DOCSLIB.ORG

T Laysan Duck 3 Alan Cooper* Subfossil 1 Judith Rhymert Subfossil 2 Helen F

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
T Laysan Duck 3 Alan Cooper* Subfossil 1 Judith Rhymert Subfossil 2 Helen F SCIENTIFIC CORRESPONDENCE from two variable portions of the mito­ Ancient DNA and island endemics chondrial control region (133 and 312 base pairs, respectively). Comparison of Sm - Most recently extinct and currently migratory mallards (Anas platyrhynchos), a the sequences ( see figure) clearly shows endangered species of birds are inhabi­ perception that has greatly influenced the that the subfossil bones match those of tants of islands, where the effects of recovery programme of the Laysan duck7•8. the extant Laysan duck, indicating that the anthropogenic predation and habitat However, the relationships between the species was formerly widespread in the modification have been most severe1• three taxa were uncertain7•9• Recent genet­ Hawaiian islands. Recently, palaeontological records have ic studies have demonstrated that, while Late Holocene subfossils of Laysan shown that the effect of prehistoric the koloa is indeed closely related to mal­ ducks, including some bones of non-flying humans on insular biotas, particularly in lards, the Laysan duck is very distinct from juveniles, have been found in habitats the Pacific, were far more severe than pre­ either (J.R., unpublished data). varying from near sea level on the islands viously believed2-4, and that many extant Bones of small ducks occur in Late of Molokai, Oahu and Kauai to formerly flighted bird species that now appear to be Pleistocene and Holocene deposits in the forested areas at high elevations (60-1,800 endemic to single islands were previously chief Hawaiian islands3•10. Measurements m), far from permanent water, on Maui more widespread4. Here we report that of the lengths of the main long bones, with and Hawaii. Although the species was the combination of ancient DNA and sample sizes between 3 and 27, showed evidently widely adaptable, it is highly palaeontological techniques can provide the average lengths of the palaeontol­ unlikely that Laysan island (maximum information necessary for conservation ogical specimens to be intermediate altitude 12 m) presents an optimal habitat management of such a species, the endan­ between Laysan ducks and koloa (dns). for it. gered Laysan duck (Anas laysanensis). The bones could not be identified from The disappearance of the Laysan duck The Laysan duck is historically known these data because: (1) skeletal morphol­ everywhere but on Laysan island is only from the remote, small (370-hectare) ogy is poorly diagnostic in dabbling assumed to result from the same human­ island of Laysan in the northwestern ducks9; (2) other island ducks changed induced factors (hunting, habitat destruc­ Hawaiian chain, where its numbers have size during the Holocene 11 ; and (3) the tion, introduction of predators and varied between 20 and approximately 500 bones could represent an extinct taxon pathogens) that are blamed for the extinc­ over the past 70 years5·". Fewer than 150 distinct from either the koloa or Laysan tion of other taxa native to Pacific islands. survived drought conditions in 1993, illus­ duck. Our data justify the reintroduction of the trating the vulnerability of this population. To resolve the identity of the subfossil Laysan duck to parts of its former range in Both the Laysan duck and the Hawaiian duck bones, we used PCR (polymerase the main Hawaiian islands where adverse duck, or koloa (Anas wyvilliana ), were chain reaction) and ancient DNA tech­ factors can be controlled. This study once thought to be derived from stray niques12 to extract and sequence DNA demonstrates the value of using ancient DNA and palaeontological information to design recovery plans for endangered species and should provide a model that Laysan duck 1 can be adapted to many other threatened 100 Laysan duck 2 insular species in the Pacific and elsewhere. ------------t Laysan duck 3 Alan Cooper* Subfossil 1 Judith Rhymert Subfossil 2 Helen F. Jamest Storrs L. Olsont 99 Carl E. McIntosh* Koloa 1 Michael D. Sorenson* Koloa 2 Robert C. Fleischer* Koloa 3 *Molecular Genetics Laboratory, 63 National Zoological Park, ---------Mallard 1 Smithsonian Institution, African Washington, DC 20008, USA -----------------------black duck tDepartment of Biological Sciences, Clemson University, Clemson, South Carolina 29634, USA 0.12 0.09 0.06 0.03 0 'fDepartment of Vertebrate Zoology, Jukes-Cantor corrected distance National Museum of Natural History, Smithsonian Institution, 13 Neighbour-joining two-parameter-corrected distance tree obtained with MEGA . An identi­ Washington, DC 20560, USA cal topology is produced by parsimony analysis. with a consistency index of 0 .9 (PAUP 3.1.1; ref. 14), and bootstrap values from 1,000 replications are given. The control 1. Milberg, P. & Tyrberg, T. Ecography 16, 229- 250 (1993). 