PHYSIOLOGIC EFFECTS OF CYTOCHROME P450 3A ACTIVITY
Raymond Carlos Givens
A dissertation submitted to the faculty of the University of North Carolina at Chapel Hill in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Nutrition, School of Public Health.
Chapel Hill 2007
Approved by:
Advisor: Dr. Nobuyo Maeda
Reader: Dr. John Anderson
Reader: Dr. Melinda Beck
Reader: Dr. Boyd Switzer
Reader: Dr. Paul Watkins
© 2007 Raymond Carlos Givens ALL RIGHTS RESERVED
ii
ABSTRACT
PHYSIOLOGIC EFFECTS OF CYTOCHROME P450 3A ACTIVITY
(Under the direction of Dr. Nobuyo Maeda)
The cytochrome P450 3A (CYP3A) subfamily of enzymes comprises isoforms that catalyze metabolism of foreign or “xenobiotic” chemicals that include most marketed pharmaceuticals. CYP3A activities are also critical in clearing and altering the bioactivities of many endogenous molecules. Research into CYP3As has focused primarily on their roles in drug metabolizing; much less attention has gone to physiologic effects of CYP3A activities. I review here established and hypothesized physiologic roles for CYP3A enzymes.
I have specifically studied whether CYP3As modulate renal sodium transport and blood pressure. A single-nucleotide polymorphism (SNP; A6986G) in the
CYP3A5 gene determines CYP3A5 apoprotein expression and enzyme activity.
A6986G was shown to predict renal CYP3A expression and activity among human kidney samples mostly from Caucasians and to associate with blood pressure and renal function among African-Americans.
Genotyping for A6986G and additional expression-determining CYP3A5
SNPs (G14690A and 27131-32insT) was performed for a larger group of African-
Americans. I show that genotypes at these loci can be computationally resolved into
iii functional haplotypes, which may improve the ability of CYP3A5 SNPs to predict blood pressure and other phenotypes.
I used mouse kidney collecting duct cells to study effects of a product of
CYP3A catalysis, 6 β-hydroxycorticosterone. I show that 6β-hydroxycorticosterone inhibits activity and expression of 11 β-hydroxysteroid dehydrogenase type 2, an enzyme that prevents glucocorticoids from inappropriately activating the mineralocorticoid receptor. 6β-hydroxycorticosterone also appears to antagonize mineralocorticoid receptor-mediated increases in expression of genes related to sodium transport.
Wild-type mice that were injected with 6β-hydroxycorticosterone failed to demonstrate greater sodium-sensitivity of blood pressure than did mice injected with vehicle. Mouse models were made to express human CYP3A5. Mice bearing a
CYP3A5 transgene exhibited slightly higher blood pressures than did wild-type mice, an effect that may be sodium-dependent.
Finally, I performed a systematic review and meta-analysis of subsequent human studies of CYP3A5 genotype associations with blood pressure and hypertension. Considerable variability is apparent among these studies. Intriguing data emerge but summary statistics for suitable studies (primarily of healthy whites) show little evidence for significant association. I discuss the need for increased standardization among future studies and for greater inclusion of black subjects.
iv
DEDICATION
For My Grandmothers
The fathers may soar
And the children may know their names
Toni Morrison, Song of Solomon
dixit et ignotas animum dimittit in artes naturamque novat
Ovid, Metamorphoses, VIII
v
ACKNOWLEDGEMENTS
Nobuyo Maeda is a peerless mentor and a tireless advocate of learning. Her insight, energy, enthusiasm, and support have been critical in the effort to produce this dissertation. Oliver Smithies as well is a fountain of wisdom and example of the need for dogged pursuit in the search for answers to research questions. Their love of science and their work ethic have left an indelible imprint upon me.
Paul Watkins has been an outstanding mentor and dissertation committee member who started me on the path to this project. Committee members John
Anderson, Melinda Beck, and Boyd Switzer provided much critical insight and counsel in the progress of this research. I am also indebted to the personal and intellectual legacies of previous mentors Salvatore Pizzo (Duke University) and J.
Michael Pierce (University of Georgia).
Members of the Smithies-Maeda laboratory were invaluable in this effort:
John Hagaman, Sylvia Hiller, Jenny Langenbach, John Cowhig, Jennifer Wilder,
Lonquan Xu, Sharome Jordan, Xianwen Yi, Feng Li, Natalia Makhanova, Nobuyuki
Takahashi, Masao Kakoki, Seigo Hatada, Tomoko Hatada, Hyung-Suk Kim, Shinja
Kim, Michael Altenburg, Jose Arbones-Mainar, Ray Fox, Lance Johnson, Hind
Muallem, Heather Doherty, Avani Pendse, Yau-Sheng Tsai, and Chih-Hong Wang.
I thank the American Physiological Society for granting permission to reprint material in Chapter II. I thank the Doris Duke Charitable Foundation and the National
Institutes of Health for crucial financial support. I thank Bruce Stanton (Dartmouth)
vi for the mIMCD-K2 cell line. I thank Erin Schuetz (St. Jude’s) for CYP3A5 cDNA, for
collaboration, and for providing space in her laboratory for me to learn the CYP3A5 genotyping protocol. I thank the UNC Department of Nutrition, and especially Joanne
Lee, for invaluable aid and support.
I thank my friends and family for sustaining me to this point. My journey began with a family that valued and promoted education. My mother, Deborah
Givens, was a relentless advocate and advisor even if she may not always have understood where my path was taking me. I thank my sister Lauren Givens for her love and support. My partner throughout this process, Monica Copeland, was always available to listen, console, and motivate. The Rhodes family have stood behind and encouraged me throughout my studies. Lastly, I thank St. Paul AME Church (Chapel
Hill, NC) and its members for the promise of a new, better, and more purposeful life.
vii
TABLE OF CONTENTS
LIST OF TABLES...... xii
LIST OF FIGURES ...... xii
ABBREVIATIONS...... xiv
CHAPTER I: GENERAL INTRODUCTION ...... 17
SUMMARY...... 18
INTRODUCTION...... 18
Cytochrome P450 Taxonomy ...... 18
CYP3A enzymes...... 19
The CYP3A metabolic unit...... 20
CYP3A metabolism...... 21
Distribution of CYP3A expression...... 21
CYP3A5 Genetic Variance...... 23
Ethnic differences in CYP3A5 allele frequencies...... 24
The Physiologic Impacts of CYP3A Enzymes...... 25
Oxysterol and lipid metabolism ...... 25
Eicosanoids and renal function ...... 26
Vitamin D, bone health, and cancer ...... 26
Steroid metabolism ...... 26
CYP3A5 and selective pressure ...... 29
CYP3A5 expression by latitude ...... 29
viii Toxicologic pressure ...... 29
Sunlight and vitamin D ...... 30
Heat stress and sodium ...... 31
RAAS pathway ...... 32
CYP3A5 A6986G covariance with hypertension gene candidates ...... 33
UNIFYING HYPOTHESIS...... 35
CHAPTER II: CYP3A5 GENOTYPE PREDICTS RENAL CYP3A ACTIVITY AND BLOOD PRESSURE IN HEALTHY ADULTS ...... 39
SUMMARY...... 40
INTRODUCTION...... 40
METHODS ...... 42
RESULTS...... 45
DISCUSSION...... 46
CHAPTER III: CYP3A5 HAPLOTYPE RECONSTRUCTION...... 51
SUMMARY...... 52
INTRODUCTION...... 52
METHODS ...... 55
RESULTS...... 56
DISCUSSION...... 59
CHAPTER IV: IN VITRO STUDIES OF 6 β-HYDROXYCORTICOSTERONE...... 61
SUMMARY...... 62
INTRODUCTION...... 63
METHODS ...... 65
RESULTS...... 69
ix DISCUSSION...... 79
CHAPTER V: IN VIVO MODELS OF CYP3A PHYSIOLOGY ...... 833
SUMMARY...... 844
INTRODUCTION...... 844
METHODS ...... 866
RESULTS...... 888
DISCUSSION...... 911
CHAPTER VI: SYSTEMATIC REVIEW OF STUDIES OF THE ASSOCIATION OF CYP3A5 GENOTYPE WITH BLOOD PRESSURE AND HYPERTENSION ...... 944
SUMMARY...... 95
INTRODUCTION...... 96
METHODS ...... 99
RESULTS...... 100
DISCUSSION...... 101
REFERENCES ...... 105
x LIST OF TABLES
TABLE I-A. CYP3A5 allele frequencies among populations ...... 24
TABLE I-B. Hypertension gene allele frequency associations with latitude...... 33
TABLE II-A. Blood pressure and creatinine clearance by CYP3A5 genotype ...... 50
TABLE III-A. CYP3A5 allele frequencies among 117 African-Americans ...... 57
TABLE III-B. CYP3A5 haplotype frequencies among African-Americans ...... 57
TABLE IV-A. List of TaqMan primers and probes ...... 67
TABLE VI-A. Studies of CYP3A5 genotype and blood pressure or hypertension ...... 103
xi LIST OF FIGURES
FIGURE I-1. Human CYP3A locus...... 20
FIGURE I-2. CYP3A enzymes catalyze steroid 6 β-hydroxylation ...... 27
FIGURE I-3. 11 β-HSD2 limits glucocorticoid transactivation of mineralocorticoid receptors...... 36
FIGURE I-4. Proposed mechanism of 6 β-hydroxysteroid effects on renal sodium transport...... 38
FIGURE II-1. CYP3A activity and CYP3A5 content in *1/*3 and *3/*3 renal microsomes from 21 organ donors...... 48
FIGURE II-2. Seated systolic blood pressure among 25 healthy African American adults by CYP3A5 genotype...... 49
FIGURE III-1. Reconstructed CYP3A5 diplotype and phenotype frequencies...... 58
FIGURE III-2. Power versus sample size for CYP3A5 genotype and haplotype...... 59
FIGURE IV-1. mIMCD-K2 cells respond to corticosterone treatment...... 71
FIGURE IV-2. 6 β-hydroxycorticosterone and carbenoxolone effects on ENaC α mRNA levels...... 722
FIGURE IV-3. Interaction between GR and MR blockade and 6β-hydroxycorticosterone effects on ENaC α mRNA induction by corticosterone...... 733
FIGURE IV-4. ENaC α mRNA dose-response with or without 10 -5 M 6 β-hydroxycorticosterone...... 744
FIGURE IV-5. Corticosterone conversion by mIMCD-K2 cells...... 755
FIGURE IV-6. Whole-cell 11 β-HSD2 substrate-velocity curve...... 766
xii FIGURE IV-7. 6 β-hydroxycorticosterone inhibits 11 β-HSD2 activity...... 777
FIGURE IV-8. 6 β-hydroxycorticosterone affects 11 β-HSD2 mRNA levels...... 788
FIGURE IV-9. 6 β-hydroxycorticosterone suppresses 11 β-HSD2 activity...... 79
FIGURE V-1. 6 β-hydroxycorticosterone affects blood pressure and heart rate...... 89
FIGURE V-2. Relative hepatic and renal expression of CYP3A11 mRNA in wild-type and PGK-CYP3A5 transgenic mice...... 900
FIGURE V-3. Diet and PGK-CYP3A5 genotype effects on systolic and diastolic blood pressure...... 900
FIGURE V-4. Dietary effects on systolic blood pressure and heart rate in ApoAI/CII-CYP3A5 transgenic and wild-type mice...... 911
FIGURE VI-1. Forest plot of studies associating systolic blood pressure with CYP3A5 genotype...... 101
xiii ABBREVIATIONS
ABC ATP-binding cassette
ACE angiotensin-converting enzyme
AGT angiotensinogen
ANOVA analysis of variance
AT-II angiotensin II
B corticosterone
BMI body mass index
BP blood pressure
CAR constitutive androstane receptor
CBX carbenoxolone
CrCl creatinine clearance
CYP cytochrome P450
DBD DNA-binding domain
DME drug-metabolizing enzyme
DMEM Dulbecco’s modified Eagle’s medium
EM expectation-maximization algorithm
ENaC epithelial sodium channel
F cortisol
FBS fetal bovine serum
FXR farnesyl X receptor
GR glucocorticoid receptor
HSD11B1 11 β-hydroxysteroid dehydrogenase type 1
xiv HSD11B2 11 β-hydroxysteroid dehydrogenase type 2
HTN hypertension
JGA juxtaglomerular apparatus
LBD ligand-binding domain
LD linkage disequilibrium
LXR liver X receptor
MAP mean arterial pressure
MDR-1 multidrug resistance transporter 1
mIMCD-K2 mouse inner medullary collecting duct cell line
MR mineralocorticoid receptor
NAD + β-nicotinamide adenine dinucleotide, oxidized form
NADPH β-nicotinamide adenine dinucleotide phosphate, reduced form
PCR polymerase chain reaction
PGK phosphoglycerate kinase
P-gp P-glycoprotein
PPAR peroxisome proliferator-activated receptor
PXR pregnane X receptor
RAAS renin-angiotensin-aldosterone system
RT-PCR reverse transcriptase-PCR
RXR retinoid X receptor
SAME apparent mineralocorticoid excess
SHR spontaneously hypertensive rat
SNP single-nucleotide polymorphism
xv SS sodium sensitivity
TLC thin-layer chromatography
VDR vitamin D receptor
xvi
CHAPTER I: GENERAL INTRODUCTION
SUMMARY
CYP3A enzymes have established and possibly undefined roles in mammalian physiology in addition to their known functions as drug-metabolizing enzymes.
CYP3A enzymes and associated transport proteins interact with physiologically important molecules. Genetic analyses suggest an evolutionary importance for human CYP3A isoforms. In this chapter, I review literature pertaining to CYP3A metabolism and physiology.
Herein I advance hypotheses concerning possible mechanisms of CYP3A action upon renal control of electrolyte balance and blood pressure. I also propose studies to address these ideas. These studies include a number of approaches and materials: human subjects, cellular and animal models, computational genetics, and meta-analyses of pre-existing studies. The conclusion offered by these studies is that roles for CYP3A enzymes in physiology remain intriguing, if puzzling, and that future studies would benefit from refining hypotheses and experimental methods.
INTRODUCTION
Cytochrome P450 Taxonomy
The cytochrome P450 (CYP) enzyme superfamily is an exceedingly diverse group with members found among organisms in every taxonomic kingdom (1). The CYPs are hemoproteins that have absorption maxima near 450 nm. CYP enzymes catalyze the oxidations and reductions of a wide array of substrates. CYPs are divided into roughly 237 numbered families on the basis of sequence homology:
18 family members share greater than 40% sequence similarity and subfamily members are more than 55% similar (2). Sixteen CYP families are found among mammals (3).
In addition to their handling of endogenous molecules, members of the first three families are also known to metabolize exogenous, or xenobiotic, compounds- including therapeutic drugs (4). CYP1-3 proteins constitute the phase I drug- metabolizing enzymes, which catalyze the functionalization of their substrates via reactions ( e.g. , hydroxylation and demethylation) that increase aqueous solubility or introduce attachment sites for bulkier moieties to be added by phase II enzymes.
CYP proteins are expressed in the liver and throughout the gastrointestinal tract, where the bulk of first-pass drug metabolism occurs (5). The generally non-CYP phase II enzymes- including glutathione S-transferases, sulfotransferases, and N- acetyltransferases- conjugate molecules to create products that are more soluble and more readily excreted by drug transporters (6). CYP activities may constitute a defense against foreign chemicals, but some have also been shown to generate harmful metabolites, such as those of benzo(a)pyrene and aflatoxin B1 (7).
CYP3A enzymes
The term “CYP3A” denotes family 3, subfamily A of the CYP superfamily. The
CYP3A enzymes function in the endoplasmic reticulum and require an electron transport chain provided by NADPH-cytochrome P450 reductase (8). Among human
CYP subfamilies, CYP3A is the most prominent- its members are the most highly expressed in the liver and intestines and they catalyze the metabolism of a tremendous variety of substrates, including more than half of currently marketed
19 drugs (9). The four human CYP3A isozymes, which are numbered 4, 5, 7, and 43,
have extensively overlapping substrate specificities.
A gene cluster on human chromosome 7q21-q22.1 encodes the CYP3A
enzymes; interspersed between the active genes are CYP3A pseudogenes, dormant remnants of duplication events (2, 10, 11) (Figure I-1). At least 6 mouse homologs reside in a syngeneic locus on mouse chromosome 5 (4, 12). All active human
CYP3A genes have 13 exons. The evolutionary emergence of the CYP3A subfamily predates that of vertebrates, as CYP3-like genes are found even among the pre- vertebrate tunicates (13). CYP3A isoforms are expressed throughout the vertebrate subphylum (4, 14) and phylogenetic analyses predict that the common ancestor of all vertebrates bore a single CYP3A gene that evolved to generate modern CYP3A
gene clusters in each species through species-specific gene-duplication and
recombination events (14).
FIGURE I-1. Human CYP3A locus
The CYP3A metabolic unit
CYP3A enzymes can be considered to belong to a basic metabolic unit that also
includes the nuclear hormone receptors pregnane X receptor (PXR) and retinoid X
receptor (RXR) and the efflux transporter P-glycoprotein (P-gp), or multidrug
resistance 1 transporter (MDR1). Levels of CYP3A and P-gp mRNAs are induced by
20 PXR/RXR heterodimers that bind to PXR response elements in CYP3A and MDR1 gene promoters (15, 16). PXR ligands include endogenous and xenobiotic compounds that are often CYP3A substrates and P-gp ligands (17). P-gp may alter the extent of CYP3A metabolism by pumping CYP3A substrates out of the cell, and
CYP3A may control the activity of PXR and P-gp by metabolizing PXR/P-gp ligands into less avid products (18, 19). In summary, there is a homeostasis in this system that is controlled by interplay among its members. As will be discussed, the
CYP3A/PXR/P-gp unit is at the nexus of a broad network of physiologic systems.
CYP3A metabolism
CYP3A enzymes participate in the oxidative, reductive, and peroxidative metabolism of a very diverse array of exogenous and endogenous substrates. Exogenous substrates include xenobiotic environmental chemicals, against which the CYP3A enzymes may form a line of defense. CYP3A enzymes metabolize a large number of therapeutic drugs and may be important in altering drug activity or in promoting drug clearance. Intriguing roles have emerged for CYP3A enzymes in endogenous processes such as steroidogenesis and steroid catabolism, lipid metabolism, and the processing of bile acids and vitamin D.
Distribution of CYP3A expression
Human CYP3A enzymes differ in their temporal and anatomic distributions. CYP3A7 expression is seen in utero but subsides by late infancy in most individuals (20). The
CYP3A43 enzyme is limited in the distribution and magnitude of its expression and it
21 has low catalytic activity for CYP3A substrates (21, 22). Adult hepatic and intestinal
CYP3A activity thus mainly reflects the contributions of CYP3A4 and CYP3A5.
CYP3A4 expression is variable but apparently universal: humans lacking
CYP3A4 have yet to be identified. Genetic variations that may control the levels of
CYP3A4 expression have been identified (23); the most studied of these is the
CYP3A4*1B allele, reflecting an A-392G single-nucleotide polymorphism (SNP) in the CYP3A4 promoter that is associated with decreased CYP3A activity (24). In contrast to that of CYP3A4, CYP3A5 expression is clearly polymorphic- that is, it is absent from some people. Furthermore, the frequency of CYP3A5 deficiency varies from one population to the other (25). The major genetic causes of CYP3A5 deficiency are discussed below.
Among people who express CYP3A5, hepatic levels of CYP3A5 may be only
25% that of CYP3A4. But the hepatic aggregate CYP3A activity of CYP3A5 expressers may be exceed that of CYP3A5 non-expressers (25, 26). CYP3A4 and 5 may be co-expressed in extra-gastrointestinal sites such as the placenta (27). But
CYP3A5 is also found in sites where CYP3A4 appears to be absent or undetectable.
CYP3A5 is the predominant and perhaps exclusive 3A isoform in the kidney (28-30), including proximal and distal tubules and collecting ducts (21, 31); adrenal zona glomerulosa (21, 31); bronchial and alveolar respiratory epithelia (32); and anterior pituitary gland (33). Extra-gastrointestinal CYP3A expression is unlikely to contribute significantly to overall drug metabolism but may modulate peripheral toxicities and physiologic effects of exogenous and endogenous molecules (34, 35).
22 It is possible then that variance in some systemic and local adult CYP3A
phenotypes reflects CYP3A5 polymorphism. For instance, CYP3A5 genotype and renal CYP3A5 expression may be associated with risk of nephrotoxic side effects due to CYP3A-substrate calcineurin inhibitors (tacrolimus and cyclosporin) (36-38).
There has also been a suggestion that CYP3A5 - and not CYP3A4 - genotype
modifies risk of a particular chronic nephritis (Balkan endemic nephropathy) whose
likely etiologic agents include pro-toxic chemicals ( e.g. , ochratoxin A) that are
activated by CYP3A enzymes (39, 40).
CYP3A5 Genetic Variance
Early studies of primarily Caucasian subjects suggested that the population-level
impact of CYP3A5 expression would be small because the vast majority of subjects
were clear non-expressers (41-43). However, expression frequency is much higher
in non-white populations and generally exceeds half among black groups. In every
human population studied so far, CYP3A5 expression variation mainly reflects the
effect of a SNP, A6986G, in the third CYP3A5 intron that distinguishes the full-
expresser allele (called *1 ) from a reduced-expresser allele ( *3 ) (44). The A-to-G
transition at this position functions as an alternative splice acceptor site that is
preferred over the canonical exon 4 acceptor site; the frame-shifted variant mRNA
predicts a truncated protein but the mRNA itself in unstable due to nonsense-
mediated decay (45, 46). Two additional CYP3A5 SNPs, G14690A and 27131-
32insT, respectively define the *6 and *7 alleles and are specific to black groups; the
frequency of each allele is roughly 0.10 (25, 47). The *6 allele may cause splicing
23 defects that result in skipping of exon 7; the single-base insertion in exon 11 that
defines *7 results in frame-shifted mRNA, a premature stop codon, and truncated protein (44, 45, 47).
