One Hundred and Eleventh Series – May 9-10, 2019 Portland, Oregon
Why Do Patients Develop ANCA Disease?
Ronald J. Falk, MD Nan and Hugh Cullman Eminent Professor of Medicine Chair, Department of Medicine University of North Carolina, Chapel Hill NC USA
1 Common Clinical Questions
1. “What is the name of my disease?” “How did I get it?”
What is the cause of disease?
2. “What will make it go away?”
What factors are involved in disease pathogenesis?
3. “What will prevent it from coming back?” What causes a relapse, and what sustains a remission?
2 Our First Case
JP is a 15-year-old female with the sudden onset of coughing up blood in a previously healthy child. There was a 2-week history of flu-like illness.
Physical examination was marked by hypertension and pulmonary findings of diffuse crackles in both lung fields.
The serum creatinine was 10 mg/dL.
Treatment was with pulses of methylprednisolone.
3 Antigen Specificity
Cytoplasmic ANCA Perinuclear ANCA
Proteinase 3 Myeloperoxidase (PR3-ANCA), BPI, (MPO-ANCA), 4 others elastase, others The Early ANCA Vasculitis Story
• Autoantibodies against neutrophils and monocytes: tool for diagnosis and marker of disease activity in Wegener’s granulomatosis o van der Woude FJ, Rasmussen N, Lobatto S et al. Lancet 1985; 325(8426):425-9 • Anti-neutrophil cytoplasmic autoantibodies with specificity for myeloperoxidase in patients with systemic vasculitis and idiopathic necrotizing and crescentic glomerulonephritis o Falk RJ, Jennette JC. N Engl J Med 1988; 318(25):1651-7 • Wegener’s granulomatosis autoantibodies identify a novel diisopropylfluorophosphate-binding protein in the lysosomes of normal human neutrophils o Goldschmeding R et al. J Clin Invest 1989; 84(5):1577-87 • Specificity of anti-neutrophil cytoplasmic autoantibodies for proteinase 3 o Jennette JC, Hoidal JR, Falk RJ. Blood 1990 74(11):2263-4
5 ANCA testing led to:
• A new classification system and a unified, overall name: ANCA vasculitis or ANCA-associated vasculitis
• Recognition that disparate clinical symptoms are part of the same disease process
• Simplification of induction therapy strategies
• Organization of several randomized clinical trials
6 Immune Complex Small Vessel Vasculitis 2012 Chapel Hill Cryoglobulinemic Vasculitis Consensus Conference IgA Vasculitis (Henoch-Schönlein) Vasculitis Nomenclature Hypocomplementemic Urticarial Vasculitis (Anti-C1q Vasculitis) Medium Vessel Vasculitis Polyarteritis Nodosa Anti-GBM Disease Kawasaki Disease
ANCA-Associated Small Vessel Vasculitis Microscopic Polyangiitis Granulomatosis with Polyangiitis (Wegener’s) Eosinophilic Granulomatosis with Polyangiitis Large Vessel Vasculitis (Churg-Strauss) Takayasu Arteritis Giant Cell Arteritis Jennette JC, Falk RJ et al. Arthritis Rheum 2013;65:1-11 ANCA-associated vasculitis can affect virtually any tissue and organ in the body:
Pulmonary Glomerular alveolar capillaries capillaries (glomerulonephritis) (capillaritis) Necrosis Crescent
Venules in Small arteries in many organs multiple organs (venulitis) (arteritis)
Capillaries: Venules: Arteries: • Glomerulonephritis • Purpura • Mononeuritis multiplex • Pulmonary capillaritis • Medullary angiitis • Skin nodules and ulcers Concept of Pauci-Immune Glomerulonephritis
Crescentic Glomerulonephritis Immune Pauci- Anti-GBMComplex Immune
>90% ANCA+ 9 Signs and Symptoms of Necrotizing Small Vessel Vasculitis
• Cutaneous purpura, nodules and ulcerations • Peripheral neuropathy (mononeuritis multiplex) • Abdominal pain and blood in stool • Hematuria, proteinuria and renal insufficiency • Hemoptysis and pulmonary infiltrates or nodules • Necrotizing (hemorrhagic) sinusitis • Myalgias and arthralgias • Muscle and pancreatic enzymes in blood • Propensity for venous thrombosis 10 Light Microscopic Morphology
FOCAL SCLEROSING GN CHRONIC GN
FOCAL NECROSIS AND CRESCENTIC END STAGE NECROSIS FEW CRESCENTS GN KIDNEY
HEMATURIA and/or ACUTE RAPIDLY SLOWLY PROTEINURIA NEPHRITIS PROGRESSIVE PROGRESSIVE NEPHRITIS NEPHRITIS
11 12
Antigen Specificity
Cytoplasmic ANCA Perinuclear ANCA
Proteinase 3 Myeloperoxidase (PR3-ANCA), BPI, (MPO-ANCA), 14 others elastase, others ANCA Disease
PR3-ANCA Disease
ANCA- MPO-ANCA Negative Disease Disease
FOR EXAMPLE: MPO-ANCA glomerulonephritis MPO-ANCA microscopic polyangiitis PR3-ANCA granulomatosis disease MPO-ANCA Churg-Strauss Syndrome
15 Falk RJ and Jennette JC. J Am Soc Nephrol 2010; 21(5):745-52 CCX168 (Avacopan) azathioprine plasmapheresis
mycophenolate
glucocorticoids Cyclophosphamide
©cjb Current Therapy Plasmapheresis or IV methylprednisolone then IV cyclophosphamide and/or rituximab then azathioprine or rituximab and/or Stop In general, remission rates are on the order of 70% to 93%.
