Blocking VRK2 Suppresses Pulmonary Adenocarcinoma Progression Via ERK1/2/AKT Signal Pathway by Targeting Mir-145-5P

European Review for Medical and Pharmacological Sciences 2021; 25: 145-153 Blocking VRK2 suppresses pulmonary adenocarcinoma progression via ERK1/2/AKT signal pathway by targeting miR-145-5p

Y.MU, W.-J. LIU, L.-Y. BIE, X.-Q. MU, Y.-Q. ZHAO

Department of Oncology, Affiliated Cancer Hospital of Zhengzhou University/Henan Cancer Hospital, Zhengzhou, Henan Province, China

Abstract. – OBJECTIVE: The incidence of Introduction pulmonary adenocarcinoma locates first in all the malignant tumors in the world. At present, Lung cancer is accounting for 27% of all ma- there are many diagnostic methods for pulmo- lignant tumors in the world1,2. Lung cancer is nary adenocarcinoma, but there are a few meth- split into small cell lung cancer and non-small ods that are mature or have ideal application prospects. We aim to explore the role of VRK2 cell lung cancer, of which non-small cell lung in the occurrence and development of pulmo- cancer accounts for about 80%. Compared with nary adenocarcinoma and its possible regulato- other types of lung cancer, non-small cell lung ry mechanism. cancer (NSCLC) has a relatively high degree of PATIENTS AND METHODS: Western blot and malignancy, proliferation, and migration3,4. In qRT-PCR were performed to assess the expres- recent years, in addition to improving the ther- sion of VRK2. Flow cytometry, Western blot, and apy of tumor patients, it has become a hot spot Caspase-3 colorimetric assay Kit were used to of pulmonary adenocarcinoma research to find evaluate the apoptosis level. The proliferation, migration, and invasion ability were measured novel markers that can effectively guide the early via cell cycle assay, wound healing, and tran- clinical diagnosis. swell invasion assay. Luciferase assay verified Vaccinia-related kinase 2 (VRK2) belongs to the relationship between VRK2 and miR-145-5p. the vaccinia-related kinase (VRK) family of ser- The effect of FGD5-AS1 on tumorigenesis of gli- ine/threonine protein kinases5,6. VRK2 involved oma was detected by the xenograft nude mice in apoptosis and tumor cell growth progression. model. RESULTS: It was reported that VRK2 plays a crucial role in VRK2 was significantly increased 7 in tumor tissues and cell lines. Loss of VRK2 schizophrenia . The VRK2-Akt complex could promoted apoptosis level and inhibited the pro- regulate cellular proliferation and perform onco- 8 liferation, migration, and invasion in A549 cells genic activity . VRK2 could promote the human via regulating the ERK1/2/AKT signal pathway. breast cell line via activation of NFAT1 and Luciferase assay reported that VRK2 could bind upregulation of the level of cyclooxygenase-29,10. with miR-145-5p. The level of miR-145-5p was Downregulation of VRK2 could increase the lev- negatively correlated with the expression of el of BAX gene, which acted as a novel meditator VRK2 and involved in VRK2 regulating tumor of apoptosis11,12. VRK2 also fixed KSR1-MEK1in progression. The tumor growth assay showed that the silencing of VRK2 inhibited tumorigen- endoplasmic reticulum forming a complex, which esis with the inactivating ERK1/2/AKT pathway. can have a modulatory effect on the signal medi- CONCLUSIONS: Knockdown of VRK2 inhib- ated by MAPK13. However, the role of VRK2 in ited the development of pulmonary adenocar- pulmonary adenocarcinoma has not been eluci- cinoma via regulating the ERK1/2/AKT signal dated, which requires further investigation. pathway by targeting miR-145-5p, which provid- MicroRNA (miRNA) is a class of non-coding some novel experimental basis for clinical ing small molecule RNA, which commonly ex- treatment of pulmonary adenocarcinoma. ists in prokaryotes and eukaryotes14. They are associated with the occurrence, development, Key Words: invasion, and metastasis of various human tu- Pulmonary adenocarcinoma, VRK2, MiRNA, Prolif- mors14,15. We predicted that VRK2 could inter- eration,RETRACTED Metastasis. act with miRNA-145-5p. It was reported that

