Hypertonicity Regulation of Cytochrome P450 CYP3A
By
I-Chyang, Andrew Chuang
A thesis submitted in conformity with the requirements
for the degree of Doctor of Philosophy
Graduate Department of Pharmacology and Toxicology
University of Toronto
©Copyright by I-Chyang, Andrew Chuang (2012)
Hypertonicity Regulation of Cytochrome P450 CYP3A
I-Chyang Andrew Chuang
A thesis submitted in conformity with the requirements For the degree of Doctor of Philosophy in Science Graduate Department of Pharmacology and Toxicology University of Toronto (C) Copyright by I-Chyang Andrew Chuang (2012)
Abstract
Cytochrome P450 3A isozymes (CYP3A) metabolize approximately 50% of therapeutic drugs. It
has recently been discovered that human CYP3A mRNA levels can be induced by hypertonicity;
a physiological state not previously linked to its regulation. The osmosensitive transcription
factor, Nuclear Factor of Activated T-Cells 5 (NFAT5), regulates multiple genes that restore
osmolyte homeostasis and promote cell protection during osmotic stress.
In silico examinations and in vitro experiments using reporters, knockdown and binding assays
in the human intestinal cell line C2bbe1 have revealed an active tonicity-responsive enhancer
(TonE) within CYP3A7 intron (+5417/+5427 from CYP3A7 transcriptional start site) that is
responsible for NFAT5 binding and NFAT5-dependent regulation of CYP3A isoforms. In addition, hypertonicity-mediated CYP3A induction is also observed in both hepatic and intestinal cell lines.
Effects of tonicity changes on in vivo CYP3A expression and function were examined in a humanized CYP3A transgenic mouse with similar tissue expression in humans. More
specifically, intervention with prolonged dehydration involving alternating between 24-hour
cycles of water-deprivation and water ad lib for 1 week (cyclic water-deprivation; four 24-hour
water-deprivation and three 24-hour water ad lib periods), increased expression of NFAT5 target
ii
genes Slc6a12 in the liver and kidney (2.5 ± 0.6-fold over water ad lib, n = 14, p = 0.04; and 3.1
± 0.6-fold, n = 10, p = 0.02, respectively), Akr1b3 in the liver, and Slc5a3 in the kidney.
Immunofluorescent microscopy revealed an increase of nuclear-distributed mouse NFAT5 in cyclic water-deprived animals, consistent with NFAT5 activation. Most importantly, CYP3A4 mRNA levels were noted to be elevated in the liver and kidney (11.8 ± 4.8-fold over water ad lib, n = 14, p = 0.04 and 2.2 ± 0.4-fold, n = 9, p = 0.02, respectively), with concurrent CYP3A protein and activity increase. Localized hypertonic environment in the gut was simulated by providing animals with a week-long high-salt diet. The effects of high-salt diet in the gut were similar to those of cyclic water-deprivation in the liver and kidney; where NFAT5 showed nuclear distribution and NFAT5 target gene expression (Slc6a12; 20.5 ± 6.7-fold over a week- long low-salt diet, n = 8, p = 0.02 and Slc6a6; 3.2 ± 0.7-fold, n = 10, p < 0.01, in the duodenum).
Furthermore, an increase of CYP3A4 mRNA was observed (2.6 ± 0.5-fold over a week-long low- salt diet, n = 14, p = 0.03), with a corresponding rise in protein expression and activity levels.
In summary, increased expression of in vitro and in vivo human CYP3A was achieved using a hypertonic stimulus; concurrent NFAT5 activation and NFAT5 target gene expression were observed. These results suggested a possible binding of activated NFAT5 to CYP3A TonE situated within the intronic region of CYP3A7. It could be further concluded that NFAT5 may be responsible for the hypertonic induction of human CYP3A.
iii
Acknowledgments
I would like to thank my supervisor Dr. Shinya Ito for the tremendous amount of time
and energy contributed to the work that we accomplished in the past years. Your kind words and actions are on-going examples to a disciplined lifestyle that is needed in the research world. I would also like to thank Dr. Harper for being both a supervisory committee member and co- supervisor. Your insights to the experiments done in the Ito lab have given us different ways to challenge and defend our work. Thanks also to Dr. Okey for your dedication in being part of my supervisory committee, and for taking the time out of your busy schedule. I thank you for all your help and suggestions.
At this time, I would like to say thank you to all the members of the Ito lab, present and past. I want to thank Kazu for setting the foundation work for NFAT5 research and a well- organized research folder. I also wish to thank Hendrick for keeping me on my toes by challenging me during lab meetings. I’d like to give the greatest appreciation to Mingdong, who provided both physical and emotional support that are much needed at the lab; I will always be grateful for the little chats that we had. I would like to thank Alex for being a friend to talk to and many others who have been a part of the Ito lab: Bernice, Haibo, Satoko, Shin, Howard, Derrick,
Cherry, Liana and Pooja. I thank you all as part of my research associates.
Finally, I would like to thank my family and friends who have offered endless support.
To my parents, church friends and others: I cannot express how much love and encouragement you have shown me. At this time, I like to thank the awesome God that places me wherever I am;
You are a constant reminder that we work for Your Glory.
iv
Table of Contents
Abstract ...... ii
Acknowledgement ...... iv
List of Figures ...... xi
List of Tables ...... xvi
List of Appendices ...... xvi
List of Abbreviations ...... xiii
Section 1 Introduction ...... 1
Statement of the problem ...... 1
Purpose of the study and objective ...... 1
Statement of research hypotheses ...... 1
Rationale for Hypotheses ...... 2
1.1 Review of Literature ……………………………………………………………………..3
1.1.1 Drug metabolizing enzymes and xenobiotic detoxification ……………………………..3
1.1.2 Cytochrome P450 CYP3A ……………………………………………………………..6
1.1.2.1 General history ……………………………………………………..6
1.1.2.2 CYP3A expression and single nucleotide polymorphisms (SNPs) …..…7
1.1.2.3 CYP3A protein structure ……………………………………………..9
1.1.2.4 CYP3A drug substrates and oxidation reaction ……………………11
v
1.1.2.5 Gene regulation: CYP3A gene cassette and regulatory sites ……………14
1.1.2.5.1 CYP3A nuclear receptors ……………………………………17
1.1.2.5.2 Pregnane X receptor (PXR) ……………………………………19
1.1.2.5.3 Constitutive active/androstane receptor (CAR) ……………20
1.1.2.5.4 Farnesoid X receptor (FXR) ……………………………………21
1.1.2.5.5 Vitamin D receptor (VDR) ……………………………………22
1.1.2.6 CYP3A inhibitors (grapefruit juice, ketoconazole and azamulin) ……23
1.1.2.7 Mouse CYP3A ……………………………………………………25
1.1.2.8 Humanized CYP3A transgenic mouse models ……………………27
1.1.3 Cellular Responses to Ambient Osmotic Environment ...... 30
1.1.3.1 Osmolality and tonicity ...... 30
1.1.3.2 Cellular responses to ambient hypertonicity ...... 30
1.1.3.3 Tonicity sensitive transcription factor, NFAT5/TonEBP ...... 33
1.1.3.4 NFAT5 transactivation domain (TAD) ...... 36
1.1.3.5 NFAT5-mutant mouse ………………………………………...... 36
1.1.4 The osmotic environment in the gastrointestinal tract ...... 38
1.1.4.1 Human intestinal lumen ...... 38
1.1.4.2 Mice and rats intestinal lumen ...... 39
1.1.5 Effects of high-salt diet on intestinal cytochrome P450 in vivo ...... 41
1.1.5.1 In vivo human studies ...... 41
1.1.5.2 In vivo animal studies ...... 42
vi
1.1.6 Hypertonicity and human P450 enzymes ...... 44
1.1.6.1 CYP2E1 ...... 44
1.1.6.2 CYP1A1 ...... 45
Section 2 Materials and methods ...... 46
In vitro experiments ...... 46
Cells and cell lines ...... 46
Primary colonocytes and hepatocytes demographics ...... 46
Cell culture treatments ...... 47
CYP3A5 genotyping ...... 48
Real time PCR ...... 48
Microsomal preparation ...... 50
Immunoblot ...... 50
CYP3A activity assay ...... 51
Expression plasmids, siRNA and reporter constructs ...... 51
Transient transfection and luciferase-based reporter assay ...... 53
Electrophoretic mobility shift assay (EMSA) ...... 54
Chromatin immunoprecipitation (ChIP) ...... 55
Immunohistochemistry ...... 56
In vivo mouse experiments ...... 57
The CYP3A4/CYP3A7-humanized transgenic mouse ...... 57
Acute plasma hypertonicity ...... 58
vii
Cyclic water-deprivation ...... 58
Acute intestinal hypertonicity ...... 59
High-salt diets ...... 59
Phenobarbital-induced transgene expression ...... 59
Osmolality measurement ...... 59
Data analyses and statistical treatment ...... 59
Section 3 Results ...... 61
3.1 In vitro human CYP3A induction by hypertonicity ...... 61
3.1.1 Expression of human CYP3A in the human intestinal carcinoma cell line C2bbe1
...... 61
3.1.2 Expression of human CYP3A in the human hepatocellular carcinoma cell line
HepG2 ...... 66
3.1.3 Expression of CYP3A in human primary colonocytes and primary hepatocytes
...... 69
3.2 NFAT5 regulates CYP3A induction in vitro under hypertonicity ...... 72
3.2.1 NFAT5 activation in human cell cultures under hypertonicity ...... 72
3.2.2 NFAT5 mediates CYP3A induction by hypertonicity ...... 74
3.2.3 Tonicity enhancer (TonE) is responsible for NFAT5 mediated CYP3A induction
...... 80
viii
3.2.4 NFAT5 binds to the CYP3A7 intronic enhancer at position +5417/+5427 ...... 92
3.3 Dehydration induces NFAT5 target genes and human CYP3A in vivo ...... 97
3.3.1 Hepatic mouse NFAT5 transactivates human CYP3A TonE motif ...... 97
3.3.2 Cyclic water-deprivation induces NFAT5 accumulation and target gene response
...... 101
3.3.3 Cyclic water-deprivation dehydration promotes human CYP3A expression ...... 107
3.4 High-salt diet induces NFAT5 target genes and CYP3A in the intestine ...... 113
3.4.1 Intestinal mouse NFAT5 transactivates human CYP3A TonE motif ...... 113
3.4.2 High-salt diet induces NFAT5 accumulation and target gene response ...... 117
3.4.3 High-salt diet increases expression of human CYP3A4 ...... 121
Section 4 Discussion, Conclusions, Recommendations ...... 126
4.1 Human CYP3A in vitro characterization ...... 126
4.2 NFAT5 and human CYP3A ...... 130
4.3 Mouse NFAT5 and target gene response ...... 135
4.3.1 Systemic hypertonicity in mouse ...... 136
4.3.2 Localized intestinal hypertonicity in mouse ...... 137
ix
4.4 Mouse and human CYP3A in the CYP3A4/CYP3A7-humanized mouse ...... 140
4.4.1 Hypertonic response of mouse Cyp3a genes ...... 140
4.4.2 Hypertonic response of human CYP3A in the CYP3A4/CYP3A7-humanized
transgenic mouse ...... 142
4.5 Hyperosmolar disease states ...... 147
4.6 Conclusions ...... 148
References ...... 150
Acknowledgement of works completed ...... 169
List of publications and poster presentations ...... 170
Appendices ...... 170
x
List of Figures
Section 1 Review of literature
Figure 1 General scheme of P450 CYP3A isoform oxidation reaction ...... 13
Figure 2 Human CYP3A gene cassette ...... 14
Figure 3 Known regulatory sites of major CYP3A isoforms ...... 16
Figure 4 Regulatory volume response ...... 32
Figure 5 Cellular adaptive response ...... 34
Section 3 Results
3.1 In vitro human CYP3A induction by hypertonicity
Figure 3.1.1.1 Hypertonicity induces CYP3A mRNA expression in intestinal cells ...... 63
Figure 3.1.1.2 Osmolality-dependent induction of CYP3A mRNA expression in intestinal cells ...... 64
Figure 3.1.1.3 Time-dependent expression of CYP3A proteins with hypertonicity ...... 65
Figure 3.1.2.1 Hypertonicity induces CYP3A mRNA expression in hepatic cell line ...... 66
Figure 3.1.2.2 Induction of hepatic CYP3A proteins with hypertonicity ...... 67
Figure 3.1.2.3 Hypertonicity induces CYP3A protein activity in HepG2 cells ...... 68
xi
Figure 3.1.3.1 Hypertonicity induced CYP3A mRNA in human primary intestinal cells ...... 70
Figure 3.1.3.2 Human CYP3A5 and CYP3A7 mRNA are induced by hypertonicity in human primary hepatocytes ...... 71
3.2 NFAT5 regulates CYP3A induction in vitro under hypertonicity
Figure 3.2.1.1 Hypertonicity causes NFAT5 nuclear translocation in HepG2 cells ...... 73
Figure 3.2.2.1 mRNA expression of CYP3A intestinal xenobiotics transporters upon hypertonicity challenges ...... 75
Figure 3.2.2.2 NFAT5 and tonicity-responsiveness of CYP3A, SMIT, NFAT5, PXR and CAR mRNA ...... 77
Figure 3.2.2.3 Effects of NFAT5 knockdown with siRNA on CYP3A and SMIT mRNA in HepG2 cells ...... 79
Figure 3.2.3.1 Reporter construct containing XREM and proximal promoter elements of human CYP3A4 does not mediate tonicity-dependent response ...... 81
Figure 3.2.3.2 Scheme of the CYP3A gene cluster and corresponding reporter constructs and corresponding TonE sites within ±10 kb of major CYP3A transcriptional start sites ...... 82
xii
Figure 3.2.3.3 Reporter constructs from a CYP3A7 intron contains a TonE motif that conveys tonicity- responsiveness ...... 84
Figure 3.2.3.4 CYP3A7 intron region (+4910/+5590) transactivate CYP3A minimal promoters with hypertonicity mediated by NFAT5 ...... 86
Figure 3.2.3.5
NFAT5 mediates CYP3A7 [+4910/+5590] reporter activity with hypertonicity ...... 87
Figure 3.2.3.6 The CYP3A7 intron 2 TonE (+5417) is indispensable for the enhancer activity ...... 89
Figure 3.2.3.7 The CYP3A7 intron 2 TonE (+5417) conveys enhancer activity ...... 91
Figure 3.2.4.1 NFAT5 binds to the CYP3A7 intron 2 TonE motif (+5417/+5427) in an in vitro binding assay..93
Figure 3.2.4.2 ChIP assay for NFAT5 binding to the CYP3A7 intron 2 TonE motif (+5417) in native cell context ...... 94
3.3 Dehydration induces NFAT5 target genes and human CYP3A in vivo
Figure 3.3.1.1 Hypertonicity induced mouse NFAT5 nuclear translocation in the mouse hepatoma cell line hepa1c1c7 ...... 98
Figure 3.3.1.2.
Hypertonicity induced hepatic NFAT5 target genes ...... 99
xiii
Figure 3.3.1.3
Hypertonicity-activated human CYP3A TonE reporter in mouse hepatoma cell line hepa1c1c7
...... 100
Figure 3.3.2.1
Cyclic water-deprivation promotes NFAT5 nuclear accumulation in the liver and kidney of
CYP3A4/CYP3A7-humanized transgenic mice ...... 104
Figure 3.3.2.2
NFAT5 target gene expression in male CYP3A4/CYP3A7-humanized transgenic mice under cyclic water-deprivation ...... 106
Figure 3.3.3.1
Human CYP3A transgene and mouse endogenous Cyp3a gene expression in male transgenic mice after cyclic water-deprivation ...... 108
Figure 3.3.3.2
Human CYP3A protein expression in the liver after cyclic water-deprivation ...... 110
Figure 3.3.3.3
Human CYP3A protein activity in the liver after cyclic water-deprivation ...... 111
xiv
3.4 High-salt diet induces NFAT5 target genes and human CYP3A in intestine
Figure 3.4.1.1
NFAT5 nuclear distribution with hypertonicity in the mouse intestinal cell line CMT93 ...... 114
Figure 3.4.1.2
Hypertonicity induced intestinal hepatic NFAT5 target genes ...... 115
Figure 3.4.1.3
Hypertonicity-activated human CYP3A TonE reporter in mouse intestinal cell line CMT93.....116
Figure 3.4.2.1
Mouse NFAT5 accumulates in the duodenum of the CYP3A4/CYP3A7-humanized transgenic mouse after one week of a high-salt diet ...... 118
Figure 3.4.2.2
NFAT5 target gene expression in female CYP3A4/CYP3A7-humanized transgenic mice under a high-salt diet ...... 120
Figure 3.4.3.1
Human CYP3A transgenes and mouse endogenous Cyp3a gene expression in female
CYP3A4/CYP3A7-humanized transgenic mouse after a high-salt diet ...... 122
Figure 3.4.3.2
Human CYP3A protein expression in the intestine after one week of a high-salt diet ...... 123
xv
Figure 3.4.3.3
Human CYP3A protein activity in the intestine after one week of a high-salt diet ...... 124
List of Tables
Section 1 Review of literature
Table 1 CYP3A4 substrates and indications ...... 12
Table 2 CYP3A inducers and their target nuclear receptors ...... 18
List of Appendices
Appendix 3.1.1.A Actinomycin D experiments ...... 170
Appendix 3.1.3.A Demographics of primary hepatocyte donors ...... 171
Appendix 3.1.3.B Rifampicin induced human CYP3A mRNA in primary human hepatocytes ...... 172
Appendix 3.1.4.A Hypertonicity induced CYP3A5 mRNA in HepaRG cells ...... 174
Appendix 3.1.4.B Rifampicin induction of CYP3A4 mRNA in HepaRG cells ...... 175
Appendix 3.2.1.A NFAT5 distribution in C2bbe1 cells treated with hypertonicity ...... 176
Appendix 3.2.2.A siNFAT5 knockdown of NFAT5 mRNA ...... 177
Appendix 3.2.3.A Examples of unresponsive CYP3A TonE motifs ...... 178
Appendix 3.3.2.A Osmolality measurements in animal-use protocols ...... 179
Appendix 3.3.2.B mRNA response to acute plasma hypertonicity in humanized CYP3A4/CYP3A7 transgenic mouse ...... 180 xvi
Appendix 3.3.2.C NFAT5 target genes are unresponsive after 24 water deprivation in CYP3A4/CYP3A7-humanized transgenic mouse ...... 181
Appendix 3.3.2.D Weight changes during the course of cyclic water-deprivation ...... 182
Appendix 3.3.2.E Weight changes after cyclic water-deprivation ...... 183
Appendix 3.3.2.F NFAT5 target genes are unresponsive after one week of cyclic water- deprivation in female CYP3A4/CYP3A7-humanized transgenic mouse ...... 184
Appendix 3.3.3.A Selected glucocorticoid target genes are not increased in cyclic water- deprived animals ...... 185
Appendix 3.4.2.A mRNA response to acute intestinal hypertonicity in C57/BL6 mice ...... 186
Appendix 4.1.A Relative CYP3A and PXR mRNA levels of C2bbe1 cells compared to HepG2 ...... 187
Appendix 4.2.A Human CYP3A TonE is active in a long promoter construct ...... 188
Appendix 4.2.B Genotype and average fold-induction of CYP3A5 mRNA transcripts in primary hepatocytes ...... 189
Appendix 4.4.1.A Putative TonE motifs of mouse Cyp3a11 and Cyp3a13 ...... 190
Appendix 4.4.2.A Phenobarbital induction of human CYP3A4 mRNA in the CYP3A4/CY3A7-humanized transgenic mouse ...... 191
Appendix 4.4.2.B Food and animal weight measurements in salt diet experiments ...... 192
xvii
List of Abbreviations
ABC ATP-binding cassette
AhR Aryl hydrocarbon receptor
AP3 Activator protein 3
ATM Ataxia telangiectasia-mutated kinase
ATP Adenosine triphosphate
BAC Bacterial artificial chromosome
BCRP Breast cancer resistance protein
BGT1 Betaine/GABA transporter 1 bp Basepair
BTE Basic transcription element
C2bbe1 Caco 2 brush border epithelial subclone 1
CAR Constitutive androstane receptor
CDCA Chenodeoxycholic acid cDNA Complementary DNA
ChIP Chromatin immunoprecipitation
COD Cause of death
CRM1 Nuclear export receptor exportin-1
COUP-TF Chicken ovalbumin upstream promoter-transcription factor
CVA Cardiovascular attack
CYP Cytochrome P450
DAPI 4',6-diamidino-2-phenylindole
DBD DNA binding domain xviii
DMSO Dimethyl sulfoxide
DN- Dominant negative-
DNA Deoxyribonucleic acid
DR3 Direct repeat with 3-nucleotide spacer
DR4 Direct repeat with 4-nucleotide spacer
EMSA Electrophoretic mobility shift assay
EPH Epoxide hydrolase
ER6 Everted repeat separated by 6-nucleotide spacer
ER8 Everted repeat separated by 8-nucleotide spacer
ERK Extracellular signal-regulated kinase
ERE Estrogen receptor responsive element
FBS Fetal Bovine Serum
FXR Farnesoid X receptor
GAPDH Glyceraldehyde-3-phosphate dehydrogenase
GI Gastrointestinal
GRE Glucocorticoid response element
GST Glutathione S-transferase
HLp Human liver P450
HFLa Human fetal liver P450 a
HFLaSE P450HFLa-specific element
HNF4α Hepatocyte nuclear factor 4 alpha
HNF3γ Hepatocyte nuclear factor-3-gamma
xix
HRP Horseradish peroxidase
HSP70 Heat shock protein 70
IC50 Inhibitor concentration at 50% enzyme velocity
ICH Intracerebral hemorrhage
JNK Jun N-terminal kinase kb Kilobase
Ki Inhibitory constant
KO Knockout
Km Concentration of substrate that produces half-maximal velocity
LCA Lithocholic acid
Luc Firefly luciferase
MAPK mitogen-activated protein kinase
MAPKK mitogen-activated protein kinase kinase
MCP1 Monocyte chemoattractant protein-1
MDR Multidrug resistance protein
MEF Mouse embryonic fibroblast
mEQ milliequivalence
MR Mineralocorticoid receptor
mRNA Messenger ribonucleic acid
MRP Multidrug resistance associated proteins
NADPH Nicotinamide adenine dinucleotide phosphate (reduced form)
NAT N-acetyltransferase
NBD Nucleotide-binding domain
xx
NES Nuclear export signal
N.D. Not detected
NFκB Nuclear factor kappa-light-chain-enhancer of activated B cells
NFAT5 Nuclear factor of activated T-cells 5
NFSE Nifedipine-specific element
NLS Nuclear localization signal
NQO NAD(P)H quinone oxidoreductases
OATP Organic anion transporter/transporting polypeptides
Oct Octamer-binding protein response element
OCT Organic cation transporters
OREBP Osmotic response element-binding protein
Osm/kg Osmole per kilogram
PAGE Polyacrylamide gel electrophoresis
PB Phenobarbital
PBS Phosphate buffered saline solution
PCN Pregnenolone-16alpha-carbonitrile
PCR Polymerase chain reaction
PRE Progesterone response element
PXRE PXR-responsive element
RIF Rifampicin/rifampin
ROS Reactive oxygen species
RT-PCR Reverse transcription-polymerase chain reaction
xxi
siRNA Small interfering RNA
SLC Solute carrier transporter
SMIT Sodium/myoinositol cotransporter
SNP Single nucleotide polymorphism
SULT Sulfotransferase
SV Simian virus
TAT Tyrosine aminotransferase
TAD Transactivation domain
TauT Taurine transporter
TNF4α Tumor necrosis factor 4 alpha
TonE Tonicity-responsive enhancer
TonEBP TonE binding protein
UDP Uridine diphosphate
UGT UDP-glucuronosyltransferase
VDR Vitamin D receptor
Vmax Maximum enzyme velocity
XREM Xenobiotic-responsive enhancer module
xxii
Section 1: Introduction
Statement of Problem:
Approximately 50% of pharmaceutical medications marketed today are metabolized by
cytochrome P450 (CYP) 3A enzymes; these same enzymes are also targets of drug interactions.
CYP3A-mediated drug metabolism is largely influenced by inter- and intra-individual variations;
however, the underlying mechanisms are not entirely clear. Regulation of CYP3A enzymes is
complex, involving multiple nuclear receptors. CYP3A enzymes are highly expressed in the liver
and proximal portions of the small intestine, with the latter readily subjected to changes in osmolality. Several studies suggested high-salt diets may influence the presystemic clearance of
CYP3A substrates [Darbar et al., 1997, 1998], implying an effect of intestinal osmolality on
CYP3A expression and function.
Purpose of the study and objective:
To examine the osmoregulation of the human cytochrome P450 3A genes
Statement of research hypotheses Specific hypotheses
Hypothesis 1: An osmosensitive transcription factor regulates CYP3A in vitro under NaCl- induced hypertonicity.
Hypothesis 2: Systemic hypertonicity induces CYP3A expression in vivo.
Hypothesis 3: High-salt diet induces intestinal CYP3A expression in vivo.
