to be critically limiting the carbon flux redirection, glyoxylate shunt was

10 deregulated by mutating iclR in P3HA31iclR to enlarge the succinate pool. P3HA31∆iclR secreted a

11 trace amount of succinate though 3-HV production was not improved compared to the control strain

12 P3HA31. Note that these TCA-gene mutations appeared to minimally affect metabolic activity of the 3-

13 hydroxyacid biosynthetic pathway since, compared to the control strain P3HA31, 3-HB titer and yield

14 were slightly increased by all single mutations (ranging from 2.41 g l-1 to 2.76 g l-1 and from 14.6% to

15 19.8%, respectively) except ∆sdhA (which slightly reduced 3-HB titer and yield). As a potential reason

16 limiting 3-HV production in P3HA31∆iclR was the carbon flux diversion (toward both oxidative and

17 reductive TCA directions) at the succinate node, we further blocked the oxidative TCA cycle by deriving

18 a double mutant P3HA31∆sdhA∆iclR such that the entire carbon flux would be redirected into the Sbm

19 pathway via the reductive TCA branch. While 3-hydroxyacid titers for this particular double mutant were

20 increased moderately compared to the control strain P3HA31 (23.7% for 3-HB and 27.9% for 3-HV), the

21 corresponding yields were increased significantly (~100% for both 3-HB and 3-HV), suggesting a much

22 higher 3-hydroxyacid producing capacity and successful carbon flux redirection into the Sbm pathway

23 under this genetic background. However, the culture performance was limited by deteriorated glycerol

24 dissimilation and cell growth for P3HA31∆sdhA∆iclR cultivated in the standard screw-cap shake-flasks,

1 which were rather anaerobic. Such limitation was partially resolved by conducting the same cultivation

2 under a more aerobic condition in the vent-cap shake-flasks, resulting in the highest titers for both 3-HV

3 (3.71 g l-1) and propionate (2.97 g l-1), a nearly 150% increase in the odd-chain yield compared to the

4 control strain P3HA31 in the standard screw-cap shake-flasks.

6 4. Discussion

7 Among the three steps in the 3-hydroxyacid biosynthetic pathway, the Claisen condensation, generating

8 acetoacetyl-CoA and 3-ketovaleryl-CoA, has to confront a thermodynamic hurdle caused by an

9 energetically unfavorable fusion of two acyl-CoA molecules (Weber, 1991), and therefore can represent a

10 rate-limiting step. While three individual β-ketothiolases of PhaA, BktB, and BktBαβ mediated

11 homofusion of acetyl-CoA for 3-HB production, only PhaA and BktB mediated heterofusion of acetyl-

12 CoA and propionyl-CoA for 3-HV production. BktB appeared to have a higher specificity than PhaA

13 toward propionyl-CoA. Also, the catalytic effects of PhaA and BktB appeared to be synergistic when the

14 two enzymes were coexpressed. Nevertheless, both PhaA and BktB had a significantly higher specificity

15 toward acetyl-CoA than propionyl-CoA, limiting the 3-HV yield.

16 PhaB and Hbd mediate ESR of the 3-hydroxyacid biosynthetic pathway, generating (R)-3-HB/HV-

17 CoA and (S)-3-HB/HV-CoA, respectively, and our results suggest that PhaB was catalytically more active

18 than Hbd. In addition, the catalytic effects of PhaB and Hbd appeared to be independent and addable upon

19 coexpression of the two enzymes. Since PhaB and Hbd are NADPH-dependent and NADH-dependent,

20 respectively, our results of higher titers in (R)-3-HB/HV than (S)-3-HB/HV might imply the physiological

21 abundance of NADPH as a reducing equivalent under the shake-flask culture conditions. Cofactor

22 engineering has been applied to manipulate the physiological levels of reducing equivalents to improve

23 the biosynthesis of an enantiomerically pure 3-hydroxyacid (Perez-Zabaleta et al., 2016).

24 Among the three evaluated CoA removing enzymes, the native TesB thioesterase outperformed

1 Ptb-Buk and Pct in both 3-HB and 3-HV production. Consistent to our results, TesB is capable of

2 catalyzing an irreversible one-step CoA removal hydrolysis and has a broad substrate specificity (Zheng

3 et al., 2004). Note that the control strain P3HA30 produced no 3-hydroxyacids, suggesting that the

4 expression of the native genomic tesB gene was insufficient or even inhibited. The low 3-hydroxyacid

5 titers for P3HA32 might be associated with the limited substrate specificity toward (R)-3-hydroxyacid-

6 CoA only. A previous study reported that strains expressing Ptb-Buk yielded no (S)-3-HB (Tseng et al.,

7 2009). While, similar to TesB, Pct also has a specificity toward both (R)- and (S)-3-hydroxyacid-CoA

8 (Matsumoto et al., 2013), its catalytic activity was less effective than TesB based on our results. Note that,

9 in order to alleviate the competition from the 3-HB biosynthetic pathway for enhanced 3-HV biosynthesis,

10 protein engineering techniques to improve enzymatic specificity of β-ketothiolases toward odd-chain

11 substrates could be potentially useful, as was successfully demonstrated for other proteins (Arabolaza et

12 al., 2010; Sofeo et al., 2019). To the best of our knowledge, there are no reports demonstrating higher

13 enzymatic preference for odd-chain precursors associated with the last two 3-HV reaction steps (i.e.,

14 reduction and CoA removal).

15 Culture conditions critically affected 3-HV production. The positive effects of the lower cultivation

16 temperature were presumably associated with increased levels of intracellular propionyl-CoA. The

17 temperature change could potentially affect the metabolic activity of the Sbm pathway. On the other hand,

18 the specific 3-HB yields based on consumed glycerol were approximately the same under both 30°C and

19 37°C (Fig. 5), suggesting that the metabolic activity of the 3-hydroxyacid biosynthetic pathway was

20 minimally affected by temperature. Previously, glycerol was shown to outperform glucose as the carbon

21 source in terms of stimulating the metabolic activity of the Sbm pathway in propanologenic E. coli strains

22 (Akawi et al., 2015; Srirangan et al., 2014). Such observation was further demonstrated in the current

23 study. The higher reductance of glycerol than glucose could generate more reducing equivalents for their

24 subsequent use in the 3-hydroxyacid biosynthetic pathway.

1 In E. coli, glycerol dissimilation proceeds through either respiratory or fermentative pathways

2 depending on the nature and availability of the electron acceptors (Gonzalez et al., 2008). In the presence

3 of external electron acceptors, glycerol is first converted to glycerol-3-phosphate (G3P) via GlpK in the

4 respiratory branch. For aerobic respiration with oxygen as the external electron acceptor, G3P is oxidized

5 by GlpD to DHAP (Murarka et al., 2008). Alternatively, for anaerobic respiration in the presence of other

6 non-oxygen external electron acceptors, such as fumarate or succinate, an enzyme complex GlpABC

7 converts G3P to DHAP (Murarka et al., 2008). Our results (Supplementary Materials) suggest that glycerol

8 dissimilation for metabolite production in P3HA31 under the shake-flask culture conditions was primarily

9 mediated through the respiratory branch via GlpK and GlpD with oxygen as the electron acceptor. In

10 addition, the enzyme complex GlpABC might not be involved in glycerol dissimilation under such

11 oxygenic culture condition. However, supplying oxygen could potentially drive dissimilated carbon flux

12 away from the Sbm pathway, limiting the supply of propionyl-CoA for 3-HV biosynthesis. On the other

13 hand, in the absence of external electron acceptors, glycerol dissimilation proceeds fermentatively (via

+ 14 GldA and DhaKLM/PtsI) with intracellular NAD as the electron acceptor (Gonzalez et al., 2008).

15 Compared to the control strain P3HA31, inactivation of any gene involved in the fermentative branch, i.e.,

16 gldA in P3HA31∆gldA, dhaKLM in P3HA31∆dhaKLM, and ptsI in P3HA31∆ptsI, significantly reduced

17 3-HV production, but minimally affected glycerol utilization, the overall metabolite profile, and even 3-

18 HB production. The decreased 3-HV production for these single mutants could be associated with a

19 reduced supply of propionyl-CoA. Under this hypothesis, glycerol was dissimilated via both respiratory

20 and fermentative branches for its conversion to propionyl-CoA though the aerobic-respiratory one via

21 GlpK-GlpD was identified to be the major route. On the other hand, the overall 3-HV production was not

22 limited by the aerobic-respiratory route for glycerol dissimilation since episomal overexpression of GlpD

23 in P3HA31 did not improve 3-HV production (data not shown).

24 As propionyl-CoA is a key precursor for 3-HV biosynthesis, metabolic engineering strategies in

1 this study were primarily developed to enhance carbon flux redirection from the TCA cycle to the Sbm

2 pathway, and succinate appeared to play a key role mediating the carbon flux redirection. In E. coli,

3 succinate is formed via three oxygen-dependent pathways, i.e. (i) reductive TCA branch, (ii) oxidative

4 TCA cycle, and (iii) glyoxylate shunt. Under anaerobic conditions, the dissimilated carbon enters the TCA

5 cycle in the form of phosphoenolpyruvate (PEP) via carboxylation to form oxaloacetate, and then proceeds

6 with reactions in the reductive TCA branch to generate succinate as a final product (Cheng et al., 2013).

