Cytokinin Regulates Root Meristem Activity Via Modulation of the Polar Auxin Transport

Cytokinin regulates root meristem activity via modulation of the polar auxin transport

Kamil Ru˚ zˇicˇkaa,1,Ma´ ria Simaˇ ´ sˇkova´ a, Jerome Duclercqa, Jan Petra´ sˇekb,c, Eva Zažímalova´ b, Sibu Simonb,d, Jirˇí Frimla,e, Marc C. E. Van Montagua,2, and Eva Benkova´ a,e,2

aDepartment of Plant Systems Biology, VIB, and Department of Plant Biotechnology and Genetics, Gent University, Technologiepark 927, 9052 Gent, Belgium; bInstitute of Experimental Botany, Rozvojova´263, 16502 Prague, Czech Republic; cDepartment of Plant Physiology, Faculty of Science, Charles University, Vinicˇna´ 5, 12844 Prague 2, Czech Republic; eLaboratory of Molecular Plant Physiology, Department of Functional Genomics and Proteomics, Masaryk University, Kamenice 5, 62500 Brno, Czech Republic; and dDepartment of Biochemistry, Faculty of Science, Charles University, Hlavova 2030, 12840 Prague 2, Czech Republic

Contributed by Marc C. E. Van Montagu, January 9, 2009 (sent for review November 26, 2008) Plant development is governed by signaling molecules called FERASE (IPT) gene (17, 18) inhibits the root growth and phytohormones. Typically, in certain developmental processes reduces the meristem size. Accordingly, decreased endogenous more than 1 hormone is implicated and, thus, coordination of their CK levels via overexpression of the CYTOKININ OXIDASE/ overlapping activities is crucial for correct plant development. DEHYDROGENASE (CKX) family genes have an opposite However, molecular mechanisms underlying the hormonal effect, i.e., enhanced meristem and root growth (19). crosstalk are only poorly understood. Multiple hormones including CK seems to play an important role already in the early events cytokinin and auxin have been implicated in the regulation of root of root specification, because lack of the ARR7, and ARR15 development. Here we dissect the roles of cytokinin in modulating components of the CK signaling pathway causes defects in the growth of the primary root. We show that cytokinin effect on root establishment of the root stem cell niche during embryogenesis elongation occurs through ethylene signaling whereas cytokinin (20). Postembryonically in the root meristem, CK does not seem effect on the root meristem size involves ethylene-independent to interfere with specification of the quiescent center (QC) and modulation of transport-dependent asymmetric auxin distribu- stem cell function, or with the overall division rate, but affects tion. Exogenous or endogenous modification of cytokinin levels mainly the meristematic cell differentiation rate, resulting in and cytokinin signaling lead to specific changes in transcription of shortening of the meristematic zone (4, 5). In addition, CK several auxin efflux carrier genes from the PIN family having a regulates elongation of cells leaving the root meristem (4). direct impact on auxin efflux from cultured cells and on auxin Although the interaction between auxin and CKs in control of distribution in the root apex. We propose a novel model for organogenesis has been known for years (the first information cytokinin action in regulating root growth: Cytokinin influences related to this phenomenon appeared decades ago) (21), the cell-to-cell auxin transport by modification of expression of several molecular mechanisms underlying the mutual coordination of auxin transport components and thus modulates auxin distribution the auxin and cytokinin action and the possible crosstalk of their important for regulation of activity and size of the root meristem. pathways in regulating root growth are so far not known. We reveal a unique mechanism of auxin–cytokinin interaction and auxin ͉ auxin transport ͉ cytokinin ͉ hormonal crosstalk ͉ root meristem show that CK regulates the cell-to-cell auxin transport by modulating transcription of several PIN auxin efflux carriers. lant hormones play a crucial role in regulating plant devel- We propose a model for regulation of the auxin–cytokinin Popment and the flexible shaping of the plant architecture in balance that is critical for root organogenesis. By modulating the response to variable environmental conditions. The final devel- auxin transport CK might control the auxin levels in root opmental and physiological output of the hormonal signaling in meristem cells and, thus, the ratio between auxin and CK. plants is the typical result of combined actions of several hormonal pathways. However, our knowledge of the mecha- Results and Discussion nisms involved in the hormonal crosstalk is still poor. The CK Effect on the Root Meristem Does Not Interfere with Ethylene- In the regulation of root development, several hormonal Mediated Processes. Root growth depends on the production of pathways are involved, with auxin and cytokinin being the new cells, their differentiation, and elongation. New cells are principal players. The whole process of root organogenesis, produced in the mitotically active meristem zone, whereas their starting with the initiation of the root pole in embryos (1), differentiation and elongation occur in the more proximal part positioning and formation of stem cell niche (2, 3), maintenance of the root tip. The plant hormone CK regulates the root of mitotic activity in proximal meristem (4–6), and rapid elon- meristem activity. Increase of CK levels either by exogenous gation and differentiation of cells leaving the root meristem (7) application of CK or overexpression of ISOPENTENYLTRANS- has been demonstrated to be controlled by auxin. In this context, FERASE (IPT), a gene involved in CK biosynthesis, reduces the the differential auxin distribution between cells is crucial (3, 8, size of root meristems and overall root growth (5) (supporting 9). The auxin gradients or local auxin maxima can be generated information (SI) Fig. S1C). On the contrary, plants overexpress- by auxin metabolic reactions, mainly by local auxin biosynthesis ing CYTOKININ OXIDASE/DEHYDROGENASE (CKX) caus- (6, 10, 11) and intercellular auxin transport dependent on the coordinated action of influx carriers of the AUX/LAX family (12), PIN efflux carriers (13, 14), and members of the multidrug- Author contributions: K.R., J.F., and E.B. designed research; K.R., M.S., J.D., J.P., E.Z., S.S., M.C.E.V.M., and E.B. performed research; K.R., M.S., J.D., J.P., E.Z., and E.B. analyzed data; resistant/P-glycoprotein (MDR/PGP) subfamily B of ATP- and J.F. and E.B. wrote the paper. binding cassette (ABCB) proteins (15, 16). Accordingly, inter- The authors declare no conflict of interest. ference with the polar auxin transport disrupts the auxin 1Present address: Institute of Biochemistry, University of Helsinki, FIN-00014, Helsinki, distribution and results in dramatic patterning defects in the root Finland. meristem (2, 3, 9). 2To whom correspondence may be addressed. E-mail: [email protected] or eva. Besides auxin, cytokinin (CK) is also involved in root orga- [email protected]. nogenesis. Increase in CK levels by exogenous application or This article contains supporting information online at www.pnas.org/cgi/content/full/ overexpression of the bacterial ISOPENTENYLTRANS- 0900060106/DCSupplemental.