2. James. H. F. & Olson. S. L. Omith. Monogr. 45, Pt II. region sequences were amplified with PCR using primers: C1 (L 00078) 5'-GTTATTTGGT­ (Am. Ornith. Un., Washingt on DC, 1991). TATGCATATCGTG; C1R 2 (H 00390) 5'-CGATTAGTAAATCCATCTGGTAC; C2 (L 00736) 5'­ 3. Olson, S. L. & James, H. F. Omith. Monogr. 44, Pt I (Am. ATCTAAGCCTGGACACACCTG; t-Phe (H 01251) 5'-TGGCAGCTTCAGTGCCATGC; and GCDR Ornith. Un., Washington DC, 1991). 4. Steadman, D. Science 267, 1123-1131 (1995). (L 01117) 5'-TATTAGAGAAACTCCAGTAC , where the strand designat ion and 3' position in 5. Warner, R. E. Condor 65, 3-23 ( 1963). the published chicken sequence are given in parentheses. Sequences were obtained as 6. Marshall, A. P. Bird Conserv. Int. 2 , 239-251 (1994). described12 from an African black duck outgroup, two subfossils from different caves on 7. Weller, M. W. The Island Waterfowl (Iowa State Univ. Hawaii, and three koloa, three Laysan ducks and two genetically divergent mallards. Press, Ames, 1980). 8. Moulton, D. W. & Weller, M. W. Condor 86, 10 5- 117 Considerable genetic diversity has been detected within mallard tax a (J.R., unpublished (1984). data), so the two most divergent haplotypes are used in this analysis. The subfossil 9. Livezey, B. C. Wildfowl 44, 75-100 (1993). sequences were ext racted and amplified in Washington DC , in a dedicated laboratory in 10. Giffin, J. G. 'Elepaio 35, 1- 3 (1993). 11. Worthy, T. H.J. Zoo/. 215, 619--028 (1988). a remote building, before studies were carried out in both DC and South Carolina on 12. Cooper, A. in Ancient DNA (eds Herrmann, B. & Hummel, extant taxa. There were 366 homologous positions for all taxa, and 36 variable sites S.) 149-165 (Springer, New York, 1993). within the ingroups. The subfossil sequences clearly group with t he Laysan duck, and 13. Kumar, S., Tamura, K. & Nei, M . MEGA : Version 1.01 are genetically distant from the koloa and mallards. (Pennsylvania St . Univ., 1993). 14. Swofford, D. PAUP: Version 3.1.1 (Illinois Nat. Hist. Survey, Champaign. 1993). 484 Nb.TURE · VOL 381 · 6 JUNE 1996 .
Load more

Recommended publications
  • The Endemic Ducks of Remote Islands DAVID LACK Introduction with the Names and Measurements of the Resident Forms of Anas
    Ducks of remote islands 5 The endemic ducks of remote islands DAVID LACK Introduction with the names and measurements of the resident forms of Anas. On large islands This paper is concerned with all those and on islands near continents many ducks which have formed distinctive sub­ species of ducks coexist. For instance, 13 species restricted to one particular small species, 7 in the genus Anas, breed regu­ and remote island or archipelago. Only larly in Britain (Parslow 1967), 16 species, dabbling ducks in the genus Anas are 6 in the genus Anas, in Iceland (F. involved. Many species in this genus have Gudmundsson pers, com.), 8, 5 in the an extremely wide range, but the average genus Anas, in the Falkland Islands number of subspecies per species is as (Cawkell and Hamilton 1961) and 7, with low as 1.9 for the 38 species recognised 2 more in the nineteenth century, 4 in the by Delacour (1954-64). Hence the fact genus Anas, in New Zealand (Williams that nearly all the ducks on remote small 1964). Some of the Falklands and New islands are separate subspecies means that, Zealand forms are endemic, not so those for ducks, they belong to relatively of British or Iceland. Although the isolated populations. In contrast, on some various species of ducks look superficially of the archipelagos concerned, notably alike, especially when seen together in a the Hawaiian Islands and Galapagos, collection of living waterfowl, they have various of the land birds are distinctive in fact evolved an adaptive radiation species or even genera.