Ethnic differences in CYP3A5 allele frequencies
The allelic frequency of CYP3A5*3 - which is inversely proportional to the prevalence of CYP3A5 expression in a population- is roughly 0.27-0.30 among African-
Americans (47), 0.60 among Southeast Asians (48), 0.73-0.76 among Chinese and
Japanese (48-50), and 0.88-0.96 among Caucasians (21, 22, 26, 47, 51, 52).
Accordingly, CYP3A5 protein levels are below limits of detection for Western blot in the majority of liver samples from Caucasians but are found in most samples from
African-Americans (25). The *6 and *7 alleles, which are found almost exclusively among black groups, occur at respective frequencies of roughly 0.15 and 0.10. A summary of *3, *6 , and *7 allele frequencies is shown in TABLE I-A. Information about lower-frequency CYP3A5 SNPs may be found elsewhere (23).
TABLE I-A. CYP3A5 allele frequencies among populations Allele Frequency *3 *6 *7 Population (A6986G) (G14690A) (27131 insT) N Refs. Black Afr.-American 0.27-0.30 0.13 0.10 (25, 47) Gabonese 0.21 0.10 0.10 72 (53) Nigerian 0.16 0.09 0.15 212 Seychelles 0.36 0.09 0.11 375 (54) Zimbabwean 0.78 0.22 0.10 400 (55)
Asian Chinese 0.76-0.78 (48, 56) Japanese 0.76-0.77 (57, 58) Malay 0.60 (48)
24 White Canadian 0.93 0.00 0.00 312 (55) British 0.94 (52) Dutch 0.91 0.001 (51) French 0.92 102 (53) German 0.96 (22) Spanish 0.91 (59) Multiethnic or undetermined Tunisian 0.81 0.01 0.00 72 (53)
The Physiologic Impacts of CYP3A Enzymes
CYP3A enzymes play a critical role in the metabolism of bile acids. CYP3As belong
to a minor pathway for the production of the primary bile acid cholate. CYP3A
activity is the major route for clearance of the toxic secondary bile acid metabolite
lithocholic acid (LCA). LCA is carcinogenic and may have a causative role in some
cases of colon cancer. By preparing LCA for clearance, CYP3A enzymes limit its
activation of prominent nuclear receptors such as farnesyl X receptor (FXR), the
constitutive androstane receptor (CAR), and the vitamin D receptor.
Oxysterol and lipid metabolism
The biologically-stable oxysterol 4 β-hydroxycholesterol is produced by CYP3A
enzyme activity (60, 61). It is a ligand for liver X receptor α (LXR α) (62). LXR α and β are nuclear receptors that are critical players in lipoprotein metabolism, cholesterol efflux, and glucose utilization. LXR activation is generally considered to have beneficial effects on energy balance: increased HDL levels and reverse cholesterol transport and increased glucose tolerance (63).
25 Eicosanoids and renal function
CYP3A enzymes are expressed in muscular arteries. In animal models, their
production of epoxyeicosatrienoic acid (EET) metabolites of arachidonic acid
appears to mediate potassium channel-dependent vasorelaxation (64-66). EETs
modulate the effects of the epithelia sodium channel (ENaC) and angiotensin II on
renal sodium excretion.
Vitamin D, bone health, and cancer
1α,25-dihydroxyvitamin D 3 induces CYP3A expression (67, 68), and CYP3A
enzymes can inactivate 1 α,25-(OH) 2D3 through 24-hydroxylation and can thus
potentially affect bone health. CYP3A inducers such as phenobarbital, ifosfamide,
rifampin, and anticonvulsants have known potentials for reducing 1 α,25-(OH) 2D3
levels and causing rickets and osteomalacia (68-76). As mentioned, CYP3A
enzymes inactivate LCA, a potent carcinogen that promotes its own detoxification
through induction of CYP3A expression by activating the vitamin D receptor (VDR).
Noted relationships between sunlight exposure and cancers of the colon, prostate,
and breast (77) may reflect ultraviolet light activation of vitamin D, which enhances
bile acid excretion (78), and the association of geographic latitude with CYP3A
expression, discussed below.
Steroid metabolism
CYP3A enzymes exhibit broad specificity for steroids. The 3As have important roles in hydroxylation of testosterone ( e.g., at the 2 β, 6 β, or 15 β positions) and estrogen
26 (positions 4 and 16 α) (79). It can be induced by various compounds including drugs,
pesticides, and carcinogens, resulting in high CYP3A4 levels in liver and other tissues, including mammary. Oxidations of these steroids have incompletely defined effects on their bioactivities, but may be responsible for some of the associations between CYP3A activity and cancers of the prostate and breast. The particular reaction most pertinent to this review is 6 β-hydroxylation (FIGURE I-2).
FIGURE I-2. CYP3A enzymes catalyze steroid 6β-hydroxylation
CYP3A-mediated 6 β-hydroxylation is a metabolic pathway in vertebrates for steroids that include, in addition to androgens, the glucocorticoids cortisol and corticosterone, and the mineralocorticoid aldosterone. 6 β-hydroxyglucocorticoid products of CYP3A- catalyzed reactions stimulate sodium transport across A6 toad kidney cells and induce sodium retention and increased creatinine clearance in rats (80-82).
CYP3A enzymes may modulate of A6 sodium transport through a mineralocorticoid receptor (MR)-mediated mechanism (83). Immunohistochemistry detects CYP3A proteins in rat kidney (80) and human distal tubules and collecting ducts (84), the principle sites at which corticosteroids stimulate sodium resorption.
6β-hydroxysteroids have been postulated to exert mineralocorticoid-like renal effects
27 (80). The findings of these studies present some confusion, however, as 6 β- hydroxycortisol appears not to activate the MR but may antagonize it and appears not to act through the glucocorticoid receptor (GR). CYP3A activity, along with that of 11 β-hydroxysteroid dehydrogenase type 2 (11 β-HSD2), has been proposed to regulate glucocorticoid occupancy of MRs (83).
Human and animal data suggest the potential clinical importance of excess
CYP3A activity. Renal CYP3A content and catalytic activity in the spontaneously hypertensive rat (SHR) are higher than in the normotensive Wistar-Kyoto rat (80,
85). Treatment of SHR with the CYP3A-selective inhibitor troleandomycin lowers BP
(85). Several human diseases associated with elevated blood pressure, including
Cushing’s syndrome (86) and pre-eclampsia (80), are characterized by increased urinary excretion of 6 β-hydroxycortisol, a marker of in vivo CYP3A activity. A single
study showed increased serum 6β-hydroxycortisol levels among essential hypertensives relative to normotensive individuals (87). Another demonstrated that a high-sodium diet caused an increase in urinary 6β-hydroxycortisol among sodium- sensitive African-American subjects in contrast to a decrease among those who were sodium-resistant (88). But it is not known whether elevated 6β-hydroxycortisol levels in these conditions truly reflect an increase in CYP3A activity or merely a spillover of increased cortisol levels into the CYP3A pathway, or whether 6 β- hydroxysteroids play significant pathophysiologic roles in these diseases.
28 CYP3A5 and selective pressure
CYP3A5 expression by latitude
As discussed CYP3A5 expression is polymorphic. Why might CYP3A5 polymorphism have arisen and what might explain interpopulation differences in
CYP3A5 expression? Certainly, the impact of CYP3A enzymes on modern pharmacology cannot be invoked here. Implicit in CYP3A5*3 allelic frequency data is
the possibility of systematically higher prevalences of CYP3A5 expression among
populations that have historically lived near the equator than among those from
higher latitudes; data by Thompson, et al. bear this out. Using samples from the
Human Genome Diversity Panel-Centre d’Etude du Polymorphisme Humain (HGDP-
CEPH), these researchers show that CYP3A5*3 allele frequency correlates with latitude (Spearman’s ρ=0.612; P<0.0001) (89). It is possible that this relationship is due to genetic drift ( i.e. , to sheer chance), but the finding that CYP3A5*3 frequency correlation with latitude in this study exceeded those of 99% of microsatellite alleles at genome-wide loci may point toward more than chance association. An unusually low degree of haplotype diversity among non-African samples (Coriell Cell
Repositories) was noted at the CYP3A gene cluster- especially at CYP3A5 - which would be consistent with selection at this locus (89-91).
Toxicologic pressure
Why might CYP3A5 expression frequency have declined with increasing latitude?
Hypothetically, some deleterious effects of CYP3A5 expression may have progressively outweighed its benefits as humans moved away from the equator. The
29 diversity of CYP3A substrates makes plausible a variety of hypotheses. Certainly, the central role of the CYP3A/PXR/MDR1 system in xenobiotic metabolism suggests that chemical threats may have exerted pressure upon CYP3A expression. CYP3A enzymes have a demonstrated role in the activation of promutagenic heterocyclic amines (92-94). The procarcinogenic and proteratogenic aflatoxin B1 (AFB1) produced by Aspergillus fungal species is also activated by CYP3A enzymes, and there is an apparent CYP3A5 expresser allele dose relationship among Africans with biomarkers of AFB1 activation (95-97).
Sunlight and vitamin D
The involvement of CYP3A enzymes in vitamin D metabolism reasonably suggests an ability of CYP3A5 to modify the physiologic effects of sunlight exposure. During childhood, vitamin D deficiency can cause a number of rachitic skeletal features, including a shallow pelvis, which could negatively affect reproductive fitness (98).
High CYP3A activity might have become detrimental at progressively polar latitudes; decreasing CYP3A5 activity would then parallel the loss of melanin that may enable ultraviolet light to form cholecalciferol in people living toward the poles (99, 100).
CYP3A-mediated decreases in vitamin D may have had a secondary effect upon blood pressure and renal sodium balance- vitamin D is a negative regulator of the renin-angiotensin-aldosterone system (discussed below) (101) and vitamin D levels are inversely associated with blood pressure and the risk of hypertension (102, 103); vitamin D levels may be decreased in pre-eclamptic women (104). Lastly, vitamin D controls activity of the insulin-like growth factor (IGF) system, an important
30 determinant of birth weight (105, 106). Thus, CYP3A activity may play important
roles in the modulation of reproductive fitness by vitamin D.
Heat stress and sodium
Ideas about vitamin D and sunlight exposure parallel those concerning the impacts of heat and sodium demand on African emigrants and their descendants. The modern human (Homo sapiens sapiens ) emerged on the African continent 140,000
to 200,000 years ago, a figure based upon fossil records and mitochondrial DNA
sequences (107, 108). The oldest known fossilized skeletons of modern humans to
be found outside of the African continent- on the Arabian peninsula- date back to
100,000 years ago (109). Into the warm and humid African climate of that era arose
a relatively hairless group with a tremendous capacity to sweat that aided in
evaporative cooling but also imposed a risk for large losses of water and of sodium,
the most critical ionic regulator of mammalian osmosis and extracellular volume.
Low sodium content of tropical soil may have added to the risk of volume depletion
and dehydration (110). It is likely that, among these early humans, those who had an
enhanced ability to retain sodium and water enjoyed a significant survival
advantage. Retention of these abilities at less stressful altitudes might have harmed
reproductive success, as demonstrated by the ability of antidiuretic hormone
(vasopressin), normally produced in response to dehydration, to cause preterm
pregnant uterine contractions (111).
A role for CYP3A5 in the response to the threat of dehydration may be
supported by the finding that human CYP3A expression, like that of aquaporin-2
31 (aqp2), increases in response to ambient hypertonicity. The promoters of the
CYP3A4 , 5, and 7 and aqp2 genes all contain tonicity-responsive enhancers (112).
RAAS pathway
Central to the physiological control of sodium and water balance is the renin- angiotensin-aldosterone system (RAAS). Classically, the renal juxtaglomerular apparatus (JGA) responds to a decrease in blood pressure or in the rate of sodium delivery to the kidney by releasing renin, which cleaves hepatically-secreted AGT to produce the angiotensin I (AT-I). The angiotensin-converting enzyme (ACE), which is found primarily in pulmonary vascular beds, processes AT-I into angiotensin II
(AT-II). AT-II has a number of functions that include vasoconstriction and increasing aldosterone synthesis and secretion by adrenal zona glomerulosa cells. Aldosterone secretion leads to increased renal sodium and water reabsorption (113). Resetting of sodium and volume homeostasis causes feedback inhibition of renin release, decreasing AT-II production. The RAAS system was likely critical for early human survival. But when salt availability is not limited, excess RAAS activity may be detrimental- it has been implicated, for instance, in pre-eclampsia (114). Balance between sodium avidity’s positive and negative effects might thus have shifted with heat stress and sodium demand. Accordingly, linkage disequilibrium (LD) patterns at the AGT gene locus are suggestive of directional selection on this gene that correlates with latitude (115).
32 CYP3A5 A6986G covariance with hypertension gene candidates
The CYP3A5*3 allele (6986G), which is not physically linked to the AGT gene, may
have faced similar pressures. In the study by Thompson, et al. the frequency of an
AGT variant (M235) that predicts decreased plasma AGT levels correlated with
latitude and with CYP3A5*3 frequency (Spearman ρ=0.712 and 0.680, respectively;
both P<0.0001) (89). A separate group, led by Young, determined functional allele
frequencies among the HGDP-CEPH panel for five HTN candidate genes and
calculated standardized coefficients (β) for regression on absolute latitude. As
shown in TABLE I-B, all but one allele were more strongly correlated with latitude
than at least 96% of short tandem repeat markers (STRs) and control SNPs (116).
Using data from Thompson, et al. (89), I calculated a β coefficient of -0.58 for
CYP3A5 A6986 ( P<0.0001), indicating that each 10° increase in absolute latitude is associated with a CYP3A5*3 allele frequency increase of 0.09; the strength of its association with latitude places it among these HTN candidates.
TABLE I-B. Hypertension gene allele frequency associations with latitude Allele β AGT -6A -0.91 GNB3 825T -0.79 ENaC α -946G -0.59 CYP3A5 A6986 -0.58 ENaC γ -173G -0.47 ADRB2 47A/79C -0.40 AGT -217A 0.09 STRs and control SNPs Mean: -0.03 SD: 0.21 Range: [-0.71, 0.71]
33 Direct interactions between CYP3A activity and the RAAS pathway have not
been shown, but the CYP3A metabolic partner P-gp/MDR1 has been implicated in
RAAS modulation. P-gp transports many CYP3A substrates- including aldosterone
and cortisol (117, 118)- is expressed in the distal renal tubules and the adrenal
cortex, and is an important component of the blood brain barrier in humans and in
animal models (119-121). Subjects homozygous for an MDR1 reduced-expresser allele (3435T) gene show an exaggerated increase of serum aldosterone in response to angiotensin II infusion and fail to appropriately increase urinary sodium excretion in response to salt loading (122).
There is reason to suspect that the prehistoric CYP3A5 expression modulated physiologic control of sodium balance (25, 44). But the truth of this contention is likely unknowable. With respect to its modern importance, the most obvious hypothetical harm of high CYP3A5 expression is a risk of high blood pressure- sodium avidity in the setting of a modern abundance of dietary salt might lead to hypervolemia and/or hypertension.
Hypertension itself is a major continuous risk factor for disability and death related to disease of the coronary vessels and peripheral vasculature, cerebrovascular accidents, and renal disease. It is perhaps worth noting that not only are people of African descent the most frequent CYP3A5 expressers but also that African-Americans have the highest global rates of sodium sensitivity and HTN
(123, 124). Both hypertensive and normotensive blacks demonstrate, on average, lower plasma renin levels than whites (125). This consistent finding may indicate a
34 decreased capacity for renal sodium excretion among African-Americans or an
increased tendency toward sodium reabsorption by unidentified mechanisms.
Potentially related to increased rates of hypertension among African-
Americans is a higher frequency of pregnancies that result in low-birth weight
babies. A number of epidemiologic studies demonstrate an association between low
birth weight or prematurity and the risk of adult hypertension.
UNIFYING HYPOTHESIS
Some of the effects of 6β-hydroxycorticosterone may mimic classic mineralocorticoid activity, but it appears to activate sodium flux primarily through a distinct non-
MR/non-GR A6 cell binding site (81). Subsequent studies suggest that such a binding site may be 11 β-HSD2 (126, 127), an NADH-dependent enzyme that limits activation of MR by cortisol and corticosterone in aldosterone-sensitive epithelia by catalyzing their conversion to their respective 11-oxidized metabolites cortisone and
11-dehydrocorticosterone, which are weaker agonists for MR (Figure I-3).
35
FIGURE I-3. 11 β-HSD2 limits glucocorticoid transactivation of mineralocorticoid receptors
Genetic 11 β-HSD2 deficiency causes the syndrome of apparent mineralocorticoid excess (AME), so named because its features of hypertension and hypokalemia would suggest high aldosterone levels. To the contrary, aldosterone and renin levels in this condition are low, indicating a sodium-replete hypervolemia. Glycyrrhetinic acid derivatives such as carbenoxolone inhibit 11 β-HSD2 and cause an AME-like pseudohyperaldosteronism. The existence of an 11 β-HSD2 knockout mouse model that exhibits hypertension, hyporeninemia, and low birth weight reinforces the physiologic importance of the enzyme.
It may be speculated that similarities between 11 β-HSD2 deficiency and the syndromic presentation of sodium sensitivity, decreased plasma renin, and low birth weight among African-Americans as a group is suggestive of a possible role for reduced 11 β-HSD2 in this phenomenon. I have hypothesized that CYP3A effects in
36 mineralocorticoid-sensitive tissues reflect 6 β-hydroxysteroid inhibition of 11 β-HSD2
(FIGURE I-4). The significance of the proposed studies lies in their potential to legitimize or disprove a causative role for CYP3A activity in vertebrate renal physiology and to unmask possible molecular mechanisms underlying their effects.
The gap in the literature that these studies may remedy is the demonstration that BP and other physiological effects can be specifically attributed to CYP3A activity and are not simply the result of association due to confounding. The particular promise of the CYP3A system lies not only in their possible etiologic role in HTN but also in their capacity to metabolize medications that include antihypertensives such as the calcium-channel blockers; thus, CYP3A activity may not only influence the susceptibility to HTN but also the response to some pharmacologic therapies.
Because of this potential CYP3A “double effect”, this system may be a promising target for novel drug therapy.
37
FIGURE I-4. Proposed mechanism of 6 βββ-hydroxysteroid effects on renal sodium transport.
38
CHAPTER II: CYP3A5 GENOTYPE PREDICTS RENAL CYP3A ACTIVITY AND
BLOOD PRESSURE IN HEALTHY ADULTS
(Chapter II contains material originally printed in J Appl Physiol 2003; 95:1297-1300.
It is used with permission of the American Physiological Society.)
SUMMARY
A single nucleotide polymorphism (SNP), A6986G, in the cytochrome P450 3A5
(CYP3A5 ) gene distinguishes an expressor ( *1 ) and a reduced-expressor ( *3 ) allele and largely predicts hepatic and intestinal CYP3A5 content. CYP3A5 is the prevailing CYP3A isoform in the kidney, where CYP3A activity has been proposed to affect blood pressure (BP) by altering sodium transport. This chapter reports that among renal microsomes from 21 organ donors, those from *1/*3 individuals had at least 8-fold higher mean CYP3A5 content and 18-fold higher mean CYP3A catalytic activity than did microsomes from *3/*3 individuals (p=0.0001 and p=0.0137, respectively). Among a group of 25 healthy African-American adults, there were significant associations between the A6986G SNP and systolic BP (SBP; p=0.0007), mean arterial pressure (MAP; p=0.0075), and creatinine clearance (CrCl; p=0.0035).
These associations remained significant when sex, age, and body mass index (BMI) were taken into account. The mean SBP of homozygous CYP3A5 expressors ( *1/*1 )
exceeded that of homozygous non-expressors ( *3/*3 ) by 19.3 mmHg. It is speculated whether a high CYP3A5 expressor allele frequency among African-
Americans may contribute to a high prevalence of sodium-sensitive hypertension in this population.
INTRODUCTION
Cytochrome P450 3A (CYP3A) homologs are variably expressed in human and rat liver (25, 128), kidney (28, 80), adrenal gland (21), and anterior pituitary gland (33) .
40 The physiologic effects of CYP3A enzyme activity have not been clearly defined, but
some observations support a role in the control of blood pressure (BP). CYP3A
content and catalytic activity in the kidneys of spontaneously hypertensive rats
(SHR) are higher than in normotensive Wistar-Kyoto rats (80, 85). Treatment of SHR
with the CYP3A inhibitor troleandomycin lowers BP (85). Several human diseases
associated with elevated BP, including Cushing’s syndrome (129) and pre-eclampsia
(80), are characterized by increased urinary excretion of 6 β-hydroxycortisol, a marker of in vivo CYP3A activity (85, 130). Plasma levels of 6β-hydroxycortisol have been reported to be elevated in essential hypertensives (87)
A role for CYP3A enzymes in blood pressure control appears scientifically plausible. CYP3A-mediated 6 β-hydroxylation is a minor metabolic pathway for
steroids, including the glucocorticoids cortisol and corticosterone. 6β-hydroxysteroid
products of CYP3A-catalyzed reactions stimulate sodium transport across A6 toad
kidney cells and sodium retention in rats (80-82). Previous evidence indicates 6β-
hydroxycorticosterone modulation of A6 cell sodium transport by acting through an
unidentified binding site (80, 81). Consistent with data from rat kidney (80, 131),
immunostaining for CYP3A highlights human distal tubules and collecting ducts (84),
the principle sites at which aldosterone stimulates sodium reabsorption. Renal
CYP3A activity, along with that of 11 β-hydroxysteroid dehydrogenase type 2, has been proposed to regulate glucocorticoid occupancy of the mineralocorticoid receptor (MR) (83).