4284–4289 ͉ PNAS ͉ March 17, 2009 ͉ vol. 106 ͉ no. 11 www.pnas.org͞cgi͞doi͞10.1073͞pnas.0900060106 Downloaded by guest on September 30, 2021 -AVG +AVG 1,3 - -AVG +AVG col ein2 etr1-3 A B * C 120 1,2 1,6 * * * * 1,1 ** 100 * * * ** 1,4 * * * * 1 1,2 80 0,9 1 60 0,8 0,8 0,7 (cm) RL 0,6 40 0,6 0,4 20 RM reduction (%) 0,5 0,2 RM reduction (relative units) 0 0105010 50 100 0105010 50 100 0 50 100 nM BA nM BA nM BA

D col ein2 etr1-3 E MS BA AVG BA AVG F 120 120 100 100 80 80 60 *

60 40 20 40 0 RL reduction (%) RL 20 * * * Relative fluorescence (%) BA MS 0 AVG

050100 AVG BA nM BA

Fig. 1. Ethylene-independent root meristem size modulation by CK. (A) Reduction of ethylene biosynthesis by AVG without interference with CK effect on the root meristem size (no difference between CK-treated and CK ϩ AVG-treated root meristems; Student’s t test, P Ͼ 0.05). (B) CK-insensitive root growth at reduced ethylene biosynthesis conditions (*statistically significant difference in root length between CK and CK ϩ AVG-treated seedlings; Student’s t test P Ͻ 0.05). (C) Reduced root meristem in the ethylene signaling mutants etr1–3 and ein2 after CK treatment (*statistically significant difference in the root meristem size between CK-treated and -nontreated seedlings; Student’s t test, P Ͻ 0.05). (D) CK-resistant root growth of etr1–3 and ein2.(E) CK-induced ectopic expression of DR5::GFP reporter in outer layers of the root meristem (lateral root cap and epidermis; arrowheads). Reduction of ethylene biosynthesis by AVG diminishes the DR5 ectopic expression. CK-reduced DR5 expression in QC (asterisks). (F) Quantification of DR5::GFP expression by image analysis in QC of roots treated with CK and CK ϩ AVG; expression of DR5::GFP is significantly reduced after CK treatment under conditions of reduced ethylene biosynthesis (*statistically significant difference between AVG and CK ϩ AVG-treated roots, Student’s t test, P Ͻ 0.05). Six-day-old seedlings grown on media containing 100 nM BA, 200 nM AVG, (if not marked differently). RM, root meristem; RL, root length; MS, Murashige and Skoog medium only; CK represented by N6-benzyladenine (BA); col, control Columbia seedlings. Error bars represent standard deviation (SD).