1
Rationale for Hypotheses
Hypothesis 1: It was observed that cells cultured in hypertonic medium showed higher CYP3A
mRNA expression. Given this finding, we postulate that the transcriptional upregulation of
CYP3A genes occurs in ambient hypertonic conditions, and that this process may involve the
osmosensitive transcription factor NFAT5.
Hypothesis 2: The effects of systemic hypertonicity have been documented in vivo in renal
tissues [Cha et al., 2001, Bartolo et al., 2008]. However, little is known about NFAT5 target
genes responses to systemic hypertonicity in non-renal cells, which do not routinely experience
substantial fluctuations in osmolality. Furthermore, it remains to be proven whether in vitro
hypertonicity-induced human CYP3A upregulation (Hypothesis 1) is also reflected in an in vivo
context.
Hypothesis 3: Previous studies have shown that a high-salt diet can increase the metabolism of
orally administered CYP3A substrates in humans [Darbar et al., 1997, 1998]. We postulate that
this phenomenon is a result of NFAT5 activation in the intestine, which in turn causes
upregulation of CYP3A.
2
1.1 Review of Literature
1.1.1 Drug metabolizing enzymes and xenobiotic detoxification:
Foreign chemicals and toxins may enter the body through inhalation, ingestion or absorption
through the skin. When left in the body, these xenobiotics may cause harm and become
detrimental to cellular processes. Three major xenobiotic detoxification systems known as the
Phase I, Phase II and Phase III systems are found primarily in the liver, gastrointestinal tract and
kidney. These systems act as protection mechanisms for eliminating xenobiotics.
The Phase I system includes cytochrome P450 enzymes and the NAPDH-P450 reductase.
Cytochrome P450 (CYP) enzymes are heme-containing, microsomal mono-oxygenases that
oxidize a wide array of xenobiotics [Isin et al., 2008, Lamb et al., 2007]. Because of their crucial
role in drug metabolism, CYP enzymes have been the foci of intense research in drug discovery
and development. Although there are 57 putatively functional human CYP isoforms and 58
pseudogenes [Pelkonen et al., 2008], members of the CYP 1-3 families are responsible for more
than 70–80% of xenobiotics biotransformation [Guengerich 2008]. Coupled with NADPH-P450
reductase serving as electron donor, CYP enzymes catalyze oxidation reactions, such as:
hydroxylation, heteroatom oxygenation, dealkylation and epoxidation [Guengerich 2007]. These
reactions introduce polar groups onto the substrates, which further promote their metabolism and
elimination. Other Phase I proteins not represented by P450 enzymes include the NAD(P)H
quinone oxidoreductases (NQO) and epoxide hydrolases (EPH). NQO enzymes reduce quinones
to hydroquinones in a two-electron reaction, thereby preventing the formation of reactive oxygen
species (ROS) from the single-electron reduction of quinones [Baird et al., 2011]. Epoxides
3
formed from Phase I reactions are highly reactive and genotoxic. EPH hydrolyze the epoxide
ring to vicinal diols, thereby forming a less reactive intermediate species [Decker et al., 2009].
The Phase II system consists of conjugation enzymes in the xenobiotic detoxification process.
Conjugation with Phase II enzymes generally increases hydrophilicity for further elimination via
bile or urine [Xu et al., 2005]. Phase II enzyme reactions include methylation via
methyltransferases, sulfation by sulfotransferases (SULT), acetylation by N-acetyltransferases
(NAT), glucuronidation by UDP-glucuronosyltransferases (UGT), and glutathione conjugation
by glutathione S-transferases (GST) [Jancova et al., 2010].
The Phase III system includes membrane-bound transporters that facilitate the removal of
xenobiotics. Drug transporters have a significant impact on drug absorption, distribution and elimination, where variation in expression can sometimes lead to adverse drug reactions [Mizuno
et al., 2003]. Like other transporters in cellular processes, Phase III transporters are categorized
as active or facilitated drug transporters. Active Phase III drug transporters hydrolyze ATP at its
nucleotide-binding domain, known as the ATP-binding cassette (ABC). Some of these active
transporters include: multidrug resistance proteins (MDR1-3), multidrug resistance associated
proteins (MRP1-9), breast cancer resistance protein (BCRP; ABCG2), and many others [Xu et
al., 2005]. In comparison, facilitated drug transporters are generally considered as solute carrier
transporters (SLC). Two important classes of these facilitated transporters include the organic
cation transporters (OCT) and organic anion transporter/transporting polypeptides (OATP)
[Mizuno et al., 2003], which couple the movement of ions down a concentration gradient for
transport.
4
The three phases of xenobiotic detoxification systems act in concert to eliminate foreign
chemicals. Working together, they serve as protection mechanisms against the deleterious effects of environmental pollutants and toxins.
5
1.1.1 Cytochrome P450 CYP3A:
1.1.2.1 General history:
Human CYP3A4 was first isolated as an inducible liver cytochrome P450 that shared a similar
N-terminal protein homology to a glucocorticoid-inducible rat cytochrome P450 (rat P-450p;
Watkins et al., 1985). In the study by Watkins et al. (1985), CYP3A4 (initially named HLp and
P-450NF) was induced by dexamethasone in adult human subjects, where its reconstituted form
was capable of demethylating erythromycin. Subsequent studies with HLp showed it was
capable of oxidizing a wide array of compounds including: 1,4-dihydropyridines (such as
nifedipine), quinidine, testosterone, progesterone, cortisol, cyclosporine, and estradiol
[Guengerich 1989].
Two cDNA clones with similar levels of sequence identity for CYP3A4 were isolated by
screening a liver cDNA library [Beaune et al., 1986]. The existence of multiple cDNA clones suggested a potential for multiple protein isoforms. The notion was initially supported when these cDNA clones were used as Southern blot probes, and hybridized to two distinctive complexes with human liver genomic DNA [Molowa et al., 1986]. However, later reports showed that the observed similarity between the cDNA clones (CYP3A3) was due to an allele variant of CYP3A4 [Nelson et al., 1996].
The second CYP3A to be fully isolated was CYP3A7, which shares a close homology to
CYP3A4 and was initially termed P450 HFLa or HLp2 [Kitada et al., 1987]. CYP3A7 showed key differences including fetal expression and a distinct N-terminal sequence compared with
CYP3A4. The third and final major CYP3A isoform CYP3A5 was isolated by Wrighton et al.
6
(1989), and termed HLp3 by their laboratory. CYP3A5 was determined to be a distinct protein
because it possessed a different antibody recognition, N-terminal amino acid sequence and
peptide mapping against CYP3A4 and CYP3A7.
1.1.2.2 CYP3A expression and single nucleotide polymorphisms (SNPs):
There are three major isoforms in the CYP3A subfamily in humans: CYP3A4, CYP3A5 and
CYP3A7. These CYP3A isoforms are abundantly expressed in the liver and small intestine, with
lower levels in kidneys and prostates [Nishimura et al., 2003]. A fourth isoform CYP3A43 is expressed at relatively low amounts and its expression is limited mainly to the prostate and testis
[Westlind et al., 2001].
One of the major extra-hepatic expression sites of CYP3A isoforms is the gastrointestinal (GI) tract, where it contributes to the pre-systemic clearance of drugs, or first-pass metabolism [Kato
2008, Komura et al., 2008, Thelen et al., 2009]. CYP3A isoforms are found at the villi tip of mature enterocytes [Kolar et al., 1992], and their expression is highest in the proximal segments
of the small intestine [McKinnon et al., 1995]. A study conducted by Kolar et al. (1991) used
cyclosporine, a CYP3A-specific substrate, to demonstrate its significant metabolism by CYP3A
enzymes across the intestinal wall (i.e., between the lumen and the portal vein) during the
anhepatic phase of a liver transplant. Other examples of drugs undergoing substantial first-pass
metabolism include: midazolam [Tsunoda et al., 1999], nifedipine [Holtbecker et al., 1996],
felodipine [Lown et al., 1997], and verapamil [Fromm et al., 1996], indicating the clinical
significance of intestinal CYP3A.
7
The expression of CYP3A isoforms is characterized by its wide inter-individual variations.
CYP3A4 is considered to be the main CYP3A enzyme expressed in humans, but other CYP3A isoforms can also be expressed at high levels in certain individuals [Jounaïdi et al., 1996]. The most common SNP for CYP3A4 is CYP3A4*1B, in which an A to G transition occurs at position -392 of the 5’-flanking region of the gene. Whilst this particular SNP does not alter substrate metabolism nor expression levels, it has been linked to some diseases, such as secondary leukemia and prostate cancer [Lamba et al., 2002]. Kuehl et al. (2001) suggested that
a secondary genetic mutation might be the true cause of these clinical phenotypes, where the
CYP3A4*1B individuals are often associated with the CYP3A5*3 genotype.
CYP3A7 is the main fetal CYP3A enzyme and its expression is down-regulated after birth.
Although the specific mechanisms for adult silencing are not well understood, recent evidence
suggests that the glucocorticoid receptor mediates its fetal expression [Pang et al. 2012].
However, CYP3A7 expression is still detectable in adults with the CYP3A7*1B and
CYP3A7*1C alleles. The CYP3A7*1C allele contains several nucleotide substitutions upstream
of the transcriptional start site that allow the binding of several transcription factors (HNF3α,
CAR and PXR/RXRα) [Burk et al., 2002, Bombail et al., 2004]. The increase in transcriptional
activity caused by CYP3A7*1C leads to an overall increase in mRNA and protein expression
found in adult expressors.
CYP3A5 polymorphic expression has been well characterized in recent years. The CYP3A5*1 allele variant encodes a functional protein. However, functional CYP3A5 is expressed only in
10–20% of Caucasians, 33% of Japanese, and 55% of African Americans [Lamba et al., 2002].
The lack of CYP3A5 protein expression in a population is attributed mainly to the CYP3A5*3
8
variant, where its frequency is as high as 90% in Caucasians. The CYP3A5*3 6986A>G substitution leads to a premature stop-codon that results in a truncated and non-functional protein
[Busi et al., 2005]. Other allele variants (CYP3A5*5, CYP3A5*6 and CYP3A5*7) are expressed
at lower frequencies compared with the CYP3A5*3 variant, but these variants also lead to
alternative splice variants [Daly 2006]. Similarly, these variants do not result in functional
CYP3A5 protein.
1.1.2.3 CYP3A protein structure:
CYP3A isoforms have similar substrate specificity and kinetic profiles. In addition, similarities
between the CYP3A isoforms have resulted in few specific molecular markers for individual
detection. The difficulties in the development of such markers is the result of comparable DNA
and protein homology (84.1%, 88.1% and 75.8% protein homology for CYP3A5, 3A7 and 3A43
compared to CYP3A4, respectively; Gellner et al., 2001). Furthermore, most commercially
available polyclonal antibodies cannot detect the differences between the isoforms, although
some laboratories have developed a monoclonal antibody that appears to be isoform specific
[Mei et al., 1999].
P450 enzymes are bound to the smooth endoplasmic reticulum (ER) through two alpha helices at
their hydrophobic outer surfaces (termed F’ and G’ helices) [Yano et al., 2004]. These N-
terminal domains anchor P450 to the ER-membrane bilayer while exposing their catalytic site to
the cytosol [Sakaguchi et al., 1984]. More recently, Jeon et al. (2008) discovered a truncated
version of CYP3A4 lacking its N-terminal hydrophobic domains in the cytosol, while retaining
its catalytic activity. In addition, N-terminal hydrophobic domains have been suggested to
9
mediate protein-protein interactions between CYP3A4 and CYP2C9, resulting in changes in enzymatic activity [Subramanian et al. 2010]
Solvent channels consisting of β-sheets that allow the substrate to enter the enzyme’s active site have also been identified. The crystal structure of CYP3A4 was published separately in 2004 by two laboratories displaying unliganded and liganded active sites [Yano et al., 2004 and Williams et al., 2004a, respectively]. In the first study, CYP3A4 showed a considerably larger active site near its heme iron compared with CYP2C8. The larger cavity near the heme group of CYP3A4 seemed to play a role in broader substrate selectivity as compared with other P450 enzymes, by adopting “alternative binding modes for multiple substrate molecules” [Yano et al., 2004].
Several key amino acids within the active site were identified using crystal structure studies.
These include residues: 119, 301, 304, 305, 369, 370, and 374, and previous studies with site- directed mutagenesis on these amino acids have implicated them as such [Yano et al., 2004]. An interesting residue, Arg-212 was found in the active site that was previously unrecognized. This amino acid may be important in peroxide supported oxidation reactions, but further investigations are needed. In recent studies, data gathered from crystal structures have allowed computer simulated docking models to predict ligand binding and substrate metabolism for levorphanol [Bonn et al., 2010]. Furthermore, these experiments provided valuable information in identifying potential CYP3A4 substrates.
10
1.1.2.4 CYP3A drug substrates and oxidation reaction:
The human CYP3A subfamily contributes to the metabolism of nearly half of all currently
marketed drugs, with a partial list shown in Table 1. These drug substrates range from
medications for cardiovascular diseases to analgesics. As with most other Phase I enzymes,
CYP3A introduces polar groups onto its target substrates to further facilitate their elimination.
A general scheme for a typical P450 CYP3A isoform reaction is depicted in Figure 1. In short,
target substrates bind to the enzyme near its heme ion (Fe3+) as an RH side group (Step 1 of
Figure 1). An electron is then transferred from NADPH-P450 reductase reducing the heme ion to
2+ its ferrous form (Fe ). An O2 molecule then binds to the prosthetic heme, followed by a second
electron transfer either from NADPH-P450 reductase, or from cytochrome b5 (in cases where
+ CYP3A reactions are dependent on cytochrome b5). A free proton (H ) enters, followed by H2O removal, forming a (FeO)3+ complex. The (FeO)3+ RH complex then undergoes a hydrogen atom
abstraction to form a transient (FeOH)3+R• radical. Oxygen rebound occurs (radical
recombination) to give rise to an ROH group and this process regenerates the initial Fe3+ for the enzyme. The oxidation reaction occurs readily at carbon and heteroatoms (nitrogen, sulfur, and iodine); dealkylation of amines and ethers; and epoxidation. [Guengerich 1991, Guengerich
1999].
11
Table 1. CYP3A4 substrates and therapeutic groups Acetaminophen [analgesic] Lidocaine [anesthetic] Alfentanil [analgesic] Lisuride [Parkinson treatment] Alpidem [anxiolytic] Loratadine [antihistamine] Alprazolam [anxiolytic] Losartan [antihypertensive] Amiodarone [antiarrhythmic] Lovastatin [cholesterol lowering] Amitriptyline [antidepressant] Meloxicam [analgesic] Artelinic acid [malaria treatment] Methadone [analgesic] Astemizole [antihistamine] Midazolam [anxiolytic] Atorvastatin [cholesterol lowering] Mifepristone [contraceptive] Benzphetamine [anorectic] N-Hydroxyarginine Budesonide [asthma treatment] Nevirapine [antiretroviral] Carbamazepine [anticonvulsant] Nicardipine [antihypertensive] Citalopram [antidepressant] Nifedipine [antihypertensive] Clarithromycin [antibiotic] Nimodipine [antihypertensive] Clopidogrel [antiplatelet] Nisoldipine [antihypertensive] Clozapine [antipsychotic] Nitrendipine [antihypertensive] Codeine [analgesic] Omeprazole [proton pump inhibitor] Colchicine [gout treatment] Oxodipine [antihypertensive] Cortisol [hormone] Paclitaxel [anticancer] Cyclobenzaprine [muscle relaxant] Progesterone [hormone] Cyclophosphamide [anticancer] Propafenone [antiarrhythmic] Cyclosporin A [immunosuppressant] Proguanil [malaria treatment] Cyclosporin G [immunosuppressant] Quetiapine [antipsychotic] Dapsone [leprosy treatment] Quinidine [antiarrhythmic] Dehydroepiandrosterone [hormone] Rapamycin [immunosuppressant] Delavirdine [antiretroviral] Retinoic acid [vitamin A metabolite] Dextromethorphan [antitussive] Ritonavir [antiretroviral] Diazepam [anxiolytic] Salmeterol [asthma treatment] Digitoxin [antiarrhythmic] Saquinavir [antiretroviral] Diltiazem [antihypertensive] Sertindole [antipsychotic] Docetaxel [anticancer] Sulfamethoxazole [antibiotic] Ebastine [antihistamine] Sufentanil [analgesic] 17β-Estradiol [hormone] Tacrolimus [immunosuppressant] Erythromycin [antibiotic] Tamoxifen [breast cancer treatment] Ethylmorphine [analgesic] Tasosartan [antihypertensive] 17β-Ethynylestradiol [hormone] Teniposide [anticancer] Etoposide [anticancer] Terfenadine [antihistamine] Felodipine [antihypertensive] Terguride [antihypertensive] Finasteride [antiandrogen] Testosterone [hormone] Flutamide [antiandrogen] Tetrahydrocannabinol [psychotic] Germander [antiseptic] Theophylline [asthma treatment] Gestodene [contraceptive] Toremifene [breast cancer treatment] Granisetron [antiemetic] Triazolam [anxiolytic] Haloperidol [antipsychotic] Trimethadione [anticonvulsant] Ifosfamide [anticancer] Troleandomycin [antibiotic] Imipramine [antidepressant] Verapamil [antihypertensive] Indinavir [antiretroviral] Warfarin [anticoagulant] Irinotecan [anticancer] Zatosetron [anxiolytic] Ivermectin [antiparasitic] Zonisamide [anticonvulsant] Lansoprazole [proton pump inhibitor] Modified from Guengerich 1999. 12
Figure 1. General scheme of P450 CYP3A isoform oxidation reaction. [Reproduced from Guengerich (1999), with permission from the publisher].
13
1.1.2.5 Gene regulation: CYP3A gene cassette and regulatory sites
The CYP3A gene locus spans ~220 kb on chromosome 7q21-q22. The four human CYP3A genes
are arranged head to tail from CYP3A4, CYP3A7 and CYP3A5, with CYP3A43 arranged in a head
to head orientation against CYP3A4 (Figure 2).
Figure 2. Human CYP3A gene cassette. Human CYP3A chromosomal locus. The human CYP3A gene locus stretches ~220 kb on chromosome 7. [Chuang and Ito. (2010): with permission from the publisher].
14
The CYP3A isoforms share common transcriptional factors as a result of similar DNA regulatory elements found at the 5’ regions of their transcription initiation sites (Figure 3). Of the isoforms,
CYP3A4 and CYP3A7 are most similar, sharing 90% DNA sequence identity up to -8.8kb of the transcriptional start sites, suggesting co-evolution of the promoters with close evolutionary distance for these two genes [Bertilsson et al., 2001]. CYP3A4 and CYP3A7 both have a distal
XREM (xenobiotic-responsive enhancer module) situated approximately 8 kb upstream of their transcription initiation sites. This XREM is a DNA regulatory region that consists of a glucocorticoid response element (GRE), HNF4α binding site, and PXR-responsive element
(PXRE). These DNA motifs allow the binding of multiple nuclear receptors including HNF4α,
PXR, CAR and VDR. In addition, there also exists an everted repeat separated by 6 nucleotides
(ER6), that is proximal to the promoters of CYP3A4, CYP3A5 and CYP3A7, which enables transcription activation via PXR, CAR and VDR [Gibson et al., 2002]. Similarity in DNA regulatory elements amongst the CYP3A isoforms further emphasizes the specific regulation mechanisms responsible for the variable expression of each CYP3A isoform.
15
Figure 3. Known regulatory sites of major CYP3A isoforms. Numbers represent positions relative to gene transcriptional start site. GRE; glucocorticoid response element, RXRα; retinoid X receptor alpha, COUP‐TF; chicken ovalbumin upstream promoter‐transcription factor, HNF4/5; hepatic nuclear factor 4/5 binding site, PXRE; PXR‐responsive element, ERE; estrogen receptor responsive element, AP3; activator protein 3, p53; tumour suppressor protein p53, NFSE; nifedipine‐specific element, HFLaSE; P450HFLa‐specific element (HFL; human fetal liver), CAAT; CAAT‐binding protein response element, PRE; progesterone receptor response element, Oct; octamer‐binding protein response element, ER6; everted repeat separated by 6 nucleotide site, TATA; TATA binding protein site, BTE; basic transcription element. [Redrawn from Gibson et al., (2002) with permission from the publisher].
16
1.1.2.5.1 CYP3A nuclear receptors:
CYP3A is regulated by several ligand-activated nuclear receptors, including: the pregnane X
receptor (PXR), the constitutive androstane receptor (CAR), the farnesoid X receptor (FXR), and
the vitamin D receptor (VDR), where each of the above can form a dimeric complex with the
retinoid X receptor (RXR) [Stanley et al., 2006, Pascussi et al., 2003, Gnerre et al., 2004, Burk
et al., 2004b, Fukumori et al., 2007, Wang et al., 2008]. Nuclear receptor activation (i.e., binding
of steroids or xenobiotics) promotes target gene transcription.
In addition to the nuclear receptors mentioned above, CYP3A is also transcriptionally regulated
by hepatocyte nuclear factor 4 alpha (HNF4α) [Tegude et al., 2007] and the glucocorticoid receptor (GR) [Sheppard et al., 2002]. HNF4α is classified as an orphan receptor, but evidence suggests endogenous fatty acid may occupy its putative ligand binding domain [Wisely et al.,
2002]. Meanwhile, glucocorticoids such as hydrocortisone can bind to the glucocorticoid receptor (GR) and modulate CYP3A expression. Dexamethasone, a potent glucocorticoid, causes activation of GR at nanomolar concentrations, while activation of PXR requires supra- micromolar concentrations [Pascussi et al., 2001]. The wide variety of ligands and potential
cross-talks between nuclear receptors demonstrates the complexity of CYP3A transcriptional
control. Some well-known activators for these nuclear receptors are listed in Table 2.
17
Table 2. CYP3A inducers and their target nuclear receptors
CYP3A inducer Responsible nuclear receptor Reference
Bisphenol A PXR Takeshita et al., 2001 Bile acids and precursors CAR and PXR Li et al., 2010 Carbamazepine CAR Faucette et al., 2007 Chenodeoxycholic acid FXR Khan et al., 2009 Clotrimazole PXR Svecova et al., 2008 Corticosterone GR and PXR Sakuma et al., 2008 Cyclophosphamide Unknown Xie et al., 2005 Cyproterone acetate Unknown Tucker et al., 1996 Dexamethasone GR and PXR Khan et al., 2009 4-hydroxytamoxifen PXR Sane et al., 2008 Hydrocortisone GR Honkakoski et al., 1999 Ifosfamide PXR Harmsen et al., 2009 Lansoprazole Unknown Krusekopf et al., 2003 Lovastatin GR and PXR Gibson et al., 2002 Metyrapone PXR Harvey et al., 2000 Nifedipine PXR Ripp et al., 2006 Omeprazole Unknown Krusekopf et al., 2003 Paclitaxel PXR Harmsen et al.. 2009 Pantoprazole Unknown Krusekopf et al., 2003 Phenobarbital CAR Mäkinen et al., 2002 Phenylbutazone Unknown Ogg et al., 1999 Phenytoin PXR Luo et al., 2002 Retinoic acid VDR/RXR and CAR/RXR Wang et al., 2008 Rifampin PXR Harmsen et al., 2009 Ritonavir PXR Luo et al., 2002 RU486 (mifepristone) PXR Teng et al., 2003 St. John’s wort (hyperforin) PXR Harmsen et al., 2009 Sulfamidine PXR Luo et al., 2002 Sulfinpyrazone PXR Luo et al., 2002 Tamoxifen PXR Harmsen et al., 2009 Troleandomycin PXR Luo et al., 2002 Troglitazone GR and PXR Gibson et al., 2002 Vitamin D VDR Khan et al., 2008 Vitamin E PXR Landes et al., 2003
18
1.1.2.5.2 Pregnane X receptor (PXR):
PXR is perhaps the most well-known regulator for CYP3A isoforms. PXR was isolated and
characterized in 1998 by three separate laboratories [Bertilsson et al., 1998, Blumberg et al.,
1998 and Kliewer et al., 1998]. PXR was first named SXR (steroid and xenobiotics receptor), due to its ability to transcriptionally activate P450 enzymes in the presence of natural steroids and xenobiotics [Blumberg et al., 1998]. Since its isolation, multitudes of compounds have been
found to bind to this receptor, thereby affirming PXR as a non-specific xenobiotics sensor (Table
2) [Tompkins et al., 2007]. PXR may also transcriptionally activate various enzymes of the
Phase I (members of CYP3A, CYP2B and CYP2C families), Phase II (glutathione S-
transferase), and Phase III (MDR and MRP transporters) xenobiotic detoxification systems
[Tompkins et al., 2007]. Consequently, PXR is considered a crucial regulator of drug metabolizing enzymes.