It has been established that, among all CYP3A isoforms, the expression of
CYP3A5 prevails in the human kidney (28, 37). The discovery of genetic variants
41 underlying polymorphic CYP3A5 activity has made possible non-invasive studies of
the contribution of polymorphic CYP3A5 expression to human renal CYP3A activity
and blood pressure. CYP3A5 expression in liver (25) and intestine (26) is largely
determined by the A6986G SNP that distinguishes the CYP3A5*1 (“expressor”)
allele from the *3 (a “reduced-expressor”) allele. This study reports that A6986G
predicts renal CYP3A5 activity among mostly Caucasian organ donors and BP and
CrCl among a group of healthy young African-American adults.
METHODS
All studies were approved by the University of North Carolina (UNC) Committee on
the Protection of Human Research Subjects.
Renal microsome studies: CYP3A catalytic activity and CYP3A5 immunoreactivity
were assayed in renal tissue samples from 21 organ donors- 17 were Caucasian,
one was Hispanic, and three were of unknown ethnicity. All methods were described
previously (26). CYP3A5 genotypes were determined by direct genomic DNA sequencing (see below). Microsomes were isolated by differential centrifugation.
CYP3A5 content in 50 µg of microsomes was measured by Western blot with a
CYP3A5-specific antibody (BD Gentest; Woburn, MA); undetectable bands were assigned a value of 0.25 pmol/mg, the limit of quantitation (LOQ; Figure 1A).
Midazolam (MDZ) 1’-hydroxylation was measured after a 15-minute incubation of
200 µg protein with 8 µM MDZ; microsomes with undetectable activity were given the LOQ value of 0.04 pmol/min/mg.
42 Human subjects: 89 unrelated self-identified healthy African-American volunteers between 18 and 65 years of age were genotyped for the CYP3A5 *3 allele using previously-described methods, as below (25). For all subjects, in-person informed consent was obtained.
Clinical measurements: A subset of this group, consisting of 25 healthy individuals
(age range: 18-52 years) who volunteered to be screened for a pharmacogenetic study, were tested for the ancillary hypothesis of CYP3A5 genotype association with blood pressure and creatinine clearance. Subjects were brought to the UNC General
Clinical Research Center (GCRC), where they were examined and donated blood and urine samples. GCRC nurses who were blind to subject genotypes and medical histories performed and recorded all clinical measurements. Creatinine clearance was calculated by the Cockcroft-Gault equation (132).
Genomic DNA collection and isolation: Subjects were instructed to swish vigorously with 10 mL Scope® mouthwash for 1 minute and expel the rinse into 50- mL conical vials. Samples were placed at room temperature for a maximum of 48 hours until further processing. DNA was extracted from rinse samples with the use of either a QIAamp DNA Blood Mini Kit (Qiagen, Inc.; Valencia, CA) or a Puregene
DNA Isolation Kit for mouthwash samples (Gentra Systems) according to the manufacturer’s instructions. Total DNA concentrations were determined by spectrophotometry at 260 nm.
43 CYP3A5 genotype determinations: The CYP3A5 *3 variant was identified by
polymerase chain reaction (PCR). The forward primer for this reaction was 5'-
CCTGCCTTCAATTTTTCACTG-3', which anneals at position 22719 (Genbank no.
AC005020); the reverse primer was 5'-GCAATGTAGGAAGGAGGGCT-3', which anneals at position 24161 (Genbank no. AC005020). PCR was performed as follows:
50 ng DNA was initially denatured at 92°C for 5 minutes followed by 35 cycles of denaturation at 92°C for 30 seconds, annealing at 61°C for 30 seconds, and synthesis at 72°C for 2 minutes. The final elongation was carried out for 5 minutes at
72°C. The unincorporated nucleotides and primers were removed as described
above. Sequencing was carried out on an ABI Prism 3700 Automated Sequencer.
The nested primers used to sequence were 5'-TAATATTCTTTTTGATAATG-3' (f)
and 5'-CATTCTTTCACTAGCACTGTTC-3' (r). Sequences were assembled using
the Polyphred program (University of Washington, Seattle), which automatically
detects the presence of heterozygous SNP substitutions by fluorescence-based
sequencing of PCR products.
Statistical analyses: Microsomal CYP3A5 content and MDZ 1’-hydroxylation were
compared between genotypes with the Wilcoxon signed-rank test for non-parametric
distributions. Differences between human subject genotype groups were assessed
by ANOVA and Fisher’s exact test for continuous and categorical variables,
respectively.
44 RESULTS
CYP3A5 genotype predicts renal CYP3A activity: The average CYP3A5 content
(1.98 pmol/mg; n=5) of microsomes from *1/*3 kidneys exceeded the average of those from *3/*3 kidneys (n=16; p=0.0001), which was at or below the limit of quantitation (Figure I-IA). None of the kidneys were *1/*1 . CYP3A4 was not detected with a CYP3A4-specific antibody in any of the microsomal preparations. Mean microsomal CYP3A activity, reflected by MDZ 1’-hydroxylation, was 18-fold higher in
*1/*3 kidney microsomes (8.04 pmol/min/mg) than in those from *3/*3 kidneys (0.43 pmol/min/mg; p=0.0137; Figure I-IB). The *1/*3 outlier indicated by arrows in Figure I also bore a *7 allele and was probably a compound heterozygote. Removal of this
outlier slightly lowered p values.
CYP3A5 genotype predicts blood pressure: The CYP3A5 A6986 (*1 allele) frequency among the 89 African-Americans was 0.7. Among the 25-subject subset
(TABLE II-A), CYP3A5 genotype associated with seated systolic BP (SBP), mean arterial pressure (MAP), the product of SBP and heart rate (SBP*HR, an indicator of left-ventricular oxygen consumption), and Cockcroft-Gault creatinine clearance
(CrCl). The *1/*1 group averaged the highest value for each measure. Average *1/*1
SBP exceeded that of the *3/*3 group by 19.3 mm Hg (Figure I-II) and a gene-dose effect was apparent. CYP3A5 genotype associated significantly with combined BP strata (p=0.0048; TABLE II-A) from the Sixth Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC-
45 VI; N=Optimal or Normal [SBP <130 and DBP <85]; H=High-Normal or higher [SBP
≥130 or DBP ≥85]) (133).
Sex-specific analysis detected CYP3A5 genotype associations with SBP,
MAP, and estimated CrCl among females (TABLE II-A); similar trends were noted among the smaller sample of males, but these did not reach statistical significance.
In multiple regression analyses, sex and genotype accounted for 70% of the
variability in SBP. When compared to non-*1/*1 females, *1/*1 males showed more
than a 20-fold increased risk of high-normal or higher BP (p=0.0002).
Subject age, averaging roughly 25 years, did not vary between genotype
groups. Age and body mass index (BMI) effects upon BP were non-significant.
Genotype association with BMI, diastolic blood pressure (DBP), pulse pressure (PP),
and HR did not reach statistical significance.
DISCUSSION
The CYP3A5*1 allele associates with CYP3A5 expression in the human kidney- a
finding which was previously reported for liver and intestine. However, in the liver
and intestine, there is also substantial CYP3A4 expression (25, 26). As a result,
hepatic and intestinal aggregate CYP3A activities associate only weakly with the
CYP3A5*1 allele. In contrast, CYP3A4 was not detected in renal microsomes, and
mean CYP3A activity differed markedly between CYP3A5 genotype groups.
The preliminary finding of CYP3A5 genotype association with resting BP
among healthy adults may be consistent with a role for CYP3A enzymes in BP
control. Young adults with supernormal BP have an increased long-term risk of
46 death due to cardiovascular and coronary heart disease (134); the identification of common genetic polymorphisms relevant to BP control is thus an important line of investigation. If shown true, this conjecture might portend a role for inhibition of
CYP3A5 activity or expression in the treatment of some forms of hypertension.
The CYP3A5 A6986 allele frequency among this cohort of African-Americans agrees roughly with a previous report (47). This frequency exceeds those among all other ethnic populations studied to date (25, 47). Inter-ethnic differences in the prevalence of sodium-sensitivity (124) parallel those of hypertension (123), with
African-Americans having the highest global prevalence of each. A possible link between CYP3A5 activity and the high prevalence of sodium-sensitive hypertension among African Americans may merit further study.
47 6 A 18 B 16 5 14
4 12
10 3 8
2 6
CYP3A5 content (pmol/mg) 4 1 2 1'-hydroxylation formation (pmol/min/mg) 0 0 *1/*3 *3/*3 *1/*3 *3/*3 n=5 n=16 n=5 n=16
FIGURE II-1. CYP3A activity and CYP3A5 content in *1/*3 and *3/*3 renal microsomes from 21 organ donors. A: CYP3A5 content differs between *1/*3 and *3/*3 renal microsomes (p=0.0001). B: MDZ 1’-hydroxylation differs between *1/*3 and *3/*3 renal microsomes (p=0.0137). Analysis of DNA from the *1/*3 outlier, indicated by arrows, revealed the inactivating *7 variant. Bars show average values.
48 160
150
140
130
120
110 Systolic Blood Pressure (mm Hg)
100 *1/*1 *1/*3 *3/*3
n=9 n=9 n=7
FIGURE II-2. Seated systolic blood pressure among 25 healthy African American adults by CYP3A5 genotype. SBP varies among genotypic groups (p=0.0007). Nurses blinded to subject genotypes performed all measurements. Bars show average values.
49 TABLE II-A. Blood pressure and creatinine clearance by CYP3A5 genotype *1/*1 *1/*3 *3/*3 p All Subjects n=9 n=9 n=7 Age (years) 24.5 (10.7) 25.0 (8.0) 25.0 (8.5) 0.9933 BMI (kg/m 2) 30.3 (8.1) 23.9 (4.6) 26.2 (2.8) 0.0851 SBP (mm Hg) 136.0 (7.9) 121.6 (8.4) 116.7 (11.0) 0.0007 DBP (mm Hg) 71.4 (5.1) 68.1 (10.1) 63.3 (6.5) 0.1283 MAP (mm Hg) 92.9 (3.8) 85.9 (9.0) 81.1 (6.5) 0.0075 PP (mm Hg) 64.6 (10.3) 53.4 (7.0) 53.4 (10.6) 0.0309 HR (min -1) 78.9 (15.3) 73.9 (9.0) 70.6 (8.3) 0.3633 SBP*HR (mm Hg*min -1) 10743.1 (2253.3) 8948.6 (1006.2) 8189.6 (810.8) 0.0088 JNC-VI stratum (N/H) 2/7 8/1 6/1 0.0048 CrCl (ml/min) 147.2 (30.9) 106.9 (23.7) 110.4 (10.5) 0.0035 Females n=4 n=6 n=5 Age (years) 20.8 (2.8) 20.8 (2.6) 25.8 (9.6) 0.3426 SBP (mm Hg) 130.8 (6.2) 117.5 (3.9) 112.2 (9.1) 0.0039 MAP (mm Hg) 91.9 (3.8) 82.5 (2.9) 80.2 (7.6) 0.0127 CrCl (ml/min) 156.9 (16.6) 114.7 (24.3) 111.0 (10.4) 0.0059 Males n=5 n=3 n=2 Age (years) 27.6 (14.0) 33.3 (9.1) 23.0 (7.1) 0.6439 SBP (mm Hg) 140.2 (6.8) 129.7 (9.8) 128.0 (5.7) 0.1355 CrCl (ml/min) 139.5 (39.2) 91.4 (15.4) 109.0 (14.9) 0.1661 Values are shown as mean (SD). BMI, body mass index; SBP, systolic blood pressure; DBP, diastolic blood pressure; mean arterial pressure (MAP); PP, pulse pressure; HR, heart rate; CrCl, creatinine clearance; JNC-VI, combined BP stratum from the Sixth Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure; N, Optimal or Normal (SBP <130 and DBP <85); H, High-Normal or higher (SBP ≥130 or DBP ≥85).
50
CHAPTER III: CYP3A5 HAPLOTYPE RECONSTRUCTION
SUMMARY
Cytochrome P450 3A5 (CYP3A5) is a member of the CYP3A enzyme subfamily,
which catalyzes the metabolism of the majority of marketed drugs. CYP3A5 is
expressed polymorphically between individuals, and the frequency of expression
varies between ethnic groups. An individual’s ability to express CYP3A5 is defined
by known single nucleotide polymorphisms (SNPs) in the CYP3A5 gene. The
A6986G SNP distinguishes the CYP3A5*1 (or “full-expresser”) allele from the dysfunctional variant *3 allele, the major expression-determining allele common to all populations. Considerable interest has arisen in the potential of CYP3A5 genotype as a predictor of drug metabolism and as a disease risk factor. Among blacks, the predictive power of the *3 allele for CYP3A5 expression may lowered by the presence in this group of two additional alleles, called *6 and *7 . In this chapter, an expectation-maximization (EM) algorithm is used to reconstruct CYP3A5 haplotypes among a sample of African-Americans who were genotyped for the three dysfunctional alleles. This method deduced the presence of four CYP3A5 haplotypes: the full-expresser haplotype and three single-variant haplotypes. This finding may obviate the need for future molecular CYP3A5 haplotyping assays.
Statistical haplotype reconstruction may restore the predictiveness of CYP3A5 SNPs and lower genotyping costs.
INTRODUCTION
The CYP3A subfamily consists of CYP3A4 and CYP3A5 in adults. While CYP3A4 expression is universal, CYP3A5 is expressed by a minority of individuals in most populations but by a majority of blacks of African descent (25, 53, 55). Interpersonal
52 variance in CYP3A5 activity may be clinically important. There is a potential for
CYP3A5 activity to predict an individual’s ability to metabolize drugs. For instance, a
number of studies have demonstrated a higher dose requirements for the
immunosuppressant CYP3A substrate tacrolimus among CYP3A5-expressing organ
recipients, compared to non-expressers (36, 38, 135-137). CYP3A5 and CYP3A activity may additionally have roles in the modification of disease risk, as suggested by CYP3A metabolism of estrogens (138-144), androgens (145-148), and corticosteroids (86, 149-152). There have been intriguing but inconstant associations of CYP3A5 genotype with cancers of the prostate, lung, and breast (153-158); hematological malignancies (159, 160); early puberty (161); and blood pressure (30,
54, 162-173).
The genetic basis for the bulk of CYP3A5 polymorphism was first described by Kuehl, et al. (25), who discovered an A-to-G transition (A6986G) that activates an alternative splice-acceptor site in the third intron of the CYP3A5 gene. The presence of guanine at this position defines the *3 allele, a dysfunctional variant that produces negligible amounts of functional enzyme, as compared to the functional *1 allele.
Inter-group differences in the prevalence of CYP3A5 expression mainly reflect variation in the frequency of *3, which is 0.85-0.95 among whites (25, 55), 0.76-0.78 among Chinese (48, 56) and 0.2-0.3 among blacks (25, 30, 55). The *3 allele predicts whether CYP3A5 is expressed in the liver (25), intestine (26), and kidney
(30). But CYP3A5 genotype at the 6986 site may have lower predictive power for blacks than for other groups.
53 Kuehl, et al. and Hustert, et al. identified two other low-expressor alleles, *6 and *7 , that respectively reflect G14690A and 27131-32insT SNPs. These are specific to blacks at frequencies of roughly 0.15 for *6 and 0.10 for *7 (25, 47). The
G14690A SNP causes aberrant splicing, while 27131-32insT causes a frame shift
resulting in premature termination of transcription. Each of the resulting alleles has
been shown to decrease CYP3A5 protein expression (25, 30, 45, 47).
The presence of multiple dysfunctional SNPs in a particular gene can lower the
power of the genotype at any individual locus in the gene to predict phenotype. In
such situations, it may be important to determine haplotype. Experimental methods
for directly determining haplotypes, such as the creation of yeast artificial
chromosomes (174) or the creation of mouse-human hybrid cell lines (175), can be
too technically difficult, laborious, or expensive for large-scale studies. While a
subject’s haplotype may also be deduced from genotypes of the subject’s family
members (176), collection of these additional samples may be impractical at least. It
may also be possible to reconstruct haplotypes by using statistical methods to infer
phase from genotypes at linked loci. One of the most popular approaches for this is
based upon maximum likelihood and uses the expectation-maximization (EM)
algorithm (177-179), which can produce accurate estimates of haplotype frequencies
for a wide range of settings (180).
The EM algorithm was used to resolve CYP3A5 genotypes at the 6986 ,
14690 , and 27131 positions among a group of African-Americans into four haplotypes. The implications of CYP3A5 haplotyping for CYP3A phenotype prediction will be discussed.
54 METHODS
Human subjects: 117 unrelated self-identified African-American adults were
genotyped for the CYP3A5 *3 , *6 , and *7 SNPs. In=person informed consent was obtained for all subjects. The study was approved by the Institutional Review Board of the University of North Carolina School of Medicine. Genotypes were obtained by genomic DNA sequencing, as described (25).
CYP3A5 genotype determinations: CYP3A5 exon 3B was amplified for
identification of the CYP3A5 *3 variant by polymerase chain reaction (PCR). The
forward primer for this reaction was 5'-CCTGCCTTCAATTTTTCACTG-3', which
anneals at position 22719 (Genbank no. AC005020); the reverse primer was 5'-
GCAATGTAGGAAGGAGGGCT-3', which anneals at position 24161 (Genbank no.
AC005020). PCR was performed as follows: 50 ng DNA was initially denatured at
92°C for 5 minutes followed by 35 cycles of denaturation at 92°C for 30 seconds,
annealing at 61°C for 30 seconds, and synthesis at 72°C for 2 minutes. The final
elongation was carried out for 5 minutes at 72°C. The unincorporated nucleotides
and primers were removed as described above. Sequencing was carried out on an
ABI Prism 3700 Automated Sequencer. The nested primers used for sequencing
were 5'-TAATATTCTTTTTGATAATG-3' (f) and 5'-CATTCTTTCACTAGCACTGTTC-
3' (r). The primers used to amplify the exon 7 deletion in CYP3A5 *6 were 5'-
GGTCATTGCTGTCTCCAACC-3' (f) and 5'-TCAAAAACTGGGGTAAGGAATGT-3'
(r). The PCR was performed as above with an annealing temperature of 59°C.
Sequencing was carried out using nested primers 5'-TATGACTGGGCTCCTTGACC-
55 3' (f) and 5'-TGGAATTGTACCTTTTAAGTGGA-3' (r). PCR for the *7 insertion was
performed with the following primers: 5'-AAATACTTCACGAATACTATGATCA-3' (f)
and 5'-CAGGGACATAATTGATTATCTTTG-3' (r). Sequences were assembled using
the Polyphred program (University of Washington, Seattle), which automatically
detects the presence of heterozygous SNP substitutions by fluorescence-based
sequencing of PCR products.
Haplotype reconstruction: CYP3A5 genotypes at each locus were assessed for
Hardy-Weinberg equilibrium and were subjected to the EM algorithm with Arlequin
2.0 software (181). The software was programmed to allow 300 initial conditions for haplotype frequency estimation, 200 initial conditions for the linkage disequilibrium test with 20,000 permutations, and 200 initial conditions for the bootstrap procedure with 100,000 replicates.
RESULTS
The observed CYP3A5*3 , *6 , and *7 allele frequencies among 117 African-
Americans were 0.329, 0.150, and 0.103, respectively; these are consistent with previous studies (25, 47). Complete linkage disequilibrium (D’ =1.0) was observed between each pair of loci. The frequencies and estimated standard deviations of haplotypes deduced by EM are shown in Figure III-I. Of the 8 possible haplotypes that might be constructed from the 3 biallelic CYP3A5 loci (2 3 = 8), only the full- expresser ( *1 -*1 -*1 ) and the three singly-variant haplotypes are detected. The deduced frequency of the full-expresser haplotype (*1-*1-*1 ) is 0.426 (0.035). The
56 distributions of diplotypes (haplotype combinations) among CYP3A5 expression phenotypes are shown in FIGURE III-1.
TABLE III-A. CYP3A5 allele frequencies among 117 African-Americans
Std. Genotype (N) Allele Frequency HWE χ2 P Error *1/*1 *1/*X *X/*X *3 (6986G) 0.329 0.043 54 49 14 0.311 0.675 *6 (14690A) 0.150 0.033 83 33 1 1.382 0.240 *7 (27131insT) 0.103 0.028 94 22 1 0.054 0.817
TABLE III-B. CYP3A5 haplotype frequencies among African-Americans
Haplotype Constituent Alleles Frequency Std. Dev. *1-*1-*1 6986A-14690G-27131wt 0.426 0.035 *3-*1-*1 6986G-14690G-27131wt 0.327 0.033 *1-*6-*1 6986A-14690A-27131wt 0.158 0.026 *1-*1-*7 6986A-14690G-27131insT 0.089 0.020
57 Functional Homozygote (H) *3-*1-*1/*3-*1-*1 16.2% 12.0 (36.8) *1-*1-*1/*1-*1-*1 Nonfunctional 16.2 (100) Homozygote (L) *3-*1-*1/ *1-*6-*1 32.5% 8.5 (26.3) *1-*1-*1/*1-*1-*7 *1-*1-*7/ *3-*1-*1 8.5 (16.7) 8.5 (26.3) *1-*6-*1/ *1-*6-*1 1.7 (5.3) *1-*1-*1/*1-*6-*1 *1-*1-*7/ *1-*6-*1 17.9 (35.0) 0.9 (2.6) *1-*1-*1/*3-*1-*1 24.8 (48.3) *1-*1-*7/ *1-*1-*7 0.9 (2.6) Heterozygote (I) 51.3%
FIGURE III-1. Reconstructed CYP3A5 diplotype and phenotype frequencies. The frequency of each diplotype deduced by EM is indicated; the proportion of each diplotype among its respective functional category is shown in parentheses. H: high CYP3A5 activity; I: intermediate activity; L: low activity
The presence of multiple unphased causative SNPs threatens to complicate attempts to associate gene function with phenotype. It is hoped that haplotyping can improve the power to detect gene-phenotype associations. Using the data presented in Chapter II, comparison of power versus sample size for homozygous expresser and nonexpresser groups based upon genotype at 6986 or haplotype shows mixed results (FIGURE III-2). Use of CYP3A5 haplotype is predicted to slightly reduce power at a given sample size for systolic blood pressure, but it is predicted to greatly increase power to detect differences in body mass index or creatinine clearance.