Relapse rates vary from 0% to 50%. Worrying about Over-Immunosuppression
19 Take Home Message #1
ANCA, which was an early biomarker of disease, is now the name of the disease, resulting in earlier diagnosis and more prompt therapy.
20 Common Clinical Questions
1. “What is the name of my disease?” “How did I get it?” What is the cause of disease?
2. “What will make it go away?” What factors are involved in disease pathogenesis?
3. “What will prevent it from coming back?” What causes a relapse, and what sustains a remission?
21 Pathogenesis of ANCA Necrotizing Vasculitis
To cause vasculitis, ANCA must induce this event sequence:
. Leukocyte margination, adherence, and diapedesis
. Leukocyte activation with degranulation and generation of toxic oxygen metabolites
. Vascular necrosis with karyorrhexis and fibrinous insudation
22 JCJ Hypothetical Pathogenesis of ANCA Vasculitis by ANCA
Primed neutrophils are activated by ANCA with involvement of FcR and complement activation amplification.
Modified from: Falk RJ, Jennette JC. J Am Soc Nephrol 2010; 21:745-52 23 MPO-ANCA Mediated Necrotizing and Crescentic Glomerulonephritis and Vasculitis in Mice
Immunize with MPO
MPO-KO 1. Immunize MPO-knockout mice with murine MPO. Anti-MPO antibodies 2. Transfer anti-MPO IgG into Rag2-/- or WT B6 mice.
3. Causes MPO-ANCA-induced pauci-immune necrotizing and crescentic glomerulonephritis and small vessel vasculitis.
Xiao H, Heeringa P, Hu P, Liu Z, Zhao M, Aratani Y, Maeda N, Falk RJ, Jennette JC. J Clin Invest 2002; 110:955-963. Comparative Pathology of Human AAV and Anti-MPO Mouse Model of AAV Mouse Human
Glomerulonephritis Fibrinoid necrosis Crescent
Vasculitis Fibrinoid necrosis Inflammation
25 In this anti-MPO IgG induced mouse model of ANCA glomerulonephritis: • Anti-MPO IgG alone can cause disease
o Jennette JC et al. J Am Soc Nephrol 2006; 17:1235-1242 • Neutrophils are required
o Xiao H et al. Am J Pathol 2005; 167:39-45 • Neutrophil priming exacerbates disease
o Jennette JC et al. J Am Soc Nephrol 2006; 17:1235-1242 • T cells do not cause acute disease
o Xiao H et al. J Clin Invest 2002; 110:955-963 • Abrogation of the alternative complement pathway prevents disease
o Xiao H et al. Am J Pathol 2007; 170:52-64 • C5a receptor antagonists abrogate disease
o Schreiber A et al. J Am Soc Nephrol 2009; 20:289-298 26 An orally active antagonist of human C5a receptor given to mice with knocked in human C5a receptor and knocked out mouse C5a receptor suppresses induction of glomerulonephritis by anti-MPO IgG
Xiao H, et al. J Am Soc Nephrol 2014; 25(2):225-231
Glomerulonephritis Clinical Study Group (UK) CLEAR trial (NCT01363388): Phase 2 trial of CCX168 (complement inhibitor) in ANCA vasculitis
27 Take Home Message #2
ANCA are pathogenic and target circulating cells rather than directly attacking the target organ (vessels).