As with most other nuclear receptors in its class, PXR partners with RXR as a heterodimer to bind to different DNA elements, such as: the everted repeat with 6-nucleotide spacer (ER6), the direct repeat with 3-nucleotide spacer (DR3), and the direct repeat with 4-nucleotide spacer
(DR4). Upon binding to its cognate enhancer elements, the PXR/RXR heterodimer facilitates transcriptional upregulation of its target genes. PXR is closely related to VDR, although crystal structure shows PXR to have a larger ligand binding pocket compared with other nuclear receptors [Watkins et al., 2001]. This wider binding pocket may explain the reason for the large number of ligands for PXR. Other interesting PXR activators include the natural dietary phytochemicals, such as tangeretin, and ginkgolides A and B [Satsu et al., 2008].
19
Species differences in PXR activation have posed a great challenge to in vivo drug metabolism
studies. For example, the semi-synthetic macrolide rifampicin is a potent human PXR activator,
capable of strongly inducing CYP3A4 mRNA and protein, both in vitro and in vivo [Schuetz et al., 1993, Kocarek et al., 1995, Goodwin et al., 1999 and Chen et al., 2006]. However, rifampicin cannot readily activate rodent PXR, but the steroid PCN (pregnenolone-16-alpha- carbonitrile) appears to be a rodent-specific PXR activator [Moore et al., 2000]. Recently, Ma et al. (2007b) developed a humanized PXR transgenic mouse that showed similar mouse CYP3A expression compared with human liver and intestine, where induction of mouse CYP3A can be achieved with human-specific PXR activators. Creation of such transgenic mice can provide suitable animal models for drug metabolism studies.
1.1.2.5.3 Constitutive active/androstane receptor (CAR):
Barbiturates like phenobarbital (PB) are potent CAR activators. When activated, CAR translocates to the nucleus from the cytoplasm, associates with its binding partner RXR, and binds to PB-responsive enhancer elements to increase transcription of target genes [Honkakoski et al., 1998, Xie et al., 2000b, Sueyoshi et al., 2001]. Similarly to PXR, CAR activates multitudes of P450 enzymes including members of the CYP2B, CYP2C and CYP3A subfamilies.
CAR was first named “constitutive active receptor” due to its ability to weakly activate retinoid responsive elements without the presence of retinoids [Baes et al., 1994]. This notion was further supported as CAR was found to accumulate in the nucleus of HepG2 cells in non-treated controlled samples [Zelko et al., 2000]. However, these in vitro observations were not reflected
20
in liver sections, where CAR was found predominantly in the cytoplasm under baseline conditions.
Aside from xenobiotics, endogenous ligands, such as steroids can also modulate CAR activity. In
HepG2 cells, progesterone and androgens act as repressors to CAR reporters, but estrogens actually induce CAR-reporter activity [Kawamoto et al., 2000]. The complexity of CYP3A transcriptional regulation is further exemplified where both CAR and PXR share identical binding sites (ER6). The potential cross talk between these nuclear receptors could be another contributing factor to the variable expression of CYP3A isoforms [Zelko et al., 2000].
1.1.2.5.4 Farnesoid X receptor (FXR):
FXR is a nuclear receptor that is activated by bile acids and heterodimerizes with RXR. Bile acid modulation of CYP3A expression was not initially linked to FXR, but to PXR because chenodeoxycholic acid (CDCA) and cholic acid could weakly activate PXR [Kliewer et al.,
2002]. The notion that PXR may not be the only nuclear receptor involved in bile acid activation of CYP3A came from the observation of lithocholic acid (LCA) induction of mouse Cyp3a11 mRNA in a PXR-null mouse line [Xie et al., 2001]. It was known that FXR had a higher affinity for these bile acids compared with PXR [Parks et al., 1999], but there was no direct evidence showing the involvement of FXR in human CYP3A expression until the works published by
Gnerre et al. (2004). In the study, CYP3A4 mRNA transcripts were upregulated by FXR activators and an FXR-responsive element (ER8) within the XREM of CYP3A4 was found to be active. Using luciferase reporters and in vitro binding assays in HepG2 cells, FXR was found to be responsible for bile acid activation of CYP3A4. Interestingly, in a follow up experiment in
21
2009, CDCA was found to increase CYP3A4 mRNA transcripts only in human liver slices, but
not those of the intestine [Khan et al., 2009]. This observation suggested a tissue-specific
regulation of CYP3A isoforms by bile acids, furthering the complexity of CYP3A regulation.
1.1.2.5.5 Vitamin D receptor (VDR):
The influence of vitamin D on CYP3A4 expression was first examined in the human intestinal
cell line Caco2, where 1α, 25-dihydroxy vitamin D3 induced CYP3A4 mRNA and protein
expression [Schmiedlin-Ren et al., 1997]. Later studies showed that the vitamin D responsive element was actually a proximal ER6 site in the CYP3A4 promoter, previously shown to modulate CYP3A4 transcription via PXR/RXR and CAR/RXR [Thummel et al., 2001]. It was found that the full activation of PXR on this proximal ER6 required further DNA elements in the distal XREM (two distal DR3 sites and one distal ER6 site) [Goodwin et al., 1999].
The notion that PXR may not have been responsible for the vitamin D activation of CYP3A4 came from the observation that Caco 2 does not show significant expression of PXR mRNA, and that vitamin D3 cannot activate a PXRE reporter in the presence of transfected PXR [Thummel et
al., 2001]. It was only when VDR was transfected that a VDR/RXR heterodimer induced
transcriptional upregulation of a CYP3A4 reporter with the presence of 1α, 25-dihydroxy
vitamin D3 (this was conducted in Cos-7 cells). The VDR/RXR binds to the proximal ER6 site,
with full activation requiring a DR3 site in the distal XREM [Drocourt et al., 2002]. Vitamin D
activation of VDR and a subsequent CYP3A4 mRNA increase have also been documented in primary hepatocytes [Wang et al., 2008].
22
1.1.2.6 CYP3A inhibitors (grapefruit juice, ketoconazole and azamulin):
Grapefruit juice:
One of the well-known CYP3A4 food-drug interactions is that consumption of grapefruit juice increases the bioavailability of felodipine; a calcium channel antagonist for treatment of hypertension. Originally used to mask the taste of ethanol in the seminal study, grapefruit juice was used as a vehicle to assess the effects of ethanol on felodipine [Bailey et al., 1989].
Felodipine is primarily metabolized by CYP3A4 to dehydrofelodipine, which does not have any active pharmacological properties. Since then, grapefruit juice has been found to increase the absolute bioavailability of many CYP3A4 drug substrates, where this interaction appears to be limited to orally administered drugs [Bailey et al., 1998].
Furancoumarins, particularly bergamottin and its derivatives, are the active ingredients in grapefruit juice that inhibit CYP3A4 [Ohnishi et al., 2000]. Bergamottins have been suggested as post-translational, mechanism-based inhibitors that decrease CYP3A4 protein content in enterocytes of the intestinal walls [Lown et al., 1997]. This hypothesis was supported as baseline
CYP3A4 mRNA levels were not affected by grapefruit juice, but de novo enzyme synthesis was required to restore CYP3A4 protein content [Bailey et al., 1998]. Dosing grapefruit juice prior to drug intake could improve the therapeutic effects of orally administered drugs, especially for drugs that are metabolized by CYP3A enzymes. However, careful consideration must be undertaken with grapefruit juice to ensure there are no significant changes in drug pharmacokinetics that could lead to an adverse event.
23
Ketoconazole:
Ketoconazole is an antifungal medication for treating superficial fungal infections. Ketoconazole
is commonly used as a CYP3A inhibitor. It is able to inhibit CYP3A isoforms at submicromolar
concentrations and other P450 enzymes at micromolar concentrations (e.g., CYP2A6, CYP2B6,
CYP2C9, CYP2C19, CYP2D6 and CYP2E1) [Khojasteh et al., 2011]. A recent review by
Greenblatt et al. (2010) summarized various ketoconazole Ki values reported in various studies.
The group stated that the mechanism of action of ketoconazole on CYP3A enzymes may not be pure non-competitive inhibition, as different concentrations of substrates (midazolam) gave rise to different ketoconazole IC50 values. Ketoconazole seems to cause a mix of competitive and
noncompetitive inhibition. A similar phenomenon is seen in enzymes with multiple substrate and
inhibitor binding sites [Galetin et al., 2003].
Azamulin:
Azamulin is a recently discovered and highly selective inhibitor for CYP3A4, with an IC50 of
0.03–0.24μM [Stresser et al., 2004]. Azamulin is ineffective against other P450 enzymes
(requiring a 100-fold higher dose to achieve inhibition compared with CYP3A4), but it is a considerably more potent inhibitor (15-fold) for CYP3A4 compared with other CYP3A isoforms
(CYP3A5 and CYP3A7). Azamulin appears to be a mechanism-based irreversible inhibitor; because it is highly stable and soluble, it is quite appropriate for laboratory use [Stresser et al.,
2004].
24
1.1.2.7 Mouse CYP3A:
No functional ortholog CYP3A pairs exist between humans and mice [Nelson et al., 2004]. Liver and intestinal functional assays show marked differences in Km and Vmax values of human
CYP3A substrates (midazolam, nifedipine and cyclosporine) among mice, rats and humans
[Komura et al., 2008]. Using in silico mapping of gene and amino acid sequences for phylogenetic analysis, Williams et al., (2004b) stated that rodent CYP3A has evolutionarily branched apart from its human counterparts. The study suggested that clearly defined ortholog pairs were plausible between similar species (i.e., mice and rats), but less likely between species of different orders (i.e., primate and rodent) [Williams et al., 2004b].
Mouse CYP3A11 is the closest putative ortholog to human CYP3A4, sharing 78.1% and 72.8% in DNA and protein sequence identity, respectively [Hart et al. 2009]. Mouse CYP3A13,
CYP3A16 and CYP3A25 are putative orthologs to human CYP3A5, CYP3A7 and CYP3A43, respectively; these mouse CYP3A isoforms share approximately 80% in DNA and 70% in protein sequence identity [Hart et al., 2009]. CYP3A11 is the main mouse CYP3A isoform expressed in the liver [Yanagimoto et al., 1997], whilst CYP3A11 and CYP3A13 are highly expressed in the intestine [Sakuma et al., 2000]. Additional mouse CYP3A isoforms include:
CYP3A41, CYP3A44, CYP3A57 and CYP3A59. Mouse CYP3A isoforms are found mostly in the liver, but they have been shown to be expressed at various levels in intestine, brain, prostate, kidney and other tissues [Sakuma et al., 2000, Sakuma et al., 2002].
CYP3A16 shows differential expression in development. Its hepatic expression increases during embryonic growth, but decreases drastically after birth [Hart et al., 2009]. CYP3A11, CYP3A13
25
and CYP3A25 also show age and sexual dimorphism in expression; these enzymes increase in
females, but decrease in male animals during aging [Down et al., 2007]. Furthermore, PXR expression appears to be positively correlated to these patterns in expression [Down et al., 2007].
On the other hand, CYP3A41 and CYP3A44 are female-specific CYP3A isoforms; their expressions are regulated by growth hormones, estrogens and glucocorticoids, and may involve nuclear receptors including ER, GR and PXR [Sakuma et al., 2002, Sakuma et al., 2008 and
Cheung et al., 2006].
Mouse CYP3A isoforms are also regulated by CAR and PXR, and can be induced by their agonists. In the study conducted by Anakk et al. (2004), it was shown that phenobarbital, PCN,
and dexamethasone induced Cyp3a11 and Cyp3a41 mRNA and total CYP3A protein in
C57/BL6 mice. Furthermore, dexamethasone has been shown to induce Cyp3a11, Cyp3a13,
Cyp3a25 mRNA levels in the liver of C57/BL6 mice [Down et al., 2007].
In addition to the differences between human and mouse CYP3A enzyme function, rodent
CYP3A expression can be influenced by species-specific receptor ligands (i.e, PCN is a rodent- specific PXR inducer). This can be explained by species differences in the ligand binding domain of nuclear receptors. For example, human PXR and mouse PXR share a mere 77% amino acid sequence homology in the ligand binding domain [Kliewer et al., 2002]. Transgenic animals expressing humanized nuclear receptors have been shown to adopt human-specific responses to human-specific ligands [Cheng et al., 2011].
26
1.1.2.8 Humanized CYP3A transgenic mouse models:
Due to differences in expression and regulation of CYP3A in mammalian species, data obtained from in vivo studies with non-human models cannot easily be extrapolated onto humans
[Gonzalez et al., 2006]. In order to provide consistent and reliable systems for predicting human responses to xenobiotics, many humanized transgenic mice were developed for such purposes.
Using bacterial artificial chromosomes (BAC) and P1 phage artificial chromosomes (PAC), mice expressing human CYP1A1, CYP1A2, CYP2E1, CYP2D6 CYP3A4, and CYP3A7 have been generated [Gonzalez 2007]. In addition, humanized nuclear receptors for P450 enzymes including: humanized AHR (CYP1A1 regulator), PXR, and CAR were also developed
[Moriguchi et al., 2003, Xie et al., 2000a, Zhang et al., 2004, respectively]. Since then, several transgenic mouse strains were developed that incorporated multiple human P450 and human nuclear receptors. These models include the CYP3A4-humanized transgenic mouse (Tg3a4)
[Granvil et al., 2003], a double transgenic line with human CYP3A4, CY3A7 and human PXR
(Tg3a4/hPXR) in a mouse Pxr-null background [Ma et al., 2008], mouse lines with liver- or small intestine-specific human CYP3A4 and endogenous mouse Cyp3a gene deletions
(Cyp3a(-/-)Tg-3A4Hep and Cyp3a(-/-)Tg-3A4Int, respectively) [van Herwaarden et al., 2007, van
Waterschoot et al. 2009], and more recently, a humanized PXR/CAR with human CYP3A4,
CYP3A7 and endogenous Cyp3a gene deletions (huCAR/huPXR/huCYP3A4/3A7 [Hasegawa et al. 2011]. The creation of humanized transgenic mouse models offer powerful tools that can further our understanding of xenobiotic metabolism in a living animal substitute that best mimics humans.
27
The CYP3A4/CYP3A7-humanized transgenic mouse lines (Tg3a4, Tg3a4/hPXR, and
huCAR/huPXR/huCYP3A4/CYP3A7) display high hepatic and intestinal CYP3A4 contents.
The similar patterns to human expression may be attributed to intact human regulatory sites. The
CYP3A4/CYP3A7 transgenes contain genomic DNA sequences that include the 5’ promoter,
exons, introns and 3’ regions. In addition, human CYP3A4 in these animal models can be
induced by typical CYP3A inducers such as dexamethasone, PCN/rifampicin and phenobarbital
[Granvil et al., 2003, Yu et al., 2005, Cheung et al., 2006, Ma et al., 2007b, Ma et al., 2008].
The huCAR/huPXR/huCYP3A4/CYP3A7 mouse has the potential to be the most sought after
model for studying human CYP3A in vivo. Because mouse endogenous Cyp3a genes are deleted,
there would be no interactions between human and mouse CYP3A in biochemical assays where
specificity and resolution could be questioned. For example, both human and mouse CYP3A
metabolize erythromycin; if erythromycin N-demethylation activity was examined in a
humanized CYP3A transgenic mouse model with intact endogenous mouse CYP3A, the resultant protein activity measurements would be confounded by CYP3A from both species. In addition, having humanized PXR and CAR would permit human-specific ligand induction of human
CYP3A. Such induction pathways would provide a more accurate profiling of drug-drug interactions that is closer to the human system.
The use of transgenic CYP3A mouse models also elucidated previously undiscovered gene regulation. These animal models also provided materials that were relatively unattainable due to
ethical reasons. For example, Pang et al., (2012) closely examined the regulation of the fetal-
specific CYP3A7 in the Tg3a4/7-hPXR mouse model. In that study, it was shown that CYP3A7
28
fetal expression was mediated by glucocorticoids and GR, while the rifampicin-induced PXR
was unable to induce CYP3A7 expression. Further experiments using hepatocytes from the fetus
have revealed active GRE sites in the 5’ upstream regions of CYP3A7 that were responsive to
glucocorticoids and a GR expression vector. These results provided a novel molecular
mechanism for human CYP3A7 regulation during development.
The CY3A4/CYP3A7-humanized transgenic mouse used in this thesis shows sexual dimorphism
in CYP3A4 expression [Cheung et al., 2006]. Sexual dimorphism of humanized CYP3A4
expression was first observed in the transgenic Tg3a4 line created by Granvil et al., (2003) [Yu
et al., 2005]. In that study, hepatic human CYP3A4 expression was undetected in male pups after
4 weeks of age, but female mice showed detectable CYP3A4 protein throughout aging. This
mouse model also showed extensive estradiol metabolism during pregnancy, suggesting
CYP3A4 may mediate estradiol homeostasis in humans [Yu et al., 2005]. Cheung et al. (2006) generated a new CYP3A4/CYP3A7-humanized transgenic mouse line, which expresses fetal human CYP3A7. In this mouse model, human CYP3A4 expression patterns were similar to those reported in Yu et al. (2005). Cheung et al. (2006) showed that male human CYP3A4 expression can be rescued when growth hormone was supplied in a manner that mimicked female secretion pattern. Furthermore, growth hormone feminized the expression profile of mouse Cyp3a44
mRNA in male mice, suggesting a regulatory role of growth hormone on sex-specific expression
of human and mouse CYP3A.
29
1.1.3 Cellular Responses to Ambient Osmotic Environment
1.1.3.1 Osmolality and tonicity:
Osmolality/osmolarity is the measure of solute concentration defined as the number of moles of
particles that influence osmotic pressure of the solution, and is expressed as Osm per unit of
solvent weight (osmolality), or per volume of the solution (osmolarity). In biological systems, osmolality and osmolarity are virtually equivalent, and physiological plasma osmolality is about
300 mOsm/kg (throughout this review, we will use the term "osmolality"). In semi-permeable
membranes that separate two solutions, a concentration gradient of non-permeable solutes would
exert osmotic pressure on the membrane. These solutes may be termed "osmolytes", and their
concentrations are called "tonicity” (also known as effective osmolality). In this thesis,
osmolality and tonicity are assumed to be approximately equal under most circumstances, unless
otherwise stated.
1.1.3.2 Cellular responses to ambient hypertonicity:
The physiological osmolality (tonicity) serves as an isotonic reference point. Significant
deviation of the tonicity from the isotonic point can be defined as either hypertonic or hypotonic.
The normal value of osmolality found in the intracellular and extracellular space of most human
tissues, such as plasma, is approximately 300 mOsm/kg. One notable exception is the renal
medulla; the hyperosmolar environment has an osmolality of roughly 1800 mOsm/kg, which is
necessary to concentrate urine. It is worth noting that in mice, liver plasma osmolality is 35
mOsm/kg higher than the plasma in circulation [Go et al., 2004]. Hypertonicity causes many
30
detrimental effects in the cells; some examples include: DNA damage [Kultz D et al., 2001],
DNA repair malfunction [Dmitrieva et al., 2004], inhibition of P53 induction [Dmitrieva et al.,
2001a], cell cycle arrest [Dmitrieva et al., 2001b], mitochondria dysfunction [Copp et al., 2005], cytoskeleton rearrangement [Di Ciano et al., 2002], inhibition of protein synthesis [Morley et al.,
2002], oxidative stress [Zhang et al., 2004], and apoptosis [Dmitrieva et al., 2001b].
Osmolytes such as NaCl and sucrose have been used to examine the effects of ambient tonicity changes on cells in vitro. One of the immediate cellular responses to ambient hypertonicity is to increase the overall intra-cellular ions Na+, Cl- and K+ by influx via the Na+-K+-2Cl-
+ + - - cotransporter, Na /H exchanger, and the Cl /HCO3 exchanger [Lang et al., 1998]. With the
influx of osmolyte ions, cells are able to normalize osmotic pressures in a process known as
“regulatory volume increase” (Figure 4) [Garner et al., 1994].
31
Figure 4. Regulatory volume response.
Immediate cellular response to ambient hypertonicity (NaCl‐mediated hypertonicity depicted) is the increase in the intra‐cellular ions by an influx of Na+, Cl‐ and K+ via the Na+‐K+‐2Cl‐ + + ‐ ‐ cotransporter (green), Na /H exchanger (yellow), and the Cl /HCO3 exchanger (orange). With the influx of osmolyte ions, cells are able to neutralize osmotic pressures to regain their initial volume. This process is known as “Regulatory Volume Increase”. [Chuang and Ito. (2010): with permission from the publisher].
Prolonged high ionic content decreases gene transcription and translation, increases DNA breaks and protein oxidation, and results in cell cycle arrest [Burg et al., 2007]. As an adaptive response, several key organic “compatible osmolytes” are produced within the cells or transported into the cells, to increase the intracellular osmolyte concentration whilst lowering intracellular ions. These compatible osmolytes include: inositol and sorbitol derived from glucose, betaine from choline, and taurine from cysteine. Over a period of several hours, compatible osmolytes accumulate in the cells, and eventually restore the initial ionic content. In addition, compatible osmolytes can stabilize protein functions by promoting native protein folding [Street et al., 2006].
32
1.1.3.3 Tonicity sensitive transcription factor, NFAT5/TonEBP:
Hypertonicity increases the expression of genes that are responsible for raising the intracellular levels of compatible osmolytes. Such osmotic stress genes include: the aldose reductase (AR) that converts glucose to sorbitol [Ko et al., 1997], the sodium myo-inositol transporter (SMIT) that transports inositol into cells in exchange for Na+ [Rims et al., 1998], the betaine/GABA transporter (BGT1) that transports betaine against Na+ and Cl- gradient [Miyakawa et al., 1998], and the taurine transporter (TauT) that transports taurine into cells [Ito et al., 2004]. Heat shock protein 70 (HSP70) is also induced to promote protein stabilization [Woo et al., 2002] (Figure 5).
33
Figure 5. Cellular adaptive response. In prolonged hypertonicity, cells produce enzymes and transporters that increase intracellular levels of compatible osmolytes. Increased organic compatible osmolytes allow the decrease of ions without changing the overall osmolyte content [Chuang and Ito. (2010): with permission from the publisher].
34
Tonicity-enhancer binding protein (TonEBP) is the tonicity responsive transcription factor that regulates the adaptive response against ambient hypertonicity. It is also known as the nuclear factor of activated T-cells 5 (NFAT5). As a constitutive homodimer, NFAT5 can be found in the cytoplasm and the nucleus under normal physiological conditions [Lee et al., 2002]. NFAT5 binds to the tonicity enhancer (TonE) with the following consensus sequence:
TGGAAANNYNY (N: any nucleotide; Y: pyrimidine C/T) [Ko et al., 2000, Lopez-Rodriguez C et al., 2001]. NFAT5 contains a Rel-like DNA binding domain and is part of the NFκB family of transcription factors [Lopez-Rodriguez et al., 1999, Miyakawa et al., 1999]. Upon an ambient hypertonic stimulus, NFAT5 is phosphorylated by several kinases (p38, fyn, protein kinase A, and ATM [Ko et al., 2002, Ferraris et al., 2002a, Irarrazabal et al., 2004, Lee et al., 2002.]).
Phosphorylation of NFAT5 promotes its nuclear translocation by exposing a monopartite nuclear localization signal (NLS) and subsequent binding to its DNA enhancer element [Tong et al.,
2006].
NFAT5 mRNA is ubiquitously expressed in both human and mouse fetal and adult tissues including: brain, prostate, testis, liver, small intestine, colon, and kidney [Maouyo et al., 2002].
Additionally, NFAT5 has been detected in thymus, testis, lung, and brain of adult mouse tissues
[Trama et al., 2000]. However, NFAT5 protein expression in humans remains unknown.
In primary cultures, NFAT5 has been shown to induce osmotic stress genes in humans: limbal epithelial cells [Lee et al., 2008], hepatocytes [Ito et al., 2007], colonocytes [Kosuge and Chuang et al., 2007]; rat cardiomyocytes [Navarro et al., 2008]; and mouse lymphocytes, macrophage and fibroblasts [Morancho et al., 2008]. Although some of these organs are unlikely to face
35
extreme hypo- or hypertonicity, the existence of a tonicity regulatory pathway is nevertheless a
potentially important feature for cell survival. [Ho, 2006 and Aramburu et al,. 2006].
1.1.3.4 NFAT5 transactivation domain (TAD):
Specific details of the NFAT5 transactivation domain (TAD) were first characterized by Ferraris
et al. (2002b). In that study, a TAD was identified at the C-terminus of NFAT5 (983 C-terminal amino acids) that was responsive to tonicity. Using a protein construct with GAL4 DNA binding domain (DBD) fused with the TAD of NFAT5, the group showed that extracellular osmolality modulated the activity of a luciferase reporter, depressing levels by 80% at 200 mOsm/kg and inducing it to greater than 8-folds with 500 mOsm/kg. Further characterization by Lee et al.
(2003) revealed a total of three activation domains (AD) and two modulation domains (MD) within NFAT5. Each of the activation domains can independently and synergistically activate luciferase reporters in a GAL4 DBD-TAD construct, with inclusion of modulation domains enhancing transactivation also in a synergistic manner [Lee et al., 2003]. The luciferase activity of constructs containing MD1 (amino acids 618-820) and/or AD2 (amino acids 1039-1249) were determined to respond to tonicity changes, but phosphorylation of these domains by hypertonicity do not appear to associate with transactivation.