58
A B
C
FIGURE III-2. Power versus sample size for CYP3A5 genotype and haplotype. Curves compare power as a function of sample size between genotype at CYP3A5 A6986 (bold line) and CYP3A5 haplotype (light line). A. systolic blood pressure. B. body mass index. C. creatinine clearance.
DISCUSSION
If taken to be representative of African-Americans broadly, these data would imply that CYP3A5 expressers are roughly 67% of this group, by the Hardy-Weinberg equilibrium equation. This figure exceeds estimated proportions of expressers among other groups- 30-40% among Asian groups, 10-20% among whites- but is much lower than estimates of roughly 90% based upon the *3 allele in this and other studies. Among 6986 *1/*1 homozygotes, less than 25% would have two truly
59 functional CYP3A5 genes, nearly 75% would have only one, and 3% would be non- expressers. Of those deemed to be expressers based upon 6986 genotype ( *1/*1 or
*1/*3) nearly 25% would be true non-expressers. Less than 40% of true non- expressers would be identified on the basis of a *3/*3 genotype. In a hypothetical scenario of CYP3A5 expression perfectly predicting a phenotype, the presence of true non-expressers in these proportions among presumed expressers would lower predictiveness by 25%. In addition to position 6986, the determination of genotypes
14690 and 27131 and the haplotype combinations among these sites is likely to be important in evaluating associations between CYP3A5 expression and various phenotypes among black subjects.
African-American CYP3A5 haplotypes among these sites can be inferred
from population data with the E-M algorithm. This computational approach may
improve the predictive power of CYP3A5 genotype and likely renders molecular
haplotyping methods unnecessary. The apparent lack of recombination between
these positions is perhaps not surprising given the relatively short distances between
them (<21 kb). Confirmation of non-recombination among these sites may also be
used to lower the costs of CYP3A5 genotyping by allowing analysis of one locus at a
time and stopping once two variant alleles have been identified for a particular
subject, thus reducing the number of reactions that must be performed to accurately
predict an individual’s phenotype.
60
CHAPTER IV: IN VITRO STUDIES OF 6 β-HYDROXYCORTICOSTERONE
SUMMARY
Excessive sodium reabsorption by the kidney may cause increased plasma volume
and a resultant hypertension. Sodium sensitivity, independently and as a cause of
hypertension, is associated with an increased risk of premature death. Cytochrome
P450 3A (CYP3A) enzymes have been proposed to alter renal sodium reabsorption
by catalyzing the conversion of glucocorticoids such as cortisol or corticosterone to
6β-hydroxylated metabolites with altered activity. The mechanisms by which these metabolites act in the kidney have not previously been identified.
This chapter details an exploration of the effects of corticosterone and 6β-
hydroxycorticosterone on gene expression in cultured renal collecting duct cells and
an evaluation of the hypothesis that 6β-hydroxycorticosterone exhibits
physiologically relevant inhibition of 11 β-hydroxysteroid dehydrogenase type 2 (11 β-
HSD2), which prevents inappropriate activation of the mineralocorticoid receptor
(MR) by glucocorticoids. The results show that, on its own, 6β-hydroxycorticosterone
does not markedly influence epithelial sodium channel α-subunit (ENaC-α) gene
expression but increases ENaC-α mRNA levels when it is applied in addition to B, its
parent compound. It is suggested that this activity reflects the ability of 6β-
hydroxycorticosterone to inhibit inactivation of corticosterone by the 11 β-HSD2
enzyme- a contention which is supported by enzyme kinetic data that show that 6β-
hydroxycorticosterone limits corticosterone conversion in a manner consistent with
reversible, competitive inhibition.
62 Exploration of this phenomenon may provide insights into the renal control of
electrolyte balance and blood pressure and may suggest new pharmacologic targets
for antihypertensive therapy and the control of sodium sensitivity.
INTRODUCTION
CYP3A enzymes catalyze the oxidative metabolism of a wide variety of lipophilic
molecules, including steroids. The results of animal and in vitro studies indicate that
CYP3A-catalyzed 6β-hydroxylation of corticosterone in the kidney can alter renal
sodium transport. 6β-hydroxycorticosterone increases sodium transport across
cultured A6 Xenopus laevis toad kidney cells and induces sodium retention in
spontaneously hypertensive rats (SHR). Some effects of 6β-hydroxycorticosterone
may mimic classic mineralocorticoid activity, but 6β-hydroxycorticosterone appears
to act through a binding site for corticosterone that is distinct from MR or the
glucocorticoid receptor (GR) (81). The identity of this binding site remains unknown.
Subsequent studies demonstrate that some high-affinity binding sites for
corticosterone in mammalian renal collecting duct consist of 11 β-hydroxysteroid
dehydrogenase type 2 (11 β-HSD2) (126, 127). 11 β-HSD2 is an NAD +-dependent
enzyme that limits glucocorticoid activation of MR in aldosterone-sensitive epithelia
by catalyzing the conversion of cortisol and corticosterone to their respective 11-
oxidized metabolites (cortisone and 11-dehydrocorticosterone), which are weaker
MR agonists.
Human genetic absence of 11 β-HSD2, encoded by the HSD11B2 gene, causes the syndrome of apparent mineralocorticoid excess (AME), so named
63 because its classic features of hypertension and hypokalemia are suggestive of high
aldosterone levels. But aldosterone and renin levels in AME are low, reflecting a
sodium-replete state caused by cortisol-mediated MR activation (182, 183).
The genomic actions of MR action can be divided into early and late phases.
Agonist-bound MR acutely (as early as 30 minutes) increases transcription of genes
such as the serum-and-glucocorticoid regulated kinase-1 (SGK1) that regulate the
activities of the Na +/K +-ATPase and the amiloride-sensitive epithelial sodium channel
(ENaC), which participate in distal tubular sodium reabsorption and exert final regulatory control over sodium homeostasis. MR agonism subsequently leads to induction of mRNAs for Na +/K +-ATPase and ENaC subunits (184, 185).
Mice in which the HSD11B2 gene has been inactivated are hypertensive and hypokalemic- a finding that reinforces the enzyme’s physiologic importance (186,
187). Milder genetic or acquired deficiencies in 11 β-HSD2 activity can also cause clinical phenotypes. Ingestion of licorice and glycyrrhetinic acid derivatives such as carbenoxolone can cause an AME-like pseudohyperaldosteronism among susceptible individuals by inhibiting 11 β-HSD2 (188).
11 β-HSD2 is co-expressed with CYP3A isoforms in MR-expressing segments of mammalian renal distal tubules and collecting ducts (80, 84, 126, 189). In addition to glucocorticoids, the two enzymes share some affinity for structurally-related molecules. For instance, bile acid CYP3A substrates and products can competitively inhibit 11 β-HSD2 activity (190, 191). In this chapter, I test the hypothesis that 6β- hydroxycorticosterone competitively inhibits 11 β-HSD2 and that its effects on sodium transport partly reflect this inhibition.
64 METHODS
Cell Culture: mIMCD-K2 cells, derived from inner medullary collecting ducts of
SV40-transgenic male mice (192), were kindly provided by the laboratory of Dr.
Bruce Stanton (Dartmouth University) at passage 14. Cells were seeded at a density of 4000 cells/cm 2 and grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), penicillin (100,000 U/liter), and streptomycin (100,000 µg/liter); all were purchased from Gibco/Invitrogen. Cells were maintained in 24- or 48-well plates (Costar) in incubators maintained at 37°C and
5% CO 2 until they reached at least 90% confluence.
For gene expression studies and enzyme assays, cells between passages 19 and 22 were grown to 90% confluence maintained in 24- or 48-well tissue culture plates (Costar). The FBS used in these studies was charcoal-dextran-stripped to remove serum steroids, in accordance with published methods (193), by incubating at 45°C for 30 min with an equal volume of 0.25% activated charcoal/0.025% dextran in 0.01 M Tris/HCl (pH 8.0 at 4°C); charcoal was removed by centrifugation.
All steroids and chemicals used for gene expression and enzyme assays were purchased from Sigma-Aldrich, except for 6 β-hydroxycorticosterone
(Steraloids, Inc.; Newport, RI). Aldosterone, corticosterone, 6β- hydroxycorticosterone, spironolactone, and mifepristone (RU486) were stored as stock solutions (10 mM in 100% ethanol) at -20°C until use. Carbenoxolone was stored in water (10 mM) at 4°C.
65 Gene Expression Studies: Steroids and other chemicals were diluted to the
indicated concentrations in DMEM with 10% fetal bovine serum that was treated with
charcoal-dextran to remove steroids. Final ethanol concentrations were 0.1% in all
preparations. Suspensions were added to cells for the indicated times, after which
RNA was extracted.
TaqMan RT-PCR: Cells in each well were lysed with 200 L of Nucleic Acid
Purification Lysis Solution (Applied Biosystems, Foster City, CA) diluted by half with phosphate-buffered saline (Gibco). RNA was isolated in an RNA purification tray with the ABI Prism 6700 automated nucleic acid workstation (PE Biosystems). RT-
PCR was performed in the ABI Prism 7700 sequence detector (PE Biosystems); cDNA was synthesized by reverse transcription prior to PCR in the 7700 system.
During amplification, fluorescences of FAM, TAMRA, and ROX (passive reference dyes) were measured by the 7700 sequence detector. For mRNA expression, each sample’s β-actin C t was used as the standard. Relative mRNA levels were
-(C gene of interest – C β-actin) calculated with the ddC t method: relative expression = 2 t t .
TaqMan primer and probe sequences are shown in TABLE IV-A.
66 TABLE IV-A. List of TaqMan primers and probes Gene Type Sequence (5’-3’) HSD11B1 Forward AGACACAGAAACAGCTATGAAG Reverse TGATGATCTCCAGGGCGCA Probe f-TGACGCCCTAGCTTCTCCCAAGGAG-q HSD11B2 Forward GACATCAGCCGTGTTCTGGA Reverse GGCCAGCGTTGTTAACCAGA Probe f-ATCACCAAGGCCCACACGGCC-q MR Forward GTGTCAAGCTCTACTTTACGA Reverse ACACCCAGAAGCCTCATCT Probe f-CTGGATCCTCAAGACCTTCCAAGATC-q GR Forward ACATGTTAGGTGGGCGCCA Reverse GTGTAAGTTTCTGAATCCTGGTA Probe f-CCTTGCCCATTTCACTGCGGCAATC-q ENaC α Forward AGCGCGTCTTCCAGTGTAC Reverse GATTTGTTCTGGTTGCACAGT Probe f-CAACAATCCCCAAGTGGACAGGAAGG-q ENaC γ Forward CACTGGTCGGAAGCGGAAA Reverse GCACAGTCAGAGGTGTCATT Probe f-ACAAGGCTTCTAATGTCATGCACGTTC-q PGK-CYP3A5 Forward CTTCAGCTGATGATTGACTCC Reverse TATTGACTGGGCTGCGAGCT Probe f-TCGAAAGAAACTGAGTCCCACAAAGCTCTGT-q CYP3A11 Forward AGAACTTCTCCTTCCAGCCTTGTA Reverse GAGGGAGACTCATGCTCCAGTTA Probe f-CTAAAGGTTGTGCCACGGGATGCAGT-q PPAR γ Forward AGACATGAGCCTTCACCCC Reverse AGAAGGAACACGTTGTCAGC Probe f-CAAGTCCTTGTAGATCTCCTGGAGC-q Endothelin-1 Forward TGCCACCTGGACATCATCTG Reverse ACGCTTGGACCTGGAAGAAC Probe f-TCCCGAGCGCGTCGTACCGTATG-q β-Actin Forward CTGCCTGACGGCCAGGTC Reverse CAAGAAGGAAGGCTGGAAAAGA Probe f-CACTATTGGCAACGAGCGGTTCCG-q f, Reporter dye (FAM:6-carboxyfluorescein); q, Quencher dye (TAMRA: 6-carboxytetramethyl1-rhodamine)
Cell Homogenate Enzyme Assays: Cells were scraped into a homogenization buffer containing 250 mM sucrose and 10 mM Tris-HCl (pH 7.5) with Protease
67 Inhibitor Cocktail (Sigma). Cells were disrupted by sonication. Homogenates were
incubated for 3 h at 37°C with 10 nM corticosterone and 2nM [1,2,6,7-3H]-B (Sigma;
70-100 Ci per mmol) in homogenization buffer with and without 1 mM NAD. Samples were incubated for 3 h at 37°C and the reaction was stopped on ice. Steroids were extracted by adding two volumes of ethyl acetate. Samples were vortexed vigorously for 1 min and then centrifuged at 10,000 xg for 5 min. The upper ethyl acetate layer was removed, extraction was repeated, and the extracts were pooled. Ethyl acetate was evaporated from pooled extracts by centrifuging under vacuum pressure. The residue was dissolved in a small amount of ethanol that contained 10 nmol each of unlabeled corticosterone and 11-dehydrocorticosterone. 11 β-HSD2 activity was assessed by thin-layer chromatography (TLC) (194). Samples were dotted onto silica gel TLC plates with a 254-nm fluorescent indicator (Whatman). Unlabeled steroid standards were added in separate lanes. Plates were developed in glass beakers containing a mobile phase of 92% chloroform/8% ethanol and dried at room temperature. Plates were visualized under short-wave ultraviolet light; fluorescence- quenched spots aligning with corticosterone and 11-dehydrocorticosterone standards were marked, cut from the plates, and placed separately into vials containing Scintiverse BD Cocktail (Fisher Scientific). After a brief shaking, vials were placed in a LKB RackBeta scintillation counter and counts per minute (CPM) were recorded. The percent conversion for each sample was calculated by dividing the 11-dehydrocorticosterone CPM value by the sum of the corticosterone and 11- dehydrocorticosterone CPM values.
68 Whole-Cell Enzyme Assays : DMEM/10% charcoal-stripped FBS, containing 2nM
[1,2,6,7-3H]-B and indicated concentrations of unlabeled corticosterone, was applied to cells. At the end of incubation, medium from each well was removed for steroid extraction. Sample processing and data collection procedures were conducted as for whole-cell assays. The amount of 11-dehydrocorticosterone produced by each incubation was calculated by multiplying the corresponding percent conversion by the total amount of corticosterone (tritiated and unlabeled) added to the incubation.
Analysis: Substrate-velocity curves were fitted by nonlinear regression with
GraphPad Prism (GraphPad Software, Inc.; San Diego, CA). Modeling assumed that conversion of B obeys Michaelis-Menten kinetics and that its inhibition by 6β-OHB was competitive and reversible.
Variation among the means of multiple groups was evaluated with analysis of variance (ANOVA). Pairwise differences were analyzed with the Student’s t-test.
Dose- and time-dependent effects were explored by linear regression where noted.
Analytical and graphing software included Prism, JMP (SAS Institute, Inc.; Cary,
NC), and Microsoft Excel. Unless indicated, all experiments were conducted in triplicate and means and standard deviations are reported.
RESULTS
Gene expression: TaqMan analysis indicated baseline signals corresponding to the
mRNAs for MR, GR, HSD11B2, ENaC α, ENaC γ, PPAR γ, and endothelin-1 (data not shown). Therefore, it was deemed that mIMCD-K2 cells have an mRNA expression
69 pattern retain reminiscent of collecting duct cells in vivo . CYP3A11 mRNA was not reliably detected in mIMCD-K2 cells at baseline. HSD11B1 mRNA was also detected and its ddCt value was roughly 7 times that of HSD11B2. The relative signal for GR exceeded that of MR by more than 70-fold.
Gene expression responses to steroid treatment: Cells were treated with 10 -6 M corticosterone for up to 8 hours and with varying doses of aldosterone and corticosterone for 24 hours. As shown in FIGURE IV-1, SGK1 mRNA levels respond to corticosterone treatment by 2 hours. ENaC α mRNA was dose-dependently induced by both steroids at 24 hours, although the maximum effect of aldosterone was nearly three times that of corticosterone. The IC 50 , the dose at which 50% of the maximum effect is produced, was roughly 5x10 -7 M for each.
70
A SGK1 mRNA 450 400 350 300 250 200 150 100 50 Relative Expression (%) Expression Relative 0 0 2 4 8 Time (h)
B ENaC mRNA level vs. [ALDO] C ENaC ααα mRNA level vs. [CORT]
2000 600
500 400
1000 300
200 Pct. of Control Pct. of Control 100 0 0 0 -9 -8 -7 -6 -5 0 -9 -8 -7 -6 -5 Conc (M) Conc (M)
FIGURE IV-1. mIMCD-K2 cells respond to corticosterone treatment. A: Treatment with 10 -6 M B from 0 to 8 h produces a short-term increase in SGK1 mRNA response. B: ENaCα mRNA levels are increased aldosterone and corticosterone at 24 h.
Comparison of 6βββ-hydroxycorticosterone to carbenoxolone: Cells were incubated with varying concentrations of 6β-hydroxycorticosterone and carbenoxolone, the known 11 β-HSD2 inhibitor, in the absence of corticosterone for
24 h (FIGURE IV-2A). While some dose effects may be apparent, they were relatively minor. FIGURE IV-2B shows the ability of 6β-hydroxycorticosterone and carbenoxolone to alter the responsiveness of ENaC α mRNA levels to corticosterone.
These data demonstrate that 6β-hydroxycorticosterone behaves like carbenoxolone
71 in an important manner: its major effects on ENaC α mRNA levels are exhibited only
in the presence of corticosterone. 6β-hydroxycorticosterone was generally more
effective than carbenoxolone at the same concentrations under most conditions.
Most but not all assays indicated a left-shift in the efficacy of corticosterone when
6β-hydroxycorticosterone was added.
A B 450 No inh. 7 400 1e-6 CBX CBX 350 6 10-5 CBX 300 6β-OHB 5 1e-6 6b mRNA mRNA
α α 10-5 6b α α 250 α α
α α 4 200 3 150 100 2 Rel. ENaC
50 Rel. ENaC 1 0 0 -12.00 -9 -8 -7 -6 -5 -8 -7 10 M B 10 M B Conc (M)
FIGURE IV-2. 6 βββ-hydroxycorticosterone and carbenoxolone effects on ENaC α mRNA levels. A: Cells were treated for 24 h with varying concentrations of CBX or 6β-OHB alone. B: Cells were treated for 24 h with 10 -6 or 10 -5 M of either CBX or 6β-OHB in the presence of B (10-8 or 10-7 M).
6βββ-hydroxycorticosterone alters ENaC α response to corticosterone: Data from
24-h incubations of mIMCD-K2 cells with varying concentrations of corticosterone
with or without 6β-hydroxycorticosterone, RU486, and/or spironolactone (all at 10 -5
M) may suggest that 6 β-hydroxycorticosterone protects the activity of corticosterone.
6β-hydroxycorticosterone may have had some minor effects in this assay on the shape of the dose-effect curve for corticosterone but its major effects occurred when
72 either MR or GR were blocked. As shown in FIGURE IV-3A, the GR antagonist
RU486 (R) produced a two-order left-shift in dose-effect, likely by blocking the low-
efficacy GR and thus freeing corticosterone to bind to the high-efficacy MR. But the
addition of 6 β-hydroxycorticosterone in this setting nearly completely flattens this
response, which may reflect 6β-hydroxycorticosterone antagonism of MR, as
previously reported (81) and as suggested by FIGURE IV-4. The addition of the MR
antagonist spironolactone (S) to corticosterone (FIGURE IV-3B) alone also flattens
its effect by a mechanism that is unknown but may involve induction of 11 β-HSD2.
Adding 6 β-hydroxycorticosterone then restores corticosterone’s effect, possibly by
inhibiting 11 β-HSD2 activity and/or expression (FIGURE IV-7, FIGURE IV-8, and
FIGURE IV-9).
B A B+R B 900 1500 B 800 B+6b B+6b 700 B+6b+R B+S 600 1000 mRNA mRNA B+6b+S α α α α α α 500 α α 400 300 500 200 Rel. ENaC 100 Rel. ENaC 0 0 0 -9 -8 -7 -6 -5 0 -9 -8 -7 -6 -5 [B] [B]
FIGURE IV-3. Interaction between GR and MR blockade and 6 βββ- hydroxycorticosterone effects on ENaC α mRNA induction by corticosterone. A: Cells were treated for 24 h with varying concentrations of B and 10 -5 M RU486 (R), 10 -5 M 6 β-OHB (6b), or both. B: Varying concentrations of B and 10 -5 M spironolactone (S), 10 -5 M 6 β-OHB, or both.
73 6βββ-OHB suppresses ALDO response: Cells were treated with increasing
concentrations of aldosterone (ALDO) for 24 hours with and without the addition of
10 -5 M 6β-hydroxycorticosterone. The expected increase of ENaC α mRNA in response to aldosterone was dampened significantly when 6β-hydroxycorticosterone was added (FIGURE IV-4).
ENaC ααα mRNA level vs. [ALDO] 2000
ALDO
1500 ALDO+10 -5 M 6 β-OHB
1000
500 Pct. of Control (%)
0 Control -9 -8 -7 -6 -5 Conc (M)
FIGURE IV-4. ENaC α mRNA dose-response with or without 10 -5 M 6 βββ- hydroxycorticosterone. mIMCD-K2 cells dose-dependently increase ENaC α mRNA levels at 24 h in response to ALDO treatment, but 10 -5 M 6 β-OHB significantly blunts this response.
mIMCD-K2 cells convert corticosterone: Cells were incubated with 2 nM [ 3H]- corticosterone and 100 nM unlabeled corticosterone for the time-points indicated in
FIGURE IV-5A, which shows a time-dependent increase in corticosterone conversion. A decrease in the apparent ratio of 11-dehydrocorticosterone to corticosterone at longer time-points (not shown) may represent the action of 11 β-
HSD1. Therefore, 30-min incubations were performed for substrate-velocity and
74 inhibition experiments. In order to establish that corticosterone conversion reflected
11 β-HSD2 activity, cell homogenates were assayed with and without the addition of
1mM NAD + (an 11 β-HSD2 cofactor) and 100 nM Ca 2+ (an 11 β-HSD2 inhibitor), as shown in FIGURE IV-5B. Conversion was stimulated by NAD+ and inhibited by Ca 2+ , which is consistent with 11 β-HSD2 activity (195).