Corresponding Author: Yanqiu Zhao, MD; e-mail: [email protected] 145 Y. Mu, W.-J. Liu, L.-Y. Bie, X.-Q. Mu, Y.-Q. Zhao circRNA CEP128 could sponge miR-145-5p in CACTCACC3’; MiRNA-NC: 5’ATTGGAAC- accelerating the development of bladder cancer GATACA GAGAAGATT3’/5’G GAAC- by controlling SOX116 and Myd88/MAPK signal GCTTCACGAATTTG3’. AMO-miRNA-145- pathway17. MiR-145-5p regulates the differenti- 5p: 5’TAG GTCAAGACTCCCCCGA 3’; AMO- ation progression of gastric cancer via KLF517. NC: 5’TAGGTCAAGAGACTCCCCCGA3’. LncRNA SNHG1 acts as a sponge of miR- 145-5p promotes the development of NSCLC qRT-PCR via promoting MTDH expression18. MiR-145-5p RNA isolation, reverse transcription, and also inhibits EMT progression via MAP3K/ quantitative expression were carried accord- JNK signaling pathway in NSCLC cells19. In ing to the manufacturer’s instructions. Total this research, we observed that VRK2 was a RNA was collected from tumor or NSCLC target of miR-145-5p, and positively correlated cells using TRIzol reagent (Invitrogen, CA, with miR-145-5p, which regulates the pathways USA), DNA was reversed transcription using of EKR 1/2 and AKT to affect the process of a High Capacity cDNA Reverse Transcription pulmonary adenocarcinoma. Kit (Qiagen, Shanghai, China). Real-Time PCR program is set to 40 cycles. After the program finished, the relative mRNA levels were calculated based on the Ct values and normalized to Patients and Methods the GAPDH/U6 level in each sample. Gene level was calculated using the 2-ΔΔCt method. The Clinical Samples primer sequences were as follows: VRK2: For- The tumor tissue samples and adjacent normal ward: 5′-AGTGAGAGAAGCGCTGAGTCCT-3′; tissue samples were collected from 60 NSCLC Reverse: 5′-CAAAGGTTCTTGAGACTCTTG-3′. patients at Affiliated Cancer Hospital of Zheng- GAPDH: Forward: 5′-GGTCTTACTCCTTG- zhou University. The present study was support- GAGGCCATGTG-3′; Reverse: 5′-ACCTAAC- ed by the Ethics Committee of Affiliated Cancer TACATGGTTTACATGTT-3′. miRNA-145: For- Hospital of Zhengzhou University and also has ward: 5′-CAGTGCGTGTCGTGGAGT-3′ Re- been carried out in accordance with the World verse: 5′-AGGTCCAGTTTTCCCAGG-3′ U6: Medical Association Declaration of Helsinki. The Forward: 5′-CTCGCTTCGGCAGCACA-3′ Re- subjects had been informed the objective. Cer- verse: 5′-AACGCTTCACGAATTTGCGT-3′. tainly, written consents were signed by every subject in the present study. Western Blot Total protein was collected from tissues and Cell Culture cells with RIPA lysis Mix (Beyotime, Shang- Beas-2B, H1299, H1975, SPC-A-1, PG49, and hai, China). Briefly, 40-60 μg protein extraction A549 cell lines were purchased from the Science was loaded via SDS-PAGE and transferred onto Cell Laboratory. NSCLC cell lines were cultured nitrocellulose membranes (Millipore, Billerica, in PRIM 1640 (Thermo Fisher Scientific, MA, MA, USA), the membranes were incubated in USA) with 10 % FBS (Thermo Fisher Scientific, 5% non-fat blocking solution for 3 h. Then, they MA, USA) and 100 μL/mL penicillin and strep- were incubated with primary antibodies for 2 h tomycin (Beyotime, Shanghai, China) and placed at room temperature, and then, plated at 4°C at 37°C with 5% CO2. for one night, After incubation with secondary antibodies, the membranes were scanned Cell Transfection using an Odyssey, and data were analyzed Si-RNA (si-VRK2) was produced by Ribobio with Odyssey software (LI-COR, Lincoln, NE, Co., Ltd. (Guangdong, China). Si-NC (negative USA). ERK (67170-1-Ig, 1:500), AKT(10176-2- control) was indicated as control (si-NC). About AP,1:1000), p-AKT (66444-1-Ig, 1:500) were 5×10 5 cells per well were seeded in 6 well plates, purchased from Proteintech (Rosemont, IL, Regents (20 nmol/L) were transfected into the USA); p-ERK (sc-7383, 1:200) was purchased cells with Lipofectamine 2000 (Thermo Fisher from SANTA CRUZ Biotechnology (Santa Scientific, MA, USA) for 48 h. Cruz, CA, USA), VRK2 (ab58052, 1:500) were Si-VRK2: 5’GCAAGGUUCUGGAUGAUA purchased from Abcam (Cambridge, UK), and U3’;RETRACTED MiRNA-145-5p mimics: 5’ATCGTC- GraphPad (60004-1-Ig, 1:2000) was used as an CAGTTTTCCCAGG3’/5’CGCCTCCACA- internal control.