7 On the other hand, under aerobic conditions, acetyl-CoA derived from glycolysis enters the oxidative TCA

8 cycle to generate succinate as a cycle intermediate (Thakker et al., 2012). We previously observed that the

9 production of 1-propanol and propionate via the Sbm pathway was favored by anaerobic conditions and

10 was minimal under aerobic conditions (Akawi et al., 2015; Srirangan et al., 2013), suggesting that the

11 reversed TCA branch was the main flux contributor toward the Sbm pathway. Hence, we targeted several

12 TCA genes encoding enzymes near the succinate node for manipulation. The cultivation results of the

13 single mutants, i.e., P3HA31∆sdhA, P3HA31∆aceA, and P3HA31∆frdB, further confirm the main

14 contribution from the reverse TCA branch for the carbon flux redirection into the Sbm pathway under the

15 standard shake-flask culture conditions. Though knocking out sucCD can potentially disrupt the TCA

16 cycle in both oxidative and reductive directions, sucCD are not essential genes since the physiologically

17 required succinyl-CoA can still be derived via SucAB (Yu et al., 2006). However, succinyl-CoA derived

18 from this half oxidative TCA branch cannot be funneled into the Sbm pathway since P3HA31∆sucD

19 produced no 3-HV or odd-chain metabolites. On the other hand, 3-HV biosynthesis was observed, though

20 in a small quantity, for the double mutant P3HA31∆frdB∆aceA, in which only the oxidative TCA cycle

21 was functional to generate succinate. These results suggest that succinate could be an essential precursor

22 for carbon flux redirection into the Sbm pathway. Knocking out sucD can also block the carbon flux

23 toward succinyl-CoA from both the reductive TCA branch and glyoxylate shunt, further suggesting the

24 critical role that SucD and its associated succinate-succinyl-CoA interconversion step played in the carbon

1 flux redirection.

2 Under aerobic conditions, succinate can be generated alternatively via glyoxylate shunt (Thakker

3 et al., 2012), which is stimulated upon transcriptional activation of the aceBAK operon and negatively

4 regulated by the IclR repressor (Nègre et al., 1992; Sunnarborg et al., 1990). Compared to the control

5 strain P3HA31, the 3-HV yield was slightly increased by the iclR knockout. Such minimal improvement

6 could be associated with rather anaerobic culture conditions in shake-flasks as well as carbon flux

7 diversion (to both oxidative and reductive directions) at the succinate node. Hence, we further prevented

8 this flux diversion by deriving a double mutant P3HA31∆sdhA∆iclR such that the carbon flux from

9 glyoxylate shunt could be completely redirected to succinyl-CoA and into the Sbm pathway. Compared to

10 the control strain P3HA31, P3HA31∆sdhA∆iclR cultivated in the standard screw-cap shake-flasks had a

11 significant increase in the yield of both 3-HV and odd-chain metabolites, suggesting successful carbon

12 flux redirection into the Sbm pathway. Such production enhancement was even more pronounced with a

13 reduced acetate accumulation when P3HA31∆sdhA∆iclR was cultivated under more aerobic conditions in

14 the vent-cap shake-flasks. Our results suggest that the shortage of oxygen supply and associated carbon

15 spill via acetogenesis can significantly limit 3-HV production. Hence, conducting cultivation in a

16 bioreactor under regulated oxygenic conditions would further enhance mechanistic understanding of

17 carbon flux redirection for developing better metabolic engineering and bioprocessing strategies toward

18 3-HV production. Note that glyoxylate shunt essentially provides anaplerotic reactions and is only active

19 under aerobic conditions when cells adapt to growth on C2 compounds (e.g., acetate) (Gottschalk, 1986;

20 Kornberg and Madsen, 1957). Our results also suggest that the Sbm pathway is metabolically active and

21 3-HV can be produced under both anaerobic and aerobic conditions.

23 Funding information

24 This work was supported by the following Government of Canada grants: (1) Natural Sciences and 19

1 Engineering Research Council (NSERC) Strategic Partnership grant, (2) Canada Research Chair (CRC)

2 grant, and (3) Networks of Centres of Excellence of Canada (BioFuelNet).

4 Author contributions

5 D.M. conceived the study, formulated research plan, coordinated research team, carried out experiments,

6 performed result interpretation and data analysis, and drafted the manuscript. K.S., T.K., and S.K.

7 participated in the design of the study, helped to conduct experiments, performed result interpretation and

8 data analysis. D.A.C., M.M.Y., and C.P.C. conceived, planned, supervised, and managed the study, as well

9 as helped to draft the manuscript. All authors read and approved the final manuscript.

11 Competing financial interests

12 The authors declare no competing financial interests.

References Akawi, L., Srirangan, K., Liu, X., Moo-Young, M., Perry Chou, C., 2015. Engineering Escherichia coli for high-level production of propionate. Journal of Industrial Microbiology & Biotechnology. 42, 1057-1072. Amann, E., Ochs, B., Abel, K.-J., 1988. Tightly regulated tac promoter vectors useful for the expression of unfused and fused proteins in Escherichia coli. Gene. 69, 301-315. Anis, S. N. S., Mohamad Annuar, M. S., Simarani, K., 2017. In vivo and in vitro depolymerizations of intracellular medium-chain-length poly-3-hydroxyalkanoates produced by Pseudomonas putida Bet001. Preparative Biochemistry and Biotechnology. 47, 824-834. Arabolaza, A., Shillito, M. E., Lin, T.-W., Diacovich, L., Melgar, M., Pham, H., Amick, D., Gramajo, H., Tsai, S.-C., 2010. Crystal Structures and Mutational Analyses of Acyl-CoA Carboxylase β Subunit of Streptomyces coelicolor. Biochemistry. 49, 7367-7376. Baba, T., Ara, T., Hasegawa, M., Takai, Y., Okumura, Y., Baba, M., Datsenko, K. A., Tomita, M., Wanner, B. L., Mori, H., 2006. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol. 2, 1-11. Bevan, M. W., Franssen, M. C. R., 2006. Investing in green and white biotech. Nat Biotech. 24, 765-767. Biernacki, M., Riechen, J., Hähnel, U., Roick, T., Baronian, K., Bode, R., Kunze, G., 2017. Production of (R)-3-hydroxybutyric acid by Arxula adeninivorans. AMB Express. 7, 4. Cheng, K.-K., Wang, G.-Y., Zeng, J., Zhang, J.-A., 2013. Improved Succinate Production by Metabolic Engineering. BioMed Research International. 2013, 1-12. Cherepanov, P. P., Wackernagel, W., 1995. Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant. Gene. 158, 9-14. Datsenko, K. A., Wanner, B. L., 2000. One-step inactivation of chromosomal genes in Escherichia coli K- 12 using PCR products. Proceedings of the National Academy of Sciences. 97, 6640-6645. de Roo, G., Kellerhals, M. B., Ren, Q., Witholt, B., Kessler, B., 2002. Production of chiral R-3- hydroxyalkanoic acids and R-3-hydroxyalkanoic acid methylesters via hydrolytic degradation of polyhydroxyalkanoate synthesized by pseudomonads. Biotechnology and Bioengineering. 77, 717- 722. Erickson, B., Nelson, J. E., Winters, P., 2012. Perspective on opportunities in industrial biotechnology in renewable chemicals. Biotechnology Journal. 7, 176-185. Federsel, H.-J., 2005. Asymmetry on large scale: the roadmap to stereoselective processes. Nat Rev Drug Discov. 4, 685-697. Fischer, C. R., Tseng, H.-C., Tai, M., Prather, K. L. J., Stephanopoulos, G., 2010. Assessment of heterologous butyrate and butanol pathway activity by measurement of intracellular pathway intermediates in recombinant Escherichia coli. Applied Microbiology and Biotechnology. 88, 265- 275. Fonseca, A. C., Lima, M. S., Sousa, A. F., Silvestre, A. J., Coelho, J. F. J., Serra, A. C., 2019. Cinnamic acid derivatives as promising building blocks for advanced polymers: synthesis, properties and applications. Polymer Chemistry. 10, 1696-1723. Froese, D. S., Dobson, C. M., White, A. P., Wu, X., Padovani, D., Banerjee, R., Haller, T., Gerlt, J. A., Surette, M. G., Gravel, R. A., 2009. Sleeping beauty mutase (sbm) is expressed and interacts with ygfd in Escherichia coli. Microbiological Research. 164, 1-8. Gao, H.-J., Wu, Q., Chen, G.-Q., 2002. Enhanced production of d-(−)-3-hydroxybutyric acid by recombinant Escherichia coli. FEMS Microbiology Letters. 213, 59-65. Gibson, D. G., Young, L., Chuang, R.-Y., Venter, J. C., Hutchison, C. A., Smith, H. O., 2009. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Meth. 6, 343-345. Gonzalez, R., Murarka, A., Dharmadi, Y., Yazdani, S. S., 2008. A new model for the anaerobic fermentation of glycerol in enteric bacteria: Trunk and auxiliary pathways in Escherichia coli. 21