25 300 A B 20 200 15
10 100
5 PCt. of Ctrl. (%) Pct. (%) Conversion 0 0 0 15 30 45 60 Ctrl. NAD NAD/Ca 2+ Time (min)
FIGURE IV-5. Corticosterone conversion by mIMCD-K2 cells. A. Conversion is time-dependent. Separate assays showed an apparent decrease in the ratio of 11-dhB to B at longer time points (90-120 min). B. 1-hr B conversion is stimulated by NAD + and inhibited by Ca2+, consistent with 11 β-HSD2 activity.
11 β-HSD2 kinetics: Data from 30-min incubations of cells with 2 nM [ 3H]- corticosterone and varying unlabeled corticosterone concentrations were fitted by nonlinear regression, assuming Michaelis-Menten kinetics. The substrate-velocity curve is shown in FIGURE IV-6. The estimated Michaelis-Menten constant (K m) for these data is roughly 150 nM (SE= 35 nM).
75
50 Best-fit SE 95% CI Vmax 57.37 6.768 43.33 to 71.41
K 40 m 148.8 34.64 76.91 to 220.6
30 2.5
2.0
20 1.5 [11-dhB] 1.0
1/[11-dhB] 10 0.5
0.0 0.1 0.2 0.3 0.4 0.5 0.6 1/[B] 0 0 100 200 300
[B], nM
FIGURE IV-6. Whole-cell 11 β-HSD2 substrate-velocity curve. Cells were incubated for 30 min with 2 nM [ 3H]-B and varying concentrations of unlabeled B.
6β-hydroxycorticosterone inhibits corticosterone conversion: Cells were
incubated for 30 min with 2 nM [ 3H]-corticosterone and indicated corticosterone and
6β-hydroxycorticosterone concentrations to test the hypothesis that 6 β- hydroxycorticosterone competitively inhibits 11 β-HSD2 activity (FIGURE IV-7A).
Substrate-velocity and double-reciprocal plots (inset) are shown. The best-fit estimate for the inhibitory constant (K I) for these data is 4.7 nM (SE= 2.3). The relative abilities of corticosterone and 6β-hydroxycorticosterone to inhibit the 30-min conversion of 2 nM [ 3H]-B was also examined (FIGURE IV-7B). At all concentrations,
6β-hydroxycorticosterone produced greater inhibition than did corticosterone.
76 5
4
3 45 2 40 A 1/[11-dhB] 1 35 0.000 0.025 0.050 0.075 0.100 0.125 30 1/[B] 25
20 [6 β-OHB], nM 15 [11-dhB], nM 0 nM 10 10 nM 5 0 0 250 500 750 1000 1250 [B], nM 25 B B
20 6β-OHB
15
10
(%) conversion H]-B 3 5
[ Pct. 0 -8 -7 -6 -5 [Competitor] FIGURE IV-7. 6β-hydroxycorticosterone inhibits 11 β-HSD2 activity. Cells were incubated for 30 min with 2 nM [ 3H]-B and with the indicated concentrations of unlabeled B or of 6 β-OHB. A. Substrate-inhibitor profile. Estimated 3 Ki=4.7 nM. B. B and 6 β-OHB dose-dependently inhibit [ H]-B conversion.
6β-hydroxycorticosterone suppresses 11 β–HSD2 mRNA and activity: Cells were cultured in 10 -7 M corticosterone +/- 10 -5 M 6β-hydroxycorticosterone. By 2 h, corticosterone had suppressed by half the mean 11 β–HSD2 mRNA level (FIGURE
IV-8A), which recovered from 2-8 h in the absence of 6β-hydroxycorticosterone; in
77 its presence, recovery was flat. In separate studies, the time- and dose-dependence
of this effect were examined for 11 β–HSD1 and 2 (FIGURE IV-8B and C). With corticosterone alone, HSD1 mRNA levels decreased from 4 to 8 h while 11 β–HSD2 levels increased. 6β-hydroxycorticosterone dose-effect trends on 11 β–HSD1 at 2
and 4 h were marginal in significance (P=0.04 and 0.09, respectively). At 8h, only
the trend for 11 β–HSD2 was significant (P=0.001).
A 150 0M 6 β-OHB
10 -5 M 6 β-OHB 100
50
HSD11B2 mRNA HSD11B2 (Pct. of baseline)
0 0 2 4 8 Time (h)
B C
150 250 4h 4h
8h 200 8h 100 150
100 -HSD2 mRNA mRNA (%) -HSD2 -HSD1 mRNA mRNA (%) -HSD1 50 β β β β β β β β 50
Rel. 11 Rel. Rel. 11 Rel. 0 0 0 -9 -8 -7 0 -9 -8 -7 [6 βββ-OHB] [6 βββ-OHB] FIGURE IV-8. 6 β-hydroxycorticosterone affects 11 β-HSD mRNA levels. Cells were incubated up to 8h with 10 -7 M B and the indicated concentrations of 6 β- OHB. A. 6 β-OHB reduces 11 β-HSD2 mRNA recovery after suppression by B. B and C. 6 β-OHB dose-dependently inhibit [ 3H]-B conversion; 6 β-OHB was more potent than B at all doses.
78 Culturing mIMCD-K2 cells for 24 h in 10 -7 M corticosterone alone or with the
11 β–HSD2 inhibitor carbenoxolone (10 -5 M) or 6 β-hydroxycorticosterone (10 -6 or 10 -5
M) suppressed 11 β–HSD2 activity (FIGURE IV-9).
Ctrl. 100 10 -5 M CBX 10 -6 M 6 β-OHB
90 10 -5 M 6 β-OHB
Pct. of Ctrl. of Pct. 80
0.0 Treatment
FIGURE IV-9. 6 β-hydroxycorticosterone suppresses 11 β-HSD2 activity. Cells were incubated for 24 h with 10 -7 M B and the indicated concentrations of CBX and 6β-OHB. 10 -5 M 6β-OHB suppressed 11 β-HSD2 activity.
DISCUSSION
The primary purpose of these experiments was to determine whether 6β- hydroxycorticosterone, a product of CYP3A-catalyzed metabolism, alters renal sodium transport by changing the expression of ENaC subunits. The secondary purpose was to identify potential mechanisms and to specifically test the hypothesis that 6β-hydroxycorticosterone inhibits the 11 β-HSD2 enzyme. Cultured mouse inner medullary collecting duct cells have been used previously as in vitro models of steroid regulation of sodium transport.
79 The major findings of these experiments are that 6β-hydroxycorticosterone competitively inhibits 11 β-HSD2 activity and that it has an unanticipated effect upon
11 β-HSD2 expression. 6β-hydroxycorticosterone inhibition of 11 β-HSD2 activity
appears to occur in a physiologically compatible range. Results from whole-cell
enzyme assays indicate that corticosterone conversion is consistent with Michaelis-
Menten kinetics. The estimated K m, roughly 150 nM, is higher than published K m values for 11 β-HSD2, which range from 10-100 nM. It is not clear whether this difference is meaningful, but the presence of 11 β-HSD1 in these cells may be responsible for a higher apparent K m due to back-conversion of product to substrate.
The derived K i for 6β-hydroxycorticosterone in this reaction is around 5 nM.
Data regarding the intracellular levels of 6 β-hydroxyglucocorticoids are not
available from the literature. Human plasma 6 β-hydroxycortisol levels average 1-3
nM but are higher in hypercortisolemic states, in which they may exceed 10 nM, and
in tissues in which 6β-hydroxycortisol is produced, such as the adrenal gland (129,
149). The levels of 6β-hydroxycortisol in the urine can reach the micromolar range, which may indicate high intrarenal concentrations. It is very likely that the ratio of 6β-
hydroxycortisol to cortisol in renal epithelial cells exceeds that in plasma. The efflux
transporter P-glycoprotein (P-gp), encoded by the MDR1 gene, limits the intracellular
concentrations of its steroid ligands, including glucocorticoids (117, 196-198).
Steroid transport by P-gp is sensitive to structural and physicochemical properties of
these compounds. Introduction of a 6 β-hydroxyl group to cortisol greatly reduces
transport by LLC-PK porcine kidney cells with or without transfection with MDR1
(199). The in vivo relevance of this finding would be that the intracellular ratio of 6β-
80 hydroxycortisol to cortisol may be higher than that seen in plasma, as cortisol is
pumped out of the cell and 6β-hydroxycortisol formed intracellularly by CYP3A is cleared less efficiently.
CYP3A11 expression was not reliably seen in these cells. CYP3A11 mRNA is detectable in adult mouse kidney, although at relatively low levels compared to
CYPs from families 1, 2, and 4 (200). CYP3A5 expression in medullary collecting ducts has been confirmed in humans (84). In future studies, it will be worth asking what the effects of actual CYP3A expression would be in these cells.
The higher relative mRNA levels for GR relative to those for MR in these cells parallel a GR predominance previously noted in cultured collecting duct cells (126).
The higher relative mRNA levels for 11 β-HSD1 relative to those for 11 β-HSD2 are consistent with results from other investigators showing 11 β-HSD1 in rat distal tubules (201) and higher TaqMan and Western blot signals for 11 β-HSD1 than for
11 β-HSD2 in the inner medulla (202).
The in vivo relevance of these findings is unclear. Inhibition of 11 β-HSD2 should in theory have an antinatriuretic effect. But the apparent ability of 6 β-OHB to antagonize the MR and the possible dependence of 6β-hydroxycorticosterone effects on MR or GR blockade makes the proposed role of 6β-hydroxycorticosterone in normal renal and systemic physiology somewhat difficult to predict. Further in vitro and in vivo studies should detail more finely define the dose effects of 6β- hydroxycorticosterone and explore its effects on not merely ENaC mRNA but also levels and activities of other effectors of sodium balance, such as Na +/K +-ATPase,
Na +/K +/Cl - cotransporter (NKCC), and renin-angiotensin-aldosterone system
81 components. But whether or not 6 β-OHB proves to be a major agent in human physiology and health, studies of its effects should provide new insights into the biology of renal epithelia.
82
CHAPTER V: IN VIVO MODELS OF CYP3A PHYSIOLOGY
SUMMARY
Animal and human data suggest that high CYP3A activity in the kidney may cause
increased renal sodium transport. Cytochrome P450 3A enzymes have been
proposed to alter renal sodium reabsorption by catalyzing the conversion of
glucocorticoids (cortisol or corticosterone) to their 6 β-hydroxylated metabolites with altered activity. The mechanisms by which these metabolites act in the kidney have not previously been identified. Excessive reabsorption of sodium by the kidney may cause increased plasma volume and a resultant hypertension. Previous studies of a possible relationship between CYP3A activity and blood pressure and/or renal function have been mostly associative, without establishing clear causation. These studies are an attempt to establish whether increased 6β-hydroxycorticosterone levels and or increased expression of CYP3A enzymes in mice can increase sodium sensitivity and/or blood pressure.
INTRODUCTION
The search for genetic causes of common diseases such as hypertension is difficult because disease-causing genetic variants are generally either rare or have little effect individually. It has been suggested that the cytochrome P450 3A (CYP3A) enzyme system could have large effects on human health. Among adults, CYP3A4 and CYP3A5 exhibit variable expression which is partly controlled by genetic variance. CYP3A4 is variably but universally expressed primarily in the liver and intestines; CYP3A5 is found in the gastrointestinal system and in the renal epithelia
84 of some individuals who constitute a minority among some populations and a majority among others. The large active sites of CYP3A enzymes allow them to catalyze the oxidative metabolism of a wide variety of endogenous and exogenous chemicals, including most therapeutic drugs.
The work of Watlington and colleagues implicated CYP3A enzymes in the control of renal sodium balance and blood pressure. CYP3A content and catalytic activity in the kidneys of spontaneously hypertensive rats (SHR) are higher than in normotensive Wistar-Kyoto rats (80, 85) and treatment of SHR with the CYP3A inhibitor troleandomycin lowers BP (85). Several human diseases associated with elevated BP, including Cushing’s syndrome (129) and pre-eclampsia (80), are characterized by increased urinary excretion of 6 β-hydroxycortisol, a marker of in vivo CYP3A activity (85, 130). Plasma levels of 6 β-hydroxycortisol have been reported to be elevated in essential hypertensives (87)
A role for CYP3A enzymes in blood pressure control appears plausible.
CYP3A-mediated 6 β-hydroxylation is a metabolic pathway, although a minor one, for steroids such as the glucocorticoid corticosterone. 6 β-hydroxycorticosterone stimulates sodium transport across A6 toad kidney cells and sodium retention in rats
(80-82). Previous evidence indicates that 6β-hydroxycorticosterone modulation of A6 cell sodium transport by acting through an unidentified binding site (80, 81).
Immunohistochemistry demonstrates CYP3A proteins in rat (80, 131) and human kidney (84), including the distal tubules and collecting ducts, the principle sites at which aldosterone stimulates sodium reabsorption. Similar to that of 11 β-
85 hydroxysteroid dehydrogenase type 2, renal CYP3A activity has been proposed to regulate glucocorticoid occupancy of the mineralocorticoid receptor (MR) (83).
In addition, work by a number of investigators has indicated possible associations between CYP3A expression and blood pressure or sodium balance in some human studies. In order to move beyond association and establish causation, it will likely be necessary to employ animal models so that the effects of modulating
CYP3A activity upon in vivo physiology can be measured.
METHODS
6β-hydroxycorticosterone injection: Wild-type C57BL/6 male mice were separated into two groups (n=4 each) that received a daily intraperitoneal injection of either 6 β-hydroxycorticosterone (1 µg/g body weight) in PBS or with PBS alone.
Each group received a normal-chow diet and drinking water ad libitum . Blood pressures were measured daily for 6 days. Drinking water was then replaced with
0.9% saline, injections were continued, and blood pressure measurements were repeated for an additional 6 days.
PGK-CYP3A5 tg mice: Functional human CYP3A5 cDNA in a pENTR/SD/DTOPO cloning vector (Invitrogen) was kindly provided by the laboratory of Erin Schuetz (St.
Jude’s Children’s Research Hospital, Memphis, TN). CYP3A5 cDNA was excised from the pENTR vector and ligated into a transgenic vector directed by a phosphoglycerate kinase (PGK) promoter (UNC Animal Models Core). The vector was linearized and microinjected into male pro-nuclei of fertilized C57BL/6 oocytes
86 by standard techniques. Founders were identified by PCR of tail or toe DNA using primers that anneal within the PGK promoter (AGCAGTGCATCTGGGGGCAG; forward) and CYP3A5 cDNA (GGAGTTGACCTTCATACGTTCCCCAC; reverse).
Founders were mated with wild-type C57BL/6 in order to produce transgenic and wild-type offspring.
ApoAI-ApoCIII-CYP3A5 mice: Human CYP3A5 cDNA was ligated into a targeting construct containing mouse apoA1 gene and a 3’ fragment of the apoC3 gene (203).
Inserting a transgene into this locus produces high expression of the transgene in the liver and intestines (204). Chimeric males were mated with wild-type C57BL/6 females. Transgenic and wild-type agouti F1 offspring were used for experiments.
Genotyping of ApoCYP3A5 mice was performed by PCR amplification of tail or toe
DNA using oligonucleotide primers that anneal within the PGK promoter and
CYP3A5 cDNA, as for PGK-CYP3A5 mice.
Blood Pressure Measurement: Noninvasive computerized tail cuff sphygmomanometry was used for BP measurements of conscious mice. Each trial consisted of six consecutive days of measurements. On each day, a series of 10 inflations is performed to allow the mouse to acclimatize to the apparatus, after which 30 inflations and measurements were performed. The average of the six daily means was used to represent the mean blood pressure of each animal and is used for statistical analysis.
87 Diets: PGK-CYP3A5 were fed either normal chow, a high-salt diet (8% sodium), and a low-salt diet (1% sodium). ApoCYP3A5-transgenic and wild-type mice were crossed over between normal chow, a high-salt diet (8% sodium), and a high-fat diet
(42% of calories from fat). All diets were from Harlan-Teklad. Mice were allowed to acclimate to each diet for one week prior to each 6-day round of blood pressure measurement.
RESULTS
6β-hydroxycorticosterone injection did not influence sodium sensitivity :
Ingestion of saline non-significantly increased systolic and diastolic blood pressure and lowered heart rate among 6β-hydroxycorticosterone- and PBS-treated mice.
Injection with 6β-hydroxycorticosterone as opposed to PBS did not significantly affect these responses. Also, 6β-hydroxycorticosterone did not exhibit a BP-raising effect and nonsignificantly lowered SBP and raised HR (FIGURE V-1).
88 SBP DBP 80 120
70
110 60 mm Hg mm Hg
100 50
0 0.0 PBS 6βββ-OHB PBS 6βββ-OHB Treatment Treatment
H2O MAP NaCl Heart Rate 95 750
700
80
bpm 650 mm Hg
600 65 0 0 PBS 6β-OHB PBS 6b-OHB ββ Treatment Treatment
FIGURE V-1. 6 β-hydroxycorticosterone affects blood pressure and heart rate.
Effects of CYP3A5 gene introduction on blood pressure: PGK-CYP3A5
transgenic demonstrated expression of CYP3A5 mRNA in the liver and kidney and
suppression of endogenous mouse CYP3A11 in these same tissues (FIGURE V-2).
Renal CYP3A11 expression was 1000-fold lower than hepatic expression for both
wild-type and transgenic mice. These mice showed trends towards higher systolic
(SBP) and diastolic blood pressures (DBP) on low- (LS) and high-salt (HS) diets.
Mean SBP and DBP were nearly equal between transgenic and wild-type mice on a
normal-salt (NS) diet (FIGURE V-3). Among the ApoAI/CIII-CYP3A5 mice there was
no apparent genotype effect on blood pressure but there was a diet effect among
89 wild-type and CYP3A5-positive mice such that high-fat diet lowered blood pressure
(FIGURE V-4).
150
CYP3A5 tg- CYP3A5 tg+ 100
50
Relative Expression (%) Expression Relative 0 Liver Kidney FIGURE V-2. Relative hepatic and renal expression of CYP3A11 mRNA in wild- type and PGK-CYP3A5 transgenic mice.
SBP DBP
95 70 wt wt tg tg
90 65
mm Hg mm Hg mm
85 60
0 0 LS NS HS LS NS HS Diet Diet
FIGURE V-3. Diet and PGK-CYP3A5 genotype effects on systolic and diastolic blood pressure.
90 SBP HR 120 wt 800 wt tg tg 750 110
700
100 bpm
mm Hg 650
90 600
0 0 NC HS HF NC HS HF Diet Diet
FIGURE V-4. Dietary effects on systolic blood pressure and heart rate in ApoAI/CII-CYP3A5 transgenic and wild-type mice. Mice were fed normal chow (NC), high-salt (HS), or high-fat (HF) diet. Bars show means and standard deviations of systolic blood pressure (SBP) and heart rate (HR).
DISCUSSION
The multiple CYP3A genes in humans, mice, and other animals reflect species- specific gene duplication and recombination events. There is thus no clear mouse ortholog of the human CYP3A5 gene, although the mouse and human CYP3A genes are obviously homologous. The attempt to create a mouse model that perfectly replicates the in vivo distribution and activity of human CYP3A5 is difficult in theory. In this study, it was attempted to circumvent the potential problems of achieving the proper tissue-specific distributions of “CYP3A5-like” activity by employing multiple approaches to model the potential hypertensive effects of CYP3A and/or 6β-hydroxycorticosterone activity.
CYP3A7 transgenic mice with a metallothionein promoter driving zinc-induced hepatic expression have previously been made (205, 206). These animals show increased serum testosterone levels, higher liver, kidney, and uterine weights, and
91 decreased testis weight. The reasons for these effects were not studied but testicular expression of CYP3A7 was confirmed. The authors speculated that the higher testosterone in conjunction with smaller testes may have reflected transgene disruption of a gene responsible for testosterone metabolism, such as the gene encoding steroid 5 α-reductase. It is more likely, however, that products of testicular
CYP3A-catalyzed reactions, such as 6 β-hydroxytestosterone, alter activity or expression of 5 α-reductase or a related enzyme. Physiologic parameters, such as blood pressure, have not been reported for other humanized CYP3A models as they have for the models described in this chapter.
Repression of endogenous mouse CYP3A mRNA was not seen in the
CYP3A7-transgenic model (207). But a 50% reduction of mouse hepatic CYP3A protein levels was observed in female mice bearing a CYP3A4 transgene driven by the full CYP3A4 promoter; transgenic males showed an age-dependent increase in murine hepatic CYP3A protein levels that exceeded those of wild-type males by 12 weeks of age (208). Mechanisms underlying these effects and differences between models have not been explained.
The possible effects of 6β-hydroxycorticosterone on blood pressure and heart rate at baseline and in response to dietary sodium modification may be further investigated in intact and adrenalectomized mice. Doses of 6β- hydroxycorticosterone may be varied in the presence or absence of 11 β-HSD2 inhibition (with carbenoxolone or glycyrrhetinic acid), and antagonism of the mineralocorticoid or glucocorticoid receptors (with spironolactone or RU486,
92 respectively). It will be informative to measure not only hemodynamic parameters but also indicators of renal function and sodium balance.