146 VRK2 expression and lung cancer via miR-145-5p/ERK1/2/AKT axis

CCK-8 Assay 30 min. Flow cytometer was used to evaluate the Cells were cultured in 96-well cell plates and cell cycle. added CCK-8 buffer (MedChemExpress, Mon- mouth Junction, NJ, USA) at 0, 24, 48, and 72 Luciferase Assay h. 2 h later, measure 450 OD value with an HEK293T cells were co-transfected with 20 MK3ELISA photometer (Thermo Fisher Scientif- mmol/L miRNA mimic or miR-NC together with ic, Waltham, MA, USA). VRK2-WT or VRK2-mutation. Luciferase activity was measured with Dual-Luciferase Reporter Matrigel Invasion Assay Assay Kit (Thermo Fisher Scientific, Waltham, Cells in the logarithmic growth phase were ad- MA, USA) on GloMax20/20 at 48 hr after the justed to 2 × 105 cells/well of medium (without transfection. serum) and plated 1μg/μl Matrigel into the upper chamber. The lower chamber was added with 500 Immunohistochemistry (IHC) μL of the medium, and then incubate the plate at The tumor tissue was cut into 5-μm-thick 37°C for 48 h. Then, the invading cells were visual- sections. The sections were dewaxed and depa- ized by the crystal violet and inverted microscope. raffinized in xylene and rehydrated in gradient alcohol solutions. Sections were heated in the In Vivo Tumor Growth Assay Tris-EDTA buffer for 30 min to extract anti- Nude mice were purchased from the Beijing gens. The samples were incubated with primary Charles River. Stable VRK2 knockdown cell antibodies for ki-67 (27309-1-AP, 1:100), VEGF lines were constructed, A549 cells (5 × 106) (19003-1-AP, 1:100), p-ERK (sc-7383, 1:20), were subcutaneously injected in the right lower p-AKT (66444-1-Ig, 1:50), cleaved-caspase3 limb of the nude mice. Tumor size was measured (ab2302, 1:100, Abcam, Cambridge, UK) and every five days. After another 15 d of injection, HRP-labeled Streptavidin (A0303, 1:200, Bey- the tumor was removed for follow-up study. This otime, Shanghai, China) secondary antibodies. animal study was approved by the Animal Clin- Sections were avoided light with hematoxy- ical Committee of Affiliated Cancer Hospital of lin, then dehydrated and secured. Photos were Zhengzhou University. Nude mice were eutha- scanned with an Olympus camera. nized and operated strictly in accordance with the Guidelines for the Care and Use of Laborato- ry Animals of the National Institutes of Health. Statistical Analysis All values are expressed as the mean ± SEM. Cell Apoptosis Assay Statistical significances were measured by Stu- The A549 cells were counted, about 5×105cells/ dent’s t-test and ANOVA. A two-tailed value of p mL. Then, 1 mL cells were centrifuged, 1000 < 0.05 was indicated as a statistically significant rpm, 10 min, 4°C, and the medium was throw difference. Data statistics were used the Graph- away. The cells were washed with PBS and Pad 7.0 (La Jolla, CA, USA). dropped medium. The cells were resuspended and avoid light for 15 min, 200 μL Binding Buf- fer with10 μL Annexin V-FITC, and 10 μL PI. Results Flow cytometry was used to measured apoptosis rate within 1 h. VRK2 Was an Upregulation in Pulmonary Adenocarcinoma Tissue Cell Cycle Assay and Cells A549 cells were collected with 1 ml trypsin To detect the role of VRK2 in pulmonary ad- for 2 min, suspension the cell with 5 ml PBS, enocarcinoma, we collected tumor and para-can- centrifuge at 1000 RPM for 5 min at 4°C. 10 ml cer tissue from 60 pulmonary adenocarcinoma PBS buffer was used to re-washed and dropping patients. By performing qRT-PCR assays, we medium, Then, the cells were fixed with 70% found VRK2 was an upregulation in tumor tis- ethanol overnight. The next day, the cell medium sue comparing with normal tissues (Figure 1A). was filtered with a 300-mesh sieve, centrifuged at We also detected the level of VRK2 in differ- 1000 RPM at 4°C for 5min, and the supernatant ent human pulmonary adenocarcinoma cell lines wasRETRACTED discarded. The cells were avoided light and (H1299, H1975, SPC-A-1, PG49, and A549); the fixed with 1ml PI solution and stated at 4°C for Beas-2B cell line was indicated as control. The