Metabolic Engineering. 10, 234-245. Gottschalk, G., 1986. Bacterial metabolism. Springer, New York. Haller, T., Buckel, T., Rétey, J., Gerlt, J. A., 2000. Discovering New Enzymes and Metabolic Pathways: Conversion of Succinate to Propionate by Escherichia coli. Biochemistry. 39, 4622-4629. Jobling, M. G., Holmes, R. K., 1990. Construction of vectors with the pl5a replicon, kanamycin resistance, inducible lacZα and pUC18 or pUC19 multiple cloning sites. Nucleic Acids Research. 18, 5315-5315. Jullesson, D., David, F., Pfleger, B., Nielsen, J., 2015. Impact of synthetic biology and metabolic engineering on industrial production of fine chemicals. Biotechnology Advances. 33, 1395-1402. Kornberg, H., Madsen, N., 1957. Synthesis of C4-dicarboxylic acids from acetate by a “glyoxylate bypass” of the tricarboxylic acid cycle. Biochimica et biophysica acta. 24, 651-653. Lau, N. S., Ch'ng, D. E., Chia, K. H., Wong, Y. M., Sudesh, K., 2014. Advances in Polyhydroxyalkanoate (PHA): Unraveling the Development and New Perspectives. Journal of Biobased Materials and Bioenergy. 9, 118-129. Martin, C. H., Prather, K. L. J., 2009. High-titer production of monomeric hydroxyvalerates from levulinic acid in Pseudomonas putida. Journal of Biotechnology. 139, 61-67. Matsumoto, K. i., Okei, T., Honma, I., Ooi, T., Aoki, H., Taguchi, S., 2013. Efficient (R)-3- hydroxybutyrate production using acetyl CoA-regenerating pathway catalyzed by coenzyme A transferase. Applied Microbiology and Biotechnology. 97, 205-210. Miller, J. H., 1992. A short course in bacterial genetics: a laboratory manual and handbook for Escherichia coli and related bacteria. Cold Spring Harbor Laboratory Press, NY. Mori, K., 1981. A simple synthesis of (S)-(+)-sulcatol, the pheromone of Gnathotrichus retusus, employing baker's yeast for asymmetric reduction. Tetrahedron. 37, 1341-1342. Murarka, A., Dharmadi, Y., Yazdani, S. S., Gonzalez, R., 2008. Fermentative utilization of glycerol by Escherichia coli and its implications for the production of fuels and chemicals. Appl Environ Microbiol. 74, 1124-1135. Nahar, L., Turner, A. B., Sarker, S. D., 2009. Synthesis of hydroxy acids of dinorcholane and 5²-cholane. Journal of the Brazilian Chemical Society. 20, 88-92. Nègre, D., Cortay, J.-C., Galinier, A., Sauve, P., Cozzone, A. J., 1992. Specific interactions between the IclR repressor of the acetate operon of Escherichia coli and its operator. Journal of molecular biology. 228, 23-29. Nielsen, J., Keasling, Jay D., 2016. Engineering Cellular Metabolism. Cell. 164, 1185-1197. Noyori, R., Kitamura, M., Ohkuma, T., 2004. Toward efficient asymmetric hydrogenation: Architectural and functional engineering of chiral molecular catalysts. Proceedings of the National Academy of Sciences of the United States of America. 101, 5356-5362. Perez-Zabaleta, M., Sjöberg, G., Guevara-Martínez, M., Jarmander, J., Gustavsson, M., Quillaguamán, J., Larsson, G., 2016. Increasing the production of (R)-3-hydroxybutyrate in recombinant Escherichia coli by improved cofactor supply. Microbial Cell Factories. 15, 1-10. Ren, Q., Ruth, K., Thöny-Meyer, L., Zinn, M., 2010. Enatiomerically pure hydroxycarboxylic acids: current approaches and future perspectives. Applied Microbiology and Biotechnology. 87, 41-52. Slater, S., Houmiel, K. L., Tran, M., Mitsky, T. A., Taylor, N. B., Padgette, S. R., Gruys, K. J., 1998. Multiple beta-ketothiolases mediate poly(beta-hydroxyalkanoate) copolymer synthesis in Ralstonia eutropha. Journal of bacteriology. 180, 1979-1987. Snell, K. D., Peoples, O. P., 2009. PHA bioplastic: A value-added coproduct for biomass biorefineries. Biofuels, Bioproducts and Biorefining. 3, 456-467. Sofeo, N., Hart, J. H., Butler, B., Oliver, D. J., Yandeau-Nelson, M. D., Nikolau, B. J., 2019. Altering the Substrate Specificity of Acetyl-CoA Synthetase by Rational Mutagenesis of the Carboxylate Binding Pocket. ACS Synthetic Biology. 8, 1325-1336. Spengler, J., Albericio, F., 2014. ChemInform Abstract: Asymmetric Synthesis of α-Unsubstituted β-

Hydroxy Acids. ChemInform. 45, 151-161. Srirangan, K., Akawi, L., Liu, X., Westbrook, A., Blondeel, E. J., Aucoin, M. G., Moo-Young, M., Chou, C. P., 2013. Manipulating the sleeping beauty mutase operon for the production of 1-propanol in engineered Escherichia coli. Biotechnology for Biofuels. 6, 139. Srirangan, K., Liu, X., Akawi, L., Bruder, M., Moo-Young, M., Chou, C. P., 2016a. Engineering Escherichia coli for microbial production of butanone. Applied and Environmental Microbiology. 82, 2574-2584. Srirangan, K., Liu, X., Tran, T. T., Charles, T. C., Moo-Young, M., Chou, C. P., 2016b. Engineering of Escherichia coli for direct and modulated biosynthesis of poly(3-hydroxybutyrate-co-3- hydroxyvalerate) copolymer using unrelated carbon sources. 6, 36470. Srirangan, K., Liu, X., Westbrook, A., Akawi, L., Pyne, M. E., Moo-Young, M., Chou, C. P., 2014. Biochemical, genetic, and metabolic engineering strategies to enhance coproduction of 1-propanol and ethanol in engineered Escherichia coli. Applied Microbiology and Biotechnology. 98, 9499-9515. Sunnarborg, A., Klumpp, D., Chung, T., LaPorte, D. C., 1990. Regulation of the glyoxylate bypass operon: cloning and characterization of iclR. Journal of Bacteriology. 172, 2642-2649. Taroncher-Oldenburg, G., Nishina, K., Stephanopoulos, G., 2000. Identification and Analysis of the Polyhydroxyalkanoate-Specific β-Ketothiolase and Acetoacetyl Coenzyme A Reductase Genes in the Cyanobacterium Synechocystis sp. Strain PCC6803. Applied and Environmental Microbiology. 66, 4440-4448. Thakker, C., Martínez, I., San, K.-Y., Bennett, G. N., 2012. Succinate production in Escherichia coli. Biotechnology journal. 7, 213-224. Toshiyuki, C., Takeshi, N., 1987. A New Synthetic Approach to the Carbapenem Antibiotic PS-5 from Ethyl (S)-3-Hydroxybutanoate. Chemistry Letters. 16, 2187-2188. Tseng, H.-C., Harwell, C. L., Martin, C. H., Prather, K. L., 2010. Biosynthesis of chiral 3-hydroxyvalerate from single propionate-unrelated carbon sources in metabolically engineered E. coli. Microbial Cell Factories. 9, 96. Tseng, H.-C., Martin, C. H., Nielsen, D. R., Prather, K. L. J., 2009. Metabolic Engineering of Escherichia coli for Enhanced Production of (R)- and (S)-3-Hydroxybutyrate. Applied and Environmental Microbiology. 75, 3137-3145. Weber, A. L., 1991. Origin of fatty acid synthesis: Thermodynamics and kinetics of reaction pathways. Journal of Molecular Evolution. 32, 93-100. Welton, T., 2015. Solvents and sustainable chemistry. Proceedings of the Royal Society A: Mathematical, Physical and Engineering Science. 471, 1-26. Williams, P. D., Perlow, D. S., Payne, L. S., Holloway, M. K., Siegl, P. K. S., Schorn, T. W., Lynch, R. J., Doyle, J. J., Strouse, J. F., 1991. Renin inhibitors containing conformationally restricted P1-P1' dipeptide mimetics. Journal of Medicinal Chemistry. 34, 887-900. Yazdani, S. S., Gonzalez, R., 2007. Anaerobic fermentation of glycerol: a path to economic viability for the biofuels industry. Current Opinion in Biotechnology. 18, 213-219. Yu, B. J., Sung, B. H., Lee, J. Y., Son, S. H., Kim, M. S., Kim, S. C., 2006. sucAB and sucCD are mutually essential genes in Escherichia coli. FEMS Microbiology Letters. 254, 245-250. Zheng, Z., Gong, Q., Liu, T., Deng, Y., Chen, J.-C., Chen, G.-Q., 2004. Thioesterase II of Escherichia coli Plays an Important Role in 3-Hydroxydecanoic Acid Production. Applied and Environmental Microbiology. 70, 3807-3813.