It is similarly necessary to investigate the possible effects of PGK-CYP3A5 transgenesis on hemodynamics and renal function. It will be informative to compare the magnitude and distribution of CYP3A expression and activity between wild-type and transgenic animals.
93
CHAPTER VI: SYSTEMATIC REVIEW OF STUDIES OF THE ASSOCIATION OF
CYP3A5 GENOTYPE WITH BLOOD PRESSURE AND HYPERTENSION
SUMMARY
Isoforms of the human CYP3A subfamily are well known as hepatic drug-
metabolizing enzymes. Beyond their pharmacologic importance, CYP3A enzymes
have established and hypothesized roles in endogenous physiologic processes. In
animal and in vitro models, 6β-hydroxycorticosterone, a product of CYP3A enzyme
activity, increases renal sodium transport and is associated with increased blood
pressure. Among humans, increased plasma levels and urinary excretion of 6β-
hydroxycortisol have been seen in diseases associated with increased blood
pressure. Polymorphic human renal CYP3A activity primarily reflects the
contributions of CYP3A5, the expression of which is primarily controlled by known
single nucleotide polymorphisms. These observations led to the hypothesis that
expression-predicting CYP3A5 genotypes could predict renal sodium transport and
blood pressure. Studies have examined associations between the CYP3A5 A6986G
SNP and blood pressure, hypertension, renal function, and other metabolic
phenotypes among American and African blacks, American and European whites,
and various Asian groups. A review of studies to date shows that results have been
quite variable. Summary measures show very minor and insignificant associations of
CYP3A5 genotype with BP and HTN among whites, possible associations among
Asians, and variable results among blacks. These observations support the notion
that development of robust, conventional molecular epidemiologic case-control studies to address these questions, including gene-gene and gene-environment interactions, will be timely.
95 INTRODUCTION
The cytochrome P450 (CYP) enzyme superfamily is an exceptionally diverse group
divided into roughly 237 numbered families on the basis of sequence homology (1,
2). CYP1-3 families comprise the phase I drug-metabolizing enzymes (4), which
catalyze substrate functionalization via reactions such as hydroxylation and
demethylation that increase aqueous solubility or introduce attachment sites for
bulkier moieties added by phase II enzymes. CYP proteins are expressed in the liver
and throughout the gastrointestinal tract, where the bulk of first-pass drug
metabolism occurs (5).
The human CYP3A enzymes- i.e., the members of family 3, subfamily A of
the CYP superfamily- are numbered 4, 5, 7, and 43. The CYP3A isoforms have
extensively overlapping substrate specificities. Among the human CYP subfamilies,
CYP3A is the most prominent. Its members are the most highly expressed in the
liver and intestines and they catalyze metabolism of a tremendous variety of
substrates, including half or more of currently marketed drugs (9). The bulk of adult
human CYP3A activity results from the contributions of the CYP3A4 and CYP3A5
enzymes.
Gastrointestinal CYP3A4 activity is variable but universal (209, 210). But
CYP3A5 expression is clearly polymorphic (25, 42). Among individuals who express
CYP3A5, it is the primary component of extrahepatic CYP3A activity. While CYP3A4
and 5 may be co-expressed in extra-gastrointestinal sites such as the placenta (27),
CYP3A5 is also found in sites from which CYP3A4 absent- i.e. , the kidney (28-30), including proximal and distal tubules and collecting ducts (21, 31); adrenal zona
96 glomerulosa (21, 31); bronchial and alveolar respiratory epithelia (32); and anterior pituitary gland (33).
The human CYP3A5 gene is located on band q22.1 of chromosome 7. The
CYP3A5 gene encompasses roughly 31.8 kbp and has 13 exons. The CYP3A5 promoter contains a basal transcription element (–35 to –50), binding sites for AP-3 and p53. The CYP3A5 5’UTR displays response elements for the pregnane X receptor (PXR), the main effector of CYP3A transcriptional induction (211). Also found in the CYP3A5 promoter are glucocorticoid and estrogen response elements and hepatocyte nuclear factor-4 and -5 binding sites (212). The CYP3A5 holoprotein consists of 502 amino acids with a molecular weight of 57.1 kDa.
In addition to their roles in the metabolism of drugs and other exogenous chemicals, CYP3A enzymes also constitute a significant metabolic pathway for lipophilic endogenous molecules, as reviewed in Chapter I. The risk for diseases and conditions such as breast and prostate cancer and early puberty (153, 154, 157,
161) have been hypothesized to be modulated by CYP3A-mediated transformation of estrogens and androgens. Most relevant to this review is the specific status of
CYP3A enzymes, and especially CYP3A5, as glucocorticoid 6β-hydroxylases.
CYP3A5 is an attractive candidate as a gene influencing hypertension.
Hydroxysteroid products of CYP3A-catalyzed reactions modulate sodium transport across cultured toad kidney cells. CYP3A enzymes are expressed in rodent and human renal tubules, including the distal tubules and collecting ducts, the major sites at which mineralocorticoids control renal sodium reabsorption. CYP3A enzymes are overexpressed in the kidneys of the spontaneously hypertensive rat (SHR) relative
97 to the related normotensive Wistar-Kyoto strain, and treatment of SHR with a
CYP3A inhibitor reduces blood pressure. Injection of SHR with 6 β- hydroxycorticosterone leads to sodium retention. Excess urinary 6 β-hydroxycortisol excretion has been noted in diseases marked by increased blood pressure, such as
Cushing’s syndrome and pre-eclampsia. The response of urinary 6 β-hydroxycortisol
excretion to sodium loading has been reported to differ between individuals whose
blood pressure is sodium-sensitive and those who are sodium-resistant. A study of
essential hypertensives revealed higher plasma 6 β-hydroxycortisol levels among
hypertensives than among normotensives. The observation that the probability of
CYP3A5 expression followed a roughly equatorial-to-polar gradient suggested the
possibility that the evolutionary importance of renal CYP3A5 activity may have been
an ability to prevent dehydration by enhancing sodium resorption. This hypothetical
antinatriuretic effect was proposed to lead to increased blood pressure in situations
in which sodium availability exceeds requirements, as in the modern Western diet.
Perhaps fittingly, CYP3A5 expression is most frequently observed among African-
Americans and Black Africans, among whom global rates of hypertension and
sodium sensitivity are the highest (123, 124). The possibility that CYP3A5 was a
“hypertension gene” was also intriguing because of CYP3A5’s activity as a drug
metabolizing enzyme, thus presenting CYP3A5 as a possible “double effector” that
could control both the likelihood of developing hypertension and the likelihood of
responding to antihypertensive treatment.
The 2001 report by Kuehl et al. (25) of the major genetic variant (A6986G)
underlying polymorphic CYP3A5 expression enabled the development of studies
98 associating CYP3A5 expression with a variety of pharmacologic and physiologic phenotypes. Thus, Givens et al. (30) examined the association of the CYP3A5
A6986G SNP with blood pressure and other clinical findings among a small group of young, mostly college-aged, healthy African-Americans who had been screened for a pharmacogenetic study. Significant associations with CYP3A5 genotype were noted for systolic blood pressure and creatinine clearance. Subsequent studies by others investigating CYP3A5 genotype association with blood pressure and/or the diagnosis of hypertension have produced variable results. This review is an attempt to quantitatively and qualitatively review the current data and assess the state of the evidence. Significant variability exists among studies in terms of subject selection, methodology, and results. Future analyses of this type require more standardized reporting of subject characteristics.
METHODS
ISI Web of Science, Medline, CINAHL, and EMBASE were searched for all articles and abstracts mentioning both CYP3A5 and blood pressure or both CYP3A5 and hypertension. Materials that did not include an association of CYP3A5 genotype and blood pressure or hypertension as a primary or secondary analysis were removed.
Statistical analyses: For studies included in the meta-analysis, the main outcome measures extracted were systolic blood pressure and the proportion of hypertensives among CYP3A5 expressers and nonexpressers. For the purpose of pooled analyses, statistics that could be used to estimate the variances of the
99 outcome measures were also recorded. These included standard deviations or standard errors, or if these statistics were not given, confidence intervals or exact t or P values. For studies of systolic blood pressure, the mean difference between the
CYP3A5 expresser and nonexpresser groups and the pooled standard deviation were used to calculate a z score. For hypertension, z scores were calculated from odds ratio of hypertension among expressers versus nonexpressers. It was assumed that genotype effects were not different between males and females, so data from studies reporting data for males and females separately were transformed by standard methods. Mean effect sizes were calculated by weighting each trial by the inverse of the variance. Funnel plot asymmetry was used to detect publication biases among the studies.
RESULTS
Fifteen publications were identified comprising 10,859 subjects. Relevant summary data, including means and measures of variation, were extracted from each study.
The list of identified studies is displayed in TABLE VI-A. For meta-analysis, studies that examined healthy subjects were included. Data from suitable studies were entered into MIX (Meta-analysis with Interactive Explanations), a freely-available and user-friendly software (213). MIX was used for all analyses.
A random effects model was used to take into account inter-study heterogeneity. Publication bias was unapparent on the basis of funnel plots. Forest plots and summary measures for systolic blood pressure and hypertension among all subjects, healthy Whites, healthy Blacks, and healthy Asians were generated.
100 The summary estimate for CYP3A5 genotype effect among all subjects was a 0.29-
mm Hg increase (P= 0.41) in systolic blood pressure among CYP3A5*1 non-carriers
(FIGURE VI-1). Sizable or significant effects of genotype upon systolic blood
pressure or hypertension among any group were unapparent among all subgroups.
FIGURE VI-1. Forest plot of studies associating systolic blood pressure with CYP3A5 genotype.
DISCUSSION
The absence of an apparent effect of CYP3A5 genotype on blood pressure or hypertension may indicate that in reality no true effect exists, or that any actual effect is swamped by other genetic and environmental variables, or that studies have been too varied in methodology to allow for adequate statistical summation. The results of
101 this meta-analysis might be considered alongside those of a recent meta-analysis of genetic association studies of the M235T angiotensinogen polymorphism. Despite a clear role for angiotensinogen in the control of BP and the ability of M235T to predict angiotensinogen plasma levels, meta-analysis demonstrates unconvincing evidence for M235T as a predictor of blood pressure or the risk of hypertension (214).
While more than 10,000 subjects have been included in published CYP3A5- blood pressure association studies, only about 800 of these subjects are classified as black or African-American, African, or of African descent. For various reasons, this figure may represent a significant underrepresentation of the subjects most likely to exhibit a CYP3A5 effect. Rigorous study of a role for CYP3A5 in blood pressure and related parameters is likely to require greater recruitment of black subjects.
Because of heterogeneity among studies, this analysis is presented only as an assessment of the state of the evidence, not as a definitive conclusion about the effects of CYP3A5 genotype. The results support the notion that development of robust, conventional molecular epidemiologic case-control studies to address these questions, including gene-gene and gene-environment interactions, will be helpful.
102 TABLE VI-A. Studies of CYP3A5 genotype and blood pressure or hypertension Popu- N Study lation(s) *1/*1 *1/X X/X Total Major Findings Givens et al . AA 9 9 7 25 *1 allele associates with 2003 (30) higher SBP, PP, CrCl. Kreutz et al . CA 43 858 5876 6777 *1 allele associates with 2005 (169) (Dutch) lower SBP, PP, and UNa among women. Fromm et al . CA 0 19 96 115 *1/*3 genotype associates (164) (German) with lower SBP, higher serum ALDO. Ho et al . 2005 *1 allele associates with (165) CA 0 29 170 199 HTN among AA. Study 1 AA 27 39 6 72
Study 2 CA 1 34 204 239 *1 allele associates with AA 72 78 23 173 higher insulin resistance among CA. Kreutz et al . Renal Tx: No association of *1 allele 2004 (170) Recipient 6 56 337 399 with BP. Donors 5 42 352 399 Kivisto et al . CA 0 55 318 373 *1 allele associates with 2005 (168) (Finnish, HTN; MDR1 3435C>T age ≥75) does not. Bochud et al . East 67 194 114 375 *1 allele predicted age- 2006, 2007 African dependent increase in (54, 162) daytime SBP, DBP. Renal Na reabsorption decreased by age in nonexpressers but in expressers. Yin et al . Chinese 7 35 51 93 Nonsi gnificant associations 2006 between 6986 genotype and SBP, DBP, HR, and CrCL. Lieb et al . CA 5 115 964 1084 No genotype association 2004 (172) (German) with BP, left ventricular mass or geometry. Mild association with eGFR. Neville et al . Nigerian 35 55 16 106 No genotype association 2005; males with SBP, DBP, BMI. Marunde et al . 2006
103 Jin et al. Japanese 0 8 8 16 7-mm Hg-higher SBP males among *1/*3 vs. *3/*3 Suh et al. Korean 33 122 193 348 No significant differences 2006 (215) cardiac in rates of HTN or DM. patients Kim et al . Korean 2 16 24 40 No association of *1 with 2006 (216) males SBP, DBP, or HR.
104 REFERENCES
1. Nelson DR. Cytochrome P450 and the individuality of species. Arch Biochem Biophys 1999; 369:1-10.
2. Nelson DR, Koymans L, Kamataki T, Stegeman JJ, Feyereisen R, Waxman DJ, Waterman MR, Gotoh O, Coon MJ, Estabrook RW, Gunsalus IC, Nebert DW. P450 superfamily: update on new sequences, gene mapping, accession numbers and nomenclature. Pharmacogenetics 1996; 6:1-42.
3. Nelson DR. Metazoan cytochrome P450 evolution. Comp Biochem Physiol C Pharmacol Toxicol Endocrinol 1998; 121:15-22.
4. Williams ET, Rodin AS, Strobel HW. Defining relationships between the known members of the cytochrome P450 3A subfamily, including five putative chimpanzee members. Mol Phylogenet Evol 2004; 33:300-308.
5. Chhabra RS. Intestinal absorption and metabolism of xenobiotics. Environ Health Perspect 1979; 33:61-69.
6. Guengerich FP, Shimada T. Oxidation of toxic and carcinogenic chemicals by human cytochrome P-450 enzymes. Chem Res Toxicol 1991; 4:391-407.
7. Guengerich FP. Metabolism of chemical carcinogens. Carcinogenesis 2000; 21:345-351.
8. Omura T. Forty years of Cytochrome P450. Biochem Biophys Res Commun 1999; 266:690-698.
9. Thummel KE, Wilkinson GR. In vitro and in vivo drug interactions involving human CYP3A. Annu Rev Pharmacol Toxicol 1998; 38:389-430.
10. Finta C, Zaphiropoulos PG. The human cytochrome P450 3A locus. Gene evolution by capture of downstream exons. Gene 2000; 260:13-23.
11. Gellner K, Eiselt R, Hustert E, Arnold H, Koch I, Haberl M, Deglmann CJ, Burk O, Buntefuss D, Escher S, Bishop C, Koebe HG, Brinkmann U, Klenk HP, Kleine K, Meyer UA, Wojnowski L. Genomic organization of the human
105 CYP3A locus: identification of a new, inducible CYP3A gene. Pharmacogenetics 2001; 11:111-121.
12. Zaphiropoulos PG. A map of the mouse Cyp3a locus. DNA Seq 2003; 14:155-162.
13. Verslycke T, Goldstone JV, Stegeman JJ. Isolation and phylogeny of novel cytochrome P450 genes from tunicates (Ciona spp.): a CYP3 line in early deuterostomes? Mol Phylogenet Evol 2006; 40:760-771.
14. McArthur AG, Hegelund T, Cox RL, Stegeman JJ, Liljenberg M, Olsson U, Sundberg P, Celander MC. Phylogenetic analysis of the cytochrome P450 3 (CYP3) gene family. J Mol Evol 2003; 57:200-211.
15. Kliewer SA, Willson TM. Regulation of xenobiotic and bile acid metabolism by the nuclear pregnane X receptor. J Lipid Res 2002; 43:359-364.
16. Geick A, Eichelbaum M, Burk O. Nuclear receptor response elements mediate induction of intestinal MDR1 by rifampin. J Biol Chem 2001; 276:14581-14587.
17. Dussault I, Yoo HD, Lin M, Wang E, Fan M, Batta AK, Salen G, Erickson SK, Forman BM. Identification of an endogenous ligand that activates pregnane X receptor-mediated sterol clearance. Proc Natl Acad Sci U S A 2003; 100:833- 838.
18. Wacher VJ, Wu CY, Benet LZ. Overlapping substrate specificities and tissue distribution of cytochrome P450 3A and P-glycoprotein: implications for drug delivery and activity in cancer chemotherapy. Mol Carcinog 1995; 13:129- 134.
19. Schuetz EG, Beck WT, Schuetz JD. Modulators and substrates of P- glycoprotein and cytochrome P4503A coordinately up-regulate these proteins in human colon carcinoma cells. Mol Pharmacol 1996; 49:311-318.
20. Stevens JC, Hines RN, Gu C, Koukouritaki SB, Manro JR, Tandler PJ, Zaya MJ. Developmental expression of the major human hepatic CYP3A enzymes. J Pharmacol Exp Ther 2003; 307:573-582.
106 21. Koch I, Weil R, Wolbold R, Brockmoller J, Hustert E, Burk O, Nuessler A, Neuhaus P, Eichelbaum M, Zanger U, Wojnowski L. Interindividual variability and tissue-specificity in the expression of cytochrome P450 3A mRNA. Drug Metab Dispos 2002; 30:1108-1114.
22. Westlind-Johnsson A, Malmebo S, Johansson A, Otter C, Andersson TB, Johansson I, Edwards RJ, Boobis AR, Ingelman-Sundberg M. Comparative analysis of CYP3A expression in human liver suggests only a minor role for CYP3A5 in drug metabolism. Drug Metab Dispos 2003; 31:755-761.
23. Oscarson M, Ingelman-Sundberg M. CYPalleles: a web page for nomenclature of human cytochrome P450 alleles. Drug Metab Pharmacokinet 2002; 17:491-495.
24. Rodriguez-Antona C, Sayi JG, Gustafsson LL, Bertilsson L, Ingelman- Sundberg M. Phenotype-genotype variability in the human CYP3A locus as assessed by the probe drug quinine and analyses of variant CYP3A4 alleles. Biochem Biophys Res Commun 2005; 338:299-305.
25. Kuehl P, Zhang J, Lin Y, Lamba J, Assem M, Schuetz J, Watkins PB, Daly A, Wrighton SA, Hall SD, Maurel P, Relling M, Brimer C, Yasuda K, Venkataramanan R, Strom S, Thummel K, Boguski MS, Schuetz E. Sequence diversity in CYP3A promoters and characterization of the genetic basis of polymorphic CYP3A5 expression. Nat Genet 2001; 27:383-391.
26. Lin YS, Dowling ALS, Quigley SD, Farin FM, Zhang J, Lamba J, et al. Co- regulation of CYP3A4 and CYP3A5 and contribution to hepatic and intestinal midazolam metabolism. Mol Pharmacol 2002; 62:162-172.
27. Hakkola J, Pasanen M, Hukkanen J, Pelkonen O, Maenpaa J, Edwards RJ, Boobis AR, Raunio H. Expression of xenobiotic-metabolizing cytochrome P450 forms in human full-term placenta. Biochem Pharmacol 1996; 51:403- 411.
28. Haehner BD, Gorski JC, Vandenbranden M, Wrighton SA, Janardan SK, Watkins PB, Hall SD. Bimodal distribution of renal cytochrome P450 3A activity in humans. Mol Pharmacol 1996; 50:52-59.
29. Lasker JM, Chen WB, Wolf I, Bloswick BP, Wilson PD, Powell PK. Formation of 20-hydroxyeicosatetraenoic acid, a vasoactive and natriuretic eicosanoid,
107 in human kidney. Role of Cyp4F2 and Cyp4A11. J Biol Chem 2000; 275:4118-4126.
30. Givens RC, Lin YS, Dowling ALS, Thummel KE, Lamba JK, Schuetz EG, Stewart PW, Watkins PB. CYP3A5 genotype predicts renal CYP3A activity and blood pressure . J Appl Physiol 2003; 95 :1297-1300.
31. Nishimura M, Yaguti H, Yoshitsugu H, Naito S, Satoh T. Tissue distribution of mRNA expression of human cytochrome P450 isoforms assessed by high- sensitivity real-time reverse transcription PCR. Yakugaku Zasshi 2003; 123:369-375.
32. Raunio H, Hakkola J, Pelkonen O. Regulation of CYP3A genes in the human respiratory tract. Chem Biol Interact 2005; 151:53-62.
33. Murray GI, Pritchard S, Melvin WT, Burke MD. Cytochrome P450 CYP3A5 in the human anterior pituitary gland. FEBS Lett 1995; 364:79-82.
34. Krishna DR, Klotz U. Extrahepatic metabolism of drugs in humans. Clin Pharmacokinet 1994; 26:144-160.
35. Raunio H, Hakkola J, Hukkanen J, Lassila A, Päivärinta K, Pelkonen O, Anttila S, Piipari R, Boobis AR, Edwards RJ. Expression of xenobiotic- metabolizing CYPs in human pulmonary tissue. Exp Toxic Pathol 1999; 51:412-417.
36. Kuypers DR, de Jonge H, Naesens M, Lerut E, Verbeke K, Vanrenterghem Y. CYP3A5 and CYP3A4 but not MDR1 Single-nucleotide Polymorphisms Determine Long-term Tacrolimus Disposition and Drug-related Nephrotoxicity in Renal Recipients. Clin Pharmacol Ther 2007.
37. Joy MS, Hogan SL, Thompson BD, Finn WF, Nickeleit V. Cytochrome P450 3A5 expression in the kidneys of patients with calcineurin inhibitor nephrotoxicity. Nephrol Dial Transplant 2007.
38. Daly AK. Significance of the minor cytochrome P450 3A isoforms. Clin Pharmacokinet 2006; 45:13-31.
108 39. Atanasova SY, von Ahsen N, Toncheva DI, Dimitrov TG, Oellerich M, Armstrong VW. Genetic polymorphisms of cytochrome P450 among patients with Balkan endemic nephropathy (BEN). Clin Biochem 2005; 38:223-228.