147 Y. Mu, W.-J. Liu, L.-Y. Bie, X.-Q. Mu, Y.-Q. Zhao

Figure 1. VRK2 expression levels in pulmonary adenocarcinoma tissues and cell lines. A, RT-PCR detected the mRNA level of VRK2. n=60, **p <0.01. B, The mRNA level of VRK2 in pulmonary adenocarcinoma cell lines (H1299, NCI-H1975, SPC-A-1, PG49, A549), Beas-2B cell line was identified as a control. n=12,p * <0.05. C, The protein level of VRK2 in pulmonary adenocarcinoma cell lines. n=6, *p <0.05. results showed that VRK2 was increased in dif- ation, after 72 h, si-VRK2 significantly inhibit- ferent of human pulmonary adenocarcinoma cell ed cell proliferation (Figure 3A). To further link lines, moreover; the expression increased more VRK2 expression to cell invasion, we applied evidently in A549 cells (Figure 1B and C). the chamber-transwell invasion assay. The results showed that VRK2 downregulation could Knockdown of VRK2 Promotes the block cell invasion in cells (Figure.3B). Figure.3C Apoptosis of A549 showed that si-VRK2 inhibited A549 migration at Next, we would verify the function of VRK2 24 h and 48 h. Downregulation of VRK2 inhibited in pulmonary adenocarcinoma. We constructed the activation of AKT and ERK1/2. (Figure 3D). siRNA to knockdown the expression of VRK2. Si-VRK2/si-NC were transfected into A549 cells; VRK2 Could Interact With MiR-145-5p then, flow cytometry performed that the apop- Bioinformatics sites showed that VRK2 was tosis rate was significantly increased in the si- negatively correlated with miRNA-145-5p and VRK2 group compare with si-NC (Figure 2A). that miRNA-145-5p could bind with the 3 ‘UTR Then, we discovered significantly increased G0/ region of VRK2 (Figure 4A&B). To verify the G1 cells and decreased S cells after downregula- forecast, we created miR-145-5p mimics/miR-NC tion VRK2 (Figure 2B). Furthermore, we detect- and performed Luciferase assay; the report con- ed the caspase3 activity and apoptosis-associated firmed the link between VRK2 and miRNA-145- protein, cleaved-PARP, Bcl-2, cleaved-caspase3, 5p (Figure 4C). We transfected si-VRK2/si-NC, cleaved-caspase8, cleaved-caspase9 (Figure miR-145-5p mimics/AMO-145-5p/miR-NC into 2C&D), the results showed that knockdown of A549 cells to measure the expression of miR-145- VRK2 could facilitate apoptosis of A549 cell. 5p and VRK2, there was a negative correlation between VRK2 and miRNA (Figure 4D&E). Knockdown of VRK2 Prevents Meanwhile, AMO-145-5p could block the inacti- Proliferation and Metastasis of A549 vation of AKT and ERK1/2 induced by si-VRK2 ThenRETRACTED CCK8 assay was carried out to evaluate (Figure 4F). In summary, interacting with miR- the function of VRK2 on NSCLC cell prolifer- 145-5p, VRK2 participated in the proliferation

148 VRK2 expression and lung cancer via miR-145-5p/ERK1/2/AKT axis

Figure 2. Knockdown of VRK2 promotes apoptosis in A549 cells. A, The apoptosis rate was measured by flow cytometry. n=6, *p <0.05. B, The effect of VRK2 on cell cycle. n=5, *p <0.05. C, Si-VRK2 induced Caspase-3 activation in A549 cells. n=6, *p <0.05. D, The protein level of apoptosis-associated protein (Cleaved-PARP, Bcl2, Cleaved Caspase3, Cleaved Caspase8, Cleaved Caspase9) was detected in A549 after si-VRK2/si-NC transfection. n=8, *p <0.05.