ing enhanced degradation of CK have longer root meristems (19) activity in the outer layers of the root meristem and the (Fig. S1C). elongation zone (Fig. 1E, data not shown). A similar change in Because CK stimulates ethylene biosynthesis (22) and ethyl- the pattern of the DR5 reporter expression has been demon- ene itself strongly affects root growth (23, 24), we first examined strated previously to be caused by ethylene (23, 24, 29). Indeed, which CK effects on the root growth are mediated by ethylene. reduced ethylene biosynthesis by AVG completely eliminated To address this issue, either CK-induced ethylene production this ectopic signal, indicating that CK upregulates DR5::GFP was eliminated with the ethylene biosynthesis inhibitor 2- expression in the elongation zone through ethylene (Fig. 1E). aminoethoxyvinylglycin (AVG) (25) or the ethylene response Remarkably, besides induction of the DR5 activity in the epi- was prevented genetically by mutations in the ethylene signaling dermis of the root tip, we observed that CK attenuated the signal pathway, thus exhibiting typical ethylene-insensitive root growth in the QC and columella cells and these effects became more (26). Significantly, reduction of ethylene synthesis by AVG, and obvious when the ethylene biosynthesis was inhibited by AVG interference with the ethylene signaling in etr1–3 and ein2 (Fig. 1 E and F). mutants led to CK-insensitive cell elongation and overall root In summary, our results dissected the ethylene-dependent and growth (data not shown and Fig. 1B and D) but did not interfere -independent roles of CK on root growth: CK regulates the root with the CK effect on the root meristem (Fig. 1 A and C). To meristem size independently of ethylene, while its effect on the analyze the CK effect on the cell size and cell division activity of cell elongation and overall root growth is mediated through the root meristem more in detail, we used the CycB1;1::GUSDB ethylene (23, 24, 29). Ethylene-independent reduction of the reporter, marking cells in the G2 stage of the cell cycle (27). CK auxin response in the QC and columella cells suggests a direct alone and at simultaneously inhibited ethylene biosynthesis interaction between the CK and the auxin pathways, indepen- dramatically reduced the zone of the CycB1;1::GUSDB expres- dent of ethylene. sion, suggesting that the CK treatment might interfere with the balance between mitotic activity and differentiation of cells in CK and Nontransportable Auxin Show Similar Effects on the Root the proximal meristematic zone (Fig. 2A, Fig. S2 B and D) (5), Meristem. The differential auxin distribution in the root meristem and further confirming that the CK effect on the root meristem requires an active auxin transport (9). Furthermore, some does not depend on ethylene. mutants defective in the activity or polar localization of PIN Spatial patterns of the auxin response based on auxin gradi- auxin efflux carriers (2, 30) are dramatically reduced in the root ents are important factors in the regulating of a large number of meristem size, resembling the CK effect. To address whether the

plant developmental processes, including dividing root cells (3, CK effect on the auxin distribution and root meristem activity is BIOLOGY

9). Using the auxin response reporters DR5::GUS and DR5::GFP related to the auxin transport, we compared the effects of 2 DEVELOPMENTAL (28), we observed that the CK treatment induces ectopic DR5 different auxins—1-naphthaleneacetic acid (NAA), well trans-

Ru˚zˇicˇkaetal. PNAS ͉ March 17, 2009 ͉ vol. 106 ͉ no. 11 ͉ 4285 Downloaded by guest on September 30, 2021 A MS NAA 2,4-D BA B 1,5 RL RM

0,5 Relative unit

0 0 50 200 400 800 nM NAA

RL RM RL RM C 1,5 D 1,2 1 1 0,8 0,5 0,6 0,4 Relative unit Relative unit 0 0,2 1 3 0 30 10

0 5 10 20 40 60 100 200 0.1 0.3 100 0.01 nM 2,4 - D nM BA

Fig. 2. CK regulation of root growth in a manner similar to 2,4-D. (A) Increased zone of CycB1;1::GUSDB reporter expression by lower (200 nM) NAA concentration. Treatment with CK (100 nM BA) or 2,4-D (100 nM) reduced expression of CycB1;1::GUSDB reporter. (B) Root growth and root meristem size on NAA concentration gradients. Low NAA concentration with strong inhibitory effect on root growth still has a stimulatory effect on the root meristem size (meristems at 200 nM statistically significant, Student’s t test, P Ͻ 0.05). (C) Gradual reduction of size of the root meristem and inhibition of root growth on 2,4-D concentration gradient (meristems at 40 nM and higher concentration statistically significant, Student’s t test, P Ͻ 0.05). (D) Gradual reduction of the root meristem size and root growth by increasing CK (BA) concentrations (meristems at 1 nM and higher concentration statistically significant, Student’s t test, P Ͻ 0.05). Six-day-old seedlings grown on media supplemented with hormones. RM, root meristem; RL, root length. Error bars represent SD.