Figure captions

1. Schematic representation of natural and engineered pathways in E. coli using glucose or

glycerol as the carbon source. Proteins targeted for mutation are in red. Metabolic pathways

outlined: glycolysis, TCA cycle, fermentative/respiratory branch of glycerol utilization pathway

(in black); engineered 3-hydroxyacid pathways (in green); engineered Sleeping beauty mutase

pathway (in purple). Metabolite abbreviations: 3-HB, 3-hydroxybutyrate; 3-HV, 3-

hydroxyvalerate; ACE, acetaldehyde; Acetyl-P, acetyl-phosphate; DHA, dihydroxyacetone;

DHAP, dihydroxyacetone phosphate; Fructose-1,6-BP, fructose-1,6-bisphosphate; Fructose-6-P;

fructose-6-phosphate; G3P, glycerol-3-phosphate; Glucose-6-P; glucose-6-phosphate; PEP,

phosphoenolpyruvate. Protein abbreviations: AceA, isocitrate lyase; AceB, malate synthase A;

AceK, isocitrate dehydrogenase kinase/phosphatase; AckA, acetate kinase; AdhE, aldehyde-

alcohol dehydrogenase; ACN, aconitase; DhaKLM, dihydroxyacetone kinase; FrdABCD,

fumarate reductase complex; FumA, fumarate hydratase class I (aerobic); FumB, fumarate

hydratase class I (anaerobic); FumC, fumarate hydratase class II; GldA, glycerol dehydrogenase;

GlK, glucose kinase; GlpABC, anaerobic glycerol-3-phosphate dehydrogenase; GlpD, aerobic

glycerol-3-phosphate dehydrogenase; GlpK, glycerol kinase; GltA, citrate synthase; GPI, glucose-

6-phosphate isomerase; Hpr, phosphocarrier protein; ICD, isocitrate dehydrogenase; IclR,

AceBAK operon repressor; IDH, isocitrate dehydrogenase; IDH-P, isocitrate dehydrogenase-

phosphate; Ipd, lipoamide dehydrogenase; MDH, malate dehydrogenase; PckA,

phosphoenolpyruvate carboxykinase; PDH, pyruvate dehydrogenase; PFK, phosphofructokinase;

PFL, pyruvate formate lyase; PK, pyruvate kinase; PPC, phosphoenolpyruvate carboxylase; Pta,

phosphotransacetylase; PtsI, PTS enzyme I; Sbm, methylmalonyl-CoA mutase; SdhABCD,

succinate dehydrogenase complex; SucAB, 2-oxoglutarate dehydrogenase; SucCD, succinyl

coenzyme A synthetase; YgfG, (R)-methyl-malonyl-CoA carboxylase; YgfH, propionyl-CoA:

succinate CoA-transferase.

2. Schematic representation of engineered three-step 3-hydroxyacid pathways. Origin and

function of enzymes involved in the 3-hydroxyacid producing pathways can be found in Table 1.

Protein abbreviations: BktB, beta-ketothiolase; BktBαβ, PHA-specific beta-ketothiolase – alpha

and beta subunits; Buk, butyrate kinase; Hbd, beta-hydroxybutyryl-CoA dehydrogenase; Pct,

acetate/propionate CoA-transferase; PhaA, acetoacetyl-CoA thiolase; PhaB, acetoacetyl-CoA

dehydrogenase; Ptb, phosphotransbutyrylase; TesB, acyl-CoA thioesterase II.

3. Construction of 3-HV-producing strain from unrelated carbon source by engineering Sbm

and 3-hydroxyacid biosynthetic pathways. Strains compared are BW∆ldhA, BW∆ldhA-3HA11,

CPC-Sbm, and P3HA11. Top panel represents cell growth (OD600), glucose consumption, and 3-

HV yield (%) while bottom panel represents titers of 3-HB, 3-HV, even and odd-chain acids (i.e.,

acetate and propionate) and ethanol reached after 48h shake-flask cultivation. All values are

reported as means ± SD (n = 3).

4. Modular construction of 3-HV biosynthetic pathway by establishing efficient Claisen

condensation, reduction reaction, and CoA removing capabilities. Strains compared are

P3HA10, P3HA11, P3HA12, P3HA13, P3HA20, P3HA21, P3HA22, P3HA30, P3HA31,

P3HA32, and P3HA33. Panel represents titers of 3-HB and 3-HV 3-HV. Cells labeled with an

asterisk represent overexpressed genes. All values are reported as means ± SD (n = 3).

5. Effects of cultivation temperature and carbon source on 3-HV production in P3HA31. Top

panel represents cell growth (OD600), glucose/glycerol consumption, 3-HV yield (%), and total

odd-chain (i.e., 3-HV, propionate, and 1-propanol) yield (%) while bottom panel represents titers

of 3-HB, 3-HV, even and odd-chain acids (i.e., acetate and propionate) and ethanol reached after

48h shake-flask cultivation. All values are reported as means ± SD (n = 3).

6. Consolidating genetic and bioprocessing strategies for enhanced carbon flux toward

succinate in TCA cycle. Top panel represents cell growth (OD600), glycerol consumption, 3-HV

yield (%), and total odd-chain (i.e., 3-HV, and propionate) yield (%) while bottom panel represents

titers of 3-HB, 3-HV, even and odd-chain acids (i.e., acetate and propionate) and ethanol reached

after 48h shake-flask cultivation. All values are reported as means ± SD (n = 3).

Table captions 1. List of relative enzymes, their origin, and enzymatic functions in 3-hydroxyacid biosynthetic

pathway

Fig. 1:

Fig. 2:

Cell growth

)

a Glucose

) 20

(

) 6

d D

e 3-HV yield

(

( 15

d u

V r

l 3

c C u 5

l G ND ND ND 0 1.2 5 10 3-HB

p )

A 1

- 3-HV l

8 1.00 c

p g

e (

o Acetate

a r

t e

e t

a i

0.75 6 , t

Ethanol

e V

i H

t - a Propionate

e 3

0.50 4 r

(

& l

1 H

) - 0.25 2 3 ND ND ND ND ND ND ND 0.00 0 BWldhA BWldhA- CPC-Sbm P3HA11 3HA11 Sbm pathway Inactive Inactive Active Active 3-HA pathway steps 1. Claisen condensation n/a PhaA n/a PhaA 2. ESR n/a PhaB n/a PhaB 3. CoA removing enzyme n/a TesB n/a TesB

a Measured cell density after 48h cultivation using spectrophotometer (OD600), time 0h cell density was kept at ~5.00 b Defined as the percentage of the 3-HV theoretical yield based on the consumed glucose 3-HA 3-hydroxyacid ESR enantiomer specific reduction n/a not applicable ND not detected

Fig. 3:

1 .2 3 -H B 1 .0

0 .8 3 -H V

)

1 -

g 0 .3 5

(

t 0 .3 0

i t

V 0 .2 5

H -

0 .2 0 &

B 0 .1 5

H -

3 0 .1 0

0 .0 5

ND ND ND ND ND ND 0 .0 0 P 3 H A 1 0 P 3 H A 1 1 P 3 H A 1 2 P 3 H A 1 3 P 3 H A 2 0 P 3 H A 2 1 P 3 H A 2 2 P 3 H A 3 0 P 3 H A 3 1 P 3 H A 3 2 P 3 H A 3 3

phaA * * * * * * * * Step 1: Claisen bktB * * * * * * * * condensation bktBαβ * phaB Step 2: * * * * * * * * * ESR hbd * * * * * tesB * * * * * * * * Step 3: ptb-buk CoA removal * pct * 30 S ESR enantiomer specific reduction Fig. 4: ND not detected

3 5 2 0 3 0  C 3 7  C 3 0  C 3 7  C C e ll g ro w th

/ 1 8

) 1

- 3 0 l

a 1 6 G lu c o se )

t ) g

(

6 2 5

d 1 4 l

D G ly c e ro l e

( o

O m

( 1 2

o (

u 2 0

h 3 -H V y ie ld

l s

t d

1 0 h

n w

e o

)

i o

1 5 i T o ta l o d d -c h a in y ie ld c

n r

y 8

g e

l s

l 6 H

o 1 0

e -

c 3

d C

u 4 l 5 G 2 0 0 3 .0 8 3 -H B 7

p )

A 1 2 .5

- 3 -H V l

g 6 (

o A c e ta te

a r 2 .0

t e

e t 5

a i

, t

t E th a n o l

e V

1 .5 4 h

i H

t - a P ro p io n a te

e 3

o 3

(

l 1 .0 g 1 -P ro p a n o l ,

2 1 H

) -

3 0 .5 1

0 .0 0 P 3 H A 3 1 P 3 H A 3 1 P 3 H A 3 1 P 3 H A 3 1 a Measured cell density after 48h cultivation using spectrophotometer (OD600), time 0h cell density was kept at ~5.00 b Defined as the percentage of the 3-HV theoretical yield based on the consumed glucose c Defined as the percentage of the total odd-chain metabolites (i.e., propionate, 1-propanol, and 3-HV) theoretical yield based on the consumed glucose/glycerol

Fig. 5:

3 5 V e n t e d c a p 4 5

fla s k s C e ll g ro w th /

) 4 0 1

- 3 0 l

o G ly c e ro l

b a

g )

) 3 5 (

0 %

6 2 5

l 3 -H V y ie ld

o D

e 3 0

( o

O m

(

o T o ta l o d d -c h a in y ie ld ( u 2 0

2 5 h

l s

t d

n w

e o

2 0 )

i o

1 5 i c

o 1 5

l r

l H

1 0 e

e -

c 3

C 1 0 y l 5 G 5

N D N D 0 0

4 .0 6 3 -H B 3 .5

p )