Figure 3. Knockdown of VRK2 inhibits proliferation and metastasis via AKT/ERK1/2 signal pathway in A549 cells. A, CCK8 assay was performed to detect the proliferation ability. n=4, *p <0.05. B, Cell invasion ability was detected in A549 after si-VRK2/si-NC transfection (magnification×100). n=6, p* <0.05. C, Representative images (left) and histogram (right) from wound-healingRETRACTED assays using A549 cells. n=4, *p <0.05. D, The protein level of VRK2, AKT, p-AKT, ERK1/2, p-ERK1/2 were identified by Western blot. n=6, p* <0.05.

149 Y. Mu, W.-J. Liu, L.-Y. Bie, X.-Q. Mu, Y.-Q. Zhao

Figure 4. MiR-145-5p banding with VRK2 regulates AKT/ERK1/2 signal pathway. A, Bioinformatics predicted the relationship between miR-145-5p and VRK2. B, Bioinformatics predicted the binding sequence of miR-145-5p to VRK2. C, Luciferase assay reported miR-145-5p interacting with VRK2. n=4, *p < 0.05. D, E, Regulatory effects between miR-145-5p and VRK2 was detected by RT-PCR. n=8, *p < 0.05. F, The protein level of AKT, p-AKT, ERK1/2, p-ERK1/2 was detected by Western blot. n=6, *p < 0.05. and metastasis of A549 cells via regulating the phosphorylation of AKT and ERK1/2 were al- ERK1/2 and AKT signal pathway. so decreased in si-VRK2-A549 injection mice (Figure 5F). The tumor tissue was sectioned for Knockdown of VRK2 Prevents Tumor immunohistochemical staining (Figure 5G). The Growth In Vivo Ki-67 staining performed that VRK2 knock- For further confirmation, we constructed a down significantly inhibited the proliferation stable low expression of VRK2 A549 cell (si- of tumo, which got similar results in vitro. VRK2-A549), the normal level of VRK2 A549 Si-VRK2-A549 decreased the level of VEGF, cell as a control (si-NC-A549). Two groups p-ERK, and p-AKT, accompanied by increased of A549 cells were randomly and subcutane- expression of cleaved-Caspase3. ously injected in the right lower limb of the nude mice. Tumor size was measured every five days. Si-VRK2-A549 injection group sig- Discussion nificantly reduced tumor volume and weight (Figure 5A-C). The tumor tissues of the si- Until now, the commonly used tumor markers VRK2-A549 injection group showed a higher such as carcinoembryonic antigen (CEA) have a level of miR-145-5p and a lower level of VRK2 specific value in the diagnosis of the tumor; their RETRACTED20,21 compared with si-NC-A549 (Figure 5D&E), the sensitivity and specificity are not high enough .

150 VRK2 expression and lung cancer via miR-145-5p/ERK1/2/AKT axis

Figure 5. VRK2 regulates tumorigenesis in vivo. A, Effects of VRK2 knockdown on the size of A549 xenograft tumors in nude mice. B, C, The significantly smaller average tumor volume and weights of the si-VRK2-A549 group are compared to the si-NC-A549 group. D, The mRNA level of miR-145-5p in tumor tissue. n=6, *p < 0.05. E, The protein level of VRK2, AKT, p-AKT, ERK1/2, p-ERK1/2 were detected by Western blot. n=6, *p<0.05. F, The protein level of apoptosis-associated protein (Cleaved-PARP, Bcl2, Cleaved Caspase3, Cleaved Caspase8, Cleaved Caspase9) were detected in tumor tissue. n=8, *p < 0.05. G, Representative images (Magnification×200) of the IHC staining of ki67, p-ERK, p-AKT, and Cleaved-caspase3.

The early diagnosis of pulmonary adenocarcino- diagnosis and therapy of pulmonary adenocarci- ma is severe, the prognosis of patients is weak, noma. the late survival period is short, especially the In previous studies, VRK2 was an abnormal ex- pulmonary adenocarcinoma, the incidence rate pression in psychiatric disorders and epilepsies. In is lower than other types of pulmonary adeno- an earlier study, VRK2 was identified as a potential carcinoma, the onset age is smaller, and the lump mental and neurological disorder, but few studs on growth is slow, so it is more accessible to misdi- tumors, especially in pulmonary adenocarcinoma. agnose22,23. Through the bioinformatics analysis It was reported that VRK2 could regulate the hy- of pulmonary adenocarcinoma, a large number of poxia stress response induced by TAK126. VRK2 studies have been reported on the development, participated in breast cancer via modulating the metastasis, drug resistance, and prognostic mo- FBXW2-MSX2-SOX2 axis27. VRK1 and VRK2 lecular markers of pulmonary adenocarcinoma24. were both described as an indicator of rectal adeno- Early diagnosis of pulmonary adenocarcinoma is carcinoma response to neoadjuvant chemoradiation an essential factor in improving the prognosis and therapy28. Some shortcomings of this study are that annual survival rate of pulmonary adenocarcino- appropriate VRK2 specific inhibitors were not used ma patients. But the diagnosis and treatment are to inhibit its activity; we choose siRNA to inhibit not satisfactory25. Therefore, we need to explore VRK2, which may have differential results. furtherRETRACTED the mechanism of pulmonary adenocarci- In our study, after quantitative detection of VRK2 noma, which could provide a new index for early level in pulmonary adenocarcinoma patients, it was