portable by the polar transport system, and 2,4-dichlorophe- expressing under the endogenous promoter the Arabidopsis noxyacetic acid (2,4-D), which tends to accumulate in cells PIN1 auxin efflux carrier tagged with RFP. In this assay, CK because of its low affinity to the auxin efflux machinery (31). Our does not affect short term the auxin efflux (within 30 min, data results revealed dramatic differences between these 2 auxins. not shown). However, longer CK pretreatments (24 h) led to an NAA stimulated the mitotic activity in the proximal root mer- increase of the [3H]NAA accumulation that indicates a decrease istem, as visualized by the CycB1;1::GUSDB reporter (Fig. 2A; in NAA efflux activity (Fig. 3B). Treatment with the auxin efflux Fig. S2A), resulting in an enlarged root meristem at lower (200 inhibitor 1-naphthylphthalamic acid (NPA) has very similar, but nM) concentrations, but reduced root growth already at 50 nM immediate, effect on the NAA accumulation in PIN1:GFP concentration (Fig. 2B). In contrast to NAA, 2,4-D treatment expressing cell culture (ref. 16; data not shown), further con- led to continuous reduction in the root meristem size and the firming that CK inhibits the auxin efflux, possibly by an indirect root length at concentrations higher than 20 nM and reached the mechanism. We tested whether CK has an effect on PIN same degree of reduction of root growth at the concentration of expression in BY-2 cells. Analysis of PIN1:RFP signal revealed 200 nM as did NAA at 800 nM (Fig. 2 A and C; Fig. S2C). When that the CK treatment leads to a decreased PIN1:RFP expression compared to auxins, CK mimics in many aspects the 2,4-D mode (Fig. 3A; Fig. S1D). These data suggest that CK might modulate of action. It reduced the root meristem size, and it dramatically the auxin efflux via regulation of the PIN expression. decreased root elongation already at 30 nM (Fig. 2 A and D; Fig. S2B). Moreover, low NAA concentration did not overcome CK CK Modulates Expression of the Auxin Efflux Carriers of the PIN Family. inhibitory effect on root meristem size (Fig. S2E) suggesting that The next question was whether endogenous or exogenous ma- CK effect on root meristem size is not mediated exclusively by nipulation of CK levels in planta affects the expression of the controlling overall auxin levels. Our results demonstrate that auxin efflux carriers from the PIN family. To distinguish whether auxins, and CK, modulate the root meristem size, but that they the observed changes in expression are CK-specific or related to differ in concentration range at which they can act either in a CK-induced ethylene synthesis, all experiments were carried out stimulatory or an inhibitory mode. Importantly, the CK effect on in parallel in the presence of AVG as inhibitor and 1-aminocy- the root meristem size resembles that of an inefficiently trans- clopropane-1-carboxylate (ACC) as precursor of the ethylene ported 2,4-D, hinting that the auxin transport can be a down- biosynthesis (25), respectively. Analyses using transcriptional stream target of the CK action in regulating this process. and translational reporters, and real-time Q-RT PCR revealed that CK modulates the expression of several PIN genes in a CK Reduces Auxin Efflux in Tobacco BY-2 Suspension Cells. We tested manner specific for each particular auxin efflux carrier. whether CK has a direct effect on the auxin efflux—the rate- CK negatively regulates PIN1 expression. CK treatment limiting process in the intercellular auxin transport. The estab- strongly reduced the PIN1:GFP or PIN1 (visualized by antibody lished assay for auxin efflux quantification from cells relies on staining) signal in root tips (Figs. 3D and 4A; Fig. S3A). measuring the accumulation of radioactively labeled NAA Similarly, endogenously increased CK levels, by dexamethasone- ([3H]NAA) in cultured tobacco BY-2 cells (14). In contrast to induced expression of the IPT gene reduced the PIN1 signal (Fig. Arabidopsis cell cultures, in BY-2 culture each cell is in direct S1A). In contrast, the decrease of CK levels by overexpression contact with the medium, so that it can render more precise of the CKX3 gene (19) resulted in upregulation of the PIN1 quantitative data. NAA is well conveyed into the tobacco cells signal (Fig. S1B). A more detailed time-lapse analysis revealed by passive diffusion and it is well transported out by the efflux that shortly after CK application, PIN1:GFP expression is tem- carriers; therefore, NAA accumulation inside cells is a good porally enhanced and then gradually decreases (Fig. S3E). measure for the auxin efflux activity (14, 31). However, the negative effect of CK on PIN1 expression is We tested the CK effect on the auxin efflux with BY-2 cells complicated by the CK-induced ethylene production and sub-

4286 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0900060106 Ru˚zˇicˇkaetal. Downloaded by guest on September 30, 2021 A B MS BA C AVG BA AVG 1,50 250,0 200,0 1,00 150,0 100,0

0,50 50,0

0,0 0,00 Accumulation of 3H NAA (pmol per milion cells) 0 5 10 15 20 25 Relative expression (%) PIN1 PIN3 PIN7 PIN2 MS BA time (min) ARR5

D PIN1:GFP (24 h) E PIN2:GFP (48 h) F PIN3:GFP (24h) G PIN7:GFP (24h)

MS BA MS BA MS BA MS BA

Fig. 3. Interference of CK with expression of auxin efﬂux carriers. (A) Reduction of PIN1:RFP expression by CK in tobacco BY-2 cells. (B) Increased auxin accumulation in the BY-2 cells after pretreatment with CK (5 ␮M BA, 24 h). (C) Quantitative RT-PCR expression analysis of PIN genes. Six hours after CK treatment, expression of PIN genes is modulated. ARR5 used as positive control induced by CK (44). (D) Expression of PIN1:GFP is reduced by CK treatment. (E) Downregulation of PIN2:GFP expression by CK effect. (F) Downregulation of PIN3:GFP expression after long-term (24 h) CK treatment. (G) Stimulation of PIN7:GFP expression by CK treatment. Six-day-old seedlings incubated in control or with 5 ␮M BA supplemented media. MS, Murashige and Skoog medium only; CK represented by BA. Error bars represent SD.