    [Show full text]
  • Effectiveness of Social Stimuli in Attracting Laysan Albatross to New Potential Nesting Sites
    EFFECTIVENESS OF SOCIAL STIMULI IN ATTRACTING LAYSAN ALBATROSS TO NEW POTENTIAL NESTING SITES RICHARD H. PODOLSKY • Universityof Michigan,School of Natural Resources,Ann Arbor,Michigan 48109 USA Al•sTRACT.--Seabirdcolonies usually grow as first-time breeders join existing groups. I testedthe hypothesisthat the presenceof conspecifics,specifically the sight and sound of establishedbreeders, was the stimulus responsiblefor first-time breeders to join existing colonies.The attractivepower of conspecificswas testedby presentingto conspecificsmodels of LaysanAlbatross (Diomedea immutabilis) in severalbehavior postures, with accompanying recordings of vocalizations. I found that Laysan Albatross landed more frequently in areas where both albatrossmodels and vocalizationswere present than in areaswith only visual stimuli or no vocal stimuli. Landing albatrossand those on the ground were found nearer to the artificial social stimuli than would be expectedfrom a random distribution. Three- dimensionalmodels were more attractivethan two-dimensionalmodels, and paired models were more attractive than single models for both three-dimensionaland two-dimensional models.Three-dimensional models in a sky-pointingposture were the mostattractive overall, whereas models in head-forward posture were the most attractive two-dimensional models. Albatrossexhibited courtshipbehavior closerto the modelsthan would be expectedfrom a random distribution. The implicationsof attraction to endangeredbird managementand restorationare discussed.Received 3 April 1989,accepted
    [Show full text]
  • MILLERBIRD Acrocephalus Familiaris Native Resident, Endemic, Endangered A.F
    MILLERBIRD Acrocephalus familiaris native resident, endemic, endangered A.f. familiaris (Laysan) Laysan subspecies extinct A.f. kingi (Nihoa) The Millerbird is an endemic resident in the Northwestern Hawaiian Islands (AOU 1998), having likely colonized the archipelago from Asia or other Pacific Island groups (Bryan 1940; Berger 1972, 1981; E 31:47). Acrocephalus warblers have widely colonized the Pacific Basin (Pratt et al. 1987, Wiles 2005, Cibois et al. 2011), and Millerbird has been found to be genetically distant from other Pacific congeners (AOU 1983, Fleischer et al. 2007), being the first to diverge from other taxa within a Polynesian clade (Cibois et al. 2011). Cassin (1858) followed by Dole (1869, 1879) reported an Acrocephalus warbler (as "Tatare otaiensis") in the marshes of Kaua'i and Hawai'i, which caused Rothschild (1900) and Bryan (1901a) to consider it a possibility on these islands, but Cassin was apparently referring to Acrocephalus caffer which is not found in Hawaii (see Tahiti Reed Warbler). No subfossil evidence exists for the occurrence of Acrocephalus in the Southeastern Hawaiian Islands (Olson and Ziegler 1995), which is curious given the genus' widespread distribution within the Pacific Basin (Bryan 1940). Two subspecies of Millerbird have been found, on Laysan and Nihoa, which are distinct and could be treated as different species (Wetmore 1924, Munro 1944, Olson and Ziegler 1995, Olson 1996b, Fleischer et al. 2007) but most regard them as subspecies (see Synonymies). See Banko (1979) for locations of 104 specimens of Millerbird, and Morin et al. (1997) for a summary of the natural history and biology of the species.