151 Y. Mu, W.-J. Liu, L.-Y. Bie, X.-Q. Mu, Y.-Q. Zhao found that VRK2 expression in pulmonary adeno- Conflict of Interest carcinoma tissues was significantly higher than ad- The Authors declare that they have no conflict of interests. jacent tissues, the similar results were performed in pulmonary adenocarcinoma cell lines. Knockdown of VRK2 could promote apoptosis and press pro- Funding liferation, metastasis of A549 cells. Further results The authors received no funding for this work. showed that miR-145-5p could bind with VRK2 involved in pulmonary adenocarcinoma progression via regulating AKT/ERK1/2 signal pathway. References In recent years, the research on the function of miRNA has become one of the break- ) 1 Rami-Porta R, Call S, Dooms C, Obiols C, San- throughs in life science, especially in the mech- chez M, Travis WD, Vollmer I. Lung cancer stag- anism of occurrence and development of malig- ing: a concise update. Eur Respir J 2018; 51. nant tumors. MiRNA is a kind of non-coding 2) Roman M, Baraibar I, Lopez I, Nadal E, Rolfo C, small molecule RNA, which is widely involved Vicent S,Gil-Bazo I KRAS oncogene in non-small cell lung cancer: clinical perspectives on the treat- in the regulation of life activities. The results ment of an old target. Mol Cancer 2018; 17: 33. show that most of the genes in human and 3) Tan X, Banerjee P, Pham EA, Rutaganira FUN, other mammals are regulated by miRNA, and Basu K, Bota-Rabassedas N, Guo HF, Grzesko- each miRNA can regulate hundreds of target wiak CL, Liu X, Yu J, Shi L, Peng DH, Rodriguez genes29,30. With the deepening of the study of BL, Zhang J, Zheng V, Duose DY, Solis LM, Mi- miRNA, it has been reported that the expres- no B, Raso MG, Behrens C, Wistuba, II, Scott sion of miRNA has significant tissue specific- KL, Smith M, Nguyen K, Lam G, Choong I, Ma- zumdar A, Hill JL, Gibbons DL, Brown PH, Rus- ity, and its expression profile analysis can be sell WK, Shokat K, Creighton CJ, Glenn JS, Kurie used to identify the source of tumor, and has JM. PI4KIIIbeta is a therapeutic target in chro- higher accuracy than the classification method mosome 1q-amplified lung adenocarcinoma. Sci of mRNA expression profile, and can directly Transl Med 2020; 12: eaax3772. reflect the level of gene function. Some studies 4) Ferrara R, Auger N, Auclin E, Besse B. Clinical have also shown that changes in the expression and translational implications of RET rearrange- ments in non-small cell lung cancer. J Thorac On- level of miRNA can cause changes in a series col 2018; 13: 27-45. of oncogenes and tumor suppressor genes, and 5) Li M, Yue W. VRK2, a candidate gene for psychi- then provide an effective pathway for tumor atric and neurological disorders. Mol Neuropsy- treatment by specifically inhibiting the activity chiatry 2018; 4: 119-133. of carcinogenic miRNA. The development of 6) Tesli M, Wirgenes KV, Hughes T, Bettella F, Atha- pulmonary adenocarcinoma is a complex pro- nasiu L, Hoseth ES, Nerhus M, Lagerberg TV, cess involving many factors, steps and genes, Steen NE, Agartz I, Melle I, Dieset I, Djurovic involving many genes31,32. Using miRNA mi- S, Andreassen OA. VRK2 gene expression in schizophrenia, bipolar disorder and healthy con- croarray to analyze the differentially expressed trols. Br J Psychiatry 2016; 209: 114-120. miRNA, in pulmonary adenocarcinoma and 7) Lee J, Lee S, Ryu YJ, Lee D, Kim S, Seo JY, Oh paracancerous tissues is helpful to systemati- E, Paek SH, Kim SU, Ha CM, Choi SY, Kim KT. cally study the interaction between genes and Vaccinia-related kinase 2 plays a critical role in complex molecular mechanisms in the devel- microglia-mediated synapse elimination during opment of this malignant tumor, and provide neurodevelopment. Glia 2019; 67: 1667-1679. reliable help for the prevention, diagnosis and 8) Hirata N, Suizu F, Matsuda-Lennikov M, Tanaka treatment of pulmonary adenocarcinoma. T, Edamura T, Ishigaki S, Donia T, Lithanatudom P, Obuse C, Iwanaga T, Noguchi M. Functional characterization of lysosomal interaction of Akt with VRK2. Oncogene 2018; 37: 5367-5386. Conclusions 9) Vazquez-Cedeira M, Lazo PA. Human VRK2 (vaccinia-related kinase 2) modulates tumor cell For the first, we established the correlation invasion by hyperactivation of NFAT1 and expres- between VRK2 and miR-145-5p and explored the sion of cyclooxygenase-2. J Biol Chem 2012; 287: role and underlying mechanism of VRK2 in pul- 42739-42750. monary adenocarcinoma. Although the research 10) Fernandez IF, Blanco S, Lozano J,Lazo PA VRK2 inhibits mitogen-activated protein kinase signal- is stillRETRACTED insufficient, it also can provide a specific ing and inversely correlates with ErbB2 in human theoretical basis for clinical research. breast cancer. Mol Cell Biol 2010; 30: 4687-4697.