sequent induction of the PIN1 expression by ethylene (29). effects on root meristem activity, there might also be additional Accordingly, both ACC and CK treatments upregulated the CK-dependent posttranscriptional regulations involved. PIN1::GUS expression (Fig. S4A) and the CK-induced PIN1 expression was completely abolished by simultaneous applica- CK Effect on PIN1 Transcription Requires Histidine Kinase-Based CK tion of AVG (Fig. S4A). Similarly to PIN1, expression of PIN4 Signaling. We investigated the requirement of the CK signaling is also negatively controlled by CK. Expression of both for CK-dependent regulation of PIN transcription and root PIN4::GUS and PIN4:GFP reporters was strongly downregu- meristem growth. To corroborate whether the CK effect on the lated by CK (Fig. S4E, data not shown) counteracting the PIN1 expression does not depend on ethylene, we treated positive effect of ethylene on the PIN4 transcription (29) (Fig. seedlings with CK and performed immunodetection of PIN1 in S4E). In contrast to PIN1 and PIN4, the expression of PIN2:GFP an etr1–3 mutant that is defective in ethylene perception (26). was relatively resistant to the CK treatment and an occasionally In this experimental setup, CK reduced the expression of PIN1 decreased expression was observed only after longer (over 24 h) in the etr1–3 mutant similarly to control roots (Fig. S5A), treatment with CK (Fig. 3E; Fig. S3 C and E). Because PIN2 confirming that ethylene biosynthesis and perception are not expression is strongly stimulated by ethylene (29), the inhibitory required for the CK effect on root meristem growth. effect of CK was more pronounced when the ethylene biosyn- It is known that CK signals through the histidine kinase family of receptors (32). To investigate the involvement of the CK thesis was inhibited (Fig. S4B). In the case of PIN3, short-term perception in the CK effect on root meristem, we analyzed CK CK treatment upregulated and longer treatments reduced the sensitivity of single and multiple receptor mutants in terms of PIN3:GFP expression (Fig. 3F; Fig. S3 B and E) and cotreat- root meristem size. While root meristems of the single CK ments with AVG and ACC did not indicate any strong influence receptor mutants ahk2–2 and ahk3–3 showed an almost normal of ethylene (Fig. S4C and S3B). In contrast to other PIN genes, CK sensitivity, cre1–12 and its multiple mutant combinations expression of PIN7:GFP and PIN7::GUS was clearly upregulated (cre1–12 ϫ ahk2–2 and cre1–12 ϫ ahk3–3) displayed reduced CK by CK with no significant influence of ethylene (Fig. 3G and sensitivity (Fig. 4B). These results demonstrate that the CK Figs. S3 D and E and S4D). The real time Q-RT PCR experi- control over the root meristem requires a functional CK per- ments in general corroborated reporter-based observation and ception pathway. confirmed that CK has a negative effect on transcription of PIN1, We tested whether CK receptors are similarly involved in the PIN2, and PIN3 and a positive effect on PIN7 (Fig. 3C). regulation of the PIN1 expression. Immunolocalization of PIN1 Nonetheless, the time dynamic and extent of response differs for revealed that PIN1 expression was reduced following CK treat- each particular PIN gene. Higher CK concentrations (10 ␮M ment of the ahk2–2 single mutant, but exhibited increased BA) even after short-term treatments show stronger effects on resistance to CK and remained unchanged in cre1–12 x ahk2–2 PIN transcription (Fig. S4F). double mutant (Fig. 4A; data not shown). A similar set of In summary, our results show that CK in a concentration- experiments using PIN1:GFP revealed that CK reduces PIN1

dependent manner differentially regulates transcription of PIN expression with lower efficiency in cre1–12 background (Fig. BIOLOGY

auxin efflux carriers in roots. Despite the fact that the effects of S5B). Thus, the CK effect on PIN1 transcription correlates well DEVELOPMENTAL CK on PIN transcription are obvious and can account for CK with the CK-sensitive or CK-resistant root meristem of partic-

Ru˚zˇicˇkaetal. PNAS ͉ March 17, 2009 ͉ vol. 106 ͉ no. 11 ͉ 4287 Downloaded by guest on September 30, 2021 A coordinated, and what are the molecular mechanisms behind their control cre1xahk2 interaction?’’ Mu¨ller and Sheen (20) revealed that auxin regulates transcription of ARR7 and ARR15, negative regulators of the CK signaling pathway, suggesting that auxin might control output of the CK signaling pathway through modulation of transcription of one of its critical components. Here, we show a novel mechanism of CK–auxin interaction involved in the control of the root meristem size. CK by modifying the expression of several PIN genes might regulate cell-to-cell auxin transport, and thus the actual level of MS BA MS BA auxin in the cells, providing the amount of signal for downstream auxin signaling.