A 1 5 3 -H V

- l

g 3 .0 (

t A c e ta te

a r 4

t e

e t 2 .5

a i

t E th a n o l

e V

2 .0 3 t

h H

- P ro p io n a te

e 3

o 1 .5

(

l 2 g

1 .0 1 H

) -

3 1 0 .5

N D N D 0 .0 0 P3HA31 P3HA31 P3HA31 P3HA31 P3HA31 P3HA31 P3HA31 P3HA31 P3HA31 P3HA31 +  frd B  aceA  frd B  sucD  sd hA  iclR  sd hA  sd hA S uccinate  aceA  iclR  iclR a Measured cell density after 48h cultivation using spectrophotometer (OD600), time 0h cell density was kept at ~5.00 b Defined as the percentage of the 3-HV theoretical yield based on the consumed glycerol/succinate c Defined as the percentage of the total odd-chain metabolites (i.e., propionate and 3-HV) theoretical yield based on the consumed ND not detected

Fig. 6:

Table 1:

3-HA pathway Enzyme(s) Gene(s) Source organism Function(s) (locus_tag)a 3-HB production 3-HV production Step 1: Acetoacetyl-CoA thiolase phaA Cupriavidus necator Homofusion of 2 acetyl- Heterofusion of acetyl-CoA and Claisen condensation (H16_RS07140) ATCC 43291 CoA moieties propionyl - CoA

β-ketothiolase bktB Cupriavidus necator Homofusion of 2 acetyl- Heterofusion of acetyl-CoA and (H16_A1445) ATCC 43291 CoA moieties propionyl - CoA

PHA-specific beta- bktBα Haloferax mediterranei Homofusion of 2 acetyl- Heterofusion of acetyl-CoA and ketothiolase alpha and beta (HFX_6004), ATCC 33500 CoA moieties propionyl - CoA subunits bktBβ (HFX_6003) Step 2: Acetoacetyl-CoA reductase phaB Cupriavidus necator Reduction of acetoacetyl- Reduction of 3-ketovaleryl-CoA Enantiomer-specific ((R)-3HB-CoA (H16_A1439) ATCC 43291 CoA to (R)-3HB-CoA to (R)-3HV-CoA reduction (ESR) dehydrogenase)+

β-hydroxybutyryl-CoA hbd Clostridium Reduction of acetoacetyl- Reduction of 3-ketovaleryl-CoA dehydrogenase (CA_C2708) acetobutylicum CoA to (S)-3HB-CoA to (S)-3HV-CoA ((S)-3HB-CoA ATCC 824 dehydrogenase) Step 3: Acyl-CoA thioesterase II tesB Escherichia coli Hydrolysis of (S) and Hydrolysis of (S) and (R)-3HV- CoA removal (AW869_16290) BW25141 (R)-3HB-CoA to racemic CoA to racemic 3-HV 3-HB

Phosphate butyryltransferase, ptb Clostridium Catalyze the conversion Catalyze the conversion of (R)-3- Butyrate kinase (CA_C3076), acetobutylicum of (R)-3-HB-CoA to (R)- HV-CoA to (R)-3-HV-P, buk ATCC 824 3-HB-P, dephosphorylation to (R)-3-HV (CA_C3075) dephosphorylation to (R)- 3-HB

Acetate/propionate CoA- pct Clostridum propionicum Removes CoA moieties Removes CoA moieties to transferase (CPRO_08400) DSM 1682 to generate racemic generate racemic 3-HB (reversible 3-HV (reversible reaction) reaction)

a Gene locus tags were obtained from the National Center for Biotechnology Information (NCBI) GenBank nucleotide database

Supplementary Materials

Title: Heterologous production of 3-hydroxyvalerate in engineered Escherichia coli

Authors: Dragan Miscevica, Kajan Sriranganb, Shane Kilpatricka, Duane A. Chungacd, Murray Moo-Younga, C. Perry Choua*

a Department of Chemical Engineering University of Waterloo Waterloo, Ontario, Canada N2L 3G1

b Biotechnology Research Institute National Research Council of Canada Montreal, Quebec, Canada H4P 2R2

c Department of Pathology and Molecular Medicine McMaster University Hamilton, Ontario, Canada L8S 4L8

d Neemo Inc. Hamilton, Ontario, Canada L8L 2X2

*Corresponding author: C. Perry Chou Department of Chemical Engineering University of Waterloo 200 University Avenue West Waterloo, Ontario, Canada N2L 3G1 Email: [email protected] Telephone: 1-519-888-4567 ext. 33310 Table S1: E. coli strains, plasmids, and oligonucleotides used in this study Name Description, relevant genotype or primer sequence (5’  3’)a Source(s) E. coli host strains DH5α F−, endA1, glnV44, thi-1, recA1, relA1, gyrA96, deoR, nupG φ80d lacZ∆acZd ladlacZYA – argF) U169, Lab stock hsdR17(rK-mK +), λ- BW25141 F-, ∆(araD-araB)567, ∆lacZ4787(::rrnB-3), ∆(phoB-phoR)580, λ-, galU95, ∆uidA3::pir + , recA1, endA9 (Datsenko and Wanner, (del-ins)::FRT, rph-1, ∆(rhaD-rhaB)568, hsdR514 2000) BW25113 F-, ∆(araD-araB)567, ∆lacZ4787(::rrnB-3), λ-, rph-1, ∆(rhaD-rhaB)568, hsdR514 (Datsenko and Wanner, 2000) BW∆ldhA BW25113 ldhA null mutant (Akawi et al., 2015; Srirangan et al., 2016a; Srirangan et al., 2014) BW∆ldhA-3HA11 BW∆ldhA/pTrc-PhaAB and pK-TesB This study CPC-Sbm BW∆ldhA, Ptrc::sbm (i.e., with the FRT-Ptrc cassette replacing the 204-bp upstream of the Sbm operon) (Akawi et al., 2015) P3HA10 CPC-Sbm/pTrc-PhaB and pK-TesB This study P3HA20 CPC-Sbm/pTrc-PhaA and pK-BktB-TesB This study P3HA30 CPC-Sbm/pTrc-PhaAB and pK- BktB-Hbd This study P3HA11 CPC-Sbm/pTrc-PhaAB and pK-TesB This study P3HA12 CPC-Sbm/pTrc-PhaB and pK-BktB-TesB This study P3HA13 CPC-Sbm/pTrc-PhaB and pK- BktBαβ-TesB This study P3HA21 CPC-Sbm/pTrc-PhaAB and pK-BktB-TesB This study P3HA22 CPC-Sbm/pTrc-PhaA and pK-BktB-Hbd-TesB This study P3HA31 CPC-Sbm/pTrc-PhaAB and pK- BktB-Hbd-TesB This study P3HA32 CPC-Sbm/ pTrc-PhaAB and pK-BktB-Hbd-Ptb-Buk This study P3HA33 CPC-Sbm/ pTrc-PhaAB and pK-BktB-Hbd-Pct This study P3HA31∆gldA gldA null mutant of P3HA31 This study P3HA31∆ptsI ptsI null mutant of P3HA31 This study P3HA31∆dhaKLM dhaKLM null mutant of P3HA31 This study P3HA31∆glpK glpK null mutant of P3HA31 This study P3HA31∆glpD glpD null mutant of P3HA31 This study P3HA31∆glpABC glpABC null mutant of P3HA31 This study P3HA31∆sdhA sdhA null mutant of P3HA31 This study P3HA31∆frdB frdB null mutant of P3HA31 P3HA31∆aceA aceA null mutant of P3HA31 P3HA31∆iclR iclR null mutant of P3HA31 This study P3HA31∆sdhA∆iclR sdhA and iclR null mutants of P3HA31 This study Plasmids pTrc99a ColE1 ori AmpR Ptrc (Amann et al., 1988) pK184 p15A ori, KmR, Plac::lacZ’ (Jobling and Holmes, 1990) pTrc-PhaA Derived from pTrc99a, Ptrc::phaA This study pTrc-PhaB Derived from pTrc99a, Ptrc::phaB This study pTrc-PhaAB Derived from pTrc99a, Ptrc::phaAB This study pK-TesB Derived from pK184, Plac::tesB This study pK-BktB-TesB Derived from pK184, Plac::bktB:tesB This study pK-BktBαβ-TesB Derived from pK184, Plac::bktBαβ:tesB This study pK-BktB-Hbd-TesB Derived from pK184, Plac::bktb:hbd:tesB Lab stock pK- BktB-Hbd Derived from pK184, Plac::bktb:hbd This study pK-BktB-Hbd-Ptb-Buk Derived from pK184, Plac::bktB:hbd:ptb:buk Lab stock pK-BktB-Hbd-Pct Derived from pK184, Plac::bktB:hbd:pct This study Primers v-ldhA GATAACGGAGATCGGGAATGATTAA; (Akawi et al., 2015) GGTTTAAAAGCGTCGATGTCCAGTA v-pta GGCATGAGCGTTGACGCAATCA; (Akawi et al., 2015) CAGCTGTACGCGGTGATACTCAGG v-adhE ATCAGGTGTCCTGAACTGTGCG; (Akawi et al., 2015) TTGACCAGCGCAAATAACCCGATGA v-glpK TGATTGGTCTACTGATTGCG; This study CCATATACATATCCGGCG v-glpD GTCAATGCTATAGACCACATC; This study ATTATTGAAGTTTGTAATATCCTTATCAC v-glpABC GATTAACAGCCTGATTCAGTGAG; This study AGCTCTATTTCTGCGGTTTC v-gldA ATTACTACACTTGGCACTGCTG; This study ATATCTTCGTGAACCAGTTTCTG v-dhaKLM ATCGAGGATAAACAGCGCA; This study TCTGATAAAGCTCTTCCAGTGT v-ptsI GGTTCAATTCTTCCTTTAGCG; This study CAGTTTGATCAGTTCTTTGATT g-phaA CCGGCTCGTATAATGTGTGGATGACTGACGTTGTCATCGTATCC; This study TACCGAGCTCGAATTCCTTATTTGCGCTCGACTG g-phaB TTCACACAGGAAACAGACATGACTCAGCGCATTGCGT; This study GGTACCGAGCTCGAATTCCATGTCAGCCCATATGCAGGCC g-phaAB CCGGCTCGTATAATGTGTGGATGACTGACGTTGTCATCGTATCC; This study ATTGTTATCCGCTCACAATTTCAGCCCATATGCAGGCCGC g-tesB ACAGGAAACAGCTATGACATGAGTCAGGCGCTAAA Lab stock GAGCTCGAATTCGTAATCATTAATTGTGATTACGCATCAC g-bktb CACAGGAAACAGCTATGACCATGACGCGTGAAGTGGTAGT; Lab stock TAAACAGACCTCCCTTAAATTTAATTCAGATACGCTCGAAGATGG g-hbd TTAAATTTAAGGGAGGTCTGTTTAATGAAAAAGGTATGTGTTATAGG; Lab stock TAACAAAGCTGCCGCAGTTATTTTGAATAATCGTAGAAACCTTT g-tesB2 GCTTTGTTACTGGAGAGTTATATGAGTCAGGCGCTAAAAA; This study GAGCTCGAATTCGTAATCATTAATTGTGATTACGCATCAC g-ptb-buk TAAAAGGGAGTGTACGACCAGTGATTAAGAGTTTTAATGAAATTATCAT; This study GAGCTCGAATTCGTAATCATTATTTGTATTCCTTAGCTTTTTCT g-pct TGATTAAGGAGGATTTTCGACAATGAGAAAGGTTCCCATTATTACC; This study GTACCGAGCTCGAATTCGTCAGGACTTCATTTCCTTCA g-bktBαβ CACAGGAAACAGCTATGACCATGGAAGTCGCAGTGATTGGC; This study AGACCTCCCTTAAATTTAATCTACACAGGGTCCCAGCGATAG g-bktB-tesB CACAGGAAACAGCTATGACCATGACGCGTGAAGTGGTAGT; This study CCTGACTCATATAACTCTCCTCAGATACGCTCGAAGATGG g-bktB-hbd ACAGGAAACAGCTATGACCATGACGCGTGAAGTGGTAG; This study TAACAAAGCTGCCGCAGTTATTTTGAATAATCGTAGAAAC g-bktB-hbd-pct CGAGGAGGATTTTCGACAATGAGAAAGGTTCCCATTATTAC; This study CGGGTACCGAGCTCGTCAGGACTTCATTTCCTTCAG g-pTrc-phaA CTGGCAGTCGAGCGCAAATAAAATTGTGAGCGGATAACAATTTCACA; This study TTATTTGCGCTCGACTGCCAGTGTGAAATTGTTATCCGCTCACAATT g-pTrc-phaB GCGGCCTGCATATGGGCTGATGGAATTCGAGCTCGGTACC; This study TACGCAATGCGCTGAGTCATCCACACATTATACGAGCCGGA g-pTrc-phaAB GCGGCCTGCATATGGGCTGATGGAATTCGAGCTCGGTACC; This study ACGATGACAACGTCAGTCATGTCTGTTTCCTGTGTGAAATTGTTATCCG g-pK-bktB GCCATCTTCGAGCGTATCTGATGATTACGAATTCGAGCTCGGTA; This study TCAGATACGCTCGAAGATGGCGAGCTCGAATTCGTAATCA g-pK-tesB GGTGATGCGTAATCACAATTAATGATTACGAATTCGAGCTCGG; This study TTTTTAGCGCCTGACTCATGGTCATAGCTGTTTCCTGTGT g-pK-bktB-tesB AAATTTAAGGGAGGTCTGTTTATGAGTCAGGCGCTAAAAA; This study CTACCACTTCACGCGTCATGGTCATAGCTGTTTCCTGTG g-pK-bktBαβ-tesB GCTGGGACCCTGTGTAGATGAGTCAGGCGCTAAAAA; This study CAATCACTGCGACTTCCATGGTCATAGCTGTTTCCTGTG g-pK-bktB-hbd ACAGGAAACAGCTATGACCATGACGCGTGAAGTGGTAG; This study CGAGCTCGAATTCGTAATCATTATTTTGAATAATCGTAGAAACCTTTT g-pK-bktB-hbd-ptb-buk AGAAAAAGCTAAGGAATACAAATAATGATTACGAATTCGAGCTCGGTAC; This study GTCGTACACTCCCTTTTACTTATTTTGAATAATCGTAGAAACCTTT g-pK-bktB-hbd-pct TGAAGGAAATGAAGTCCTGACGAATTCGAGCTCGGTAC; This study GTCGAAAATCCTCCTTAATCATTATTTTGAATAATCGTAGAAACCTTT g-pK-bktB-hbd-tesB GGTGATGCGTAATCACAATTAATGATTACGAATTCGAGCTCGG; Lab stock TACCACTTCACGCGTCATGGTCATAGCTGTTTCCTGTGTGAA