152 VRK2 expression and lung cancer via miR-145-5p/ERK1/2/AKT axis

11) Monsalve DM, Merced T, Fernandez IF, Blanco S, the demand, access and related factors of cancer Vazquez-Cedeira M, Lazo PA Human VRK2 mod- prevention and treatment knowledge among ur- ulates apoptosis by interaction with Bcl-xL and ban residents in China from 2015 to 2017]. Zhon- regulation of BAX gene expression. Cell Death ghua Yu Fang Yi Xue Za Zhi 2020; 54: 84-91. Dis 2013; 4: e513. 23) Leng A, Jing J, Nicholas S, Wang J. Catastrophic 12) Li LY, Liu MY, Shih HM, Tsai CH,Chen JY Human health expenditure of cancer patients at the end- cellular protein VRK2 interacts specifically with of-life: a retrospective observational study in Chi- Epstein-Barr virus BHRF1, a homologue of Bcl-2, na. BMC Palliat Care 2019; 18: 43. and enhances cell survival. J Gen Virol 2006; 87: 24) Ruiz-Cordero R,Devine WP. Targeted therapy 2869-2878. and checkpoint immunotherapy in lung cancer. 13) Fernandez IF, Perez-Rivas LG, Blanco S, Cas- Surg Pathol Clin 2020; 13: 17-33. tillo-Dominguez AA, Lozano J, Lazo PA. VRK2 25) Inamura K. Clinicopathological characteristics anchors KSR1-MEK1 to endoplasmic reticulum and mutations driving development of early lung forming a macromolecular complex that com- adenocarcinoma: tumor initiation and progres- partmentalizes MAPK signaling. Cell Mol Life Sci sion. Int J Mol Sci 2018; 19. 2012; 69: 3881-3893. 26) Blanco S, Santos C, Lazo PA. Vaccinia-related ki- 14) Rupaimoole R, Calin GA, Lopez-Berestein G, nase 2 modulates the stress response to hypoxia Sood AK. MiRNA deregulation in cancer cells mediated by TAK1. Mol Cell Biol 2007; 27: 7273- and the tumor microenvironment. Cancer Discov 7283. 2016; 6: 235-246. 27) Yin Y, Xie CM, Li H, Tan M, Chen G, Schiff R, 15) Kong YW, Ferland-McCollough D, Jackson TJ, Xiong X, Sun Y. The FBXW2-MSX2-SOX2 axis Bushell M. MicroRNAs in cancer management. regulates stem cell property and drug resistance Lancet Oncol 2012; 13: e249-258. of cancer cells. Proc Natl Acad Sci U S A 2019; 16) Wu Z, Huang W, Wang X, Wang T, Chen Y, Chen 116: 20528-20538. B, Liu R, Bai P, Xing J. Circular RNA CEP128 acts 28) Del Puerto-Nevado L, Marin-Arango JP, Fernan- as a sponge of miR-145-5p in promoting the blad- dez-Acenero MJ, Arroyo-Manzano D, Martinez-Us- der cancer progression via regulating SOX11. Mol eros J, Borrero-Palacios A, Rodriguez-Remirez M, Med 2018; 24: 40. Cebrian A, Gomez Del Pulgar T, Cruz-Ramos M, 17) Sun M, Zhao W, Chen Z, Li M, Li S, Wu B,Bu R Carames C, Lopez-Botet B, Garcia-Foncillas J. Circular RNA CEP128 promotes bladder cancer Predictive value of vrk 1 and 2 for rectal adeno- progression by regulating Mir-145-5p/Myd88 via carcinoma response to neoadjuvant chemoradia- MAPK signaling pathway. Int J Cancer 2019; 145: tion therapy: a retrospective observational cohort 2170-2181. study. BMC Cancer 2016; 16: 519. 