B Materials and Methods Plant Materials and Growth Conditions. Seeds were chloral-gas sterilized, * * * plated (0.5 ϫ MS medium with 1% sucrose), stored for 2 days at 4 °C in the dark, and then grown under a 16-h photoperiod at 20 °C. The following transgenic lines were characterized elsewhere: 35S::CKX2, 35S::CKX3 (37); etr1–3 and ein2–1 (26); pOp::ipt/Lh6r (38), CycB1;1::GUSDB (39); DR5rev::GFP; PIN1,2,3,4,7::GUS; PIN1:GFP (8, and references herein); PIN2:GFP (40), PIN3:GFP, PIN4:GFP, PIN7:GFP (2), cre1–12, ahk2–2, ahk3–3 and their RM reduction (%) double-mutant combinations (41). PIN1::PIN1:mRFP1 gene construct was obtained from PIN1::PIN1:GFP (8) by replacing GFP coding sequence with mRFP1. Tobacco BY-2 cells (Nicotiana tabacum L. cv. Bright Yellow 2) were trans- formed by cocultivation with Agrobacterium tumefaciens strain C58C1 carry- ing PIN1::PIN1:mRFP1 according to ref. 42 and cultured as described (14). ahk2 ahk3 cre1 ahk2x cre1x cre1x ahk3 ahk2 ahk3 ACC stock solution (Sigma-Aldrich) was prepared as 10 mM, AVG (Fluka) as 10 mM, 2,4-D (Duchefa) as 1 mM, dissolved with water, NAA (Duchefa) as 10 Fig. 4. Dependence of CK-mediated inhibition of PIN1 expression on CK mM, dexamethasone (Sigma-Aldrich) as 5 mM, dissolved with dimethyl sul- perception. (A) Reduced expression of PIN1 in wild-type, but not in the cre1–12 foxide, and N6-benzyladenine (BA) (Sigma-Aldrich) as 50 mM, dissolved with x ahk2–2 double-mutant root meristem after CK treatment. (B) CK-resistant 1 N sodium hydroxide. Dexamethasone induction of IPT in pOp::ipt/Lh6r was root meristem of cytokinin receptor mutants cre1–12, cre1–12 x ahk2–2, done as decribed (16, 17). cre1–12 x ahk3–3, and CK-sensitive root meristem in ahk2–2, ahk3–3, and ahk2–2 x ahk3–3 mutants (*significantly different from control, Student’s t Phenotypical Analysis, Microscopy and Statistics. Roots and root meristem test P Ͻ 0.05). Six-day-old seedlings (A) incubated for 20 h in control media or regions were measured as published (29) with the following modification: supplemented with 1 ␮M BA, (B) grown on control media or supplemented with root meristem length was assessed as the distance between the QC and the 0.1 ␮M BA, respectively. Red signal, immunolocalization of PIN1 by PIN1-specific first elongating cell, the experimental image data sets were then randomly antibodies. Control, wild type, CK represented by BA, error bars represent SD. measured using the Altap Salamander Renamer (www.altap.cz) and ImageJ programs (National Institutes of Health, http://rsb.info.nih.gov/ij). Automated whole mount protein immunolocalization was done as de- ular CK receptor mutant combinations. In conclusion, our data scribed (43); each sample was processed in 3 technical replicates (each Ϸ10 demonstrated that CK controls meristem size and that the PIN1 seedlings) and all experiments were repeated at least twice. The bright field expression requires functional CK, but not ethylene perception. and GFP fluorescence photographs were obtained by a Zeiss Axiophot microscope equipped with an Axiocam HR CCD camera. For the confocal laser scanning microscopy, a Leica TCS SP2 AOBS was used. GFP fluorescence of Model for Auxin–CK Interaction in Root Meristems. The interaction of membrane-localized proteins was quantified as published (29). Images pre- auxin and CK plays an important role in the regulation of plant sented were processed in Adobe Photoshop. development and organogenesis (20, 33, 34). Early experiments on Histochemical GUS stainings and root tissue clearing was done as published tobacco pith tissue cell cultures revealed that auxin and CK are (43). Data were statistically evaluated with NCSS 2007 (www.ncss.com). Equal essential hormones for maintenance of cell proliferation, but also variances of values were verified by Levene test; a Mann-Whitney nonpara- for the regeneration of plant organs (21). Amazingly, the decision metric test was performed simultaneously with Student’s t test. of whether a cell culture stays in the proliferating status or new organs, such as shoots or roots, are formed depends on the PIN1:mRFP1 Expression Analysis in BY-2 Cells. For treatment with CK, stationary concentration ratio between these 2 plant hormones (21). Another 7-day-old cells were inoculated into fresh medium containing (5 ␮M) BA after interesting aspect of the auxin–CK crosstalk is that their interaction 24 h of cultivation. Cells were then incubated for another 24 h and auxin mode strongly depends on the developmental context: they act accumulation assays or confocal microscopy was performed. For observations of PIN1::PIN1:mRFP1 in BY-2 cells, a Zeiss LSM 5-DUO confocal microscope with synergistically to stimulate the mitotic activity of cells in cell cultures a40ϫ C-Apochromat objective (N.A. ϭ 1.2 W) was used. (21), but antagonistically in root and shoot branching (for review, refs. 35 and 36). When focused at the apical root meristem, the role Auxin Accumulation Assays. [3H]NAA accumulation into the cells was measured for both auxin and CK is well defined. Auxin is an important in 0.5-mLiter cell suspension aliquots as described (14). regulator of stem cell niche establishment (2, 3), cell proliferation occurring in the meristematic zone (4–6), and differentiation and Quantitative RT-PCR. RNA was extracted with the RNeasy kit (Qiagen) from rapid elongation of cells leaving the meristematic zone (7). Re- root samples (last 2 mm of the root tip). A DNase treatment with RQ1 cently, significant progress on the role of CK has been made. CK RNase-Free DNase (Promega) was carried out for 30 min at 37 °C. Poly(dT) levels have been shown to be critical for maintenance of the root cDNA was prepared from 1 ␮g total RNA with SuperScript III Reverse Tran- meristem size and the site of CK action is primarily the regulation scriptase (Invitrogen) and quantified with a LightCycler 480 (Roche) with the of the ratio between cell division and differentiation of cells leaving LightCycler 480 SYBR GREEN I Master (Roche) according to the manufacturer’s instructions. PCR was carried out in 384-well optical reaction plates heated for the meristem. In addition, a role for the CK signaling pathway has 10 min to 95 °C to activate hot start TaqDNA polymerase (Roche), followed by been suggested in stem cell niche establishment during embryo- 40 cycles of denaturation for 60 s at 95 °C and annealing/extension for 60 s at genesis (20). 58 °C. Targets were quantified with specific primer pairs designed with the Because auxin and CK closely overlap in the regulation of root Beacon Designer 4.0 (Premier Biosoft International, Palo Alto, CA). Expression meristems the question arises ‘‘how are their overlapping activities levels were normalized to ACTIN2 expression levels. All RT-PCR experiments