    [Show full text]
  • Albatross Or Mōlī (Phoebastria Immutabilis) Black-Footed Albatross Or Ka’Upu (Phoebastria Nigripes) Short-Tailed Albatross (Phoebastria Albatrus)
    Hawaiian Bird Conservation Action Plan Focal Species: Laysan Albatross or Mōlī (Phoebastria immutabilis) Black-footed Albatross or Ka’upu (Phoebastria nigripes) Short-tailed Albatross (Phoebastria albatrus) Synopsis: These three North Pacific albatrosses are demographically similar, share vast oceanic ranges, and face similar threats. Laysan and Black-footed Albatrosses nest primarily in the Northwestern Hawaiian Islands, while the Short-tailed Albatross nests mainly on islands near Japan but forages extensively in U.S. waters. The Short-tailed Albatross was once thought to be extinct but its population has been growing steadily since it was rediscovered in 1951 and now numbers over 3,000 birds. The Laysan is the most numerous albatross species in the world with a population over 1.5 million, but its trend has been hard to determine because of fluctuations in number of breeding pairs. The Black-footed Albatross is one-tenth as numerous as the Laysan and its trend also has been difficult to determine. Fisheries bycatch caused unsustainable mortality of adults in all three species but has been greatly reduced in the past 10-20 years. Climate change and sea level rise are perhaps the greatest long-term threat to Laysan and Black-footed Albatrosses because their largest colonies are on low-lying atolls. Protecting and creating colonies on higher islands and managing non-native predators and human conflicts may become keys to their survival. Laysan, Black-footed, and Short-tailed Albatrosses (left to right), Midway. Photos Eric VanderWerf Status
    [Show full text]
  • THE HAWAIIAN-EMPEROR VOLCANIC CHAIN Part I Geologic Evolution
    VOLCANISM IN HAWAII Chapter 1 - .-............,. THE HAWAIIAN-EMPEROR VOLCANIC CHAIN Part I Geologic Evolution By David A. Clague and G. Brent Dalrymple ABSTRACT chain, the near-fixity of the hot spot, the chemistry and timing of The Hawaiian-Emperor volcanic chain stretches nearly the eruptions from individual volcanoes, and the detailed geom­ 6,000 km across the North Pacific Ocean and consists of at least etry of volcanism. None of the geophysical hypotheses pro­ t 07 individual volcanoes with a total volume of about 1 million posed to date are fully satisfactory. However, the existence of km3• The chain is age progressive with still-active volcanoes at the Hawaiian ewell suggests that hot spots are indeed hot. In the southeast end and 80-75-Ma volcanoes at the northwest addition, both geophysical and geochemical hypotheses suggest end. The bend between the Hawaiian and .Emperor Chains that primitive undegassed mantle material ascends beneath reflects a major change in Pacific plate motion at 43.1 ± 1.4 Ma Hawaii. Petrologic models suggest that this primitive material and probably was caused by collision of the Indian subcontinent reacts with the ocean lithosphere to produce the compositional into Eurasia and the resulting reorganization of oceanic spread­ range of Hawaiian lava. ing centers and initiation of subduction zones in the western Pacific. The volcanoes of the chain were erupted onto the floor of the Pacific Ocean without regard for the age or preexisting INTRODUCTION structure of the ocean crust. Hawaiian volcanoes erupt lava of distinct chemical com­ The Hawaiian Islands; the seamounts, hanks, and islands of positions during four major stages in their evolution and the Hawaiian Ridge; and the chain of Emperor Seamounts form an growth.