28 Major Phases of Autoimmune Disease
Genetic Predisposition
ANCA Production + T Cell and Macrophage Defective T and B Cell Mediation of Acute Injury (by neutrophils and monocytes) Response to Injury Regulation
Environmental Resolution Scarring Factors
Relapse/Recurrence
29
Patient Y ANCA Titer ANCA Patient X
Active Disease Disease Remission Active Disease
30 Cryptic Epitopes in MPO
6/4/2019 31 PR3 Transcripts are Detected in Mature Neutrophils and Monocytes But Not in Lymphocytes of ANCA
32 Yang JJ et al. J Am Soc Nephrol 2004; 15:2103-14 PRTN3 and MPO mRNA levels in leukocytes from ANCA patients are significantly increased compared to levels from healthy controls
PRTN3mRNA p<0.0001 MPOmRNA p<0.0001
8000 12000
7000 10000
6000
8000 5000
4000 6000
mRNA Expression mRNA 3000 4000
2000 (Relative to a standard curve)
2000 1000
0 0
HC (n=169) ANCA (n=969) HC (n-169) ANCA (n=969)
33 PRTN3 and MPO mRNA Levels are Closely Correlated with Disease Activity During Disease Course
MPOmRNA 1000 4000
750 3000
500 2000
mRNA Expression mRNA 250 1000
(Relative (Relative to a standard curve) 0 0
A R A A R A A A R A A R A A
34 PR3 and MPO Gene Transcription are Closely Correlated 1600 R² = 0.70 1400 P<0.0001
1200
1000
800
600
400 MPOmRNA (Spearman Rank) MPOmRNA
200
0 0 200 400 600 800 1000 1200 1400 1600 PR3mRNA (Spearman Rank) 35 MPO and PR3 expression results in new protein production in neutrophils isolated from patients with ANCA vasculitis.
McInnis E et al. J Am Soc Nephrol 2015; 26(2): 390-9 36 Transcriptional Dysregulation Linked to Alternative Transcripts
PRTN3 PRTN3-002
About 25% of patients are positive for the alternative transcript, mostly during active disease 37 McInnis E et al. J Am Soc Nephrol 2015; 26(2): 390-9 Epigenetic Silencing of Neutrophil Granule Genes
Ciavatta DJ et al. J Clin Invest 2010 ; 120(9):3209-19 38 DNA Methylation at CpG Islands Leads to Transcriptional Silencing of Gene Promoters
M Methylated Unmethylated
Gene Expression
CpG Island Gene
M M M Gene Expression Repressed
CpG Island Gene PRTN3 Promoter
CTGAGGGCTGTGGCCATGTTGCCCACCTGGCCAGGGACCCCCGAC CG element TTGGGTGGGTGACAGCCAGCCTCCCCGCCCCCACAAAGGTTGG
GACCTTGAGCCCAAAGCCCCCACCTCCTCCCCGGAGTCCGTTCTG PU.1 ACTCCCAGGCTCCCAAGGCAAAAGGAGGAAGTGGGGACCCAGCC
TGGGCATTGGGCAACTCAACGGCCTCTGGCATTGGGCTATAAGA
Met GGAGCTTGACCGTGGGTGCACCCTGGACCCCACCATG PRTN3 Promoter
CTGAGGGCTGTGGCCATGTTGCCCACCTGGCCAGGGACCCCCGAC CG element TTGGGTGGGTGACAGCCAGCCTCCCCGCCCCCACAAAGGTTGG
GACCTTGAGCCCAAAGCCCCCACCTCCTCCCCGGAGTCCGTTCTG PU.1 ACTCCCAGGCTCCCAAGGCAAAAGGAGGAAGTGGGGACCCAGCC
TGGGCATTGGGCAACTCAACGGCCTCTGGCATTGGGCTATAAGA
Met GGAGCTTGACCGTGGGTGCACCCTGGACCCCACCATG Change in DNA Methylation at PRTN3 Promoter Predicts Relapse
42 Jones BE et al. J Am Soc Nephrol 2017; 28(4):1175-87 Take Home Message #4
It is not just the presence of ANCA, but also an epigenetic dysregulation of ANCA antigen genes that may be responsible for causing the disease.
43 Common Clinical Questions
1. “What is the name of my disease?” “How did I get it?” What is the cause of disease?
2. “What will make it go away?” What factors are involved in disease pathogenesis?
3. “What will prevent it from coming back?” What causes a relapse, and what sustains a remission?
44 Acute Injury Response to Injury
Jennette JC et al. Annu Rev Pathol Mech Dis 2013; 8:139–60 Biology of Relapse and Remission
Need for biomarkers of
Remission and Relapse
46 Patient Global Assessment Scored During Times of Remission and Disease Relapse
The Vasculitis Clinical Research Consortium reports an increase in the patient global assessment tool, which captures how patients judge their own disease activity, often precedes detection of disease activity by the physician by at least 3 months.
47 Tomasson G et al. Arthritis Rheum 2014; 66:428-32. Active Urine Sediment
48 What will cause a relapse, and
what sustains a remission?
49 Common Clinical Questions
1. “What is the name of my disease?” “How did I get it?” What is the cause of disease?
2. “What will make it go away?” What factors are involved in disease pathogenesis?
3. “What will prevent it from coming back?” What causes a relapse, and what sustains a remission?
50 UNC Kidney Center