1.1.3.5 NFAT5-mutant mice:
Two similar Nfat5-mutant mouse strains have been independently generated by Go et al. (2004) and López-Rodriguez et al. (2004). Go et al. (2004) used targeted disruption to delete exon 6 and 36
7 of the Nfat5 gene, which encode critical residues within the NFAT5 DNA-binding domain
(DBD). The resultant homozygous mutant mouse showed a complete loss of function in NFAT5
and HSP70.1 reporters using isolated mouse embryonic fibroblasts (MEF), while the
heterozygous mouse showed a partial loss of function. In the same study, lack of NFAT5 resulted in impaired cell proliferation under hyperosmotic stress, and poor cell viability of thymocytes and splenocytes. The homozygous mutant mouse showed late gestational lethality,
which was also reported by López-Rodriguez et al. (2004) to be genetically underrepresented
after embryonic day 14.5. The surviving homozygous pups (~3% from expected) showed
growth retardation, renal atrophy, renal morphological abnormalities and severely reduced renal
NFAT5 target gene expression (aldose reductase, Bgt1, Smit and TauT) [López-Rodriguez et
al., 2004].
37
1.1.4 The osmotic environment in the gastrointestinal tract:
The lumen of gastrointestinal tract is exposed to large fluctuations in osmolality caused by
ingested food that contains various amounts of salts, sugars and amino acids. However, the role
of intestinal osmotic environment in physiology of the GI tract is poorly understood, compared with renal tissues. The following sections summarize available data on the osmotic environment of human and rodent intestinal tracts.
1.1.4.1 Human intestinal lumen:
A typical adult human needs approximately 24 hours to fully digest consumed food. After passing through the oral cavity and esophagus, food enters the stomach where it remains for
about three to four, while it is broken down into the form of chyme. Chyme then enters the
duodenum and is mixed with bile and pancreatic enzymes [Kong et al., 2008]. The small
intestine absorbs most of the digested nutrients; and it is also the site of highly expressed CYP3A enzymes where significant drug biotransformation occurs.
Osmolality measurements of the content in the human gastrointestinal tract have been difficult due to the invasiveness and non-therapeutic nature of the experiment. In addition to procedural difficulties, fluid volume tends to be small during fasting states, whereas in fed states food particles may clog the aspirating process. In the study conducted by Kalantzi et al. (2006a), the authors collected duodenum contents after the subjects had ingested water or “Ensure Plus”, a nutrient drink (610 mOsm/kg) that resembles the compositions of meals in bioequivalent/ 38
bioavailability studies. Osmolality was measured during the fasting (water group) and fed states
(Ensure Plus) at various time points. The group showed that under fasted states, the duodenal lumen appears to be hypoosmotic at 178 mOsm/kg. In contrast, luminal fluids under fed states were hyperosmolar at ~400 mOsm/kg at 30 minutes post-ingestion, and returned to isotonic levels (compared to the physiological tonicity) after 210 minutes. In another study conducted by
Gisolfi et al. (1998), the authors measured a fasting state osmolality of 142 mOsm/kg in the
duodenum, but 312 mOsm/kg after a hypertonic drink. However, it is worth noting that Gisolfi et
al. (1998) used a less hypertonic solution (414 mOsm/kg vs. 610 mOsm/kg in Ensure Plus) and that the volume ingested was not specified.
Lindahl et al. (1997) showed that the osmolality in the jejunum under fasting and water
deprivation is approximately 270 mOsm/kg in healthy humans. Kalantzi et al. (2006b) measured
duodenal canine osmolality values of 69 mOsm/kg under fasting, but as high as 841 mOsm/kg
twenty minutes after Ensure Plus ingestion [Kalantzi et al., 2006b]. It can be inferred from the
above studies that the intestinal lumen, especially in the duodenum, is hypotonic in a fasting state. In contrast under fed conditions, the duodenal lumen becomes hyperosmolar (and probably, hypertonic), but returns to isotonic conditions after approximately 3 hours.
Intestinal osmolality in individuals consuming a high-fat diet were also reported to be
hyperosmolar within the first three hours of digestion (~400 mOsm/kg), with similar values in
fed-states with equal caloric content [Clarysse et al., 2009].
39
1.1.4.2 Mice and rats intestinal lumen:
Most studies that involved osmotic solutions (hyper or hypo) in rodent intestine focused on the
changes of absorption rate of small molecules, ions or water [Pihl et al., 2008, Hoffmann et al.,
2006, Nishinaka et al., 2004]. Other studies using these tissues were primarily concerned with
Na+ ion transporters or cell regulatory volume changes [Bachmann et al., 2004, Mignen et al.,
1999]. Little is known about the actual osmolality of the luminal content of rodent species within the intestinal tract during normal, fed or fasted states. The study conducted by Osaka et al.
(2001) showed that after the ingestion of solid food, rats with free access to water achieved an
intestinal osmolality of approximately 600-800 mOsm/kg; clearly higher than the measured
plasma osmolality of 300 mOsm/kg. The group also showed that the duodenum-jejunum tract
has a higher luminal osmolality compared with the ileum (700 vs. 600 mOsm/kg, respectively).
40
1.1.5 Effects of high-salt diet on intestinal cytochrome P450 in vivo:
1.1.5.1 In vivo human studies:
Currently, no data on the direct effects of ambient hypertonicity (e.g., hypertonic plasma or hypertonic/hypotonic food intake) on human CYP3A expression have been published. However, there were several reports suggesting that high-salt diets increased intestinal CYP3A activity.
Quinidine is an antiarrhythmic agent metabolized by CYP3A4 [Brain et al., 1990] and it is also a non-substrate inhibitor for CYP2D6 [Caporaso et al., 1991]. Darbar et al. (1997) demonstrated that a week-long high-salt diet (400 mEq of sodium/day) decreased the plasma concentrations of quinidine (substrate) in the first 1 to 4 hours after ingestion, compared with a low-salt diet (10 mEq of sodium/day). However, in contrast to the oral route, there was no difference in pharmacokinetics for the intravenously-injected quinidine between the high-salt and low-salt diet groups [Darbar et al., 1997]. These results suggest that intestinal CYP3A activity might be increased after the prolonged high-salt diet, possibly enhancing the first-pass metabolism of quinidine in the intestinal epithelia.
In a similar study that followed, Darbar et al. (1998) examined the pharmacokinetics of verapamil in various salt diets. Verapamil is metabolized by CYP3A4, CYP3A5, CYP2C8 and
CYP2E1 [Tracy et al., 1999]. In this cross-over controlled study spanning 21 days, high- and low-salt diets were switched in each group during the middle week (High-salt group: 7-day high- salt + 7-day low-salt + 7-day high-salt; Low-salt group: 7-day low-salt + 7-day high-salt + 7-day 41
low-salt). Throughout the course of the study, racemic verapamil was given by oral ingestion and deuterium-labelled verapamil was intravenously injected on days 7, 14 and 21. The results show that plasma concentrations of orally administered verapamil were significantly lower during the period of high-salt diet compared with the low-salt diet period. Furthermore, the plasma concentration of labelled verapamil did not differ during any of the diet periods. These results were consistent with the previous study involving quinidine [Darbar et al., 1997], and suggested an increase of pre-systemic clearance of verapamil after prolonged exposure to a high-salt diet.
1.1.5.2 In vivo animal studies:
A recent study conducted by Kang et al. (2008) used rats to examine the effects of different salt diets on drug metabolizing enzymes and their transcriptional regulators. In that study, a high-salt diet of 8% NaCl (w/w content) for 14 days increased rat Cyp3a3 transcripts in the liver and the ileum (Note that the annotation for Cyp3a3 [NM_013105.1] is Cyp3a1/Cyp3a23 in the NCBI assembly and noted as Cyp3a1 in this report from this point on). In addition, increased nuclear receptor (Fxr, Car) and drug transporter (Bcrp, Mdr1a, Mdr1b and Oct1) transcripts were observed in the ileum. Although Pxr mRNA levels did not change in the intestinal tract, the low- salt diet (0.06% NaCl) increased Pxr mRNA levels more robustly compared with the high-salt diet (8% NaCl) in the liver (7-fold vs. 2-fold respectively). In contrast, Car mRNA showed high induction in the low-salt diet group compared with the high-salt diet group (10 fold vs. no change, respectively).
42
CYP3A1 and CYP3A2 are the main rat CYP3A expressed in the liver, whilst CYP3A9 and
CYP3A62 are expressed in the intestine [Nelson et al., 2004, Komura et al., 2008 and Takara et
al., 2003]. Kang et al. (2008) showed Cyp3a1 mRNA induction in the rat ileum after two weeks of high dietary salt, but no changes were observed in the liver. A separate study also showed similar findings; rat liver Cyp3a mRNA (Cyp3a2) was unchanged after treating animals with 3× or 6× the daily dose of sodium [Liu et al., 2003]. Interestingly, in the same report, CYP2C11 protein levels appeared to be induced in the liver, but with a concurrent decrease in protein activity [Liu et al., 2003]. The authors speculated that the increase in CYP2C11 protein expression was associated with protein stability, and/or its lack of degradation, but the expressed protein may have minimal catalytic function.
Currently, no publications exist that document NFAT5 function in rodent species with regard to
P450 regulation.
43
1.1.6 Hypertonicity and human P450 enzymes
1.1.6.1 CYP2E1:
Aside from the works conducted by our laboratory (Kosuge and Chuang et al., 2007 and Chuang
et al., 2010), the only known publication showing a direct relationship between NFAT5 and
P450 regulation was described by Ito et al., (2007). In their initial study, cDNA generated from
primary hepatocytes was measured in a microarray to assess gene induction after treatment with
hypertonic NaCl or sucrose. Results showed CYP1A1 and CYP2E1 mRNA levels were induced to greater than 2-fold compared to isotonic controls. mRNA levels of P450 isoforms including
CYP1A2, CYP2B6, CYP2C9 and CYP3A4 were further assessed by real-time RT-PCR. However, aside from CYP1A1 and CYP2E1 mRNA inductions, CYP1A2 and CYP2D6 showed a reduction
in expression, whilst others were unresponsive to hypertonic stimuli.
Using mutation and deletions in gene reporter constructs, Ito et al. (2007) discovered an active
TonE motif at position -568/-578 from the CYP2E1 transcriptional start site. In addition, NFAT5
was shown to mediate the hypertonic induction of a CYP2E1 TonE reporter through gain- and
loss-of-function assays with an NFAT5 over-expression vector and dominant negative-NFAT5.
In vitro binding assays using EMSA also confirmed NFAT5 binding to this CYP2E1 TonE.
The group proposed that the hypertonic upregulation of CYP2E1 may provide an adaptive
response to cellular stress. However, it was also stated that CYP2E1 induction may produce
44
oxidative stress that leads to hepatic pathogenesis [Gonzalez 2005]. No further data regarding
CYP2E1 and NFAT5 have been generated by this group.
1.1.6.2 CYP1A1:
CYP1A1 is mainly expressed in extrahepatic tissues, and it is responsible for metabolizing
polycyclic aromatic hydrocarbons (PAH) and heterocyclic aromatic amines/amides (HAA) [Ma
et al., 2007a]. In addition to CYP1A1’s role in PAH/HAA detoxification, oxygenation of these
molecules results in the formation of arene oxide, diolepoxide and electrophilic reactive species
that are carcinogenic [Ma et al., 2007a]. Ito et al. (2007) showed that NaCl-induced
hypertonicity (+50 mM NaCl) increased CYP1A1 mRNA levels to 4-folds and 5-folds with sucrose-induced hypertonicity (+100 mM sucrose), compared to the isotonic control in primary hepatocytes. The group also examined up to the 5kb DNA region 5’ of CYP1A1 transcriptional start site for active TonE motifs, but no active TonE was reported. The paper did not further pursue the hypertonicity upregulation of CYP1A1.
45
Section 2 Materials and Methods
Cell culture and cell lines:
Cells and cell lines. Cell lines were purchased from ATCC (American Type Culture Collection:
VA, USA). Human C2bbe1 and mouse CMT93 were grown in Dulbecco’s minimal essential medium containing 1.5 g/L sodium bicarbonate, 10 mg/L human holo-transferrin and 10% fetal
bovine serum (FBS). HepG2 and mouse hepa1c1c7 were grown in alpha MEM containing 10%
fetal bovine serum. HepaRG cells were purchased from Biopredict International (Rennes,
France) and were switched to low DMSO-containing revival medium upon arrival for 3 days,
then to high DMSO-containing medium for another 3 days prior to treatments. Human normal
colonic epithelial cells were obtained from CELPROGEN (CA, USA) and propagated in Human
Colon Complete growth medium with 10% FBS (CELPROGEN). The primary cultured
colonocytes were 95% positive for the epithelial marker, cytokeratin 19, and used for
experiments at approximately 70% confluency. Primary hepatocyte samples 1 and 3, were
purchased from Lonza (Walkersville, MD, USA); samples 2 and 7 were purchased from BD
Gentest (Woburn, MA, USA); samples 4 to 6, 8 and 9 were purchased from Celsis-IVT
(Baltimore, MD, USA); sample 10 was purchased from XenoTech (Lenexa, KS, USA). All
primary hepatocytes were maintained in hepatocyte culture medium (Lonza; HCM Bulletkit,
catalogue # CC-3198) except for sample 2, which was maintained in In VitroGRO HI Medium
(Celsis IVT catalogue#: Z99009).
Human primary colonocytes and hepatocytes. Human primary colonic epithelial cells were
obtained from 4 Caucasian male subjects ranging in age from 35 to 55 years old. (Lot #: 60749-
05; 6050-05; 6049-05; and 60750-05). Primary hepatocyte sample 1 was obtained from a healthy
46
21 year-old Caucasian male (Lot# Tan 16336); sample 2 was acquired from a healthy 32 year-
old Caucasian, sample 3 came from a 37 year-old Caucasian male with known hypertension (Lot
# Tan 17691); sample 4 originated from a 45 year-old African American male with known
hypertension [COD: CVA] (Lot# MHU-L-020709); sample 5 came from an African American
male with extensive alcohol consumption [COD: head trauma] (Lot# MHU-L-051309); sample 6
was obtained from a 66 year-old American male with a history of both alcohol and tobacco
consumption [COD:CVA] (Lot# MHU-L-071109); sample 7 came from a 5 year-old African
American male with no medical history [COD: cardiac arrest secondary to stroke] (Lot #260);
sample 8 was acquired from a 53 year-old African American with a BMI of 33.8, heavy tobacco
use and hypertension, COPD, schizophrenia, and type II diabetes [COD: anoxia] (Lot # MHU-L-
082809); sample 9 was obtained from a 40 year-old African American with heavy alcohol and
tobacco consumption, positive for CMV and a history of cirrhosis and heart attacks, [COD: ICH]
(Lot# MHU-L-101409); sample 10 came from a 50 year-old African American with no medical
history [COD: anoxia] (Lot # 946).
Cell culture treatments. Tonicity of the culture medium was increased to 350–450 mOsm/kg by
adding NaCl or sucrose to the regular medium and incubated for 24 hours unless otherwise stated. The addition of 50 mM NaCl to the regular medium increased osmolality by 100 mOsm/kg and was the set standard for hypertonic treatment in this thesis unless otherwise stated.
Glycerol was used as an osmolyte (solute) control; but it is also a tonicity-neutral substance
because it was able to cross cell membranes freely without eliciting osmotic pressure. Cell
cultures that were treated with the prototypical CYP3A inducer rifampicin were incubated at
25μM for 24 hours.
47
CYP3A5 genotyping. CYP3A5 genotyping methods were described by Kuehl et al. (2001).
PCR products representing *1 (539 bp) or *3 (670 bp) were excised from agarose gel and
purified for nested PCR. Nested PCR primers and conditions for *1 fragment are F:
5’AAAAAGTATGGAAAAATGTG and R: 5’CATAAATCCCACTGGGCCTAAAGA; 95°C–2
min, 18 cycles (94°C–30s, 60°C–30s, 72°C–30s), 5 min 72°C (147 bp product). For *3: F:
5’AAAAAGTATGGAAAAATGTG and R: 5’CATTCTTTCACTAGCACTGTTC; 95°C–2 min,
30 cycles (94°C–30s, 56°C–30s, 72°C–30s), 5 min 72°C (230 bp product). For *6 genotype, the
first round of PCR used F: 5’GGT CTC TGG AAA TTT GAC ACA G and R: TCT TCA TTC
TGT TTA CAG ATT TAC as primers; with the following PCR conditions: 95°C–2 min, 35
cycles (95°C–30s, 55°C–30s, 72°C–2 min), 5 min 72°C (458 bp product). For *6 nested PCR,
primers used were F: 5’- AAAAAGTATGGAAAAATGTG and R: 5’TAT CTT TTG GAA
ACA GAG AGA C; with the following PCR conditions: 95°C–2 min, 35 cycles (94°C–30s,
58°C–30s, 72°C–30s), 5 min 72°C (389 bp product).
In vitro experiments:
Real time PCR. Total RNA was extracted using RNeasy Kit (Qiagen). cDNA was generated
using oligo(dT)12–18 primers (Applied Biosystems) and M-MLV reverse transcriptase
(Invitrogen). The ABI 7500 Real-Time PCR system was used for real-time PCR detection and
the samples were prepared using TaqMan Universal PCR Master Mix with no UNG (Applied
Biosystems). Probes and primers were also purchased from Applied Biosystems (TaqMan Gene
Expression Assays) for all genes tested; human genes: CYP1A1 (Hs00153120_m1), CYP1A2
(Hs00167927_m1), CYP2A6 (Hs00868409_s1), CYP2B6 (Hs00167937_g1), CYP2C9
(Hs00426397_m1), CYP2C19 (Hs00426380_m1), CYP2D6 (Hs00164385_m1), CYP2E1
48
(Hs00559368_m1), CYP3A4 (Hs00430021_m1), CYP3A5 (Hs00241417_m1), CYP3A7
(Hs00426361_m1), AKR1B1 (aldose reductase) (Hs00739326_m1), SLC5A3 (sodium myo- inositol transporter: SMIT) (Hs00272857_s1), NFAT5 (Hs00232437_m1), TAT (tyrosine aminotransferase) (Hs00356930_m1), GAPDH (Hs99999905_m1), CAR (Hs00231959_m1), and
VDR(Hs00172113_m1); mouse genes: Cyp3a11 (Mm00731567_m1), Cyp3a13
(Mm0048110_m1), Cyp3a25 (Mm01221297_m1), Cyp3a16 (Mm00655824_m1), Cyp3a41
(Mm00776855_mH), Akr1b3 (aldose reductase) (Mm03047803_g1), Slc6a12 (betaine GABA transporter: BGT1) (Mm00446675_m1), Slc5a3 (sodium myo-inositol transporter: SMIT)
(Mm00444330_s1), Slc6a6 (taurine transporter: TAU-T) (Mm00436909_m1), Nfat5
(Mm01247387_m1), Nr1i2 (pregnane X receptor: PXR) (Mm00803092_m1), Tat (tyrosine aminotransferase) (Mm00455392_m1) and Gapdh (Mm99999915_g1). The primers used in
SYBR Green real-time PCR for drug transporter genes were: MDR1 (Forward 5’-cag agg gga tgg tca gtg tt; Reverse 5’-cct gac tca cca cac caa tg); BCRP (Forward 5’-ccc gtt ctg agc ttt ttc ag;
Reverse 5’- caa ggg taa ccg cag tca tt); MRP1 (Forward 5’- agg tgg acc tgt ttc gtg ac; Reverse 5’- tcc acc aga agg tga tcc tc); MRP2 (Forward 5’- tga aag gct aca agc gtc ct; Reverse 5’- tcc acc aga agg tga tcc tc); MRP3 (Forward 5’- aca tgc tgc ccc agt taa tc; Reverse 5’- cac act ctg ggg gtc aag tt); MRP4 (Forward 5’- tgt ttg atg cac acc agg at; Reverse 5’- gac aaa cat ggc aca gat gg);
OCTN1 (Forward 5’- gac cga gtg gaa tct ggt gt; Reverse 5’- tct tcc tgc caa acc tgt ct); OCTN2
(Forward 5’- ctg gtg gtt cat ccc tga gt; Reverse 5’- agt gga agg cac aac aat cc); OCT1 (Forward
5’- cct gcc tcg tca tga ttt tt; Reverse 5’- acg aat gtg ggg tac agc tc); and GAPDH (Forward 5’- caa tga ccc ctt cat tga cc; Reverse 5’- gac aag ctt ccc gtt ctc ag). The delta-delta Ct method [Livak and Schmittegen, 2001] was used to calculate the amplification difference between Ct values of target genes that were normalized to GAPDH or Gapdh values (see Data analyses and statistical
49
treatment). The measurements were done in triplicates and repeated at least three times using 50
ng of cDNA per sample. Animal samples were taken from the left liver lobe (liver), renal
medulla (kidney), or epithelia scrapings of the inner intestinal wall (duodenum).
Microsomal preparation. Microsomal fractions from the liver, kidney, and intestinal inner wall
scrapings were obtained using methods described previously [Cheung et al., 2006]. In brief,
tissue samples were homogenized in buffer A (50 mM Tris-HCl, 150 mM KCl, 20% (v/v)
glycerol, 1 mM EDTA; pH 7.4) and centrifuged at 20,000g for 20 minutes at 4 °C. The
supernatant was spun at 100,000g for 1 hour at 4 °C. The microsomal pellet was then
resuspended in the storage buffer (100mM Tris, 0.1M EDTA, 0.1M DTT, 1.15% w/v KCl, 20%
v/v glycerol; pH 7.4).
Immunoblot. C2bbe1, HepG2 and primary hepatocytes were lysed in RIPA buffer and centrifuged at 12,000 RPM for 20 minutes at 4 °C. 50 μg of protein lysates were loaded onto a
4–12% Bis-Tris Gel (Invitrogen, NuPAGE) and resolved. Primary antibody staining was
performed at 1:500 dilution using CYP3A antibody (recognizes all three major CYP3A isoforms;
Research Diagnostics cat# RDICYP3A4abr), β-Actin (HepG2; Santa-Cruz, cat# SC-1616) and
GAPDH (primary hepatocytes; Abcam cat#ab9485). Secondary antibody staining with respective hosts conjugated with horse radish peroxidise (HRP) was performed at 1:1000 dilution (Santa-
Cruz, cat# SC-2004 and SC-2020). For the animal studies, 40 μg of microsomal protein was incubated with 1:1000 dilution of anti-human CYP3A antibody and mouse anti-mouse Gapdh
(Santa-Cruz, cat# SC-59540). Secondary antibody staining with respective hosts conjugated with
HRP was conducted at 1:1000 dilution (Sigma Anti-rabbit IgG, A-0545; Abcam, goat anti-mouse
IgG + IgM, cat# ab47827-250). Visualization was conducted using ECL Western Blotting
Detection Reagents.
50
CYP3A activity assay. The P450-Glo Assay with the specific CYP3A substrates luciferin-PFBE
and luciferin-IPA were kind gifts from Promega (Promega, Cat#V8902, Cat#V9001). In HepG2
cells, CYP3A protein activity measurements were conducted using luciferin-PFBE in the cell-
based approach as instructed. In the animal studies, 20μg of microsomal protein was used with
luciferin-IPA using the biochemical assay approach. A single tube luminometer was used to
measure the relative light units (RLUs) generated by luciferin. Results were expressed as fold-
induction to control/baseline samples, with n values stated for each experiment.
Expression plasmids, siRNA and reporter constructs. NFAT5 expression plasmid was made
from the KIAA0827 clone (a gift from Dr. Nagase, Kazusa Institute, Japan), by digestion with
NotI and XhoI, and ligation into pTARGET (Invitrogen). Human PXR expression plasmid (pEF- hPXR: [Tirona et al., 2003]) was kindly provided by Dr. Kim (University of Western Ontario).