4288 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0900060106 Ru˚zˇicˇkaetal. Downloaded by guest on September 30, 2021 were done at least in triplicates. The statistical signiﬁcance was evaluated by ACKNOWLEDGMENTS. We thank Tatsuo Kakimoto, Jan Heja´tko, Kla´ra Hoy- the t test. The following primers were used: ACTIN2 (TTGACTACGAGCAG- erova´, and Ian Moore for sharing published material, Marke´ta Parˇezova´, GAGATGG and ACAAACGAGGGCTGGAACAAG), PIN1 (TACTCCGAGACCTTC- Robin Piron, and Elke Barbez for technical help, and Martine De Cock for CAACTACG and TCCACCGCCACCACTTCC), PIN2 (CCTCGCCGCACTCTTTCTT- critical reading of the manuscript. This work was supported by the European TGG and CCGTACATCGCCCTAAGCAATGG), PIN3 (GAGGGAGAAGGAAGAAA- Research Area-Networking (ERA-NET) Plant Genomics program (to K.R.), Min- GGGAAC and CTTGGCTTGTAATGTTGGCATCAG), PIN7 (CGGCTGATATTGATA- istry of Education, Youth and Sports of the Czech Republic (LC06034 and ATGGTGTGG and GCAATGCAGCTTGAACAATGG), and ARR5 (ACACTTCT- MSM0021622415) (J.P., E.Z., S.S., and J.F.), and a European Research Council TCATTAGCATCACCG and CTCCTTCTTCAAGACATCTATCGA). (ERC) starting independent research grant (M.S. and J.D.).