    [Show full text]
  • Notes on the Birds Peculiar to Laysan Island, Hawaiian Group
    3S4 V'lS,•ER,Birds of La),san Island. FL AukOct. NOTES ON THE BIRDS PECULIAR TO LAYSAN ISLAND, HAWAIIAN GROUP. 1 BY WALTER K. FISHER. •ølates x_,r_,r-x WE DOnot naturally associateland birds with tiny coral atolls in tropicalseas. It is thereforea strangefact that sucha diminu- tive island as Laysan, and one so remote from continentalshores, should harbor no less than five peculiar species: the Laysan Finch (]klespiza cantans) and Honey-eater (I-Iima•ione freethi), both • drepanidid' birds, the Miller Bird (.4crocefihalusfamiliaris), the LaysanRail (?orzanulapalmeri),and lastly the LaysanTeal (•tnas laysanensis).I usethe term ' land birds' loosely,in con- tradistinctionto sea-fowl,multitudes of which breed here through- out the year. The presenceof these speciesis all the more remarkablebecause none appear on neighboringislands, more or less distant, someof which are very similar to Laysan in structure and flora. Reachingout towardJapan from the main Hawaiian group is a long chainof volcanicrocks, atolls,sand-bars• and sunkenreefs, all insignificantin size and widely separated. The last islet is fully two thousandmiles from Honolulu and about half-way to Yokohama. Beginningat the east,the more importantmembers of this chain are: Bird Island and Necker (tall volcanicrocks), French Frigate Shoals, Gardner Rock, Laysan, Lisiansky, Mid- way, Cure, and Motell. Laysanis eighthundred miles northwest- by-westfrom Honolulu,and is perhapsbest knownas beingthe home of countless albatrosses. We sightedthe island early one morning in May, lying low on the horizon,with a great cloud of sea-birdshovering over it. On all sides the air was lively with terns, albatrosses,and boobies, •These notes were made during a visit of the Fish Commissionsteamer ' Albatross' to Laysan, May 17 to 23, 19o2, and are abridged from a more extendedreport on the avifauna of the i•land• to appearin the Bulletin of the U.S.
    [Show full text]
  • Handbook of Waterfowl Behavior: Tribe Anatini (Surface-Feeding Ducks)
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Handbook of Waterfowl Behavior, by Paul Johnsgard Papers in the Biological Sciences January 1965 Handbook of Waterfowl Behavior: Tribe Anatini (Surface-feeding Ducks) Paul A. Johnsgard University of Nebraska-Lincoln, [email protected] Follow this and additional works at: https://digitalcommons.unl.edu/bioscihandwaterfowl Part of the Ornithology Commons Johnsgard, Paul A., "Handbook of Waterfowl Behavior: Tribe Anatini (Surface-feeding Ducks)" (1965). Handbook of Waterfowl Behavior, by Paul Johnsgard. 16. https://digitalcommons.unl.edu/bioscihandwaterfowl/16 This Article is brought to you for free and open access by the Papers in the Biological Sciences at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Handbook of Waterfowl Behavior, by Paul Johnsgard by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Subfamily Anatinae 125 Aix. During extreme excitement the male will often roll his head on his back, or even bathe. I have not observed Preening-behind-the- wing, but W. von de Wall (pers. comm.) has observed a male per- form it toward a female. Finally, Wing-flapping appears to be used as a display by males, and it is especially conspicuous because each sequence of it is ended by a rapid stretching of both wings over the back in a posture that makes visible the white axillary feathers, which contrast sharply with the black underwing surface. Copulatory behavior. Precopulatory behavior consists of the male swimming up to the female, his neck stretched and his crest de- pressed, and making occasional Bill-dipping movements. He then suddenly begins to perform more vigorous Head-dipping movements, and the female, if receptive, performs similar Bill-dipping or Head- dipping movements.
    [Show full text]
  • Genetic Divergence Among Populations of the Hawaiian Duck, Laysan Duck, and Mallard
    The Auk 110(1):49-56, 1993 GENETIC DIVERGENCE AMONG POPULATIONS OF THE HAWAIIAN DUCK, LAYSAN DUCK, AND MALLARD ROBERT A. BROWNE,• CURTICE R. GRIFFIN, 2 PAUL R. CHANG, 2 MARK HUBLEY, • AND AMY E. MARTIN s •Departmentof Biology,Wake Forest University, Winston-Salem, North Carolina27109, USA; and 2Departmentof Forestryand Wildlife Management, University of Massachusetts,Amherst, Massachusetts 01003, USA ABSTRACr.--Allozymicvariation at 20 gene loci was estimatedfor populationsof the Laysan Duck (Anaslaysanensis) and the Hawaiian Duck (A. wyvilliana)from the Hawaiianarchipelago, as well as for Mallard populations(A. platyrhynchos)from Hawaii and North America. The Laysan Duck and Hawaiian Duck are endemic, have experiencedsevere bottlenecks,and are listed as endangered species.Alternative alleles are fixed at six loci for Mallards versus Hawaiian anatids (Hawaiian and Laysan ducks). In contrast,every allelic variant found in the Laysan Duck was present in the Hawaiian Duck (but not vice versa), suggestingthe formeris an offshootof the latter.The geneticdistance (Nei's D) betweenLaysan and Hawaiian ducks is lessthan 0.01, while that between both Hawaiian and Laysan ducks and Mallards is greater than 0.45. The allozymic evidence also suggeststhat there has been extensive hy- bridization between Mallards and Hawaiian Ducks on Oahu, with the near disappearanceof Hawaiian Duck alleles.However, there is only slight evidenceof Mallard genic introgression into the Hawaiian Duck population on Kauai. Finally, the allozymic data suggestthat the Hawaiian Duck is a distinctspecies from the Mallard, but that little geneticdivergence has occurredbetween Hawaiian and Laysanducks. Received 25 July 1991,accepted 8 March 1992. THERESULTS of evolutionary processeson oce- and maintenance of populations of Hawaiian anic islands are evident in the Hawaiian avi- Ducks on Oahu and Hawaii relied on progeny fauna, which exhibits striking examples of from relatively few captive-reared birds.