Dominant negative NFAT5Δ1-156, which lacked the first 156 amino acids, was derived by in-
frame insertion of KIAA0827 cDNA corresponding to amino acid residues 157–581 into NotI
and BamHI restriction sites of pFLAG-CMV-2 mammalian expression vector (Sigma, St. Louis,
MO) as reported [Tong et al., 2006]. This region of NFAT5 was shown to function in a dominant
negative manner when expressed in transgenic mice [Lam et al., 2004; Wang et al., 2005]. Small
interfering RNA (siRNA) against NFAT5 was prepared as described by Na et al (2003); we
synthesized siRNA569R [Na et al., 2003] that targeted exon 5 of NFAT5. This siRNA569R was
reported to show specific reduction of NFAT5 protein in HeLa cells [Na et al., 2003]. The negative control siRNA for siRNA659R was an inverted sequence of 569R (siRNAinv569R). In separate experiments, we used a mixture of 4 siRNAs against NFAT5 (Dharmacon SMARTpool: cat #M-009618-01; Thermo Fisher Scientific, Lafayette, CO, USA) or control non-targeting mismatch siRNA (cat #D-001206-13). 51
CYP3A7[-9302/+53] and CYP3A4[-10466/+53] plasmids [Bertilsson et al., 2001] were kindly provided
by Dr. Blomquist (Karolinska Institute). The CYP3A7 promoter fragment encompassing -
370/+55 of the transcription start site was cloned by PCR from the CYP3A7[-9302/+53] plasmid using cloning primers (forward 5'-tcc gct agc gca cac tcc agg cat agg taa-3'; reverse 5'-cat gga tcc tgc tgc tgt ttg ctg ggc tgt-3'). Similarly, the 478-bp CYP3A4 promoter plasmid from -424 to +54 of the transcription start site was generated from the CYP3A4[-10466/+53] plasmid (forward 5'- aca
gct agc ctg ggt ttg gaa gga tgt gt-3'; reverse 5'- cat gga tcc tgt tgc tct ttg ctg ggc tat gt-3'). These
promoter fragments introduced a NheI and a BamHI restriction site at the 5’- and 3’-end,
respectively, and were inserted into the NheI and BglII sites of the pGL3-Basic luciferase
reporter gene vector, thereby destroying the 3’- restriction site [Goodwin et al., 1999] for
subsequent reporter constructs. The 737-bp CYP3A5 promoter fragment (-688/+49 from the
transcription start site) [Burk et al., 2004a] was generated from C2bbe1 genomic DNA using
cloning primers (forward 5'- aca gct agc aga tct atc acc aca gag tca gag ggg atg-3'; reverse 5'- cat
gga tcc gct gtt tgc tgg gct gtt tgc ctg g-3'), and this introduced a NheI - BglII tandem restriction
site at the 5’-end, and BamHI site at the 3’-end. This too, was similarly inserted into the NheI and
BglII sites of the pGL3-Basic vector. The BglII digest sequence in the tandem restriction site was
used as the CYP3A5 promoter-driven constructs.
The fragments of CYP3A7 intron 2 for the deletion/mutation assays were made by PCR from
genomic DNA of C2bbe1 cells using the following primers: backbone CYP3A7[+4910/+5590]
(Forward 5'-tcg gta cca ggc aga atc aca tgc aaa a-3'; Reverse 5'-gaa gat ctt gag caa tct tac gac att cca-3'), CYP3A7[+4910/+5204] (Forward 5'- tcg gta cca ggc aga atc aca tgc aaa a-3'; Reverse 5'-gaa
gat ctc aac aaa gcc ctc act tag ga-3'), CYP3A7[+4910/+5453] (Forward 5'-tcg gta cca ggc aga atc aca
tgc aaa a-3'; Reverse 5'-gaa gat ctc tga caa tgg ata acc acc tta act-3'), CYP3A7[+4910/+5453]mutant 52
(Forward 5'-tcg gta cca ggc aga atc aca tgc aaa a-3'; Reverse 5'-gaa gat ctc tga caa tgg ata acc acc
ttt aac tTt Tac ttt cca-3', where “T” indicates mutation to thymine), the backbone reverse
CYP3A7[+4910/+5590]reverse (5'-gaa gat cta ggc aga atc aca tgc aaa a-3' / 5'-tcg gta cct gag caa tct tac
gac att cca-3') and CYP3A7[+5088/+5590]: (Forward 5'- tcg gta cca gct tat ttc cac agg gcc a -3';
Reverse 5'- gaa gat ctt gag caa tct tac gac att cca -3'). These fragments were inserted into KpnI and BglII sites of the CYP3A promoter-driven reporter plasmids (see above). The fragment of
CYP3A7[+4910/+5590]3’position was made using primers (Forward: 5'-ttc gga tcc agg cag aat cac atg
caa aa-3'; reverse: 5'-ctc gtc gac tga gca atc tta cga cat tcc a-3'). This was inserted into the BamHI
and SalI sites of the reporter. Other reporter constructs were made using a similar approach and
inserted into the appropriate restriction sites in luciferase reporters containing either CYP3A or
SV40 minimal promoter. All constructs and their inserts were confirmed via DNA sequencing
(TCAG DNA sequencing facility, Hospital for Sick Children).
Transient transfection and luciferase-based reporter assay. Cells were seeded in 6-well
plates at 0.5 × 106 cells/well. After 48 hours, cells were transfected with 0.3–0.5 μg of the firefly luciferase reporter plasmids and 0.08–0.2 μg pRL-TK plasmids (Promega, Madison, WI, U.S.A.) containing a Renilla luciferase gene by Lipofectamin 2000 (Invitrogen) in Opti-MEM (Gibco).
In some experiments, cells were cotransfected with an NFAT5 expression vector, hPXR expression vector (pEF-hPXR: Tirona et al., 2003), siRNA against NFAT5 (siRNA569R and
siRNAinv569R: Na et al., 2003), gene-specific siRNAs (SMARTpool NFAT5: Dharmacon), the dominant negative NFAT5, or empty expression plasmids. At 24 to 48 hours post-transfection, cells were incubated in various experimental conditions for another 16 to 24 hours unless otherwise stated. SMARTpool NFAT5 siRNA experiments were conducted using the following steps. Overnight-seeded HepG2 cells at 50% confluence were transfected for 48 hours with 32.5 53
nM siRNA against NFAT5 (siNFAT5), or equal molar mismatched siRNA controls. These
siRNAs were suspended in liposome carrier Dharmafect 1,2,3,4 transfection reagent
(Dharmacon) at 0.1 µL/nM siRNA concentration in serum-free Opti-MEM (Invitrogen).
Luciferase activities of the cell extracts were determined using the Dual-Luciferase Reporter
Assay System (Promega). Relative luciferase activity was calculated as observed relative light
units from firefly luciferase normalized to Renilla luciferase values, and expressed as ratios to its
minimal promoter constructs under isotonic conditions unless otherwise stated. In some
experiments, the ratios were further normalized to those of the respective reporter in isotonic
condition. All experiments were done in triplicate and repeated at least three times.
Electrophoretic mobility shift assay (EMSA). After a 4-hour hypertonic treatment (+50mM
NaCl), nuclear extracts were prepared from confluent C2bbe1 cells using the Nuclear Extraction
Kit (Panomics) according to the manufacturer’s instructions. EMSA was performed using the
LightShift Chemiluminescent EMSA kit (Pierce) with modifications. 0.5 pmol of the 27bp
5’biotinylated probe (+5409/+5435 from CYP3A7 transcriptional start site) was used to detect
protein/DNA interaction with a 100-, 200-, or 400-fold increase of competitor (unbiotinylated) or
mutant (tAAaGagA-aG; capitalized letters represent base pair changes and the dash represent a
1-bp deletion from the original “tggaaagttac”) probes. NFAT5 antibody used for the supershift lane was obtained from Affinity Bioreagents at a concentration of 2.5 µL/reaction. The binding reaction consisted of 10 µg of nuclear extract, 1× binding buffer, 2 µg of poly dI·dC, 3 µg of random primers (Invitrogen), 5 mM MgCl2, 0.05% NP40, and 1 pmol of biotinylated probe, with
or without the stated amount of competitor or mutant probes, or NFAT5 antibody at a final
volume of 10 µL. The incubation period was 40 minutes at room temperature for all reactions.
54
The 6% PAGE was allowed to run for 2 hours before its transfer to the nylon membrane and UV
crosslinking (Ultraviolet Crosslinker, UVP). Protein band detection was conducted by
chemiluminescence according to manufacturer’s instructions.
Chromatin immunoprecipitation (ChIP). The ChIP assay was done using the ChIP kit
(Upstate Cell Signalling Solutions: NY, USA). Briefly, C2bbe1 cells were incubated under a
NaCl-induced hypertonic condition (400 mOsm/kg) for 16 hours and proteins cross-linked to
DNA by 1% formaldehyde for 10 minutes at 37 °C. Cells were lysed in SDS and sonicated with
a probe sonicator to obtain sheared DNA fragments that ranged from 200 to 1,000 bps. A 200 µL aliquot was taken for reverse-crosslinking with 8µL of 5M NaCl, and DNA was isolated by phenol/chloroform extraction and ethanol precipitation. This 1% of fraction was used as the input control. Sample aliquots of 200 µL were diluted with the ChIP dilution buffer and incubated with salmon sperm DNA/protein A agarose beads for 1 hour at 4 ºC to remove non-specific DNA binding that was present on the beads. After a spin down, the supernatant was incubated with 2
µL (1:500) rabbit polyclonal IgG NFAT5 antibody (SC-13035X: SantaCruz, CA, USA),
CYP1A1 antibody (SC-20772: SantaCruz, CA, USA), or no antibody control at 4 ºC overnight, and fresh beads (60 µL) were added with agitation at 4 ºC for 1 hour. The beads were washed twice according to the buffer systems supplied in the kit, and the protein/DNA complex was eluted with 250 µL elution buffer (1% SDS, 0.1 M NaHCO3) with 200 µL supernatant collected
after gentle shaking for 30 minutes at room temperature. This step was repeated twice to obtain a
total of 400 µL of eluted samples. The samples were reverse-crosslinked with 20 µL of 5 M
NaCl for > 4 hours at 65 ºC and treated with proteinase K. DNA was extracted as above and
resuspended in 100 µL DEPC water for PCR. All PCR reactions were done in a 50 µL reaction
mix using Mastercycler (Eppendorf) with 1% template (1µL). All PCR conditions were as 55
follows (95 ºC, 2 min); (95 ºC; 45 sec, 60 ºC; 1 min, 72 ºC; 30 sec) × 40 cycles; (72 ºC; 2 min) except for NFAT5 coding region (annealing temperature at 55 ºC; 1 min). The CYP3A7 intron 2
TonE regions were assessed as fragment A and fragment B. Fragment A contained a non- responsive antisense TonE motif +4688/+4698, whereas Fragment B included a sense TonE
+5417/+5427. The primers for Fragment A (288-bp) were: forward, 5’– gtc att tgc acc tgc ttg aa; and reverse, 5’– tgc atg tga ttc tgc ctt tg. The primers for Fragment B (271-bp) were: forward,
5’– aac agg ctt tgt gtg agc aa; and reverse, 5’– atg act tgt tcc tgc cct gt. For the positive control, we detected a 194-bp PCR product of the SMIT promoter that contained an active TonE sequence at -21622/-21611 from the start site. This site was originally characterized as TonEp
[Rim et al., 1998]. The primers used for SMIT-TonEp site were: forward 5’- cgc gaa ggt ccc tag ctc; reverse 5’- gac cct gcc tgc ccc tac. An NFAT5 coding region (exon 14: the third terminal exon lacking a TonE motif) was used as the null-TonE PCR control [Lopez-Rodriguez et al.,
2001] with the following primers: forward, 5’ gtt gcc atg cag agt aac tct and reverse 5’ cat tgg att ttg att ggg ttg aat atc ctg for an 180-bp product.
Immunohistochemistry. HepG2, hepa1c1c7 and CMT93 cells were seeded onto poly-L-lysine coated cover-slips and subjected to hypertonic treatment (+50 mM NaCl) for 24 hours. Cells were fixed in 3% paraformaldehyde and then permeabilized with 0.25% Triton X-100. NFAT5 antibodies (Affinity BioReagents, cat# PA1-023 for HepG2, and Santa Cruz, cat# sc-13035X for
hepa1c1c7) were used at 1:500 dilution followed by donkey anti-rabbit antibody conjugated to
CY3 (Jackson ImmunoResearch Laboratories, cat# 711-165-152) at 1:400 dilution. For animal
studies, tissues were embedded in paraffin and cut into 5 μm slices. Antigen retrieval was performed in retrieval buffer (10 mM Tris Base, 1mM EDTA, 0.05% Tween 20, pH 9) and microwaved using a 1250 watt microwave: on high setting for 10 minutes and medium setting 56
for 15 minutes (liver), 10 minutes on high and 8 minutes on medium (kidney), and 10 minutes on high setting (duodenum). Samples were then placed in a blocking buffer (4% donkey serum with
0.3% TritonX in PBS; with additional 0.5% BSA for intestine slices), incubated with NFAT5 antibody (Santa Cruz, cat# sc-13035X) and then in secondary antibody at 1:400 dilution. For intestinal slices, primary antibody used was goat anti-mouse SGLT-1 (glucose transporter, an apical membrane marker; Santa Cruz, cat# sc-20581) at 1:300 dilution, followed by secondary antibody donkey anti-goat IgG conjugated to conjugated to Alexa Fluor 488 (Invitrogen, molecular probes, cat #A11055) also at 1:300 dilution. Nuclear staining was conducted using
ProLong Gold Antifade Reagent with DAPI (Molecular Probes, cat# P36935). All images were taken using a Zeiss confocal laser microscope.
In vivo mouse experiment.
The CYP3A4/CYP3A7-humanized transgenic mouse. Embryos of CYP3A4/CYP3A7- humanized transgenic mice with a C57/BL6 background [Cheung et al., 2006] were obtained from the National Institutes of Health (courtesy of Dr. Frank Gonzalez), and re-derived by surrogate at the Toronto Centre for Phenogenomics, Toronto, Canada. These re-derived transgenic mice were examined via tail clipping and analyzed for human transgene using real- time RT-PCR. This CYP3A4/CYP3A7-humanized transgenic mouse model contained linear
DNA starting from 35 kilobases 5’ of the CYP3A4 transcriptional start site to 9 kilobases 3’ of the CYP3A7 transcriptional termination site. This fragment also included a previously identified human CYP3A TonE motif [Kosuge and Chuang et al., 2007], which was located in intron 2 of
CYP3A7, and considered to be an appropriate mouse model for in vivo experiments. The
CYP3A4/CYP3A7-humanized mouse model showed developmental expression patterns of the
57
transgenes consistent with the in vivo human development, switching from fetal expression of
CYP3A7 to postnatal CYP3A4 expression. Secondly, sexual dimorphism was observed in these animals where CYP3A4 expression was higher in females than males approximately after 6 weeks of age [Cheung et al., 2006]. Tissue-dependent patterns of transgene expression were similar to those of humans (i.e., liver > intestine > kidney).
Animal care and experiments were conducted in accordance with the guideline of the Canadian
Council on Animal Care, and approved by the animal care committees at the Hospital for Sick
Children and the Toronto Centre for Phenogenomics (Toronto, Ontario, Canada). Mice were housed under controlled temperature of 23 °C with 12 hour lighting cycles, fed ad lib with a standard animal chow and clean water. The 8–10 week-old mice were subjected to acute plasma hypertonicity, or cyclic water-deprivation treatments, as described below.
Acute plasma hypertonicity. Mice received an intra-peritoneal (IP) injection of 2 M sucrose solution (hypertonic group), or water (water control group) at 2.0 mL/100g body weight, and they were subsequently water-deprived (modified from a protocol described in Loyher et al.
2004). This IP administration of hypertonic sucrose solution caused a fluid shift from the intravascular compartments to the peritoneal cavity, resulting in plasma hypertonicity. Another animal group received the same volume of isotonic PBS as the isotonic control. After more than
6 hours of water and food deprivation, the animals were killed by cervical dislocation, and tissues including blood were removed for endpoint measurements.
Cyclic water-deprivation. To comply with widely-accepted guidelines of animal welfare, which stipulate a maximum period of 24 hours of consecutive water deprivation, we developed a week- long intermittent water-deprivation approach. Briefly, the cyclic water-deprivation experiments comprised 24 hours of water deprivation followed by 24 hours water ad lib; this regimen was
58
repeated every 48 hours for 7 days. During the 7-day experiment, mice underwent four 24-hour
water-deprivation periods (food ad lib) alternating with three 24-hour water ad lib periods.
Immediately after the fourth 24-hour water deprivation (Day 8), mice were killed by cervical
dislocation, and blood and tissues were removed for analysis.
Acute intestinal hypertonicity. Mice received water or hyperosmolar sucrose solution (200 g/L
solution [584 mOsm/kg]; given at 1 mL/100g body weight) via gavage with a ball-ended feeding
needle. They were fed every 4 hours (3 times total) with animals sacrificed at the 12-hour mark.
High-salt diets. Animals under dietary treatments experienced either a low-salt (sodium
deficient diet; TD.90228; Harlan Laboratories: Teklad lab animal diets), normal-salt (0.49%
NaCl; TD.96208), or high-salt (8% NaCl; TD.92012) diet. After one week of their respective
diets, mice were killed by cervical dislocation, and tissues were removed for further analysis.
Phenobarbital-induced transgene expression. Phenobarbital was administered by IP injection at 60 mg/kg/day for two days. This experiment was aimed at confirming CYP3A induction by a chemical stimulus in re-derived animals and their colonies.
Osmolality measurement. Plasma and urinary osmolality were measured using a freezing point osmometer at the Department of Paediatric Laboratory Medicine, The Hospital for Sick
Children, Toronto, Canada.
Data analyses and statistical treatment. Slc6a12 (Bgt1) was used as a surrogate marker for hypertonicity-induced NFAT5 activation for in vivo experiments. Other NFAT5 target genes and their collective expression profiles were also taken into account when data were interpreted.
Because of the sexual dimorphism in the human CYP3A4 expression in this mouse model, fold- change values were derived separately in the female and male mice. mRNA expression levels derived as Ct values standardized to GAPDH/Gapdh were analysed using delta-delta Ct method,
59
with mean delta Ct values of respective genes in the water ad-lib control group as a reference standard. Outliers were removed by using the Grubb’s test (α = 0.05) and the results were compared between treatment and control by means of unpaired Student t-test (SigmaStat v3.11 software). The values were expressed as fold changes from the control group, and shown as mean and standard error. A P-value of < 0.05 was considered significant.
60
Section 3 Results:
3.1 In vitro human CYP3A induction by hypertonicity
3.1.1 Expression of human CYP3A in the human intestinal carcinoma cell line C2bbe1:
The impact of hypertonicity on human CYP3A expression was examined in the intestinal
carcinoma cell line C2bbe1, a subclone of Caco-2, which exhibits homogenous brush border
epithelial characteristics [Peterson et al., 1992]. This cell model was chosen to assess the
potential of food-related alterations in intestinal CYP3A expression and function. Hypertonicity
was achieved by adding 50 mM NaCl to the culture medium, raising ambient osmolality from
300 mOsm/kg to 400 mOsm/kg. An increase in CYP3A mRNA (CYP3A4, CYP3A5 and CYP3A7)
could be detected as early as 4 hours after hypertonic treatment, reaching greater than 10-fold
after 12 hours (Figure 3.1.1.1). The established hypertonicity-responsive gene SLC5A3 (SMIT;
sodium myo-inositol transporter) [Yamauchi et al., 1993 and Rim et al., 1998] also increased
with hypertonic treatment, reaching ~5-fold after 4 hours of exposure. mRNA levels of CYP3A
isoforms remained elevated even after 48 hours of prolonged hypertonicity; but further
experiments suggested these observations were not attributable to mRNA stability because NaCl-
treated samples showed a gradual decrease in CYP3A mRNA levels in the presence actinomycin
D (Appendix 3.1.1.A). (Note: the relative baseline mRNA levels of CYP3A isoforms were
roughly 1:3:0.5 [CYP3A4/ CYP3A5/ CYP3A7] in C2bbe1 cells).
Other solutes, such as sucrose and glycerol also increase the osmolality of the treatment medium.
Glycerol however, is a tonicity-neutral substance because it readily penetrates cell membranes and does not create a concentration gradient that would result in net water movement. Figure
3.1.1.2 shows an osmolality-dependent (300 to 450 mOsm/kg) increase of CYP3A gene 61
transcripts by NaCl (open square) and sucrose (closed square), but not by glycerol (shaded square). The magnitude of induction of CYP3A mRNA transcripts appears to be higher using sucrose compared with NaCl with the same osmolality values. Sucrose is a disaccharide composed of glucose and fructose, and it is typically hydrolyzed by sucrase that is highly expressed in the epithelial cells of the duodenum. It is possible that C2bbe1 cells may break down sucrose to create a differential osmotic environment compared to an equal osmolar of sodium chloride. Finally, de novo protein synthesis was observed after 4 hours of hypertonic treatment (Figure 3.1.1.3).
62
Figure 3.1.1.1 Hypertonicity induces CYP3A mRNA expression in intestinal cells. C2bbe1 cells were cultured under hypertonic conditions (400 mOsm/kg), and mRNA levels of CYP3A4 (closed circle), CYP3A7 (open circle), CYP3A5 (open square), SMIT (closed square), and NFAT5 (open triangle) were measured using real‐time RT‐PCR. Results are normalized to respective GAPDH levels, and expressed as ratios to the value at time 0 for each gene (mean ± S.E.M., N=3). [Republished from Kosuge and Chuang et al. (2007) with permission from the publisher].
63
Figure 3.1.1.2 Osmolality‐dependent induction of CYP3A mRNA expression in intestinal cells.
C2bbe1 cells were treated for 24 hours in medium of increasing osmolality using NaCl (open square), sucrose (black square), or glycerol (shaded square). mRNA levels were measured using real‐time RT‐PCR. GAPDH‐standardized results are expressed as ratios to each respective isotonic condition (mean ± S.E.M., N = 3). [Republished from Kosuge and Chuang et al. (2007) with permission from the publisher].
64
Figure 3.1.1.3 Time‐dependent expression of CYP3A proteins with hypertonicity. C2bbe1 cells were incubated with regular medium or hypertonic medium (+50 mM NaCl) for the indicated periods. Cell lysates were obtained and immunoblot was performed. [Republished from Kosuge and Chuang et al. (2007), with permission from the publisher].
.
65
3.1.2 Expression of human CYP3A in the human hepatocellular carcinoma cell line
HepG2:
The effects of hypertonicity on CYP3A expression were also examined in the hepato-carcinoma line HepG2, to evaluate whether the same phenomenon could be observed in other cell types.
Treating the cells for 24 hours in hypertonic medium (400 mOsm/kg) increased CYP3A mRNA transcripts 15- to 20-fold from baseline values (Figure 3.1.2.1). A large, 50-fold response in mRNA levels for SMIT was also observed. An increase in the overall CYP3A protein expression was also detected (Figure 3.1.2.2).
Figure 3.1.2.1 Hypertonicity induces CYP3A mRNA expression in hepatic cell line. HepG2 cells were cultured under hypertonic conditions (400 mOsm/kg), and mRNA levels were measured using real‐time RT‐PCR. Results are normalized to respective GAPDH levels, and expressed as ratios to isotonic conditions (mean ± S.E.M., N = 3, *P < 0.05).
66
Figure 3.1.2.2 Induction of hepatic CYP3A proteins with hypertonicity. HepG2 cells were either incubated with regular medium or hypertonic medium (+50 mM NaCl) for 24 hours. Cell lysates were obtained and immunoblot was performed.
In addition to increased protein expression, HepG2 cells treated with hypertonic medium for 24 hours showed a strong increase in CYP3A protein activity, of ~4-fold (Figure 3.1.2.3). HepG2 cells were also treated with rifampicin with a PXR expression vector as an induction control.
However, this expression system reached a mere 2-fold increase in protein activity, and this apparent lack of increase may be attributed to the lowered expression levels of CYP3A transcriptional regulators in cells under prolonged culture [Rodriguez-Antona et al., 2002].
Nevertheless, these results showed hypertonicity increased CYP3A expression in intestine and liver cell lines.
67
Figure 3.1.2.3 Hypertonicity induces CYP3A protein activity in HepG2 cells. CYP3A activity of untreated (isotonic; iso) and treated (+50mM NaCl; hyper) for 24 hours in HepG2 cells were measured using the P450 Glo assay with Luciferin‐PFBE using the cell‐based approach (Promega). As a control for this assay, HepG2 cells were transfected with a PXR expression vector and treated with the PXR agonist rifampicin (Rif; 25μM) for 24 hours. Results are expressed as mean fold induction to untreated controls with empty vector (mean ± S.E.M., N = 3, *P < 0.05).
68
3.1.3 Expression of CYP3A in human primary colonocytes and primary hepatocytes:
Further examination of hypertonicity induction of CYP3A expression was conducted in primary human intestinal and hepatic cells. Hypertonic treatment caused an increase in expression levels of CYP3A4 and CYP3A7 mRNA (12.5 ± 2.5-fold, P=0.04 and 9.3 ± 0.6, P=0.005, respectively) in primary intestinal cells, while SMIT and NFAT5 also showed statistical significant increase
(4.1 ± 0.3-fold, p = 0.008 and 1.8 ± 0.1-fold, p = 0.008, respectively) (Figure 3.1.3.1). In primary hepatocytes, however, CYP3A4 did not show significant expression changes, while
CYP3A5 and CYP3A7 expression were moderately increased (Figure 3.1.3.2; 2.1 ± 0.3-fold with P < 0.01 and 3.6 ± 0.9-fold with P < 0.001, respectively). The tonicity-responsive genes
SLC5A3 (SMIT) and AKR1B1 (aldose reductase) [Ko et al., 1997] showed a strong induction of
4.9 ± 0.9-fold and 13.7 ± 2.5-fold in mRNA levels, respectively (Figure 3.1.3.2).
The response of other cytochrome P450 enzymes to hypertonicity was assessed for CYP1A2,
CYP2C9, CYP2C19, and CYP2E1. Only the previously reported tonicity-responsive CYP2E1 [Ito et al., 2007] was elevated after hypertonic treatment (Figure 3.1.3.2). The donor demographics of the human primary hepatocytes are shown in Appendix 3.1.3.A.