a bktB, beta-ketothiolase; bktBαβ, PHA-specific beta-ketothiolase – alpha and beta subunits; buk, butyrate kinase; dhaKLM, dihydroxyacetone kinase; frdB, fumarate reductase (subunit B); gldA, glycerol dehydrogenase; glpABC, anaerobic glycerol-3-phosphate dehydrogenase; glpD, aerobic glycerol-3-phosphate dehydrogenase; glpK, glycerol kinase; hbd, beta-hydroxybutyryl-CoA dehydrogenase; iclR, AceBAK operon repressor; lacZ, β-galactosidase (E. coli); ldhA, lactate dehydrogenase; pct, acetate/propionate CoA-transferase; phaA, acetoacetyl-CoA thiolase; phaB, acetoacetyl-CoA dehydrogenase; ptb, phosphotransbutyrylase; ptsI, PTS enzyme I; sdhA, succinate dehydrogenase complex (subunit A); sucD, succinyl coenzyme A synthetase (subunit D); tesB, acyl-CoA thioesterase II. AmpR, amplicillin resistance cassette; KmR, kanamycin resistance cassette.

Notation for primers: v-verification primer, c-cloning primer, and g-Gibson DNA assembly primer. Homology arms are in bold print.

Pathway implementation for heterologous 3-HV biosynthesis

Table S2: Construction of biosynthetic pathway for 3-hydorxyacid production in E. coli strains with activated and non-activated Sbm operon

3-HA pathway genes Cell Glucose Metabolites produced (g l-1)d Strain density consumed Claisen ESRa CoA (OD600)b (g)c 3-HB 3-HV Acetate Propionate Ethanol condensation removal Non-propanologenic BW∆ldhA ------13.9 23.4 ± 0.3 ND ND 4.13 ± 0.12 ND 3.89 ± 0.22 (59.43%) (0.00%) (0.00%) (26.93%) (0.00%) (32.50%) BW∆ldhA-3HA11 PhaA PhaB TesB 12.2 17.2 ± 0.9 0.94 ± 0.08 ND 4.55 ± 0.21 ND 0.07 ± 0.03 (50.71%) (9.55%) (0.00%) (40.36%) (0.00%) (0.80%) Propanologenic CPC-Sbm ------12.7 15.6 ± 0.4 ND ND 6.93 ± 0.16 0.17 ± 0.00 0.13 ± 0.01 (100.09%) (0.00%) (0.00%) (97.12%) (1.34%) (1.63%) P3HA11 PhaA PhaB TesB 12.0 18.3 ± 0.1 0.27 ± 0.03 0.03 ± 0.01 3.05 ± 0.03 0.14 ± 0.03 ND (52.21%) (4.72%) (0.46%) (46.53%) (0.49%) (0.00%)

a ESR enantiomer-specific reduction b Measured cell density after 48h cultivation using spectrophotometer (OD600), time 0h cell density was kept at ~5.00 c Consumed glucose after 48h cultivation (30 g l-1 initial concentration), glucose efficiency is presented in parentheses as a percentage value (%) d Metabolites produced (g l-1) after 48h cultivation, theoretical percent yield based on consumed glucose is presented in parentheses ND not detected

Manipulation of genes involved in 3-HV biosynthetic pathway

Table S3: Establishing an efficient Claisen condensation route towards biosynthesis of 3-HV

3-HA pathway genes Cell Glucose Metabolites produced (g l-1)d Strain density consumed Claisen ESRa CoA (OD600) (g)c 3-HB 3-HV Acetate Propionate Ethanol condensation removal b Control P3HA10 --- PhaB TesB 9.1 14.2 ± 0.5 ND ND 8.88 ± 0.03 0.10 ± 0.01 ND (96.28%) (0.00%) (0.00%) (95.41%) (0.87%) (0.00%) Individual ketothiolases

P3HA11 PhaA PhaB TesB 10.6 18.4 ± 0.1 0.27 ± 0.03 0.03 ± 0.01 3.05 ± 0.03 0.04 ± 0.03 ND (52.21%) (4.72%) (0.46%) (46.53%) (0.49%) (0.00%) P3HA12 BktB PhaB TesB 10.3 17.1 ± 0.3 0.29 ± 0.01 0.06 ± 0.02 8.11 ± 0.04 0.14 ± 0.06 0.17 ± 0.04 (78.82%) (2.96%) (0.54%) (72.36%) (1.01%) (1.94%) P3HA13 BktBαβ PhaB TesB 12.2 12.3 ± 0.9 0.20 ± 0.00 ND 7.46 ± 0.06 0.09 ± 0.02 ND (97.07%) (2.86%) (0.00%) (93.29%) (0.91%) (0.00%) Combined ketothiolases