40. Vignati L, Turlizzi E, Monaci S, Grossi P, Kanter R, Monshouwer M. An in vitro approach to detect metabolite toxicity due to CYP3A4-dependent bioactivation of xenobiotics. Toxicology 2005; 216:154-167.
41. Wrighton SA, Vandenbranden M. Isolation and characterization of human fetal liver cytochrome P450HLp2: a third member of the P450III gene family. Arch Biochem Biophys 1989; 268:144-151.
42. Wrighton SA, Ring BJ, Watkins PB, Vandenbranden M. Identification of a polymorphically expressed member of the human cytochrome P-450III family. Mol Pharmacol 1989; 36:97-105.
43. Wrighton SA, Brian WR, Sari MA, Iwasaki M, Guengerich FP, Raucy JL, Molowa DT, Vandenbranden M. Studies on the expression and metabolic capabilities of human liver cytochrome P450IIIA5 (HLp3). Mol Pharmacol 1990; 38:207-213.
44. Lamba JK, Lin YS, Schuetz EG, Thummel KE. Genetic contribution to variable human CYP3A-mediated metabolism. Adv Drug Deliv Rev 2002; 54:1271-1294.
45. Rogan PK, Svojanovsky S, Leeder JS. Information theory-based analysis of CYP2C19 , CYP2D6 , and CYP3A5 splicing mutations. Pharmacogenetics 2003; 13:218.
46. Busi F, Cresteil T. CYP3A5 mRNA degradation by nonsense-mediated mRNA decay. Mol Pharmacol 2005; 68:808-815.
47. Hustert E, Haberl M, Burk O, Wolbold R, He Y-Q, Klein K, Nuessler AC, Neuhaus P, Klattig J, Eiselt R, Koch I, Zibat A, Brockmöller J, Halpert JR, Zanger UM, Wojnowski L. The genetic determinants of the CYP3A5 polymorphism. Pharmacogenetics 2001; 11:773-779.
48. Balram C, Zhou Q, Cheung YB, Lee EJD. CYP3A5*3 and CYP3A5*6 single nucleotide polymorphisms in three distinct Asian populations. Eur J Clin Pharmacol 2003; 59:126.
109 49. Shih P-S, Huang J-D. Pharmacokinetics of midazolam and 1'- hydroxymidazolam in Chinese with different CYP3A5 genotypes. Drug Metab Dispos 2002; 30:1496.
50. Hiratsuka M, Takekuma Y, Endo N, Narahara K, Hamdy SI, Kishikawa Y, et al. Allele and genotype frequencies of CYP2B6 and CYP3A5 in the Japanese population. Eur J Clin Pharmacol 2002; 58:421.
51. van Schaik RHN, van der Heiden IP, van den Anker JN, Lindemans J. CYP3A5 variant allele frequencies in Dutch Caucasians. Clin Chem 2002; 48:1668-1671.
52. King BP, Leathart JBS, Mutch E, Williams FM, Daly AK. CYP3A5 phenotype- genotype correlations in a British population. Br J Clin Pharmacol 2003; 55:625-629.
53. Quaranta S, Chevalier D, Allorge D, Lo-Guidice JM, Migot-Nabias F, Kenani A, Imbenotte M, Broly F, Lacarelle B, Lhermitte M. Ethnic differences in the distribution of CYP3A5 gene polymorphisms. Xenobiotica 2006; 36:1191- 1200.
54. Bochud M, Eap CB, Elston RC, Bovet P, Maillard M, Schild L, Shamlaye C, Burnier M. Association of CYP3A5 genotypes with blood pressure and renal function in African families. J Hypertens 2006; 24:923-929.
55. Roy JN, Lajoie J, Zijenah LS, Barama A, Poirier C, Ward BJ, Roger M. CYP3A5 genetic polymorphisms in different ethnic populations. Drug Metab Dispos 2005; 33:884-887.
56. Hu YF, He J, Chen GL, Wang D, Liu ZQ, Zhang C, Duan LF, Zhou HH. CYP3A5*3 and CYP3A4*18 single nucleotide polymorphisms in a Chinese population. Clin Chim Acta 2005; 353:187-192.
57. Saeki M, Saito Y, Nakamura T, Murayama N, Kim SR, Ozawa S, Komamura K, Ueno K, Kamakura S, Nakajima T, Saito H, Kitamura Y, Kamatani N, Sawada J. Single nucleotide polymorphisms and haplotype frequencies of CYP3A5 in a Japanese population. Hum Mutat 2003; 21:653.
58. Fukuen S, Fukuda T, Maune H, Ikenaga Y, Yamamoto I, Inaba T, Azuma J. Novel detection assay by PCR-RFLP and frequency of the CYP3A5 SNPs,
110 CYP3A5*3 and *6, in a Japanese population. Pharmacogenetics 2002; 12:331-334.
59. Gervasini G, Vizcaino S, Gasiba C, Carrillo JA, Benitez J. Differences in CYP3A5*3 genotype distribution and combinations with other polymorphisms between Spaniards and Other Caucasian populations. Ther Drug Monit 2005; 27:819-821.
60. Bodin K, Bretillon L, Aden Y, Bertilsson L, Broome U, Einarsson C, Diczfalusy U. Antiepileptic drugs increase plasma levels of 4beta-hydroxycholesterol in humans: evidence for involvement of cytochrome p450 3A4. J Biol Chem 2001; 276:38685-38689.
61. Bodin K, Andersson U, Rystedt E, Ellis E, Norlin M, Pikuleva I, Eggertsen G, Bjorkhem I, Diczfalusy U. Metabolism of 4 beta -hydroxycholesterol in humans. J Biol Chem 2002; 277:31534-31540.
62. Janowski BA, Willy PJ, Devi TR, Falck JR, Mangelsdorf DJ. An oxysterol signalling pathway mediated by the nuclear receptor LXR alpha. Nature 1996; 383:728-731.
63. Zelcer N, Tontonoz P. Liver X receptors as integrators of metabolic and inflammatory signaling. J Clin Invest 2006; 116:607-614.
64. Ayajiki K, Okamura T, Fujioka H, Imaoka S, Funae Y, Toda N. Involvement of CYP3A-derived arachidonic acid metabolite(s) in responses to endothelium- derived K+ channel opening substance in monkey lingual artery. Br J Pharmacol 1999; 128:802-808.
65. Ayajiki K, Fujioka H, Toda N, Okada S, Minamiyama Y, Imaoka S, Funae Y, Watanabe S, Nakamura A, Okamura T. Mediation of arachidonic acid metabolite(s) produced by endothelial cytochrome P-450 3A4 in monkey arterial relaxation. Hypertens Res 2003; 26:237-243.
66. Fujioka H, Ayajiki K, Shinozaki K, Toda N, Okamura T. Mechanisms underlying endothelium-dependent, nitric oxide- and prostanoid-independent relaxation in monkey and dog coronary arteries. Naunyn Schmiedebergs Arch Pharmacol 2002; 366:488-495.
111 67. Schmiedlin-Ren P, Thummel KE, Fisher JM, Paine MF, Lown KS, Watkins PB. Expression of enzymatically active CYP3A4 by Caco-2 cells grown on extracellular matrix-coated permeable supports in the presence of 1alpha,25- dihydroxyvitamin D3. Mol Pharmacol 1997; 51:741-754.
68. Xu Y, Hashizume T, Shuhart MC, Davis CL, Nelson WL, Sakaki T, Kalhorn TF, Watkins PB, Schuetz EG, Thummel KE. Intestinal and hepatic CYP3A4 catalyze hydroxylation of 1alpha,25-dihydroxyvitamin D(3): implications for drug-induced osteomalacia. Mol Pharmacol 2006; 69:56-65.
69. Relf M, Boal DK. Rickets--a complication of ifosfamide chemotherapy for Wilms tumor. Pediatr Radiol 1992; 22:209-210.
70. Hahn TJ, Halstead LR. Sequential changes in mineral metabolism and serum vitamin D metabolite concentrations produced by phenobarbital administration in the rat. Calcif Tissue Int 1983; 35:376-382.
71. Hahn TJ, Shires R, Halstead LR. Serum dihydroxyvitamin D metabolite concentrations in patients on chronic anticonvulsant drug therapy: response to pharmacologic doses of vitamin D2. Metab Bone Dis Relat Res 1983; 5:1- 6.
72. Hahn TJ. Drug-induced disorders of vitamin D and mineral metabolism. Clin Endocrinol Metab 1980; 9:107-127.
73. Hahn TJ, Halstead LR. Anticonvulsant drug-induced osteomalacia: alterations in mineral metabolism and response to vitamin D3 administration. Calcif Tissue Int 1979; 27:13-18.
74. Hahn TJ. Bone complications of anticonvulsants. Drugs 1976; 12:201-211.
75. Hahn TJ. Anticonvulsant therapy and vitamin D. Ann Intern Med 1973; 78:308-309.
76. Hahn TJ, Birge SJ, Scharp CR, Avioli LV. Phenobarbital-induced alterations in vitamin D metabolism. J Clin Invest 1972; 51:741-748.
77. van der Rhee HJ, de Vries E, Coebergh JW. Does sunlight prevent cancer? A systematic review. Eur J Cancer 2006; 42:2222-2232.
112 78. Chatterjee B, Echchgadda I, Song CS. Vitamin D receptor regulation of the steroid/bile acid sulfotransferase SULT2A1. Methods Enzymol 2005; 400:165- 191.
79. Keshava C, McCanlies EC, Weston A. CYP3A4 polymorphisms--potential risk factors for breast and prostate cancer: a HuGE review. Am J Epidemiol 2004; 160:825-841.
80. Clore J, Schoolwerth A, Watlington CO. When is cortisol a mineralocorticoid? Kidney Int 1992; 42:1297-1308.
81. Duncan RL, Grogan WM, Kramer LB, Watlington CO. Corticosterone's metabolite is an agonist for Na+ transport stimulation in A6 cells. Am J Physiol 1988; 255:F736-F748.
82. Matsuzaki K, Arai T, Miyazaki T, Yasuda K. Formation of 6 beta-OH- deoxycorticosterone from deoxycorticosterone by A6 cells. Steroids 1995; 60:457-462.
83. Morris DJ, Latif SA, Rokaw MD, Watlington CO, Johnson JP. A second enzyme protecting mineralocorticoid receptors from glucocorticoid occupancy. Am J Physiol 1998; 274:C1245-C1252.
84. Murray GI, McFadyen MC, Mitchell RT, Cheung YL, Kerr AC, Melvin WT. Cytochrome P450 CYP3A in human renal cell cancer. Br J Cancer 1999; 79:1836-1842.
85. Watlington CO, Kramer LB, Schuetz EG, Zilai J, Grogan WM, Guzelian P, Gizek F, Schoolwerth AC. Corticosterone 6 beta-hydroxylation correlates with blood pressure in spontaneously hypertensive rats. Am J Physiol 1992; 262:F927-F931.
86. Voccia E, Saenger P, Peterson RE, Rauh W, Gottesdiener K, Levine LS, New MI. 6 beta-Hydroxycortisol excretion in hypercortisolemic states. J Clin Endocrinol Metab 1979; 48:467-471.
87. Kornel L, Miyabo S, Saito Z, Cha R-W, Wu F-T. Corticosteroids in human blood. VIII. Cortisol metabolites in plasma of normotensive subjects and patients with essential hypertension. J Clin Endocrinol Metab 1975; 40:949- 958.
113 88. Sica DA, Wilson DK, Kramer L, Watlington CO. Effect of dietary sodium (Na +) on urinary 6-beta-hydroxycortisol excretion in salt-sensitive (SS) and salt- resistant (SR) adolescent African-Americans. Am J Hypertens 1996; 9:13A.
89. Thompson EE, Kuttab-Boulos H, Witonsky D, Yang B, Roe BA, Di Rienzo A. CYP3A variation and the evolution of salt-sensitivity variants. Am J Hum Genet 2004; 75:1059-1069.
90. Thompson EE, Kuttab-Boulos H, Yang L, Roe BA, Di Rienzo A. Sequence diversity and haplotype structure at the human CYP3A cluster. Pharmacogenomics J 2006; 6:105-114.
91. Schirmer M, Toliat MR, Haberl M, Suk A, Kamdem LK, Klein K, Brockmoller J, Nurnberg P, Zanger UM, Wojnowski L. Genetic signature consistent with selection against the CYP3A4*1B allele in non-African populations. Pharmacogenet Genomics 2006; 16:59-71.
92. Sadrieh N, Snyderwine EG. Cytochromes P450 in cynomolgus monkeys mutagenically activate 2-amino-3-methylimidazo[4,5-f]quinoline (IQ) but not 2- amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx). Carcinogenesis 1995; 16:1549-1555.
93. Stevens GJ, Burkey JL, McQueen CA. Toxicity of the heterocyclic amine batracylin: investigation of rodent N-acetyltransferase activity and potential contribution of cytochrome P450 3A. Cell Biol Toxicol 2000; 16:31-39.
94. Windmill KF, McKinnon RA, Zhu X, Gaedigk A, Grant DM, McManus ME. The role of xenobiotic metabolizing enzymes in arylamine toxicity and carcinogenesis: functional and localization studies. Mutat Res 1997; 376:153- 160.
95. Gallagher EP, Kunze KL, Stapleton PL, Eaton DL. The kinetics of aflatoxin B1 oxidation by human cDNA-expressed and human liver microsomal cytochromes P450 1A2 and 3A4. Toxicol Appl Pharmacol 1996; 141:595-606.
96. Miyata M, Takano H, Guo LQ, Nagata K, Yamazoe Y. Grapefruit juice intake does not enhance but rather protects against aflatoxin B1-induced liver DNA damage through a reduction in hepatic CYP3A activity. Carcinogenesis 2004; 25:203-209.
114 97. Wojnowski L, Turner PC, Pedersen B, Hustert E, Brockmoller J, Mendy M, Whittle HC, Kirk G, Wild CP. Increased levels of aflatoxin-albumin adducts are associated with CYP3A5 polymorphisms in The Gambia, West Africa. Pharmacogenetics 2004; 14:691-700.
98. Wells C. Prehistoric and historical changes in nutritional diseases and associated conditions. Prog Food Nutr Sci 1975; 1:729-779.
99. Neer RM. The evolutionary significance of vitamin D, skin pigment, and ultraviolet light. Am J Phys Anthropol 1975; 43:409-416.
100. Jablonski NG, Chaplin G. The evolution of human skin coloration. J Hum Evol 2000; 39:57-106.
101. Li YC, Qiao G, Uskokovic M, Xiang W, Zheng W, Kong J. Vitamin D: a negative endocrine regulator of the renin-angiotensin system and blood pressure. J Steroid Biochem Mol Biol 2004; 89-90:387-392.
102. Scragg R, Sowers M, Bell C. Serum 25-hydroxyvitamin D, Ethnicity, and Blood Pressure in the Third National Health and Nutrition Examination Survey. Am J Hypertens 2007; 20:713-719.
103. Forman JP, Giovannucci E, Holmes MD, Bischoff-Ferrari HA, Tworoger SS, Willett WC, Curhan GC. Plasma 25-hydroxyvitamin D levels and risk of incident hypertension. Hypertension 2007; 49:1063-1069.
104. Halhali A, Diaz L, Avila E, Ariza AC, Garabedian M, Larrea F. Decreased fractional urinary calcium excretion and serum 1,25-dihydroxyvitamin D and IGF-I levels in preeclampsia. J Steroid Biochem Mol Biol 2007; 103:803-806.
105. Capoluongo E, Zuppi C, Ameglio F. IGF-1 system, Vitamin D and blood pressure relationships. Cytokine 2007; 37:183-184.
106. Akcakus M, Koklu E, Kurtoglu S, Kula M, Koklu SS. The relationship among intrauterine growth, insulinlike growth factor I (IGF-I), IGF-binding protein-3, and bone mineral status in newborn infants. Am J Perinatol 2006; 23:473- 480.
115 107. Brauer G, Yokoyama Y, Falgueres C, Mbua E. Modern human origins backdated. Nature 1997; 386:337-338.
108. Horai S, Hayasaka K, Kondo R, Tsugane K, Takahata N. Recent African origin of modern humans revealed by complete sequences of hominoid mitochondrial DNAs. Proc Natl Acad Sci U S A 1995; 92:532-536.
109. Stringer CB, Andrews P. Genetic and fossil evidence for the origin of modern humans. Science 1988; 239:1263-1268.
110. Gleiberman L. Salt, hypertension, evolution. Psychosom Med 2001; 63:325- 327.
111. Akerlund M. Involvement of oxytocin and vasopressin in the pathophysiology of preterm labor and primary dysmenorrhea. Prog Brain Res 2002; 139:359- 365.
112. Kosuge K, Chuang AI, Uematsu S, Tan KP, Ohashi K, Ko BC, Ito S. Discovery of Osmo-sensitive Transcriptional Regulation of Human Cytochrome P450 3As (CYP3As) by the Tonicity-Responsive Enhancer Binding Protein (TonEBP/ NFAT5). Mol Pharmacol 2007.
113. Reid IA. The renin-angiotensin system and body function. Arch Intern Med 1985; 145:1475-1479.
114. Ward K, Hata A, Jeunemaitre X, Helin C, Nelson L, Namikawa C, Farrington PF, Ogasawara M, Suzumori K, Tomoda S, . A molecular variant of angiotensinogen associated with preeclampsia. Nat Genet 1993; 4:59-61.
115. Nakajima T, Wooding S, Sakagami T, Emi M, Tokunaga K, Tamiya G, Ishigami T, Umemura S, Munkhbat B, Jin F, Guan-Jun J, Hayasaka I, Ishida T, Saitou N, Pavelka K, Lalouel JM, Jorde LB, Inoue I. Natural selection and population history in the human angiotensinogen gene (AGT): 736 complete AGT sequences in chromosomes from around the world. Am J Hum Genet 2004; 74:898-916.
116. Young JH, Chang YP, Kim JD, Chretien JP, Klag MJ, Levine MA, Ruff CB, Wang NY, Chakravarti A. Differential susceptibility to hypertension is due to selection during the out-of-Africa expansion. PLoS Genet 2005; 1:e82.
116 117. Ueda K, Okamura N, Hirai M, Tanigawara Y, Saeki T, Kioka N, Komano T, Hori R. Human P-glycoprotein transports cortisol, aldosterone, and dexamethasone, but not progesterone. J Biol Chem 1992; 267:24248-24252.
118. Parker RB, Yates CR, Laizure SC, Weber KT. P-glycoprotein modulates aldosterone plasma disposition and tissue uptake. J Cardiovasc Pharmacol 2006; 47:55-59.
119. Ernest S, Rajaraman S, Megyesi J, Bello-Reuss EN. Expression of MDR1 (multidrug resistance) gene and its protein in normal human kidney. Nephron 1997; 77:284-289.
120. Ichikawa-Haraguchi M, Sumizawa T, Yoshimura A, Furukawa T, Hiramoto S, Sugita M, Akiyama S. Progesterone and its metabolites: the potent inhibitors of the transporting activity of P-glycoprotein in the adrenal gland. Biochim Biophys Acta 1993; 1158:201-208.
121. Muller MB, Keck ME, Binder EB, Kresse AE, Hagemeyer TP, Landgraf R, Holsboer F, Uhr M. ABCB1 (MDR1)-type P-glycoproteins at the blood-brain barrier modulate the activity of the hypothalamic-pituitary-adrenocortical system: implications for affective disorder. Neuropsychopharmacology 2003; 28:1991-1999.
122. Zolk O, Jacobi J, Pahl A, Fromm MF, Schmieder RE. MDR1 genotype- dependent regulation of the aldosterone system in humans. Pharmacogenet Genomics 2007; 17:137-144.
123. Cornoni-Huntley J, LaCroix AZ, Havlik RJ. Race and sex differentials in the impact of hypertension in the United States: the National Health and Nutrition Examination Survey I Epidemiologic Follow-up Study. Arch Intern Med 1989; 149:780-788.
124. Weinberger MH. Salt sensitivity of blood pressure in humans. Hypertension 1996; 27:481-490.
125. Sagnella GA. Why is plasma renin activity lower in populations of African origin? J Hum Hypertens 2001; 15:17-25.
117 126. Naray-Fejes-Toth A, Rusvai E, Fejes-Toth G. Is the renal type III corticosteroid-binding site the collecting duct-specific isoform of 11 beta- hydroxysteroid dehydrogenase? Endocrinology 1994; 134:1671-1675.
127. Naray-Fejes-Toth A, Fejes-Toth G. 11 beta-hydroxysteroid dehydrogenase-2 is a high affinity corticosterone-binding protein. Mol Cell Endocrinol 1997; 134:157-161.
128. Ghosh SS, Basu AK, Ghosh S, Hagley R, Kramer L, Schuetz J, Grogan WM, Guzelian P, Watlington CO. Renal and hepatic family 3A cytochromes P450 (CYP3A) in spontaneously hypertensive rats. Biochem Pharmacol 1995; 50:49-54.
129. Varga I, Jakab C, Szucs N, Patocs A, Toth M, Kiss R, Glaz E, Racz K. Plasma and salivary 6beta-hydroxycortisol measurements for assessing adrenocortical activity in patients with adrenocortical adenomas. Horm Metab Res 2003; 35:421-426.
130. Galteau MM, Shamsa F. Urinary 6beta-hydroxycortisol: a validated test for evaluating drug induction or drug inhibition mediated through CYP3A in humans and in animals. Eur J Clin Pharmacol 2003; 59:713-733.
131. Schuetz EG, Schuetz JD, Grogan WM, Naray-Fejes-Toth A, Fejes-Toth G, Raucy J, Guzelian P, Gionela K, Watlington CO. Expression of cytochrome P450 3A in amphibian, rat, and human kidney. Arch Biochem Biophys 1992; 294:206-214.