The combined results in Section 3.1 suggest hypertonicity can induce in vitro human CYP3A expression. A possible explanation for the mechanism of hypertonic-induction of CYP3A will be offered in the next section.
69
Figure 3.1.3.1 Hypertonicity induced CYP3A mRNA in human primary intestinal cells. Primary colonic cells were incubated for 24 hours in hypertonic medium (+50 mM NaCl) and mRNA were measured using real‐time PCR. Results are normalized to GAPDH levels, and expressed as ratios to isotonic conditions for each gene (mean ± S.E.M., N = 3, *P < 0.05, **P < 0.01). [Redrawn and analyzed by Andrew Chuang from data collected in Kosuge and Chuang et al. (2007), with permission from the publisher].
70
.
Figure 3.1.3.2 Human CYP3A5 and CYP3A7 mRNA are induced by hypertonicity in human primary hepatocytes. Fresh, primary human hepatocytes were subjected to 24 hours of hypertonic treatment by the addition of 50 mM NaCl to the culture medium. mRNA levels of AKR1b1, SLC5A3, CYP3A4, CYP3A5, CYP3A7, and other P450 enzymes were determined using real‐time PCR. Results are normalized with GAPDH expression and expressed as fold induction relative to untreated/isotonic conditions for each gene (mean ± S.E.M., N = 10, *P < 0.05, **P < 0.01, ***P < 0.001).
71
3.2 NFAT5 regulates CYP3A induction in vitro under hypertonicity.
3.2.1 NFAT5 activation in human cell cultures under hypertonicity:
The increase in CYP3A mRNA transcripts by hypertonicity appears to be a transcriptional
upregulation event because CYP3A mRNA levels were unchanged in samples, with or without
hypertonicity in the presence of actinomycin D (Appendix 3.1.1.A). The nuclear factor of
activated T-cells 5 (NFAT5, also known as tonicity enhancer binding protein, TonEBP) is the
only known transcription factor that responds to tonicity changes [Maouyo et al., 2002]. Osmotic
stress (i.e., hypertonicity) activates NFAT5 by exposing an active monopartite nuclear
localization signal (NLS) responsible for NFAT5 nuclear translocation [Tong et al., 2006]. After
NFAT5 enters the nucleus, it binds to its cognate DNA element (TonE; Tonicity enhancer). The
steady-state level of NFAT5 in the nucleus depends on the rate of its nuclear exportation and
importation. Even under isotonic conditions, NFAT5 is present in the nucleus. The nuclear
export of NFAT5 is mediated by a CRM1-dependent (nuclear export receptor exportin-1) nuclear
export signal (NES) [Tong et al., 2006].
In C2bbe1 cells, NFAT5 distribution in isotonic conditions obscured the cytoplasm-nuclear
boundaries, whereas hypertonic treatment resulted in demarcation patterns that were likely and
consistent with nuclear compartments. However, no specific nuclear marker was used in these
experiments [Kosuge and Chuang et al. (2007) and Appendix 3.2.1.A]. In HepG2 cells, which also respond to ambient tonicity changes in a similar manner to C2bbe1 cells, nuclear-cytoplasm
distribution of NFAT5 (red) was demonstrated under isotonic conditions. NFAT5 activation was confirmed by its dominant nuclear dispersion and co-localizing with the DAPI stain (blue) under hypertonic conditions (Figure 3.2.1.1).
72
Figure 3.2.1.1 Hypertonicity causes NFAT5 nuclear translocation in HepG2 cells. HepG2 cells were fixed, incubated with the NFAT5 antibody, and visualized with Cy3‐conjugated anti‐rabbit IgG after a 24‐hour treatment with isotonic or hypertonic medium (400 mOsmol/kg). DAPI (blue) was used as a nuclear counter stain. Images were taken using a Zeiss confocal laser microscope.
73
3.2.2 NFAT5 mediates CYP3A induction by hypertonicity:
CYP3A enzymes are regulated by several well-known nuclear receptors, such as: PXR, CAR,
and VDR. These nuclear receptors also modulate the expression of other phase II and phase III
genes in the xenobiotic detoxification system. For example, PXR modulates CYP3A expression by binding to the ER6 site in the proximal region of CYP3A promoters, and to the PXRE site in the distal XREM [Gibson et al., 2002]. In addition, PXR also regulates the expression of several
MDR and MRP drug transporters [Tompkins et al., 2007]. In addition, VDR also modulate
MDR1 expression through binding to DR3 and DR4 sites ~8kb upstream of the MDR1 promoter
[Saeki et al., 2008]
To determine whether known nuclear receptors may be involved in the hypertonicity-mediated upregulation of CYP3A genes, we assessed the mRNA levels of various nuclear receptor target genes. Figure 3.2.2.1 shows the changes in mRNA levels of drug transporters in the MDR, MRP,
OCT and OCTN families. Compared with the mRNA levels of the known tonicity-responsive
gene SMIT (4.3±0.6-folds, p=0.02), hypertonicity caused only marginal changes, if any, in the expression of these nuclear receptor target transporters. OCT1 mRNA levels showed a weak increase of 1.5±0.13-fold with p=0.04 under the hypertonic treatment compared to the isotonic gene control. However, the weak p-value may suggest the presence of a type I error which occurs during multiple comparisons. Nevertheless, the lack of response of nuclear receptor target genes suggests regulatory nuclear receptors themselves are not functionally activated by NaCl- induced hypertonicity.
74
Figure 3.2.2.1 mRNA expression of intestinal xenobiotics transporters upon hypertonicity
challenges. C2bbe1 cells were incubated in hypertonic conditions for 24 hours, and mRNA levels were quantified using real‐time RT‐PCR. GAPDH‐standardized results are expressed as ratios to its respective isotonic gene control (mean ± S.E.M., N = 3, *p < 0.05). [Redrawn and analyzed by Andrew Chuang from data collected in Kosuge and Chuang et al. (2007), with permission from the publisher].
75
To further our investigation of NFAT5-dependent CYP3A expression, we examined the response
of C2bbe1 cells transfected with an NFAT5 expression plasmid (Figure 3.2.2.2). CYP3A and
SMIT showed an increasing trend of mRNA expression with isotonic + NFAT5, hypertonic +
empty vector and hypertonic + NFAT5, compared to the isotonic + empty vector (Figure
3.2.2.2). The lack of CYP3A and SMIT mRNA increase under isotonic + NFAT5 conditions may
be attributed to large variations for the relatively small sample size. However, comparing
CYP3A4 mRNA levels under the hypertonic + empty vector against the hypertonic + NFAT5
condition, it can be shown that the presence of NFAT5 augmented the hypertonic response
(P<0.05). Finally, hypertonicity or NFAT5 transfection did not produce appreciable changes in
PXR and CAR mRNA levels. These observations suggest PXR and CAR are not direct NFAT5 target genes.
76
Figure 3.2.2.2 NFAT5 and tonicity‐responsiveness of CYP3A, SMIT, NFAT5, PXR and CAR
mRNA. C2bbe1 cells were transfected with pTARGET empty vector or NFAT5‐pTARGET in regular isotonic (iso, 300 mOsmol/kg) or hypertonic (hyper, 400 mOsmol/kg) medium for 24 hours. mRNA was extracted and measured using real‐time RT‐PCR. Results are normalized to individual GAPDH and expressed as ratios to those of isotonic conditions with pTARGET empty vector for each gene (mean ± S.E.M., N = 4, *p < 0.05 and **p < 0.01 compared to isotonic + empty pTARGET, #p < 0.05 comparing hypertonic + NFAT5‐pTARGET against hypertonic + empty pTARGET). [Redrawn and analyzed by Andrew Chuang from data collected in Kosuge and Chuang et al. (2007), with permission from the publisher]. 77
We further characterized the involvement of NFAT5 in CYP3A mRNA expression by utilizing a loss-of-function assay with siRNA. Two siRNA experiments were conducted; using a pooled combination of four different siRNA against NFAT5 (siNFAT5: Dharmacon SMARTpool: cat
#M-009618-01), and with a single NFAT5 siRNA (siRNA560R against NFAT5; Na et al. (2003)).
Because optimal conditions for C2bbe1 cells were not possible in these experiments, HepG2 cells
were used as substitutes. siRNA-mediated knockdown of NFAT5 was approximately >80% for
pooled siNFAT5 (Appendix 3.2.2.A). NFAT5 knockdown caused a significant reduction in
isotonic mRNA expression levels of CYP3A isoforms (p < 0.01) and decreased the magnitude of
induction of CYP3A mRNA by hypertonic induction (Figure 3.2.2.3). Although the isotonic and
hypertonic reduction of CYP3A mRNA was greater for the pooled siRNA method (siNFAT5), a
similar trend was observed using the siRNA560R approach (Figure 3.2.2.3, inset). These results
show that human CYP3A expression is influenced by a tonicity-driven mechanism, possibly involving NFAT5.
78
Figure 3.2.2.3. Effects of NFAT5 knockdown with siRNA on CYP3A and SMIT mRNA in HepG2 cells. HepG2 cells were treated with siRNA NFAT5 (siNFAT5) or control (mismatched non‐target siRNA) for 48 hours, and incubated for another 16 hours with isotonic or NaCl‐induced hypertonic medium. Results are standardized to respective GAPDH levels, and expressed as ratios to the value of each gene in cells transfected with mismatched non‐target siRNAs under isotonic conditions (broken line) and shown as mean ± S.E.M., N = 3 (*p < 0.05; **p < 0.01).
Inset, siRNA569R against NFAT5 or negative control (siRNAinv569R) were transfected and treated with similar conditions described above. Representative figures are shown. [Republished from Kosuge and Chuang et al. (2007), with permission from the publisher].
79
3.2.3 Tonicity enhancer (TonE) is responsible for NFAT5 mediated CYP3A induction:
In the previous sections of this thesis, tonicity-dependent transcriptional upregulation of
CYP3A4, CYP3A7 and CYP3A5 was established. Furthermore, this upregulation appeared to be
NFAT5-dependent, thereby suggesting the possibility of active TonE site(s) that would modulate
CYP3A expression. TonE is an 11-nucleotide DNA enhancer element with the following sequence: TGGAAANNYNY, with N denoting any nucleotide and Y as pyrimidine. There are
85 consensus TonE motifs in the 230 kb-wide CYP3A gene locus, with active TonE(s) postulated to exist in close proximity to the promoter of each CYP3A gene cassette. A 10 kb-long CYP3A4 reporter construct that consists of the CYP3A4 promoter and its 5’ regulatory elements, including the XREM region [Bertilsson et al., 1998] were examined closely. As shown in Figure 3.2.3.1, the PXR activator rifampicin increased luciferase activity >3-fold, and >5-fold when hPXR was co-transfected in HepG2 cells, and demonstrated a functional PXR transcriptional regulatory pathway for CYP3A. However, this reporter construct was not responsive to tonicity changes, suggesting CYP3A regulatory factors associated with the 5’ DNA elements of CYP3A4 themselves were not activated. The lack of hypertonic activation also suggested that an active
TonE was not present at this 5’ region of the CYP3A4 transcriptional start site.
A search for consensus TonE sites within ±10 kb of transcriptional start sites of each CYP3A was conducted next. Figure 3.2.3.2 shows that there are 11 sense (upward facing) and 2 antisense
(downward facing) TonE sequences within these search criteria (3 sense and 1 antisense TonE for CYP3A4, 4 sense and 1 antisense TonE for CYP3A7, and 4 sense TonE for CYP3A5).
Putative TonE motifs 5’ of CYP3A transcriptional start sites were first assessed in reporter constructs. There is one TonE motif for CYP3A4 (-7913/-7903 of transcriptional start site), two
80
for CYP3A7 (-7900/-7980 and -551/-541), and three for CYP3A5 (-6341/-6331, -3051/-3041 and
-1924/-1914).
Figure 3.2.3.1 Reporter construct containing XREM and proximal promoter elements of human CYP3A4 does not mediate tonicity‐dependent response. Reporter constructs encompassing ~10 kb of the 5’‐flanking regions of CYP3A4 were examined in HepG2 cells co‐ transfected with a human PXR or empty expression vector. After a 24‐hour treatment with either 10 μM rifampicin (black bars) or 50 mM NaCl (shaded bars), reporter activity was measured. The normalized reporter responses shown are expressed as a ratio to the respective reporter activity value in control isotonic conditions (open bars). Results are expressed as mean ± S.E.M. (*p < 0.05, **p < 0.01, N = 6–9). [Republished from Kosuge and Chuang et al. (2007), with permission from the publisher].
81
Figure 3.2.3.2 Scheme of the CYP3A gene cluster and corresponding reporter constructs and corresponding TonE sites within ±10 kb of major CYP3A transcriptional start sites. Eleven sense and two antisense consensus TonE motifs in the regions are depicted as an open column on either the top (sense) or bottom (antisense) side of the genome (horizontal line), with the starting 5’ (sense TonE) and 3’ base pair positions (antisense TonE) relative to the transcription initiation site of each CYP3A gene. The reporter constructs (thick horizontal lines with or without TonE as a white dot) are shown with the 5’‐/3’‐ends of the sequence. The constructs with an asterisk (*) were responsive to hypertonicity and NFAT5. The CYP3A4 XREM (‐7836/‐ 7607) was reported by Goodwin et al. (1999) and the CYP3A7 XREM (‐7478) was reported by Bertilsson et al. (2001). [Modified from Kosuge and Chuang et al. (2007), with permission from the publisher].
82
Many of these TonE sites are situated near the XREM where an ER6 site mediates receptor
regulation of CYP3A gene expression, such as PXR and CAR [Gibson et al., 2002]. However, reporter constructs encompassing these TonE sites (see Figure 3.2.3.2 for inserts and their relative position to each CYP3A transcriptional start site) under the control of a SV40 promoter, or each individual CYP3A gene promoter, did not show any hypertonicity-mediated increase in luciferase activity (data not shown). These results demonstrate that there are no active TonE sites within 10 kb upstream of each of the individual CYP3A promoters.
The 7 remaining TonE sites situated within 10 kb downstream (Figure 3.2.3.2) of each CYP3A transcriptional start site were examined (two sense TonE in CYP3A4 exon 3/ intron 3 at
+6144/+6154 and +6169/+6179; one antisense TonE in CYP3A4 intron 2 +5636/+5646; two sense TonE in CYP3A7 intron 2 at +5076/+5086 and +5417/+5427; one antisense TonE in
CYP3A7 intron 2 at +4688/+4698; one sense TonE in CYP3A5 exon 3 +5437/+5447). Screening with SV40 promoter-driven luciferase reporters (CYP3A4[+5971/+6352], CYP3A7[+4910/+5590] and
CYP3A5[+5318/+5669]) in C2bbe1 cells revealed only construct CYP3A7[+4910/+5590], to have two
sense TonE motifs, conveying strong luciferase activity (data not shown). In addition, placing the
CYP3A7[+4910/+5590] fragment in a reporter with its own CYP3A7 gene promoter did not abolish
tonicity response (Figure 3.2.3.3). A similar and comparable region of CYP3A4 containing two sense and one antisense TonE motifs was further examined in reporter constructs (Figure
3.2.3.3); however, these constructs did not show any tonicity responsiveness. Examination of
CYP3A7 TonE sites at positions +5076 and +5417 in construct CYP3A7[+4910/+5910] showed robust
response under isotonic conditions, and enhanced response to hypertonicity compared with the
CYP3A7 promoter alone. Inclusion of the antisense TonE at position +4688 (CYP3A7[+4658/+5587])
83
Figure 3.2.3.3 Reporter constructs from a CYP3A7 intron contains a TonE motif that conveys tonicity‐responsiveness. Activity of the reporter constructs was measured in C2bbe1 cells after 24 hours of control isotonic (open bars) or hypertonic conditions (black bars). Results are expressed as ratios to the activity of the respective minimal promoters (mean ± S.E.M., N = 3, *p < 0.05 and ***p < 0.001. Comparing hypertonic with DNA insert to isotonic with DNA insert #p < 0.05 and ###p < 0.001). [Redrawn and analyzed by Andrew Chuang from data from Kosuge and Chuang et al. (2007), with permission from the publisher].
84
did not change luciferase activity. This antisense TonE alone (CYP3A7[+4658/+4909]) was unresponsive to hypertonicity. The findings above indicated that only the CYP3A7 intron 2 region containing the two sense TonE motifs (+5076/+5086 and +5417/+5427) appeared to possess tonicity-responsive enhancer activity.
Transactivation of the CYP3A7 intron 2 TonE insert (CYP3A7[+4910/+5590]) was tested by placing
this segment in reporter constructs with other CYP3A promoters (CYP3A4, CYP3A5 and
CYP3A7), with or without co-transfection with an NFAT5 expression vector (Figure 3.2.3.4).
Experimental results show this insert is capable of activating all CYP3A promoter constructs with hypertonicity and isotonic NFAT5 co-transfection.
Next, experiments utilizing loss-of-function approaches were set up. Using a dominant-negative
NFAT5 (dnNFAT5Δ1-156; Tong et al., 2006), the activity of a CYP3A7 intron 2 reporter with the
CYP3A7 promoter (CYP3A7 promoter + CYP3A7[+4910/+5590]) was reduced in the presence of
dnNFAT5Δ1-156 in isotonic and hypertonic medium (p < 0.01) (Figure 3.2.3.5). Similarly, siRNA
against NFAT5 (siRNA569R; Na et al., 2003) also reduced reporter activity in these experiments
(p < 0.05; Figure 3.2.3.5). Together with the gain- and loss-of function assays results, the data
suggest that the CYP3A7 intron 2 inserts (CYP3A7[+4910/+5590]) may work in conjunction with other CYP3A promoters; and that NFAT5 is required for enhancer activation.
85
Figure 3.2.3.4 CYP3A7 intron region (+4910/+5590) transactivates CYP3A minimal promoters
with hypertonicity mediated by NFAT5. C2bbe1 cells were cotransfected with various reporter constructs with empty or NFAT5 expression vector. After 24 hours of incubation under isotonic (open bars), hypertonic (closed bars) or NFAT5 expression vector (shaded bars), luciferase activity was measured. In this experiment, results are expressed as values relative to each respective gene promoter without the CYP3A7[+4910/+5590] fragment (enhancer‐less gene promoter) with empty expression plasmid under isotonic conditions (mean ± S.E.M., N = 4, **p < 0.01 and *** p < 0.001 against enhancer‐less gene promoter; ##p < 0.01 and ###p < 0.001
against respective gene promoter + CYP3A7[+4910/+5590] under isotonic condition). [Redrawn and analyzed by Andrew Chuang from data collected in Kosuge and Chuang et al. (2007), with permission from the publisher].
86
Figure 3.2.3.5 NFAT5 mediates CYP3A7 [+4910/+5590] reporter activity with hypertonicity. Loss of
function assays on the CYP3A7[+4910/+5590] reporter were assessed using dominant‐negative
(dnNFAT5, top) or siRNA (bottom) against NFAT5. C2bbe1 cells were cotransfected with the
CYP3A7 TonE reporter plasmid, and with either dnNFAT5Δ1–156 (open bar) or pFLAG empty vector (closed bar). In other experiments, siRNA569R (open bar) or an inverted 569R sequence
(siRNAinv569R, closed bar) was used. Cells were treated with isotonic or hypertonic medium for 24 hours. Results are normalized against the values of the CYP3A7 minimal promoter reporter under isotonic conditions (means ± S.E.M., *p < 0.05, **p < 0.01, compared with respective controls; N = 4). [Republished from Kosuge and Chuang et al. (2007), with permission from the publisher].
87
Serial deletions of the CYP3A7 intron 2 insert were carried out to determine the minimal
sequence needed for enhancer activity (Figure 3.2.3.6). This insert contains 2 sense TonE at
+5076/+5086 and +5417/+5427 relative to CYP3A7 transcriptional start site. Gradual reduction
of reporter activity occurred when upstream sequences were deleted (reductions of 80-fold to 40-
fold in isotonic NFAT5 co-transfection, comparing constructs CYP3A7[+4910/+5590] to
CYP3A7[+5051/+5590]). On the other hand, those constructs with deleted upstream TonE motif and an intact downstream TonE (CYP3PA7[+5088/+5590] and CYP3A7[+5361/+5590]) still retained inducible, but reduced reporter activity. This suggested that upstream sequences and the upstream TonE were dispensable, but required for full response. Deletions that further removed the consensus downstream TonE (CYP3A7[+5428/+5590]) completely eliminated reporter activity, suggesting it to
be indispensable for enhancer activity (Figure 3.2.3.6). Finally, a reporter construct that
contained only the upstream TonE (CYP3A7[+4910/+5204]) on its own, indicated no reporter activity.
88
Figure 3.2.3.6 The CYP3A7 intron 2 TonE (+5417) is indispensable for the enhancer activity.
Deletion analyses of the CYP3A7 intron 2 region using the reporter CYP3A7[+4910/+5910], which harbours an upstream (+5076, open triangle) and downstream (+5417, closed triangle) TonE
site. C2bbe1 cells were cotransfected with various reporter constructs and with either NFAT5 expression vector or empty plasmids. Cells were then treated in isotonic or hypertonic conditions for 24 hours. The 5’‐/3’‐ends of the construct sequences are shown on the left as base positions from the CYP3A7 transcription start site. Luciferase activities are expressed as ratios to the CYP3A7 minimal promoter in isotonic condition (means ± S.E.M., N = 3; *p < 0.05, **p < 0.01 and ***p < 0.001 against isotonic reporter constructs). [Redrawn and analyzed by Andrew Chuang from data collected in Kosuge and Chuang et al. (2007), with permission from the publisher].
89
The regions surrounding the TonE site at +5417/+5427 were further characterized with 3’
deletions. Without deleting the site itself, no changes were observed in reporter activity compared with the CYP3A7[+4910/+5590] construct (Figure 3.2.3.7). Mutating the +5417/+5427
sequence to tggaaagtAaA (capital A represents replacing adenine with cytosine and thymine,
respectively) severely reduced reporter activity (Figure 3.3.2.7), thereby emphasizing the
indispensability of this enhancer motif.
General enhancers can transactivate promoter reporters independent of their direction and
location. To assess whether CYP3A7[+4910/+5590] could do the same, it was placed in a reversed
direction (CYP3A7[+4910/+5590 reverse]) and downstream from the luciferase reporter gene
(CYP3A7[+4910/+5590 3’position]). The reversal of the CYP3A7 intron 2 insert showed a robust increase
in reporter activity with isotonic NFAT5 co-transfection (~300-fold vs. ~120-fold against
CYP3A7[+4910/+5590]). In contrast, placing the insert away from the promoter still retained reporter
response, but its magnitude was smaller (Figure 3.2.3.7). It is worth noting that this configuration
is close to the actual CYP3A7 promoter-intron 2 spatial arrangement on the chromosome situated
~5 kb from the promoter.
These combined findings show that the CYP3A7 intron 2 TonE at +5417/+5427 is indispensable
for enhancer activity.
90
Figure 3.2.3.7 The CYP3A7 intron 2 TonE (+5417) conveys enhancer activity. Mutation and positioning experiments involving the CYP3A7 intron 2 fragment. The mutated downstream TonE (shaded triangle labelled “mut”), the reversed configuration, and the 3’‐positioned
schemes of CYP3A7 intron 2 fragment were tested in reporter constructs in C2bbe1 cells cotransfected with NFAT5 expression vector or empty plasmids. Cells were then treated with isotonic or hypertonic conditions for 24 hours. The 5’‐/3’‐ends of the construct sequences are shown on the left as base positions from the CYP3A7 transcription start site. Luciferase activities are expressed as ratios to that of CYP3A7 minimal promoter under isotonic conditions (means ± S.E.M., N = 3, *p < 0.05, **p < 0.01 against isotonic conditions). [Redrawn and analyzed by Andrew Chuang from data published from Kosuge and Chuang et al. (2007), with permission from the publisher].
91
3.2.4 NFAT5 binds to the CYP3A7 intronic enhancer at position +5417/+5427:
As shown in Figure 3.2.4.1, NFAT5 was bound to a labelled DNA probe that included the active
CYP3A7 intronic TonE (+5409/+5435 from CYP3A7 transcriptional start site; lane 1).
Competition against the unlabeled probe (lanes 2 and 3) eliminated binding, whilst the mutated version of the probe did not (lanes 4 and 5). The addition of NFAT5 antibody caused a supershift
(black arrow, lane 6), indicating specific binding of NFAT5 to the CYP3A7 intronic TonE.
Note: the EMSA mutated probe was changed to tAAaGaaA‐aG, where capitalized letters represent base changes, and the dash represents a 1 bp deletion from the original “tggaaagttac”. The mutated TonE sequence used in the earlier reporter experiments showed weak competitive binding in EMSA experiments (data not shown).