    [Show full text]
  • THE FORAGING ECOLOGY, HABITAT USE, and POPULATION DYNAMICS of the LAYSAN TEAL (Anas Laysanensis)
    THE FORAGING ECOLOGY, HABITAT USE, AND POPULATION DYNAMICS OF THE LAYSAN TEAL (Anas laysanensis) by Michelle H. Reynolds A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biology Virginia Polytechnic Institute and State University Approved by Jeffery R. Walters, Committee chair Curtis Adkisson, Committee member E. F. Benfield, Committee member James Fraser, Committee member William Steiner, Committee member Defense date October 31, 2002 Blacksburg, VA Keywords: Anas laysanensis, foraging ecology, habitat use, population estimate, survival, island waterfowl, Laysan Island THE FORAGING ECOLOGY, HABITAT USE, AND POPULATION DYNAMICS OF THE LAYSAN TEAL (Anas laysanensis) Michelle H. Reynolds ABSTRACT The Laysan teal, an endangered species, is restricted to a single population on Laysan Island, a remote atoll of the Hawaiian archipelago. Little is known of the Laysan teal’s ecology, therefore, I examined food habits, habitat use, and population dynamics. These aspects of its ecology are fundamental to the species management and conservation. I described diel and nocturnal habitat use, home range, and foraging with radio telemetry in 1998-2000. Most individuals showed strong site fidelity during the tracking period, but habitat selection varied between individuals. Mean home range size was 9.78 ha (SE 2.6) using the fixed kernel estimator (95% kernel; 15 birds with >25 locations). Foraging was strongly influenced by time of day: birds spent only 4% of their time foraging in the day, but spent 45% of their time foraging at night. Time activity budgets from the island’s four habitat zones indicated that the coastal zone was rarely used for foraging.
    [Show full text]
  • Northwestern Hawaiian Islands/Kure Atoll Assessment and Monitoring Program
    Northwestern Hawaiian Islands/Kure Atoll Assessment and Monitoring Program Final Report March 2002 Grant Number NA070A0457 William j. Walsh1, Ryan Okano2, Robert Nishimoto1, Brent Carman1. 1 Division of Aquatic Resources 1151 Punchbowl Street Rm. 330 Honolulu, HI 96813 2 Botany Department University of Hawai`i Mānoa Honolulu, HI 96822 2 INTRODUCTION The Northwest Hawaiian Islands (NWHI) consist of 9,124 km2 of land and approximately 13,000 km2 of coral reef habitat. They comprise 70% of all coral reef areas under U.S. jurisdiction. This isolated archipelago of small islands, atolls, reefs and banks represent a unique and largely pristine coral reef ecosystem. The islands support millions of nesting seabirds and are breeding grounds for the critically endangered Hawaiian monk seal and threatened green sea turtle. The reefs include a wide range of habitats and support a diverse assemblage of indigenous and endemic reef species, many of which have yet to be described. Kure Atoll, located at the northwestern end of the NWHI chain (approximately 28º 25’ N latitude and 178º 20’ W longitude) is the northernmost atoll in the world. The atoll is located 91 km northwest of Midway Islands and nearly 1,958 km northwest of Honolulu. It is a nearly circular atoll with a diameter of 10 km (6mi). The outer reef is continuous Figure 1. IKONOS satellite image of Kure Atoll 3 and almost encircles the atoll’s lagoon except for passages to the southwest (Fig. 1). An emergent rock ledge consisting primarily of coralline algae and algally bound and encrusted coral is present along some sections of the reef crest.