132. Robertshaw M, Lai KN, Swaminathan R. Prediction of creatinine clearance from plasma creatinine: comparison of five formulae. Br J Clin Pharmacol 1989; 28:275-280.
133. The sixth report of the Joint National Committee on prevention, detection, evaluation, and treatment of high blood pressure. Arch Intern Med 1997; 157:2413-2446.
134. McCarron P, Okasha M, McEwen J, Davey Smith G. Blood pressure in early life and cardiovascular disease mortality. JAMA 2002; 162:610-611.
135. Goto M, Masuda S, Kiuchi T, Ogura Y, Oike F, Okuda M, Tanaka K, Inui K. CYP3A5*1-carrying graft liver reduces the concentration/oral dose ratio of
118 tacrolimus in recipients of living-donor liver transplantation. Pharmacogenetics 2004; 14:471-478.
136. MacPhee IA, Fredericks S, Mohamed M, Moreton M, Carter ND, Johnston A, Goldberg L, Holt DW. Tacrolimus pharmacogenetics: the CYP3A5*1 allele predicts low dose-normalized tacrolimus blood concentrations in whites and South Asians. Transplantation 2005; 79:499-502.
137. Yu S, Wu L, Jin J, Yan S, Jiang G, Xie H, Zheng S. Influence of CYP3A5 gene polymorphisms of donor rather than recipient to tacrolimus individual dose requirement in liver transplantation. Transplantation 2006; 81:46-51.
138. Lee AJ, Cai MX, Thomas PE, Conney AH, Zhu BT. Characterization of the oxidative metabolites of 17beta-estradiol and estrone formed by 15 selectively expressed human cytochrome p450 isoforms. Endocrinology 2003; 144:3382- 3398.
139. Lee AJ, Mills LH, Kosh JW, Conney AH, Zhu BT. NADPH-dependent metabolism of estrone by human liver microsomes. J Pharmacol Exp Ther 2002; 300:838-849.
140. Modugno F, Knoll C, Kanbour-Shakir A, Romkes M. A potential role for the estrogen-metabolizing cytochrome P450 enzymes in human breast carcinogenesis. Breast Cancer Res Treat 2003; 82:191-197.
141. Starr JR, Chen C, Doody DR, Hsu L, Ricks S, Weiss NS, Schwartz SM. Risk of testicular germ cell cancer in relation to variation in maternal and offspring cytochrome p450 genes involved in catechol estrogen metabolism. Cancer Epidemiol Biomarkers Prev 2005; 14:2183-2190.
142. Williams ET, Leyk M, Wrighton SA, Davies PJ, Loose DS, Shipley GL, Strobel HW. Estrogen regulation of the cytochrome P450 3A subfamily in humans. J Pharmacol Exp Ther 2004; 311:728-735.
143. Lin HL, Hollenberg PF. The inactivation of cytochrome P450 3A5 by 17alpha- ethynylestradiol is cytochrome b5-dependent: metabolic activation of the ethynyl moiety leads to the formation of glutathione conjugates, a heme adduct, and covalent binding to the apoprotein. J Pharmacol Exp Ther 2007; 321:276-287.
119 144. Williams JA, Ring BJ, Cantrell VE, Jones DR, Eckstein J, Ruterbories K, Hamman MA, Hall SD, Wrighton SA. Comparative metabolic capabilities of CYP3A4, CYP3A5, and CYP3A7. Drug Metab Dispos 2002; 30:883-891.
145. Moilanen AM, Hakkola J, Vaarala MH, Kauppila S, Hirvikoski P, Vuoristo JT, Edwards RJ, Paavonen TK. Characterization of androgen-regulated expression of CYP3A5 in human prostate. Carcinogenesis 2007; 28:916-921.
146. Aoyama T, Yamano S, Waxman DJ, Lapenson DP, Meyer UA, Fischer V, Tyndale R, Inaba T, Kalow W, Gelboin HV, . Cytochrome P-450 hPCN3, a novel cytochrome P-450 IIIA gene product that is differentially expressed in adult human liver. cDNA and deduced amino acid sequence and distinct specificities of cDNA-expressed hPCN1 and hPCN3 for the metabolism of steroid hormones and cyclosporine. J Biol Chem 1989; 264:10388-10395.
147. Huang W, Lin YS, McConn DJ, Calamia JC, Totah RA, Isoherranen N, Glodowski M, Thummel KE. Evidence of significant contribution from CYP3A5 to hepatic drug metabolism. Drug Metab Dispos 2004; 32:1434-1445.
148. Kamdem LK, Meineke I, Koch I, Zanger UM, Brockmoller J, Wojnowski L. Limited contribution of CYP3A5 to the hepatic 6beta-hydroxylation of testosterone. Naunyn Schmiedebergs Arch Pharmacol 2004; 370:71-77.
149. Nahoul K, Adeline J, Paysant F, Scholler R. Radioimmunoassay of plasma and urine 6 beta-hydroxycortisol: levels in healthy adults and in hypercortisolemic states. J Steroid Biochem 1982; 17:343-350.
150. Grogan WM, Fidelman ML, Newton DE, Duncan RL, Watlington CO. A corticosterone metabolite produced by A6 (toad kidney) cells in culture: identification and effects on Na+ transport. Endocrinology 1985; 116:1189- 1194.
151. Morris DJ, Latif SA, Conca TJ, Wei LT, Watlington CO, Kirk DN, Toms HC, Shackleton CH. Synthesis of 6 beta-hydroxyaldosterone by A6 (toad kidney) cells in culture. Steroids 1990; 55:482-487.
152. Watlington CO, Atkins JL, McNeil JS, Grogan WM, Johnson JP. Corticosterone is converted to 6 beta-hydroxycorticosterone in rat: effects of the metabolite on urinary electrolyte excretion. J Steroid Biochem 1988; 31:947-954.
120 153. Plummer SJ, Conti DV, Paris PL, Curran AP, Casey G, Witte JS. CYP3A4 and CYP3A5 genotypes, haplotypes, and risk of prostate cancer. Cancer Epidemiol Biomarkers Prev 2003; 12:928-932.
154. Zeigler-Johnson C, Friebel T, Walker AH, Wang Y, Spangler E, Panossian S, Patacsil M, Aplenc R, Wein AJ, Malkowicz SB, Rebbeck TR. CYP3A4, CYP3A5, and CYP3A43 genotypes and haplotypes in the etiology and severity of prostate cancer. Cancer Res 2004; 64:8461-8467.
155. Zhenhua L, Tsuchiya N, Narita S, Inoue T, Horikawa Y, Kakinuma H, Kato T, Ogawa O, Habuchi T. CYP3A5 gene polymorphism and risk of prostate cancer in a Japanese population. Cancer Lett 2005; 225:237-243.
156. DeMichele A, Aplenc R, Botbyl J, Colligan T, Wray L, Klein-Cabral M, Foulkes A, Gimotty P, Glick J, Weber B, Stadtmauer E, Rebbeck TR. Drug- metabolizing enzyme polymorphisms predict clinical outcome in a node- positive breast cancer cohort. J Clin Oncol 2005; 23:5552-5559.
157. Tucker AN, Tkaczuk KA, Lewis LM, Tomic D, Lim CK, Flaws JA. Polymorphisms in cytochrome P4503A5 (CYP3A5) may be associated with race and tumor characteristics, but not metabolism and side effects of tamoxifen in breast cancer patients. Cancer Lett 2005; 217:61-72.
158. Yeh KT, Chen JC, Chen CM, Wang YF, Lee TP, Chang JG. CYP3A5*1 is an inhibitory factor for lung cancer in Taiwanese. Kaohsiung J Med Sci 2003; 19:201-207.
159. Blanco JG, Edick MJ, Hancock ML, Winick NJ, Dervieux T, Amylon MD, Bash RO, Behm FG, Camitta BM, Pui CH, Raimondi SC, Relling MV. Genetic polymorphisms in CYP3A5, CYP3A4 and NQO1 in children who developed therapy-related myeloid malignancies. Pharmacogenetics 2002; 12:605-611.
160. Liu TC, Lin SF, Chen TP, Chang JG. Polymorphism analysis of CYP3A5 in myeloid leukemia. Oncol Rep 2002; 9:327-329.
161. Kadlubar FF, Berkowitz GS, Delongchamp RR, Wang C, Green BL, Tang G, Lamba J, Schuetz E, Wolff MS. The CYP3A4*1B variant is related to the onset of puberty, a known risk factor for the development of breast cancer. Cancer Epidemiol Biomarkers Prev 2003; 12:327-331.
121 162. Eap CB, Bochud M, Elston RC, Bovet P, Maillard MP, Nussberger J, Schild L, Shamlaye C, Burnier M. CYP3A5 and ABCB1 genes influence blood pressure and response to treatment, and their effect is modified by salt. Hypertension 2007; 49:1007-1014.
163. Ferraresso M, Tirelli A, Ghio L, Grillo P, Martina V, Torresani E, Edefonti A. Influence of the CYP3A5 genotype on tacrolimus pharmacokinetics and pharmacodynamics in young kidney transplant recipients. Pediatr Transplant 2007; 11:296-300.
164. Fromm MF, Schmidt BMW, Pahl A, Jacobi J, Schmieder RE. CYP3A5 genotype is associated with elevated blood pressure. Pharmacogenetics and Genomics 2005; 15:737-741.
165. Ho H, Pinto A, Hall SD, Flockhart DA, Li L, Skaar TC, Cadman P, O'Connor DT, Wagner U, Fineberg NS, Weinberger MH. Association between the CYP3A5 genotype and blood pressure. Hypertension 2005; 45:294-298.
166. Jin Y, Wang YH, Miao J, Li L, Kovacs RJ, Marunde R, Hamman MA, Phillips S, Hilligoss J, Hall SD. Cytochrome P450 3A5 Genotype is Associated with Verapamil Response in Healthy Subjects. Clin Pharmacol Ther 2007.
167. Kain S, Bolbrinker J, Zuurman M, de Jong PE, Navis G, Kreutz R. The CYP3A5 polymorphism affects systolic blood pressure and pulse pressure in the general population. Naunyn-Schmiedebergs Archives of Pharmacology 2006; 371:R135-R136.
168. Kivisto KT, Niemi M, Schaeffeler E, Pitkala K, Tilvis R, Fromm MF, Schwab M, Lang F, Eichelbaum M, Strandberg T. CYP3A5 genotype is associated with diagnosis of hypertension in elderly patients: data from the DEBATE Study. Am J Pharmacogenomics 2005; 5:191-195.
169. Kreutz R, Zuurman M, Kain S, Bolbrinker J, de Jong PE, Navis G. The role of the cytochrome P450 3A5 enzyme for blood pressure regulation in the general Caucasian population. Pharmacogenetics and Genomics 2005; 15:831-837.
170. Kreutz R, Zurcher H, Kain S, Martus P, Offermann G, Beige J. The effect of variable CYP3A5 expression on cyclosporine dosing, blood pressure and long-term graft survival in renal transplant patients. Pharmacogenetics 2004; 14:665-671.
122 171. Langaee TY, Gong Y, Yarandi HN, Katz DA, Cooper-DeHoff RM, Pepine CJ, Johnson JA. Association of CYP3A5 polymorphisms with hypertension and antihypertensive response to verapamil. Clin Pharmacol Ther 2007; 81:386- 391.
172. Lieb W, Bolbrinker J, Doring A, Hense HW, Erdmann J, Schunkert H, Kreutz R. No association of the CYP3A5*1 allele with blood pressure and left ventricular mass and geometry: the KORA/MONICA Augsburg echocardiographic substudy. Clin Sci (Lond) 2006; 111:365-372.
173. Pahl A, Schmidt BMW, Fromm MF, Jacobi J, Schmieder RE. CYP3A5 genotype is associated with blood pressure. Eur J Clin Pharmacol 2006; 61:716.
174. Ozelius LJ, Hewett J, Kramer P, Bressman SB, Shalish C, de Leon D, Rutter M, Risch N, Brin MF, Markova ED, Limborska SA, Ivanova-Smolenskaya IA, McCormick MK, Fahn S, Buckler AJ, Gusella JF, Breakefield XO. Fine localization of the torsion dystonia gene (DYT1) on human chromosome 9q34: YAC map and linkage disequilibrium. Genome Res 1997; 7:483-494.
175. Patil N, Berno AJ, Hinds DA, Barrett WA, Doshi JM, Hacker CR, Kautzer CR, Lee DH, Marjoribanks C, McDonough DP, Nguyen BT, Norris MC, Sheehan JB, Shen N, Stern D, Stokowski RP, Thomas DJ, Trulson MO, Vyas KR, Frazer KA, Fodor SP, Cox DR. Blocks of limited haplotype diversity revealed by high-resolution scanning of human chromosome 21. Science 2001; 294:1719-1723.
176. Wijsman EM. A deductive method of haplotype analysis in pedigrees. Am J Hum Genet 1987; 41:356-373.
177. Excoffier L, Slatkin M. Maximum-likelihood estimation of molecular haplotype frequencies in a diploid population. Mol Biol Evol 1995; 12:921-927.
178. Hawley ME, Kidd KK. HAPLO: a program using the EM algorithm to estimate the frequencies of multi-site haplotypes. J Hered 1995; 86:409-411.
179. Long JC, Williams RC, Urbanek M. An E-M algorithm and testing strategy for multiple-locus haplotypes. Am J Hum Genet 1995; 56:799-810.
123 180. Fallin D, Schork NJ. Accuracy of haplotype frequency estimation for biallelic loci, via the expectation-maximization algorithm for unphased diploid genotype data. Am J Hum Genet 2000; 67:947-959.
181. Schneider S, Roessli D, Excoffier L. Arlequin ver. 2.000: a software for population genetics data analysis. University of Geneva, Switzerland, Genetics and Biometry Laboratory: 2000. http://lgb.unige.ch/arlequin/ .
182. New MI, Levine LS, Biglieri EG, Pareira J, Ulick S. Evidence for an unidentified steroid in a child with apparent mineralocorticoid hypertension. J Clin Endocrinol Metab 1977; 44:924-933.
183. Ulick S, Levine LS, Gunczler P, Zanconato G, Ramirez LC, Rauh W, Rosler A, Bradlow HL, New MI. A syndrome of apparent mineralocorticoid excess associated with defects in the peripheral metabolism of cortisol. J Clin Endocrinol Metab 1979; 49:757-764.
184. Fuller PJ, Young MJ. Mechanisms of mineralocorticoid action. Hypertension 2005; 46:1227-1235.
185. Stewart PM. Mineralocorticoid hypertension. Lancet 1999; 353:1341-1347.
186. Holmes MC, Kotelevtsev Y, Mullins JJ, Seckl JR. Phenotypic analysis of mice bearing targeted deletions of 11beta-hydroxysteroid dehydrogenases 1 and 2 genes. Mol Cell Endocrinol 2001; 171:15-20.
187. Kotelevtsev Y, Brown RW, Fleming S, Kenyon C, Edwards CR, Seckl JR, Mullins JJ. Hypertension in mice lacking 11beta-hydroxysteroid dehydrogenase type 2. J Clin Invest 1999; 103:683-689.
188. Armanini D, Calo L, Semplicini A. Pseudohyperaldosteronism: pathogenetic mechanisms. Crit Rev Clin Lab Sci 2003; 40:295-335.
189. Naray-Fejes-Toth A, Rusvai E, Fejes-Toth G. Minealocorticoid receptors and 11 beta-steroid dehydrogenase activity in renal principal and intercalated cells. Am J Physiol 1994; 266:F76-F80.
190. Buhler H, Perschel FH, Fitzner R, Hierholzer K. Endogenous inhibitors of 11 beta-OHSD: existence and possible significance. Steroids 1994; 59:131-135.
124 191. Latif SA, Hartman LR, Souness GW, Morris DJ. Possible endogenous regulators of steroid inactivating enzymes and glucocorticoid-induced Na+ retention. Steroids 1994; 59:352-356.
192. Kizer NL, Lewis B, Stanton BA. Electrogenic sodium absorption and chloride secretion by an inner medullary collecting duct cell line (mIMCD-K2). Am J Physiol 1995; 268:F347-F355.
193. Horwitz KB, McGuire WL. Estrogen control of progesterone receptor in human breast cancer. Correlation with nuclear processing of estrogen receptor. J Biol Chem 1978; 253:2223-2228.
194. Escher G, Galli I, Vishwanath BS, Frey BM, Frey FJ. Tumor necrosis factor alpha and interleukin 1beta enhance the cortisone/cortisol shuttle. J Exp Med 1997; 186:189-198.
195. Agarwal AK, Mune T, Monder C, White PC. NAD(+)-dependent isoform of 11 beta-hydroxysteroid dehydrogenase. Cloning and characterization of cDNA from sheep kidney. J Biol Chem 1994; 269:25959-25962.
196. Bourgeois S, Gruol DJ, Newby RF, Rajah FM. Expression of an mdr gene is associated with a new form of resistance to dexamethasone-induced apoptosis. Mol Endocrinol 1993; 7:840-851.
197. Gruol DJ, Bourgeois S. Expression of the mdr1 P-glycoprotein gene: a mechanism of escape from glucocorticoid-induced apoptosis. Biochem Cell Biol 1994; 72:561-571.
198. Gruol DJ, Bourgeois S. Chemosensitizing steroids: glucocorticoid receptor agonists capable of inhibiting P-glycoprotein function. Cancer Res 1997; 57:720-727.
199. Yates CR, Chang C, Kearbey JD, Yasuda K, Schuetz EG, Miller DD, Dalton JT, Swaan PW. Structural determinants of P-glycoprotein-mediated transport of glucocorticoids. Pharm Res 2003; 20:1794-1803.
200. Choudhary D, Jansson I, Schenkman JB, Sarfarazi M, Stoilov I. Comparative expression profiling of 40 mouse cytochrome P450 genes in embryonic and adult tissues. Arch Biochem Biophys 2003; 414:91-100.
125 201. Hermans JJR, Fischer MA, Schiffers PM, Struijker-Boudier HA. Effect of angiotensin II on rat renal cortical 11beta-hydroxysteroid dehydrogenase. Endocrine 2000; 13:393-399.
202. Usa K, Singh RJ, Netzel BC, Liu Y, Raff H, Liang M. Renal Interstitial Corticosterone and 11-Dehydrocorticosterone in Conscious Rats. Am J Physiol Renal Physiol 2007; [Epub ahead of print].
203. Williamson R, Lee D, Hagaman J, Maeda N. Marked reduction of high density lipoprotein cholesterol in mice genetically modified to lack apolipoprotein A-I. Proc Natl Acad Sci U S A 1992; 89:7134-7138.
204. Hatada S, Kuziel W, Smithies O, Maeda N. The influence of chromosomal location on the expression of two transgenes in mice. J Biol Chem 1999; 274:948-955.
205. Yamada A, Fujita K, Yokoi T, Muto S, Suzuki A, Gondo Y, Katsuki M, Kamataki T. In vivo detection of mutations induced by aflatoxin B1 using human CYP3A7/HITEC hybrid mice. Biochem Biophys Res Commun 1998; 250:150-153.
206. Li Y, Yokoi T, Kitamura R, Sasaki M, Gunji M, Katsuki M, Kamataki T. Establishment of transgenic mice carrying human fetus-specific CYP3A7. Arch Biochem Biophys 1996; 329:235-240.
207. Li Y, Yokoi T, Katsuki M, Wang JS, Groopman JD, Kamataki T. In vivo activation of aflatoxin B1 in C57BL/6N mice carrying a human fetus-specific CYP3A7 gene. Cancer Res 1997; 57:641-645.
208. Yu AM, Fukamachi K, Krausz KW, Cheung C, Gonzalez FJ. Potential role for human cytochrome P450 3A4 in estradiol homeostasis. Endocrinology 2005; 146:2911-2919.
209. Shimada T, Yamazaki H, Mimura M, Inui Y, Guengerich FP. Interindividual variations in human liver cytochrome P-450 enzymes involved in the oxidation of drugs, carcinogens and toxic chemicals: studies with liver microsomes of 30 Japanese and 30 Caucasians. J Pharmacol Exp Ther 1994; 270:414-423.
210. Watkins PB. Noninvasive tests of CYP3A enzymes. Pharmacogenetics 1994; 4:171-184.
126 211. Xie W, Barwick JL, Downes M, Blumberg B, Simon CM, Nelson MC, Neuschwander-Tetri BA, Brunt EM, Guzelian PS, Evans RM. Humanized xenobiotic response in mice expressing nuclear receptor SXR. Nature 2000; 406:435-439.
212. Gibson GG, Plant NJ, Swales KE, Ayrton A, El Sankary W. Receptor- dependent transcriptional activation of cytochrome P4503A genes: induction mechanisms, species differences and interindividual variation in man. Xenobiotica 2002; 32:165-206.
213. Bax L, Yu LM, Ikeda N, Tsuruta H, Moons KG. Development and validation of MIX: comprehensive free software for meta-analysis of causal research data. BMC Med Res Methodol 2006; 6:50.
214. Sethi AA, Nordestgaard BG, Tybjaerg-Hansen A. Angiotensinogen gene polymorphism, plasma angiotensinogen, and risk of hypertension and ischemic heart disease: a meta-analysis. Arterioscler Thromb Vasc Biol 2003; 23:1269-1275.
215. Suh JW, Koo BK, Zhang SY, Park KW, Cho JY, Jang IJ, Lee DS, Sohn DW, Lee MM, Kim HS. Increased risk of atherothrombotic events associated with cytochrome P450 3A5 polymorphism in patients taking clopidogrel. CMAJ 2006; 174:1715-1722.
216. Kim KA, Park PW, Lee OJ, Choi SH, Min BH, Shin KH, Chun BG, Shin JG, Park JY. Effect of CYP3A5*3 genotype on the pharmacokinetics and pharmacodynamics of amlodipine in healthy Korean subjects. Clin Pharmacol Ther 2006; 80:646-656.
127