A ChIP assay was used to confirm NFAT5 binding to the CYP3A7 intron 2 TonE in a native
chromatin context. As shown in the top panel of Figure 3.2.4.2, fragment A represents a 288 bp
PCR product that includes the non-active antisense TonE (+4688/+4698 from CYP3A7 start site), whilst the 271 bp fragment B includes the active TonE (+5417/+5427). Results show that only fragment B is detected in the output lanes with the NFAT5 antibody. Neither the non-specific antibody (CYP1A1), nor the null-antibody preparation detected any PCR products (Figure
3.2.4.2, middle panel). In addition, a previously reported active TonE motif of the SMIT
promoter [Rim et al., 1998] was detected in the same output fraction (Figure 3.2.4.2, bottom
panel). In contrast, the negative PCR control which amplified NFAT5 exon 14 [Lopez-Rodriguez
et al., 2001] in the input control, showed no PCR products in the output samples (Figure 3.2.4.2, bottom panel).
92
Figure 3.2.4.1 NFAT5 binds to the CYP3A7 intron 2 TonE motif (+5417/+5427) in an in vitro binding assay. Nuclear extracts were obtained from C2bbe1 cells treated with hypertonic medium for 4 hours. Samples were incubated with biotinylated DNA probes containing the CYP3A7 intron 2 TonE motif (+5417/+5427) and surrounding regions (+5409/+5435). EMSA was conducted with increasing concentrations of unlabeled competitor or mutated DNA probes. Probe signals of non‐competing (lane 1, left‐most lane), competing (lanes 2 and 3), and mutated probes (lanes 4 and 5) are shown (open triangle). A supershift band driven by the addition of NFAT5 antibody was demonstrated (black triangle, lane 6). A representative figure is shown. [Republished from Kosuge and Chuang et al. (2007), with permission from the publisher].
93
Top
Middle
Bottom
94
Figure 3.2.4.2 ChIP assay for NFAT5 binding to the CYP3A7 intron 2 TonE motif (+5417) in a native cell context. Top panel; positioning of TonE motifs within CYP3A7 intron 2 and PCR fragments amplified in ChIP. Fragment A contained an inactive antisense TonE at +4688, and fragment B held the functional TonE at +5417. Middle panel; NFAT5 binding to fragment B.
C2bbe1 cells exposed to NaCl‐induced hypertonicity (400 mOsmol/kg) for 16 hours were subjected to ChIP analyses using NFAT5 antibody to immunoprecipitate and amplify the 271‐bp fragment B (see Materials and Methods). Output lanes (left to right): 1 and 2, NFAT5 antibody; 3 and 4, CYP1A1 antibody; 5 and 6, no antibody. Bottom panel; a 194‐bp sequence containing a characterized TonE from SMIT (SLC5A3) was amplified after immunoprecipitation with the NFAT5 antibody. A similar size fragment from NFAT5 exon 14 without a TonE motif was used as a negative binding control. Output lanes: 1 and 4, NFAT5 antibody; 2 and 5, CYP1A1 antibody; 3 and 6, no antibody. A representative result of two to four experiments is shown. [Republished from Kosuge and Chuang et al. (2007), with permission from the publisher].
95
In section 3.2, the hypertonicity-mediated upregulation of CYP3A in hepatic and intestinal cell
cultures were further evaluated. Results show that human CYP3A transcriptional upregulation is
dependent on NFAT5. In vitro experiments revealed that an active TonE site at position
+5417/+5427 from CYP3A7 transcriptional start site was indispensable for tonicity-mediated reporter activation. Furthermore, NFAT5 was shown to bind to this TonE site. Combining these findings, NFAT5 may mediate the tonicity-dependent expression of human CYP3A genes by binding to the CYP3A7 intronic enhancer.
96
3.3 Dehydration induces NFAT5 target genes and human CYP3A in vivo.
3.3.1 Hepatic mouse NFAT5 transactivates human CYP3A TonE motif:
Kosuge and Chuang et al., (2007) revealed that mouse Cyp3a mRNA levels did not respond to
tonicity changes in vitro. Therefore, we had to first determine whether human CYP3A TonE
motif was responsive to mouse NFAT5 in mouse cell lines. This step was an important
prerequisite for the planned in vivo experiments with the CYP3A4/CYP3A7-humanized
transgenic mouse model. Mouse NFAT5 and human NFAT5 share 92% amino acid sequence
homology and 99% similarity in the Rel-like DNA binding domain [Maouyo et al., 2002]. For
this reason, it is possible that mouse NFAT5 is capable of binding to human TonE motifs.
In the mouse hepatic line hepa1c1c7, mouse NFAT5 (red) can be seen in both the cytoplasm and the nuclear compartments under isotonic conditions (Figure 3.3.1.1). In contrast, cells exposed to hypertonic medium (400 mOsm/kg) showed strict nuclear localization of mouse NFAT5 (blue), which is an indication of NFAT5 activation. NFAT5 target genes showed a robust increase in mRNA levels. Akr1b3 (aldose reductase: 5.7 ± 0.1-fold, n = 3), Slc6a12 (Bgt1: 51.9 ± 3.3-fold, n
= 3), Slc5a3 (Smit: 2.2 ± 0.3-fold, n = 3) and Slc6a6 (TauT: 1.6 ± 0.1-fold, n = 3) all showed statistically-significant increases. Close examination of endogenous mouse Cyp3a mRNA levels also revealed a weak, but statistically-significant increase of mouse Cyp3a41 (2.4 ± 0.2-fold, n =
3), whilst Cyp3a13 was unchanged, and other Cyp3a isoforms were undetectable (Cyp3a11,
Cyp3a16 and Cyp3a25). a
97
Figure 3.3.1.1 Hypertonicity induced mouse NFAT5 nuclear translocation in the mouse hepatic cell line hepa1c1c7. Hepa1c1c7 cells were exposed to hypertonic medium (+50 mM NaCl) for 24 hours and immunohistochemistry was performed. Mouse NFAT5 is shown as red (CY3/red), with DAPI (blue) as a nuclear counter stain. All images were taken using a Zeiss confocal laser microscope with a representative figure shown. Top row: (isotonic), bottom row: (hypertonic); left panels: (DAPI nuclear stain), middle panels: (NFAT5), right panels: (merged).
98
Figure 3.3.1.2. Hypertonicity induced hepatic NFAT5 target genes. Hepa1c1c7 cells were incubated in hypertonic conditions for 24 hours. RNA was then extracted from cells and mRNA levels were quantified with real‐time PCR. GAPDH‐standardized results are expressed as ratios to the isotonic gene control (mean ± S.E.M., N = 3, *P < 0.05; a:statistical decrease, P < 0.05). NFAT5 target genes: Akr1b3, Slc6a12, Slc5a3, Slc6a6; endogenous mouse Cyp3a11, Cyp3a16, and Cyp3a25 were not detected (N.D. = not detected).
99
Next, the human CYP3A TonE reporter (CYP3A7[+4910/+5590]) was examined in mouse hepa1c1c7
cells. This experiment was aimed at exploring mouse NFAT5 binding to a human TonE reporter, and as a final justification for using the CYP3A4/CYP3A7-humanized transgenic mouse as an in vivo model. Figure 3.3.1.3 shows a statistically significant increase in luciferase activity of the human CYP3A TonE reporter with hypertonic treatment, compared with isotonic conditions.
These results demonstrate that mouse NFAT5 is capable of activating the human CYP3A TonE motif in vitro in a hepatic cell line.
Figure 3.3.1.3. Hypertonicity‐activated human CYP3A TonE reporter in mouse hepatoma cell line hepa1c1c7. Hepa1c1c7 cells were transfected with reporters that contained the human CYP3A minimal promoter, with or without the CYP3A7 intronic TonE (Kosuge and Chuang et al. 2007). Cells were then treated with hypertonic medium (400 mOsm/kg) and reporter activity was then measured. Results are expressed as fold induction to untreated CYP3A minimal promoter (mean ± S.E.M, N = 3, *P < 0.05).
100
3.3.2 Cyclic water-deprivation induces NFAT5 accumulation and target gene response:
Loyher et al. (2004) demonstrated rat NFAT5 accumulation in the nucleus of neurons after
injecting the animals with a hypertonic sucrose solution. Adopting their approach, the injection
of a 2 M sucrose solution (2 Osm/kg at 2 mL/100g body weight) into the peritoneal cavity of the
CYP3A4/CYP3A7-humanized mice, caused a marked increase in plasma osmolality within 6
hours (318.7 ± 2.2 mOsm/kg in baseline and 397.3 ± 19.3 mOsm/kg in sucrose injected groups)
(Appendix 3.3.2.A). However, mRNA responses of NFAT5 target genes were weak (Appendix
3.3.2.B) and only Slc6a6 (TauT) reached statistically significant levels compared to water-
injected group (3.9±0.2-folds, n=3, p<0.05) in the liver. Robust responses that were seen from
Akr1b3 (mouse aldose reductase) and Slc6a12 (Bgt1) in cultured hepatocytes (Figure 3.3.1.2),
were not observed under this in vivo experimental condition.
Mouse NFAT5 activation using the above acute plasma hypertonicity approach was not optimal for observing changes in NFAT5 target genes. Therefore, another method utilizing mild
dehydration was explored. Cha et al. (2001) and Bartolo et al. (2008) deprived rats and Spinifex
hopping mice (a desert rodent) of water intake for 3–7 days to observe whether there was
NFAT5 expression or its nuclear shift in the renal medulla. In addition, NFAT5 target gene
expression was demonstrated in the kidney without a particular change in plasma osmolality. A
maximum of 24-hour water deprivation was allowed by the animal care committee for this
research. However, a pilot study showed that the mRNA levels of NFAT5 target genes did not
change within this water-deprivation period (Appendix 3.3.2.C). A week-long intermittent water
deprivation approach was then developed, which consisted of a 24-hour water deprivation period
on odd-numbered days (days 1, 3, 5 and 7), with a 24-hour water ad-lib recovery period on even-
101
numbered days (days 2, 4 and 6). Using this cyclic water-deprivation approach, urinary
osmolality increased from 2700 mOsm/kg to 4155 mOsm/kg without changes in plasma osmolality (Appendix 3.3.2.A). These values suggested that there was no substantial disruption in hydration homeostasis. With this method, NFAT5 (red) was shown to translocate to the nucleus in the liver (Figure 3.3.2.1; top panels) and accumulated within the nucleus (shown by greater intensity) in the renal medulla (Figure 3.3.2.1; bottom panels).
Animal weight changes were monitored to assess hydration status. Animals experienced a 5–8% decrease in weight compared with the initial baseline value (Appendix 3.3.2.D) at the end of each 24-hour water-deprivation period. After each 24-hour water ad lib phase, weight rebounded to near baseline values. This trend seemed to suggest that a modest dehydration and recovery had occurred during the water-deprivation cycles.
A difference in weight change caused by animal gender was observed in these experiments. Male mice showed significant weight reduction from baseline (median -8.6%, n = 14, P < 0.001) versus control animals (median +2.8%, n = 9), but females experienced insignificant weight loss
(median -4.8%, n = 4) versus the control mice (median -2.1%, n = 8) (Appendix 3.3.2.E). These observations are consistent to the results reported in rats; where similar sex differences in water balance during periods of water deprivation may be accounted by differences in vasopressin secretion [Wang et al., 1996].
Real-time RT-PCR results also showed no change in mRNA expression of NFAT5 target genes for female mice (with the exception of Akr1b3 in the kidney, Appendix 3.3.2.F), which was consistent with the apparent absence of dehydration demonstrated by the lack of weight change.
In contrast, male animals showed a significant increase of Slc6a12 (Bgt1) in the liver and kidney
102
against the water ad-lib group (2.5 ± 0.6-fold, n = 14, p = 0.04 and 3.1 ± 0.6-fold, n = 10, p =
0.02, respectively) (Figure 3.3.2.2). Other NFAT5 target genes such as Akr1b3 in the liver and
Slc5a3 in the kidney also showed a significant increase, thereby suggesting NFAT5 activation in these animals. Because of the ineffectiveness of the dehydration procedure in female animals, only male mice were in cyclic water-deprivation studies.
103
Liver
Kidney (renal medulla)
104
Figure 3.3.2.1 Cyclic water‐deprivation promotes NFAT5 nuclear accumulation in the liver and kidney of CYP3A4/CYP3A7‐humanized transgenic mice. Male CYP3A4/CYP3A7‐humanized mice experienced cyclic water‐deprivation for 1 week that consisted of four periods of 24‐hour water deprivation interspersed with three periods of 24‐hour water ad lib periods. NFAT5 is shown as red (CY3/red), with DAPI (blue) as a nuclear counter stain. All images were taken using a Zeiss confocal laser microscope with a representative figure shown. Top figure: liver slice from the left liver lobe; bottom figure: kidney slice from the renal medulla. For each figure, top row: (isotonic), bottom row: (hypertonic); left panels: (DAPI nuclear stain), middle panels: (NFAT5), right panels: (merged).
105
Figure 3.3.2.2 NFAT5 target gene expression in male CYP3A4/CYP3A7‐humanized transgenic mice under cyclic water‐deprivation. Male CYP3A4/CYP3A7‐humanized transgenic mice were challenged with one week of cyclic water‐deprivation (see materials and methods). At the end of Day 7, mice were sacrificed for RNA extraction. mRNA was measured using real‐time RT‐PCR. Gapdh‐standardized results were further compared with mean values of the control group, and expressed as fold difference (mean ± SEM; N = 10–14, *P < 0.05).
106
3.3.3 Cyclic water-deprivation promotes human CYP3A expression:
The CYP3A4/CYP3A7-humanized mouse model harbored linear DNA starting from 35 kb 5’ of
the CYP3A4 transcriptional start site to 9 kb 3’ of the CYP3A7 transcriptional termination site
[Cheung et al., 2006]. This inserted DNA segment contained the active human CYP3A TonE motif (CYP3A7[+5417/+5427]) that was discovered in earlier in vitro studies (Section 3.2). In Section
3.3.2, it was revealed that the cyclic water-deprivation protocol was associated with NFAT5
nuclear localization and induction of NFAT5 target genes. Evaluating human CYP3A expression
in this mouse model under cyclic water-deprivation may provide further information on in vivo human CYP3A regulation and potential NFAT5 regulation.
As shown in Figure 3.3.3.1, a significant increase of 11.8 ± 4.8-fold in mRNA levels was observed for hepatic CYP3A4 in the cyclic water-deprived group (against water ad-lib group, p =
0.04, n = 14). In contrast, CYP3A7 mRNA levels did not change to reach statistical significance
(1.8 ± 0.7-fold, p = 0.32, n = 14). Three endogenous mouse Cyp3a isoforms were detected in the liver (Cyp3a11, Cyp3a13 and Cyp3a25). Of the three, only Cyp3a11 showed a statistical significant increase of 1.6 ± 0.2-fold in mRNA levels (p = 0.01, n = 13). Examination of renal medulla showed a moderate, but statistically significant increase of CYP3A4 (2.2 ± 0.4-fold from
control, p = 0.02, n = 9), whilst CYP3A7 remained unresponsive (0.7 ± 0.2-fold from control, p =
0.13, n = 9) (Figure 3.3.3.1, bottom figure). Meanwhile, Cyp3a11 and Cyp3a25 mRNA responded positively, showing 4.9 ± 1.3-fold and 3.3 ± 0.7-fold over control, respectively (p =
0.01; n = 9 and p = 0.02; n = 10, respectively).
107
Figure 3.3.3.1 Human CYP3A transgene and mouse endogenous Cyp3a gene expression in male transgenic mice after cyclic water‐deprivation. Male humanized CYP3A transgenic mice were treated with the cyclic water‐deprivation as described in Methods. At the end of Day 7, mice were killed and RNA was extracted from the liver (white bars) and kidneys (black bars). mRNA levels of CYP3A transgene and mouse Cyp3a were measured using real‐time PCR. GAPDH‐standardized results were further compared to mean values of the baseline control group (dotted line), and expressed as fold difference for each gene (mean ± SEM, N = 14 for liver and N = 9–10 for kidney, *P < 0.05).
108
Mouse Cyp3a and human CYP3A are both regulated by the nuclear receptors PXR and CAR.
Human and mouse CYP3A/Cyp3a are also directly regulated by the glucocorticoid receptor
(GR), or indirectly by the glucocorticoid-mediated increase of PXR by GR [Sérée et al., 1998;
Schuetz et al., 1996; Down et al., 2007]. The cyclic water-deprived protocol has the potential to cause a stress-related increase in endogenous glucocorticoids, which may confound the data in
Figure 3.3.3.1. mRNA levels of Pxr mRNA and the typical GR target gene Tat (tyrosine aminotransferase) were measured to rule out the effects of glucocorticoid in these experiments
(Note that the mineralocorticoid receptor (MR) shares the same response element as GR).
Results from real-time RT-PCR showed no statistically significant changes in mRNA levels of
Pxr or Tat in the tissues examined (Appendix 3.3.3.A). Therefore, it is unlikely that glucocorticoids, and/or the GR/MR pathway, were involved in the transcriptional upregulation of human CYP3A and mouse Cyp3a genes in cyclic water-deprived animals.
Induction of CYP3A4 mRNA levels in the liver of cyclic water-deprived animals was also associated with an increase of human CYP3A proteinsa (Figure 3.3.3.2). In addition, microsomal
samples taken from the liver of cyclic water-deprived animals showed an increase of 1.6-fold in
CYP3A protein activity levelsb, whereas the phenobarbital-injected group showed a 4.3-fold increase, compared with the water ad-lib group (pooled samples from 3 mice in each arm).
However, the luciferin-IPA substrate used to measure CYP3A protein activity was first developed as a human CYP3A4 substrate, but a recent publication by Roncoroni et al. (2012) showed luciferin-IPA can be metabolize by mouse CYP3A in vivo. In our studies, Cyp3a11 was the only mouse Cyp3a to be induced in the liver after cyclic-water deprivation (1.6±0.2-folds, p=0.01, Figure 3.3.3.1), so the increase in total CYP3A protein activity may be partially
109
accounted for by endogenous factors. Nevertheless, the robust increase in human CYP3A4
mRNA and protein expression is likely to result in a subsequent increase in protein activity.
Note: aThe antibody appeared to be specific to human CYP3A, as no protein band associated with human CYP3A (~55kDa) was detected in wild‐type animal samples (C57/BL6; data not shown). bHuman CYP3A protein activity was measured using luciferin‐IPA (Promega).
Figure 3.3.3.2 Human CYP3A protein expression in the liver after cyclic water‐deprivation. Male CYP3A4/CYP3A7‐humanized mice were challenged with 1 week of cyclic water‐ deprivation (24‐hr alternating water‐deprivation and water recovery cycles) and microsomal proteins were harvested from the liver. A positive CYP3A induction control was generated by injecting phenobarbital I.P. at 60 mg/kg body weight for 2 days via I.P. injection. Pooled liver microsomal fractions of 3 animals in each treatment group are shown; a representative of two blots is shown.
110
Figure 3.3.3.3 Human CYP3A protein activity in the liver after cyclic water‐deprivation. Male CYP3A4/CYP3A7‐humanized mice were challenged with 1 week of cyclic water‐deprivation (24‐ hr alternating water‐deprivation and water recovery cycles) and microsomal proteins were harvested from the liver. A positive CYP3A induction control with phenobarbital was used at 60 mg/kg body weight for 2 days via I.P. injection. 20 μg of microsomal protein was used with the CYP3A substrate luciferin‐IPA per supplier instructions. Pooled liver microsomal fractions of 3 animals in each treatment group are shown. A representative figure from two experiments is shown.
111
In summary, prolonged dehydration by alternating water-deprivation periods promoted mouse
NFAT5 nuclear accumulation and target gene expression in the CYP3A4/CYP3A7-humanized transgenic mouse model. In addition, this water-deprivation protocol also led to an associated increase in human CYP3A4 expression.
112
3.4 High-salt diet induces NFAT5 target genes and human CYP3A in the
intestine.
3.4.1 Intestinal mouse NFAT5 transactivates human CYP3A TonE motif:
Human CYP3A isoforms are highly expressed in the intestine and contribute to the presystemic
clearance of orally administered drugs. In the previous section (Section 3.3), NFAT5 was shown
to activate human CYP3A TonE in the mouse hepatic cell line hepa1c1c7. Similar approaches were carried out in the mouse intestinal line CMT93 to determine whether the same was true.
The majority of mouse NFAT5 (red) was seen in the nucleus (blue) under isotonic conditions, although some cytoplasmic distribution was observed (Figure 3.4.1.1). Hypertonic treatment for
24-hours resulted in comparable mouse NFAT5 distribution, but its nuclear distribution appeared to be greater (Figure 3.4.1.1).
Despite the lack of histochemical evidence for NFAT5 activation, some mouse NFAT5 target genes did respond dramatically to hypertonic treatments. mRNA levels of Akr1b3 (mouse aldose reductase: 16.3 ± 1.2-fold, p < 0.01, n = 3) and Slc6a12 (Bgt1: >4000-fold, p < 0.01, n = 3) increased drastically, compared with baseline conditions (Figure 3.4.1.2). Meanwhile, Slc5a3
(Smit) showed a minor increase to 1.8 ± 0.4-fold without reaching statistically significant levels
(p = 0.2, n = 3). mRNA of Cyp3a11, Cyp3a16 and Cyp3a25 were undetected in CMT93 cells.
Cyp3a13 was unresponsive to treatment, whilst Cyp3a41 showed a 2.4 ± 0.5-fold increase without reaching statistical significance (p = 0.09, n = 3) (Figure 3.4.1.2).
113
Figure 3.4.1.1 NFAT5 nuclear distribution with hypertonicity in mouse intestinal cell line CMT93. CMT93 cells were exposed to hypertonic medium (+50 mM NaCl) for 24 hours and immunohistochemistry was carried out. NFAT5 is shown as red (CY3), with DAPI (blue) as a nuclear counter stain. All images were taken using a Zeiss confocal laser microscope with a representative figure shown. Top row: (isotonic), bottom row: (hypertonic); left panels: (DAPI nuclear stain), middle panels: (NFAT5), right panels: (merged).
114
Figure 3.4.1.2 Hypertonicity induced intestinal NFAT5 target genes. CMT93 cells were incubated in hypertonic medium (+50 mM NaCl) for 24 hours, and mRNA levels were quantified with real‐time RT‐PCR. GAPDH‐standardized results were expressed as ratios to the isotonic gene controls (mean ± S.E.M., N = 3, *P < 0.01). NFAT5 target genes: Akr1b3, Slc6a12, Slc5a3, Slc6a6; mouse Cyp3a11, Cyp3a16, and Cyp3a25 were not detected (N.D. = not detected).
115
The response of the human CYP3A TonE reporter (CYP3A7[+4910/+5590]) in mouse CMT93 cells was examined next (Figure 3.4.1.3). This human CYP3A TonE reporter showed a mild, but statistically significant increase to ambient hypertonicity in the mouse intestinal line (isotonic:
4.2 ± 0.2-fold; hypertonic: 5.7 ± 0.1-fold, p < 0.05; results were expressed as fold-change against the CYP3A minimal promoter in isotonic conditions).
From the results of Section 3.4.1, it can be concluded that the induction of NFAT5 target genes and the activation of the human CYP3A TonE reporter, have provided the justification for the use of the CYP3A4/CYP3A7-humanized transgenic mouse in intestinal-tonicity experiments.
Figure 3.4.1.3 Hypertonicity‐activated human CYP3A TonE reporter in the mouse intestinal cell line CMT93. CMT93 cells were transfected with a reporter that contained the human CYP3A minimal promoter, either with or without the CYP3A7 intronic TonE (Kosuge and Chuang et al. 2007). Cells were then treated with hypertonic medium (400 mOsm/kg) for 24 hours and luciferase activity was measured. Results are expressed as fold induction to the untreated CYP3A minimal promoter construct (mean ± S.E.M, N = 3, *P < 0.05). 116
3.4.2 High-salt diet induces NFAT5 accumulation and target gene response:
Pilot experiments using the C57/BL6 background mouse were carried out as early attempts to
achieve localized hypertonicity in the intestine. A hyperosmolar sucrose solution was fed via
gavage (200 g/L, 1 mL/100g body weight, per os.) every 4 hours until the 12 hour mark.
Intestinal epithelial cells were collected by inner wall scraping and RNA was harvested. Real- time RT-PCR was unable to detect any change in mRNA levels of NFAT5 target genes
(Appendix 3.4.2.A), including Akr1b3 (aldose reductase) and Slc6a12 (Bgt1). These two genes were the highly tonicity-responsive genes in earlier experiments (Section 3.4.1). The lack of induction of NFAT5 target genes suggests that NFAT5 is not activated in the intestine under this experimental condition. Furthermore, only Slc6a12 was detected in female animals, which led to the exclusion of the male population in further experiments. The selection of female mice was also rationalized by the fact that intestinal expression of CYP3A4 in the CYP3A4/CYP3A7- humanized mouse model was more robust, compared with the male sex [Cheung et al., 2006].
Kang et al. (2008) fed a high-salt diet (8% NaCl) to rats for 14 days and observed Cyp3a3 mRNA (Cyp3a1 in NCBI assembly) increase in the ileum compared with the low-salt diet
(sodium deficient). Using a similar approach, animals were fed with the high-salt diet (8% NaCl) or the low-salt diet (sodium deficient) for 1 week. As shown in figure 3.4.2.1, the high-salt diet promoted duodenal mouse NFAT5 expression (red), and accumulation in the nucleus (blue), thereby suggesting NFAT5 activation.