    [Show full text]
  • Endangered Millerbird Population on Hawai'i's Laysan Island Doubles To
    NEWS RELEASE CONTACT FOR IMMEDIATE RELEASE USFWS: Ken Foote 808-792-9535 or 808-282-9442 . June 24, 2013 American Bird Conservancy (ABC): Bob Johns 202-234-7181 or Chris Farmer 808-987-1779 Endangered Millerbird Population on Hawai‘i's Laysan Island Doubles to More Than 100 Historic Translocation Efforts Securing Future for Species (Honolulu, Hawaii, June 24, 2013) The latest count of endangered Millerbirds on Hawai‘i's Laysan Island found that the bird’s population has doubled – to over 100 – from the original total of 50 translocated birds released by the U.S. Fish and Wildlife Service (FWS), American Bird Conservancy (ABC), and others in 2011 and 2012. The translocation program was initiated several years ago, when all of the world’s remaining Millerbirds -- between 400 and 600 at that time -- were limited to the island of Nihoa in the remote Northwestern Hawaiian Islands. By moving some of the birds to a second island, Laysan, approximately 650 miles northwest of Nihoa, the Millerbird team hoped to reduce the high risk of extinction from catastrophes such as severe storms, droughts, fires, and accidental introduction of alien species such as rats, mosquitos, and/or diseases such as avian pox and malaria. Establishing a second population reduces this risk by increasing the population size and distribution. The translocation of the Nihoa Millerbird to Laysan also serves another purpose. It re-establishes the link in the ecosystem that was lost about 100 years ago when the closely-related Laysan Millerbird went extinct. In the highly successful first phase of the translocation effort, 24 Millerbirds were moved 650 miles from Nihoa to Laysan in September 2011.
    [Show full text]
  • Potential Effects of Sea Level Rise on the Terrestrial Habitats of Endangered and Endemic Megafauna in the Northwestern Hawaiian Islands
    Vol. 2: 21–30, 2006 ENDANGERED SPECIES RESEARCH Printed December 2006 Previously ESR 4: 1–10, 2006 Endang Species Res Published online May 24, 2006 Potential effects of sea level rise on the terrestrial habitats of endangered and endemic megafauna in the Northwestern Hawaiian Islands Jason D. Baker1, 2,*, Charles L. Littnan1, David W. Johnston3 1Pacific Islands Fisheries Science Center, National Marine Fisheries Service, NOAA, 2570 Dole Street, Honolulu, Hawaii 96822, USA 2University of Aberdeen, School of Biological Sciences, Lighthouse Field Station, George Street, Cromarty, Ross-shire IV11 8YJ, UK 3Joint Institute for Marine and Atmospheric Research, 1000 Pope Road, Honolulu, Hawaii 96822, USA ABSTRACT: Climate models predict that global average sea level may rise considerably this century, potentially affecting species that rely on coastal habitat. The Northwestern Hawaiian Islands (NWHI) have high conservation value due to their concentration of endemic, endangered and threatened spe- cies, and large numbers of nesting seabirds. Most of these islands are low-lying and therefore poten- tially vulnerable to increases in global average sea level. We explored the potential for habitat loss in the NWHI by creating topographic models of several islands and evaluating the potential effects of sea level rise by 2100 under a range of basic passive flooding scenarios. Projected terrestrial habitat loss varied greatly among the islands examined: 3 to 65% under a median scenario (48 cm rise), and 5 to 75% under the maximum scenario (88 cm rise). Spring tides would probably periodically inun- date all land below 89 cm (median scenario) and 129 cm (maximum scenario) in elevation. Sea level is expected to continue increasing after 2100, which would have greater impact on atolls such as French Frigate Shoals and Pearl and Hermes Reef, where virtually all land is less than 2 m above sea level.
    [Show full text]