P3HA21 PhaA + BktB PhaB TesB 13.5 17.9 ± 0.2 0.77 ± 0.12 0.11 ± 0.03 7.86 ± 0.11 0.17 ± 0.03 0.23 ± 0.05 (79.14%) (7.52%) (0.95%) (67.00%) (1.17%) (2.51%) a ESR enantiomer-specific reduction b Measured cell density after 48h cultivation using spectrophotometer (OD600), time 0h cell density was kept at ~5.00 c Consumed glucose after 48h cultivation (30 g l-1 initial concentration), glucose efficiency is presented in parentheses as a percentage value (%) d Metabolites produced (g l-1) after 48h cultivation, theoretical percent yield based on consumed glucose is presented in parentheses ND not detected

Table S4: Testing the reduction performance of ESDs for enhanced production of 3-HV

3-HA pathway genes Cell Glucose Metabolites produced (g l-1)e Strain density consumed b Claisen ESR CoA (OD600)c (g)d 3-HB 3-HV Acetate Propionate Ethanol condensation removal Control P3HA20 PhaA + BktB --- TesB 10.4 12.3 ± 0.4 0.08 ± 0.02 ND 7.17 ± 0.04 0.12 ± 0.04 0.18 ± 0.03 (94.14%) (1.14%) (0.00%) (88.94%) (1.20%) (2.86%) Individual ESDa P3HA21 PhaA + BktB PhaB TesB 13.5 17.9 ± 0.2 0.77 ± 0.12 0.11 ± 0.03 7.86 ± 0.11 0.17 ± 0.03 0.23 ± 0.05 (79.14%) (7.52%) (0.95%) (67.00%) (1.17%) (2.51%) P3HA22 PhaA + BktB Hbd TesB 10.6 15.6 ± 0.4 0.24 ± 0.02 0.04 ± 0.02 6.01 ± 0.14 0.15 ± 0.07 0.29 ± 0.02 (66.68%) (2.69%) (0.39%) (58.78%) (1.19%) (3.63%) Combined ESDs

P3HA31 PhaA + BktB PhaB + Hbd TesB 11.2 16.7 ± 1.4 1.07 ± 0.07 0.19 ± 0.03 5.84 ± 0.07 0.27 ± 0.04 0.87 ± 0.12 (78.48%) (11.20%) (1.75%) (53.35%) (1.99%) (10.19%)

a ESD enantiomer-specific dehydrogenase b ESR enantiomer-specific reduction c Measured cell density after 48h cultivation using spectrophotometer (OD600), time 0h cell density was kept at ~5.00 d Consumed glucose after 48h cultivation (30 g l-1 initial concentration), glucose efficiency is presented in parentheses as a percentage value (%) e Metabolites produced (g l-1) after 48h cultivation, theoretical percent yield based on consumed glucose is presented in parentheses ND not detected

Table S5: Comparing the effects of CoA removing enzymes with respect to 3-HV production

3-HA pathway genes Cell Glucose Metabolites Produced (g l-1)d

Strain a density consumed Claisen ESR CoA (OD600)b (g)c 3-HB 3-HV Acetate Propionate Ethanol condensation removal Control P3HA30 PhaA + BktB PhaB + Hbd --- 11.0 14.8 ± 0.6 ND ND 4.48 ± 0.08 0.03 ± 0.01 0.21 ± 0.08 (49.21%) (0.00%) (0.00%) (46.18%) (0.25%) (2.77%) Individual CoA removal genes P3HA31 PhaA + BktB PhaB + Hbd TesB 11.2 16.7 ± 1.4 1.07 ± 0.07 0.19 ± 0.03 5.84 ± 0.07 0.27 ± 0.04 0.87 ± 0.12 (78.48%) (11.20%) (1.75%) (53.35%) (1.99%) (10.19%) P3HA32 PhaA + BktB PhaB + Hbd Ptb-Buk 10.1 13.8 ± 0.6 0.74 ± 0.02 0.03 ± 0.02 6.52 ± 0.13 0.31 ± 0.04 0.61 ± 0.06 (93.20%) (9.37%) (0.33%) (72.08%) (2.77%) (8.64%) P3HA33 PhaA + BktB PhaB + Hbd Pct 10.2 15.2 ± 1.6 0.63 ± 0.02 0.02 ± 0.01 4.43 ± 0.47 0.28 ± 0.03 0.32 ± 0.04 (58.29%) (7.24%) (0.20%) (44.47%) (2.27%) (4.11%)

Bacterial cultivation for 3-HV production

Table S6: Enhancing biosynthesis of 3-HV and overall yield of odd-chain metabolites in P3HA31 by manipulating cultivation conditions (i.e., temperature and carbon source)

Cultivation Cell Carbon Metabolite produced (g l-1)c Overall yield of Strain temperature density consumed 3-HB 3-HV Acetate Propionate Ethanol 1-Propanol odd-chain a b d (°C) (OD600) (g) products (%) Glucose metabolic profile CPC-Sbm 30 13.5 28.7 ± 0.7 ND ND 4.36 ± 0.22 1.03 ± 0.02 0.04 ± 0.01 0.00 ± 0.00 4.42 (27.93%) (0.00%) (0.00%) (23.18%) (4.42%) (0.27%) (0.00%) 37 12.7 15.6 ± 0.4 ND ND 9.93 ± 0.16 0.17 ± 0.00 0.13 ± 0.01 ND 1.34 (100.09%) (0.00%) (0.00%) (97.12%) (1.34%) (1.63%) (0.00%) P3HA31 30 10.7 29.6 ± 0.1 2.30 ± 0.19 1.13 ± 0.49 1.28 ± 0.17 0.23 ± 0.01 0.28 ± 0.05 ND 6.84 (28.90%) (13.60%) (5.88%) (6.61%) (0.96%) (1.85%) (0.00%) 37 11.2 16.7 ± 1.4 1.07 ± 0.07 0.19 ± 0.03 5.84 ± 0.07 0.27 ± 0.04 0.87 ± 0.12 ND 3.74 (78.48%) (11.20%) (1.75%) (53.35%) (1.99%) (10.19%) (0.00%) Glycerol metabolic profile P3HA31 30 13.4 29.6 ± 0.3 2.41 ± 0.39 2.29 ± 0.12 2.26 ± 0.31 0.90 ± 0.10 0.28 ± 0.02 0.06 ± 0.05 16.31 (44.68%) (14.56%) (12.17%) (11.92%) (3.83%) (1.89%) (0.31%) 37 10.4 24.6 ± 1.2 1.96 ± 0.34 1.71 ± 0.18 5.03 ± 0.66 0.76 ± 0.12 0.89 ± 0.27 0.13 ± 0.03 15.63 (69.00%) (14.23%) (10.93%) (31.89%) (3.89%) (7.23%) (0.81%)

a Measured cell density after 48h cultivation using spectrophotometer (OD600), time 0h cell density was kept at ~5.00 b Consumed glucose or glycerol after 48h cultivation (30 g l-1 initial concentration), carbon source efficiency is presented in parentheses as a percentage value (%) c Metabolites produced (g l-1) after 48h cultivation, theoretical percent yield based on consumed glucose/glycerol is presented in parentheses d Calculated as the percent mole of carbon in odd-chain metabolites per mole of glucose or glycerol consumed ND not detected

Table S7: Comparison of 3-hydroxyacid production on several P3HA31 strains with disrupted glycerol utilization pathway

Cell Glycerol Metabolites produced (g l-1)c Strain density consumed a b (OD600) (g) 3-HB 3-HV Acetate Propionate Ethanol 1-Propanol Succinate P3HA31 13.4 29.6 ± 0.1 2.41 ± 0.39 2.29 ± 0.12 2.26 ± 0.31 0.90 ± 0.10 0.28 ± 0.02 0.06 ± 0.05 ND (44.68%) (14.56%) (12.17%) (11.92%) (3.83%) (1.89%) (0.31%) (0.00%) Glycerol metabolism - fermentative branch mutants P3HA31∆gldA 10.4 28.5 ± 0.1 2.99 ± 0.07 1.30 ± 0.01 2.47 ± 0.07 0.43 ± 0.03 0.31 ± 0.04 0.14 ± 0.01 ND (44.28%) (18.75%) (7.18%) (13.52%) (1.90%) (2.18%) (0.75%) (0.00%) P3HA31∆ptsI 10.7 27.7 ± 0.6 2.25 ± 0.12 0.83 ± 0.07 1.91 ± 0.08 0.69 ± 0.10 0.20 ± 0.01 0.13 ± 0.02 ND (35.24%) (14.50%) (4.71%) (10.74%) (3.14%) (1.44%) (0.72%) (0.00%) P3HA31∆dhaKLM 11.0 21.2 ± 0.8 2.12 ± 0.07 0.92 ± 0.05 5.75 ± 0.12 0.51 ± 0.04 0.46 ± 0.04 0.05 ± 0.03 ND (74.76%) (17.87%) (6.83%) (42.33%) (3.03%) (4.34%) (0.36%) (0.00%) Glycerol metabolism - respiratory branch mutants P3HA31∆glpK 10.7 7.5 ± 0.9 ND ND ND ND ND ND ND (0.00%) (0.00%) (0.00%) (0.00%) (0.00%) (0.00%) (0.00%) (0.00%) P3HA31∆glpD 9.5 5.9 ± 1.0 ND ND ND ND ND ND ND (0.00%) (0.00%) (0.00%) (0.00%) (0.00%) (0.00%) (0.00%) (0.00%) P3HA31∆glpABC 11.2 29.9 ± 0.1 2.53 ± 0.26 1.78 ± 0.11 0.87 ± 0.19 0.76 ± 0.01 0.17 ± 0.05 ND ND (33.40%) (15.14%) (9.37%) (4.54%) (3.21%) (1.14%) (0.00%) (0.00%)

a Measured cell density after 48h cultivation using spectrophotometer (OD600), time 0h cell density was kept at ~5.00 b Consumed glycerol after 48h cultivation (30 g l-1 initial concentration), glycerol efficiency is presented in parentheses as a percentage value (%) c Metabolites produced (g l-1) after 48h cultivation, theoretical percent yield based on consumed glycerol is presented in parentheses ND not detected