18) Lu Q, Shan S, Li Y, Zhu D, Jin W,Ren T Long non- 29) Yu N, Yong S, Kim H, Choi Y, Jung Y, Kim D, Seo coding RNA SNHG1 promotes non-small cell lung J, Lee Y, Baek D, Lee J, Lee S, Lee J, Kim J, Kim cancer progression by up-regulating MTDH via J, Lee S. Identification of tumor suppressor miR- sponging miR-145-5p. FASEB J 2018; 32: 3957- NAs by integrative miRNA and mRNA sequenc- 3967. ing of matched tumor-normal samples in lung ad- 19) Chang Y, Yan W, Sun C, Liu Q, Wang J,Wang M enocarcinoma. Mol Oncol 2019; 13: 1356-1368. miR-145-5p inhibits epithelial-mesenchymal tran- 30) Wei S, Zhang Z, Fu S, Xie J, Liu X, Xu Y, Zhao sition via the JNK signaling pathway by targeting J, Xiong W. Hsa-miR-623 suppresses tumor pro- MAP3K1 in non-small cell lung cancer cells. On- gression in human lung adenocarcinoma. Cell col Lett 2017; 14: 6923-6928. Death Dis 2016; 7: e2388. 20) Chen W, Zheng R, Baade PD, Zhang S, Zeng H, 31) Molina-Pinelo S, Pastor M, Suarez R, Rome- Bray F, Jemal A, Yu XQ,He J Cancer statistics in ro-Romero B, González De la Peña M, Sali- China, 2015. CA Cancer J Clin 2016; 66: 115-132. nas A, García-Carbonero R, De Miguel M, Ro- 21) Chen H, Li N, Ren J, Feng X, Lyu Z, Wei L, Li X, dríguez-Panadero F, Carnero A, Paz-Ares L. Mi- Guo L, Zheng Z, Zou S, Zhang Y, Li J, Zhang K, croRNA clusters: dysregulation in lung adenocar- Chen W, Dai M, He J. Group of cancer screen- cinoma and COPD. Eur Respir J 2014; 43: 1740- ing program in urban C participation and yield of 1749. a population-based colorectal cancer screening 32) Robles A, Arai E, Mathé E, Okayama H, Schet- programme in China. Gut 2019; 68: 1450-1457. ter A, Brown D, Petersen D, Bowman E, Noro 22) Wang K, Liu CC, Mao AY, Shi JF, Dong P, Huang R, Welsh J, Edelman D, Stevenson H, Wang Y, HY, Wang DB, Liu GX, Liao XZ, Bai YN, Sun XJ, Tsuchiya N, Kohno T, Skaug V, Mollerup S, Hau- Ren JS, Yang L, Wei DH, Song BB, Lei HK, Liu gen A, Meltzer P, Yokota J, Kanai Y, Harris C. An YQ, Zhang YZ, Ren SY, Zhou JY, Wang JL, Gong integrated prognostic classifier for stage i lung JY, Yu LZ, Liu YY, Zhu L, Guo LW, Wang YQ, He adenocarcinoma based on mRNA, microRNA, YT, Lou PA, Cai B, Sun XH, Wu SL, Qi X, Zhang and DNA methylation biomarkers. J Thorac On- RETRACTEDK, Li N, Chen WQ, Qiu WQ, Dai M. [Analysis on col 2015; 10: 1037-1048.

153