1. Friml J, et al. (2003) Efflux-dependent auxin gradients establish the apical–basal axis of 23. Stepanova AN, Yun J, Likhacheva AV, Alonso JM (2007) Multilevel interactions be- Arabidopsis. Nature 426:147–153. tween ethylene and auxin in Arabidopsis roots. Plant Cell 19:2169–2185. 2. Blilou I, et al. (2005) The PIN auxin efflux facilitator network controls growth and 24. Swarup R, et al. (2007) Ethylene upregulates auxin biosynthesis in Arabidopsis seed- patterning in Arabidopsis roots. Nature 433:39–44. lings to enhance inhibition of root cell elongation. Plant Cell 19:2186–2196. 3. Sabatini S, et al. (1999) An auxin-dependent distal organizer of pattern and polarity in 25. Yang SF, Hoffman NE (1984) Ethylene biosynthesis and its regulation in higher plants. the Arabidopsis root. Cell 99:463–472. Annu Rev Plant Physiol 35:155–189. 4. Beemster GTS, Baskin TI (2000) STUNTED PLANT 1 mediates effects of cytokinin, but not 26. Roman G, Lubarsky B, Kieber JJ, Rothenberg M, Ecker JR (1995) Genetic analysis of of auxin, on cell division and expansion in the root of Arabidopsis. Plant Physiol ethylene signal transduction in Arabidopsis thaliana: Five novel mutant loci integrated 124:1718–1727. into a stress response pathway. Genetics 139:1393–1409. 5. Dello Ioio R, et al. (2007) Cytokinins determine Arabidopsis root-meristem size by 27. Doerner P, Jørgensen J-E, You R, Steppuhn J, Lamb C (1996) Control of root growth and controlling cell differentiation. Curr Biol 17:678–682. development by cyclin expression. Nature 380:520–523. 6. Stepanova AN, et al. (2008) TAA1-mediated auxin biosynthesis is essential for hormone 28. Ulmasov T, Murfett J, Hagen G, Guilfoyle TJ (1997) Aux/IAA proteins repress expression crosstalk and plant development. Cell 133:177–191. of reporter genes containing natural and highly active synthetic auxin response 7. Rahman A, et al. (2007) Auxin, actin and growth of the Arabidopsis thaliana primary elements. Plant Cell 9:1963–1971. root. Plant J 50:514–528. 29. Ru˚zˇicˇka K, et al. (2007) Ethylene regulates root growth through effect on auxin 8. BenkovaÉ, et al. (2003) Local, efflux-dependent auxin gradients as a common module biosynthesis and transport-dependent auxin distribution. Plant Cell 19:2197–2212. for plant organ formation. Cell 115:591–602. 30. Michniewicz M, et al. (2007) Antagonistic regulation of PIN phosphorylation by PP2A 9. Friml J, et al. (2002) AtPIN4 mediates sink driven auxin gradients and root patterning and PINOID directs auxin flux. Cell 130:1044–1056. in Arabidopsis. Cell 108:661–673. 31. Delbarre A, Muller P, Imhoff V, Guern J (1996) Comparison of mechanisms controlling 10. Zhao Y, et al. (2001) A role for flavin monooxygenase-like enzymes in auxin biosyn- uptake and accumulation of 2,4-dichlorophenoxy acetic acid, naphthalene-1-acetic thesis. Science 291:306–309. acid, and indole-3-acetic acid in suspension-cultured tobacco cells. Planta 198:532–541. 11. Tao Y, et al. (2008) Rapid synthesis of auxin via a new tryptophan-dependent pathway 32. Inoue T, et al. (2001) Identification of CRE1 as a cytokinin receptor from Arabidopsis. is required for shade avoidance in plants. Cell 133:164–176. Nature 409:1060–1063. 12. Bennett MJ, et al. (1996) Arabidopsis AUX1 gene: A permease-like regulator of root 33. Laplaze L, et al. (2007) Cytokinins act directly on lateral root founder cells to inhibit root gravitropism. Science 273:948–950. initiation. Plant Cell 19:3889–3900. 13. Ga¨lweiler L, et al. (1998) Regulation of polar auxin transport by AtPIN1 in Arabidopsis 34. Wickson M, Thimann KV (1958) The antagonism of auxin and kinetin in apical domi- vascular tissue. Science 282:2226–2230. nance. Physiol Plant 11:62–74. 14. Petra´sˇek J, et al. (2006) PIN proteins perform a rate-limiting function in cellular auxin 35. Fukaki H, Tasaka M (2009) Hormone interactions during lateral root formation. Plant efflux. Science 312:914–918. Mol Biol, 10.1007/pmb.s11103–008-9417–2. 15. Terasaka K, et al. (2005) PGP4, an ATP binding cassette P-glycoprotein, catalyzes auxin 36. Shimizu-Sato S, Tanaka M, Mori H (2009) Auxin–cytokinin interactions in the control of transport in Arabidopsis thaliana roots. Plant Cell 17:2922–2939. 16. Mravec J, et al. (2008) Interaction of PIN and PGP transport mechanisms in auxin shoot branching. Plant Mol Biol, 10.1007/pmb.s11103–008-9416–3. distribution-dependent development. Development 135:3345–3354. 37. Pernisova´M, et al. (2009) Cytokinins modulate auxin-induced organogenesis in plants 17. KuderovaÁ, et al. (2008) Effects of conditional IPT-dependent cytokinin overproduc- via regulation of the auxin efflux. Proc Natl Acad Sci USA, in press. tion on root architecture of Arabidopsis seedlings. Plant Cell Physiol 49:570–582. 38. Craft J, et al. (2005) New pOp/LhG4 vectors for stringent glucocorticoid-dependent 18. Medford JI, Horgan R, El-Sawi Z, Klee HJ (1989) Alterations of endogenous cytokinins transgene expression in Arabidopsis. Plant J 41:899–918. in transgenic plants using a chimeric isopentenyl transferase gene. Plant Cell 1:403– 39. Ferreira PCG, et al. (1994) Developmental expression of the Arabidopsis cyclin gene 413. cyc1At. Plant Cell 6:1763–1774. 19. Werner T, et al. (2003) Cytokinin-deficient transgenic Arabidopsis plants show multiple 40. Xu J, Scheres B (2005) Dissection of Arabidopsis ADP-RIBOSYLATION FACTOR 1 function developmental alterations indicating opposite functions of cytokinins in the regula- in epidermal cell polarity. Plant Cell 17:525–536. tion of shoot and root meristem activity. Plant Cell 15:2532–2550. 41. Higuchi M, et al. (2004) In planta functions of the Arabidopsis cytokinin receptor 20. Mu¨ller B, Sheen J (2008) Cytokinin and auxin interaction in root stem-cell specification family. Proc Natl Acad Sci USA 101:8821–8826. during early embryogenesis. Nature 453:1094–1097. 42. An G (1985) High efficiency transformation of cultured tobacco cells. Plant Physiol 21. Skoog F, Miller CO (1957) Chemical regulation of growth and organ formation in plant 79:568–570. tissues cultures in vitro. Symp Soc Exp Biol 11:118–131. 43. Friml J, Benkova´ E, Mayer U, Palme K, Muster G (2003) Automated whole mount 22. Chae HS, Faure F, Kieber JJ (2003) The eto1, eto2, and eto3 mutations and cytokinin localisation techniques for plant seedlings. Plant J 34:115–124. treatment increase ethylene biosynthesis in Arabidopsis by increasing the stability of 44. D’Agostino IB, Derue`re J, Kieber JJ (2000) Characterization of the response of the ACS protein Plant Cell 15:545–559. Arabidopsis response regulator gene family to cytokinin. Plant Physiol 124:1706–1717. BIOLOGY DEVELOPMENTAL

Ru˚zˇicˇkaetal. PNAS ͉ March 17, 2009 ͉ vol. 106 ͉ no. 11 ͉ 4289 Downloaded by guest on September 30, 2021