Metabolic engineering to enhance 3-HV production

Table S8: Comparison of metabolite production on several P3HA31 strains with disrupted TCA cycle genes

Cell Glycerol Metabolites produced (g l-1)c Strain density consumed (OD600)a (g)b 3-HB 3-HV Acetate Propionate Ethanol 1-Propanol Succinate

P3HA31 13.4 29.6 ± 0.1 2.41 ± 0.39 2.29 ± 0.12 2.26 ± 0.31 0.90 ± 0.10 0.28 ± 0.02 0.06 ± 0.05 ND (44.68%) (14.56%) (12.17%) (11.92%) (3.83%) (1.89%) (0.31%) (0.00%) With succinate supplementation P3HA31 14.1 30.5 ± 0.6 2.74 ± 0.04 2.81 ± 0.01 0.98 ± 0.02 1.43 ± 0.09 0.31 ± 0.02 ND ND (+2.50 g l-1 succinate) (39.83%)d (14.07%)d (13.60%)d (4.70%)d (5.55%)d (1.91%)d (0.00%)d (0.00%)d Oxidative TCA & glyoxylate cycle mutant P3HA31∆sdhA 14.9 31.1 ± 0.4 2.09 ± 0.17 1.81 ± 0.14 3.15 ± 0.26 0.97 ± 0.02 0.18 ± 0.04 ND ND (41.61%) (12.00%) (9.17%) (15.80%) (3.93%) (1.16%) (0.00%) (0.00%) P3HA31∆aceA 13.1 28.4 ± 0.4 2.61 ± 0.12 1.98 ± 0.11 1.82 ± 0.05 0.63 ± 0.04 0.24 ± 0.03 0.03 ± 0.01 ND (42.03%) (16.42%) (10.96%) (10.00%) (2.80%) (1.69%) (0.16%) (0.00%) P3HA31∆iclR 14.1 24.3 ± 0.2 2.69 ± 0.23 2.16 ± 0.07 1.67 ± 0.23 0.74 ± 0.07 0.13 ± 0.02 ND 0.15 ± 0.04 (49.77%) (19.78%) (13.98%) (10.72%) (3.84%) (1.07%) (0.00%) (0.96%) TCA cycle – reductive branch mutants P3HA31∆frdB 12.9 25.9 ± 0.7 2.58 ± 0.21 0.53 ± 0.06 0.18 ± 0.08 0.36 ± 0.01 0.16 ± 0.05 ND ND (25.08%) (17.79%) (3.22%) (1.08%) (1.75%) (1.23%) (0.00%) (0.00%) P3HA31∆sucD 14.7 27.5 ± 0.3 2.76 ± 0.18 ND 4.82 ± 0.09 ND 0.14 ± 0.02 ND ND (46.29%) (17.93%) (0.00%) (27.34%) (0.00%) (1.02%) (0.00%) (0.00%)

TCA cycle - double mutants

P3HA31∆aceA∆frdB 11.6 20.7 ± 0.4 3.02 ± 0.27 0.21 ± 0.09 1.52 ± 0.05 0.08 ± 0.01 0.23 ± 0.03 ND ND (41.82%) (26.07%) (1.60%) (11.45%) (0.49%) (2.22%) (0.00%) (0.00%)

P3HA31∆sdhA∆iclR 12.4 18.3 ± 0.3 2.98 ± 0.31 2.93 ± 0.03 2.81 ± 0.13 1.96 ± 0.06 ND 0.06 ± 0.01 0.27 ± 0.04 (94.52%) (29.09%) (25.18%) (23.95%) (13.50%) (0.00%) (0.50%) (2.30%) P3HA31∆sdhA∆iclR 17.1 24.2 ± 0.1 2.12 ± 0.16 3.71 ± 0.14 0.87 ± 0.11 2.97 ± 0.21 ND ND ND (vented flask caps) (60.84%) (15.65%) (24.11%) (5.61%) (15.47%) (0.00%) (0.00%) (0.00%)

a Measured cell density after 48h cultivation using spectrophotometer (OD600), time 0h cell density was kept at ~5.00 b Consumed glycerol after 48h cultivation (30 g l-1 initial concentration), glycerol efficiency is presented in parentheses as percentage value (%) c Metabolites produced (g l-1) after 48h cultivation, theoretical percent yield based on consumed glycerol is presented in parentheses d Theoretical percent yield based on combined moles of consumed glycerol and succinate ND not detected

Effects of glycerol dissimilation on 3-HV biosynthesis

In E. coli, glycerol is dissimilated either in the presence of external electron acceptors (i.e., respiratory branch) or in their absence (i.e., fermentative branch) (Murarka et al., 2008) (Fig. 1).

As glycerol was used as the major carbon source, various genes involved in glycerol dissimilation were manipulated to investigate their respective effects on 3-HV production (Fig. S1). Out of the three mutants with an inactivated gene in the fermentative branch, i.e., P3HA31∆gldA,

P3HA31∆ptsI, and P3HA31∆dhaKLM, only P3HA31∆dhaKLM showed a slight reduction in glycerol dissimilation with a significant increase in acetate secretion. Compared to the control strain P3HA31, the three mutants had reduced biosynthesis of 3-HV, while 3-HB biosynthesis was minimally affected. On the other hand, three mutants with an inactivated gene in the respiratory branch, i.e., P3HA31∆glpK, P3HA31∆glpD, and P3HA31∆glpABC, were also derived for characterization. Notably, the two mutants, i.e., P3HA31∆glpK and P3HA31∆glpD, displayed a significantly defective capacity in glycerol dissimilation compared to the control strain P3HA31 and failed to generate any metabolites during the cultivation period. The results suggest that the aerobic GlpK-GlpD route was critical for metabolite production from glycerol. On the other hand, glycerol dissimilation was hardly affected in the mutant strain P3HA31∆glpABC with a metabolic profile, including 3-hydroxyacid production, being similar to that of the control strain P3HA31. 3 5 1 8

C e ll g ro w th /

) 1 6 1

- 3 0

/ G ly c e ro l b

g )

) 1 4 (

0 %

l 6

2 5

d l

D 3 -H V y ie ld e 1 2

( o d

m (

o ( u 2 0

1 0 h

l T o ta l o d d -c h a in y ie ld

s t

h l

n w

e o

)

i 8 o

1 5 i c

o 6

r l

i H

1 0 e

e -

c 3

C 4 y

l 5 G 2 N D N D N D N D 0 0 3 . 5 8 3 -H B 7

p ) 3 .0

A 1

- 3 -H V l

g 6 (

2 .5

o A c e ta te

t e

e t 5

a i

, t

t E th a n o l 2 .0

e V

4 t

h H

t - a P ro p io n a te

1 .5 e 3

o 3

(

l g 1 -P ro p a n o l

B 1 .0

2 1 H

)

- 3 0 .5 1

N D N D N D N D N D N D N D N D 0 .0 0 P 3 H A 3 1 P 3 H A 3 1 P 3 H A 3 1 P 3 H A 3 1 P 3 H A 3 1 P 3 H A 3 1 P 3 H A 3 1  g ld A  p ts I  d h a K L M  g lp K  g lp D  g lp A B C

a Measured cell density after 48h cultivation using spectrophotometer (OD600), time 0h cell density was kept at ~5.00 b Defined as the percentage of the 3-HV theoretical yield based on the consumed glycerol c Defined as the percentage of the total odd-chain metabolites (i.e., propionate, 1-propanol, and 3-HV) theoretical yield based on the consumed ND not detected

Fig. S1: Effects of glycerol pathway knockouts on 3-HV production. Strains compared are P3HA31, P3HA31∆gldA, P3HA31∆ptsI, P3HA31∆dhaKLM, P3HA31∆glpK, P3HA31∆glpD, and P3HA31∆glpABC. Top panel represents cell growth (OD600), glycerol consumption, 3-HV yield (%), and total odd-chain (i.e., 3-HV, propionate, and 1-propanol) yield (%) while bottom panel represents titers of 3-HB, 3-HV, even and odd-chain acids (i.e., acetate and propionate) and alcohols (i.e., ethanol and 1-propanol) reached after 48h shake-flask cultivation. All values are reported as means ± SD (n = 3).