117
Figure 3.4.2.1 Mouse NFAT5 accumulates in the duodenum of the CYP3A4/CYP3A7‐ humanized transgenic mouse after one week of a high‐salt diet. Female CYP3A4/CYP3A7‐ humanized mice were fed low‐salt (0% NaCl; top row), or high‐salt (8% NaCl; bottom row) diets for one week. Duodenal segments were collected and sectioned for immunohistochemistry. NFAT5 is shown as red (CY3/red), with DAPI (blue) as a nuclear counter stain. SGLT1 (sodium glucose cotransporter, an apical marker) was conjugated to Alexa 488 and stained as green. Panels (left to right): SGLT1 apical marker, DAPI nuclear stain, NFAT5, and merged. A representative image is shown.
118
The apparent activation of duodenal NFAT5 was also associated with the induction of its target
genes. mRNA levels of Slc6a12 (bgt1) and Slc6a6 (TauT) were increased to 20.5 ± 6.7-fold and
3.2 ± 0.7-fold, respectively (n = 8, p = 0.02 and n = 10, p < 0.01, respectively) (Figure 3.4.2.2).
Surprisingly, Akr1b3 (aldose reductase) and Slc5a3 (Smit) showed a respective statistically
significant reduction to 0.7 ± 0.1-fold and 0.6 ± 0.1-fold in mRNA levels (n = 14, p < 0.01).
Meanwhile, only Slc6a12 (Bgt1) showed a statistically significant increase of 4.3 ± 1.2-fold (n =
12, p = 0.02) in mRNA levels in the kidneys (renal medulla), whilst other NFAT5 target genes
were unresponsive (Figure 3.4.2.2). Finally, no NFAT5 target genes responded in the liver,
suggesting systemic hypertonicity did not occur in this experimental method.
119
Figure 3.4.2.2 NFAT5 target gene expression in female CYP3A4/CY3A7‐humanized transgenic mice under a high‐salt diet. Female CYP3A4/CYP3A7‐humanized mice were fed a low‐salt (0% NaCl), or high‐salt (8% NaCl) diet for 1 week. Duodenal samples were gathered from inner wall scrapings (left), kidney samples were taken from the renal medulla (center), and liver samples were collected from the left liver lobe (right). mRNA levels were measured using real‐time PCR, with Gapdh‐standardized results further compared to the mean values of the low‐salt diet group, and expressed as fold differences for each gene (mean ± SEM; N = 3–7 for duodenum, N = 7 for kidney, N = 10 for liver, *P < 0.05, a:statistical decrease, P < 0.05).
120
3.4.3 High-salt diet increases expression of human CYP3A4:
Apparent mouse NFAT5 activation was seen in the duodenum of mice fed with a high-salt diet
(Section 3.4.2). However, NFAT5 target genes response was rather selective, observed in just
two of the four target genes measured. In Figure 3.4.3.1, duodenal human CYP3A4 transgene
was increased to 2.6 ± 0.5-fold in mRNA levels, compared with the low-salt diet control (p =
0.03, n = 14). In contrast, CYP3A7 showed an increase of 1.6 ± 0.2-fold, but did not reach statistical significance (p = 0.08, n = 12). There was also a trend of mild increase in Pxr
expression (1.9 ± 0.3-fold, p = 0.07), but endogenous mouse Cyp3a isoforms (PXR target genes)
were unresponsive to the high-salt diet. These results would seem to suggest that the regulatory
pathways common to both human and mouse CYP3A/Cyp3a genes (i.e., PXR) were not involved
in human CYP3A4 mRNA expression by the high-salt diet.
Examination of extra-intestinal tissues revealed that only Cyp3a13 responded positively in the
kidney (2.5 ± 0.5-fold in mRNA levels against low-salt control, p = 0.02, n = 12) (Figure
3.4.3.1). CYP3A4 in the kidney showed an increase of 3.0 ± 0.8-fold in mRNA levels, but
statistical significance was not reached (p = 0.10, n = 9). In the liver, both CYP3A/Cyp3a
isoforms were largely unresponsive to the high-salt diet, except for CYP3A7 and Cyp3a25,
showing a respective statistical increase to 2.5 ± 0.4-fold and decrease to 0.6 ± 0.1-fold in
mRNA against the low-salt control (p = 0.01 and p = 0.03, respectively). Because a hypertonic
stimulus was not present in the liver of animals under a high-salt diet (indicative of lack of
NFAT5 target gene responses, Figure 3.4.2.2.), it is unlikely that NFAT5 was involved for these
hepatic observations. Finally, mRNA levels of Pxr did not change significantly in these extra-
intestinal tissues.
121
Figure 3.4.3.1 Human CYP3A transgenes and mouse endogenous Cyp3a gene expression in female CYP3A4/CYP3A7‐humanized transgenic mouse after a high‐salt diet. Female CYP3A4/CYP3A7‐humanized mice were fed a low‐salt (0% NaCl), or high‐salt (8% NaCl) diet for 1 week. Duodenal samples were gathered from inner wall scrapings (left), kidney samples were taken from the renal medulla (center), and liver samples were collected from the left liver lobe (right). mRNA levels were measured using real‐time PCR, with Gapdh‐standardized results further compared with the mean values of the low‐salt diet group, and expressed as fold differences for each gene (mean ± SEM; N = 3–14 for duodenum, N = 3–12 for kidney, N = 7–16 for liver, *P < 0.05; a: statistical decrease, P < 0.05).
122
In other experiments, immunoblot (Figure 3.4.3.2) showed an increase in human CYP3A protein
expression in the duodenal microsomal fractions of the high-salt diet groups. Consistent with
these findings, duodenal CYP3A protein activity was also increased (~3-fold against low-salt
diet control) (Figure 3.4.3.3). Because endogenous mouse Cyp3a mRNA levels did not change in
the duodenal samples, the increase in duodenal CYP3A protein activity is most likely attributed
to the increase in human CYP3A4 content.
Figure 3.4.3.2 Human CYP3A protein expression in the intestine after one week of a high‐salt diet. Female CYP3A4/CYP3A7‐humanized mice were fed with a low‐salt (0% NaCl), or a high‐salt (8% NaCl) diet for 1 week. Animals were then killed by cervical dislocation and duodenal microsomal proteins were collected by inner wall scraping. A representative blot of two independent experiments with pooled duodenal microsomal fraction of 3 animals in each diet group is shown.
123
Figure 3.4.3.3 Human CYP3A protein activity in the intestine after one week of a high‐salt diet. Female CYP3A4/CYP3A7‐humanized transgenic mice were fed a low‐salt (0% NaCl), a normal‐salt (0.5% NaCl), or a high‐salt (8% NaCl) diet for 1 week. Animals were then killed by cervical dislocation and microsomal proteins collected by inner wall scraping. 20 μg of microsomal protein per sample was used with the CYP3A substrate luciferin‐IPA per supplier instructions. Results were normalized against a blank control without microsomes, then further against the normal‐salt values. A representative figure from two experiments with pooled duodenal microsomal fraction of 3 animals in each diet group is shown.
124
In summary, the week-long high-salt diet promoted duodenal mouse NFAT5 nuclear accumulation and selective NFAT5 target gene induction in the CYP3A4/CYP3A7-humanized mouse model. This dietary approach also led to an increase in human CYP3A4 gene expression in the gut, with concurrent increases in protein and activity levels.
125
Section 4: Discussion, Conclusions, Recommendations
The findings described in this thesis provide an insight into the molecular mechanism of tonicity- induced changes of human CYP3A genes (CYP3A4, CYP3A5 and CYP3A7). We found the tonicity-responsive transcription factor NFAT5 binds to a cognate enhancer element (tonicity enhancer, TonE) in an intronic region of the CYP3A locus. This human CYP3A TonE elicits transcriptional upregulation in reporter constructs with all major human CYP3A promoters
(Section 3.2). Our results suggest that tonicity regulation of human CYP3A is not limited to in vitro cells (intestinal and hepatic cells, Section 3.1), but is also present in living systems
(Sections 3.3 and 3.4). It is speculative, but human CYP3A expression may possess a role in osmotic homeostasis because most NFAT5 target genes act to deter osmotic changes and damages [Ho, 2006]. It is possible that human CYP3A may mediate the production of intracellular osmolytes in order to counteract the effects of ambient hypertonicity. Further studies are needed to identify and examine the effect of such molecules.
Section 4.1 Human CYP3A in vitro characterization:
Previous studies conducted by Darbar et al. (1997 and 1998) in humans have suggested that high intakes in dietary sodium may increase the expression of human CYP3A in the intestine. This hypothesis was supported by the enhanced first-pass effects of CYP3A substrates in those clinical studies. Kang et al. (2008) also demonstrated an increase of rat Cyp3a1 mRNA levels in the gut after a period of high-salt diet. Given these findings, we conducted in vitro experiments to gain insight into the mechanism of this phenomenon. We observed an osmolyte concentration and exposure-time dependent increase of CYP3A in hepatic and intestinal cells (Sections 3.1.1
126
and 3.1.2, respectively). In addition, comparable trends from primary cultures of human liver and intestine were also observed (Section 3.1.3).
The increase in human CYP3A transcripts by hypertonicity can be detected as early as the 4 hour mark (Figure 3.1.1.1). This observation would suggest that the increase in human CYP3A isoforms was transcriptionally activated. This notion was supported by our actinomycin D experiments, which failed to show a prolonged decay half-life for CYP3A mRNA in hypertonic treatments (Appendix 3.1.1.A). Furthermore, increased protein expression and activity levels in the liver and the intestine (Figures 3.1.1.3, 3.1.2.2, and 3.1.2.3) would suggest functional consequences of this phenomenon.
CYP3A isoforms are regulated by multitudes of nuclear receptors, such as: PXR and CAR.
However, no statistically-significant changes in mRNA levels of PXR, CAR (Figure 3.2.2.2) and various nuclear receptor target transporters were detected with hypertonic treatment (Figure
3.2.2.1). The lack of mRNA changes in nuclear receptor target transporters (i.e., MDR1) suggest that nuclear receptors themselves were not activated; therefore it is unlikely that nuclear receptors were responsible for the observed increase in human CYP3A levels. The absence of a hypertonic response in a CYP3A4 gene reporter construct that contained proximal and distal nuclear receptor regulatory elements also supported this line of thought (Figure 3.2.3.1).
Specifically, human CYP3A transcriptional upregulation by hypertonicity appeared to be independent of PXR (Figure 3.2.3.1), but other nuclear receptors (i.e., CAR or VDR) were not examined closely. Experiments designed to assess various nuclear receptors and their effect on a human CYP3A gene reporter under hypertonic conditions would shed more light on their
127
involvement. Needless to say, any subtle alterations of CYP3A nuclear receptors levels may
ultimately contribute to the final steady state levels of CYP3A, and should not be casually
dismissed.
Several in vitro cell models were used to assess the hypertonicity-mediated response of human
CYP3A. C2bbe1 cells were first chosen as the model cell line for our in vitro experiments,
because intestinal epithelial cells were more likely to experience fluctuations in the osmotic
environment. In addition, C2bbe1 cells also expressed more CYP3A4 mRNA transcripts compared with HepG2 cells (Appendix 4.1.A). Examinations in other immortalized cell lines and primary cultures against C2bbe1 cells also revealed several differences between these cells; only
specific CYP3A isoforms were upregulated by hypertonicity in primary cultures, and induction
magnitudes were much lower (Section 3.1). Because of these differences, careful consideration
must be taken when comparing the hypertonic response of human CYP3A isoforms in various
culture systems.
An example of culture-specific human CYP3A response can be seen in the hepatoma cell line
HepaRG, which expresses high PXR content [Aniant et al., 2006]. The unusually high basal
CYP3A4 content may have resulted in a weak induction of CYP3A4 mRNA levels by the potent
PXR activator rifampicin (3- vs 35-fold in HepaRG and primary hepatocytes; Appendix 3.1.4.B
and Appendix 3.1.4.C, respectively). The lack of a rifampicin-mediated response also extended
to CYP3A5 and CYP3A7 mRNA levels, suggesting induction pathways of these genes may be
saturated (Appendix 3.1.4.B). Given that hypertonic response in HepaRG cells also differed from
other hepatocytes (HepG2 cells and primary hepatocytes), which showed no changes in CYP3A4
128
and CYP3A7 mRNA levels, it is likely that unidentified factors may interfere with their
hypertonic response. In addition, the NFAT5 target gene SMIT that was robustly induced in other hepatocytes was equally unresponsive in HepaRG. This may also suggest a differential NFAT5 regulatory pathway in these cells. Combined with these observations, we deem HepaRG as an unsuitable hepatocyte system for tonicity studies.
Our results in primary hepatocytes were similar to the data collected by Ito et al. (2007). In that study, CYP3A4 mRNA was equally unresponsive to hypertonicity. Although CYP3A5 and
CYP3A7 mRNA levels were not included in their original study, we showed tonicity- responsiveness for those genes (Section 3.1.3). At present, it is uncertain if nuclear receptors known to regulate CYP3A or other unidentified factors in primary cells could have contributed to the differential response between cell cultures.
In summary, we discovered an in vitro tonicity modulation of human CYP3A expression in hepatic and intestinal cell cultures. The magnitude of induction and the specific CYP3A isoform induced appeared to be cell-type specific. Furthermore, the biological significance of CYP3A
upregulation by hypertonicity remained unclear.
129
Section 4.2 NFAT5 and human CYP3A:
NFAT5 belongs to the NFκB family of transcription factors. Unlike other members of its family
that are calcium-dependent, NFAT5 is the only member that is responsive to tonicity changes
[Trama et al., 2000]. When a hypertonic stimulus is present, NFAT5 translocates to the nucleus
and binds to its DNA recognition site (TonE) to promote gene expression [Tong et al., 2006].
Most research to date regarding NFAT5 utilized renal tissues, but NFAT5 has been shown to
induce target genes in organs that do not normally face changes in ambient tonicity [Loyher et
al., 2004]. Furthermore, NFAT5 is ubiquitously expressed, suggesting tonicity gene regulation
could be a universal event and perhaps critical for cell survival [Maouyo et al., 2002].
Using gain (NFAT5 overexpression) and loss (NFAT5 siRNA) of function assays (Section
3.2.2), we were able to determine that NFAT5 plays a role in CYP3A upregulation by
hypertonicity. There are a total of 13 TonE motifs within ±10 kb of each major CYP3A gene
transcriptional start site. Using reporter constructs containing these TonE sites, we screened the
CYP3A gene locus for functional motifs. In our search, only construct CYP3A7[+4910/+5590] conveyed tonicity responsiveness (Figure 3.2.3.3). Additional tests with serial deletion and mutations revealed that the TonE motif at position +5417/+5427 from the CYP3A7 transcriptional start site was necessary for enhancer properties (Section 3.2.3). We also showed that NFAT5 binds to this TonE motif from the combined results of EMSA and ChIP.
The discovery of a sole active TonE motif within CYP3A7 intron 2 was surprising because all
CYP3A isoforms were shown to be transcriptionally activated by hypertonicity. We expanded our search for TonE motifs to ± 20kb, but no additional active enhancer was found (Appendix 130
3.2.3.A). The placement of the active enhancer ~5 kb downstream from the CYP3A7 start site is
also unusual because cis-transcriptional elements are usually located at the upstream region. An
example of a well-characterized downstream regulatory element is that of the tumour necrosis
factor-alpha (TNF-α). Barthel et al. (2003) used DNA footprinting techniques to show that an
intronic region of TNF-α (intron 3), along with its associated protein, was responsible for cell-
specific expression of TNF-α.
The prevailing model for long-range enhancer describes a situation where enhancer-bound
proteins interact with promoter-bound factors to “loop-out” the large segment of intervening
DNA [Dekker et al., 2002]. It is possible that this CYP3A7 intronic TonE may possess long-
range enhancer properties that could act on its neighbouring promoters of CYP3A4 and CYP3A5.
Figure 3.2.3.4 showed that tonicity responsiveness remained when the 0.7 kb fragment
containing the active TonE motif was placed with other CYP3A gene promoters. These
observations suggested that interactions between this fragment and other CYP3A gene promoters
may be possible, by some form of chromatin folding. We characterized the CYP3A TonE for its
long-range properties by placing the fragment upstream of a 10kb CYP3A4 long promoter construct (spanning from -10466 to +53 of CYP3A4 start site). Tonicity responsiveness was exhibited despite being distal to the CYP3A4 promoter (Appendix 4.2.A). Therefore, it was plausible that this CYP3A7 intron TonE and bound NFAT5, were readily accessible to other
CYP3A gene promoters via chromosomal folding, possibly in a manner similar to long-range enhancers found on β-globin or mouse immunoglobulin-kappa [Liu et al., 2005]. For example, the locus control region (LCR) of the human β-globin gene is situated ~50kb upstream of the adult β-globin gene. This LCR governs the transcription of fetal (γ-globin) and adult (β-globin)
131
subunits of the hemoglobin tetramers (α2γ2 and α2β2, respectively) [Hardison et al., 1996 and
Mahajan et al., 2005]. Within the LCR, multiple DNase hypersensitive sites (HS) with cis-acting enhancer elements promote gene expression and enhancement in a position-independent manner, suggesting the opening of the chromatin around the gene locus [Hardison et al., 1996]. Mahajan et al. 2005 showed that nuclear ribonucleoprotein C1/C2, nucleosome remodeling and deactylating protein MeCP1, and nucleosome remodeling protein SWI/SNF were found at HS2 of LCR, and that these proteins were also immunoprecipitated in ChIP assays with the β-globin- like promoters. These observations are consistent with chromatin folding and restructuring of
LCR, allowing physical access to the β-globin-like promoters. It remains to be determined if
CYP3A intron TonE is part of an unknown LCR for CYP3A genes or if chromatin folding and remodeling actual occurs.
NFAT5 regulation of CYP3A expression may play a role in physiological response to changes in tonicity. For example, NFAT5 target genes SLC5A3 (SMIT) and SLC6A12 (BGT1) encode proteins that transport inorganic ions out of the cell in exchange for compatible osmolytes. These compatible osmolytes act to deter changes in ionic contents within the cell, which could impede normal biological functions. CYP3A are expressed mainly in the liver and intestine, where the latter tissues experience changes in tonicity. However, no literature published to date has suggested CYP3A enzymes can modulate water and salt homeostasis in the intestine. On the other hand, the presence of 6β-OH corticosteroids in the kidney, which is a CYP3A-mediated metabolite of cortisol, has been shown to induce water and salt retention through binding to low- affinity receptors not shared with aldosterone or glucocorticoids [Duncan et al., 1988 and
Grogan et al., 1990]. Given that NFAT5 increases human CYP3A expression through ambient
132
hypertonicity, the NFAT5-CYP3A pathway in the kidney may support the water retention
mechanism by responding to dehydration-induced hypertonicity.
The CYP3A5*3 allele, which is common in the Caucasian population, produces a cryptic splice
variant (A>G transition, generating a cryptic acceptor splice site) that allows the insertion of
intron 3 where the product mRNA is rapidly degraded by a process called “non-sense mRNA
decay” [Busi et al., 2005]. The properly-spliced wild-type CYP3A5*1 variant can still be
detected in HepG2 cells (CYP3A5*3/*3 genotype) and CYP3A5*3/*3 individuals, although
CYP3A5*3/*3 individuals expresses 20-25% of wild-type CYP3A5 mRNA compared to
CYP3A5*1/*3 individuals [Lin et al., 2002 and Busi et al., 2005]. CYP3A5 is highly expressed
in individuals with the CYP3A5*1 genotype often associated with people of African descent.
This allele showed linkage disequilibrium with salt-sensitive hypertensive patients, suggesting a
causal relationship between CYP3A5 expression and this type of hypertension [Kuehl et al.,
2001, Givens et al., 2003, Thompson et al., 2004 and 2006, Bochud et al., 2006]. The real-time
RT-PCR probe we used to measure CYP3A5 mRNA levels in this thesis detects functional wild-
type transcriptsa (CYP3A5*1 splice variant). However, there was no statistically-significant
difference in hypertonicity-induced CYP3A5 mRNA levels against individuals with various
CYP3A alleles (Appendix 4.2.B). CYP3A5*6, another CYP3A5 allele variant, which encodes a
non-functional protein [Kuehl et al., 2001], also showed no detectable differences (Appendix
4.2.B).
Note: aCYP3A5*1 transcripts were detected in our cell lines and primary cultures. HepG2 and
C2bbe1 cells were both genotyped to be CYP3A5*3/*3.
133
Water and salt retention is controlled in the kidney by the renin-angiotensin-aldosterone axis.
One of the functions of angiotensin is to stimulate aldosterone secretion from the adrenal cortex,
which binds to the mineralocorticoid receptor (MR) to promote sodium reabsorption in the
kidney [Fujita et al., 2008]. The glucocorticoid cortisol also has mineralocorticoid activity through its binding to the MR [Grogan et al., 1990, Duncan et al., 1998, Whiteworth et al., 2005,
Biller et al., 2008]. Typically, cortisol is converted to the inactive cortisone by 11β- hydroxysteroid dehydrogenase II (11β-HSDII), but it can also be hydroxylated at the 6β position to 6β-OH cortisol by CYP3A4/CYP3A5 in the kidney. The urinary 6β-OH cortisol metabolite is often used as an endogenous marker for CYP3A activity and function [Galteau et al., 2003]. It is known that CYP3A5 is the main CYP3A isoform expressed in the kidney, and it acts as the local regulator for the production of 6β-OH cortisol [Haehner et al., 1996, Ghosh et al., 1993]. It is possible that CYP3A5 expression in response to hypertonicity in the kidney represents the feed- forward mechanism for salt-retention seen in salt-sensitive hypertensive patients. Functional
CYP3A5 is highly expressed in individuals with the CYP3A5*1 variant compared with other
CYP3A isoforms. This may be a significant point, as minor changes in CYP3A5 levels could lead to a sudden change in 6β-OH corticosteroid levels in CYP3A5*1/*1 individuals.
In summary, we have found a possible molecular mechanism for human CYP3A induction by hypertonicity. We speculate that NFAT5 mediates human CYP3A transcriptional upregulation by binding to an intronic TonE at position +5417/+5427 from the CYP3A7 transcriptional initiation site. Other active TonE sites may exist, which are responsible for the induction of
CYP3A4 and CYP3A5 transcripts. However, no such active motifs have been found within the search criteria of ±20 kb from each CYP3A transcriptional start sites.
134
Section 4.3 Mouse NFAT5 and target gene response:
Results from our in vitro studies in human cell lines revealed a possible mechanism in which human CYP3A were transcriptionally upregulated by hypertonicity. In order to examine this phenomenon further, characterization of the hypertonic response in mouse cells line was necessary prior to conducting experiments in a whole mouse model.
Given the results from our in vitro studies (Section 3.2.1), one would anticipate that an activated mouse NFAT5 would experience nuclear translocation and promote target gene induction.
Furthermore, NFAT5 transcriptional activity is modulated by extracellular osmolality, with hypotonicity capable of depressing basal transcript levels and hypertonicity inducing it [Ferraris et al., 2002b]. As previously discussed, NFAT5 distribution depends on the steady state levels of nuclear import and export. It is unclear how the substantial nuclear localization of NFAT5 in the isotonic condition in mouse cell lines influences its tonicity responsiveness (Figures 3.3.1.1 and
3.4.1.1), but it may possibly result in a diminished NFAT5 target gene response. In this view, mouse Slc5a3 (Smit) did show a relatively low, but still statistically significant hypertonic response compared with human SLC5A3 (Figure 3.3.1.2, compared with Figure 3.1.2.1).
However, differential regulation of NFAT5 target genes may exist across species, which make such comparisons a cautionary argument at best. Because the mouse Slc5a3 hypertonic response was unremarkable, we utilized other NFAT5 target genes as additional markers for NFAT5 activation. We noticed that Slc6a12 (Bgt1) had the highest sensitivity to our hypertonic stimuli by its high fold-change. As a result, Slc6a12 was designated as an indicator target gene for
NFAT5 activation.
135
Section 4.3.1 Systemic hypertonicity in mouse:
Our initial attempts to create a systemic hypertonic environment in mice were based on those
reported in literature for rats [Loyher et al., 2004]. Injection of a hyperosmolar sucrose solution
into the peritoneal cavity of animals caused water shift from the circulatory system, which
promoted a sudden increase in plasma osmolality as a sign for systemic hypertonicity (Appendix
3.3.2.A). This procedure was inappropriate as mice became lethargic immediately following
treatment and they were then terminated under ethical obligations. At the end of the 6-hr
experiment, we detected no statistically significant change in the liver or kidney of our
designated NFAT5 target gene Slc6a12.
The lack of NFAT5 target gene response prompted us to develop a new experimental protocol
(i.e., cyclic water-deprivation) that would allow apparent systemic hypertonicity without placing
extreme stress on the animals. Cyclic water-deprivation would permit isotonic dehydration
without drastic changes in plasma osmolality. At the end of a one-week experiment, we observed
an increase in urinary osmolality and slight rise in plasma osmolality (Appendix 3.3.2.A).
Studies conducted in rats [Cha et al., 2001] and a desert mouse species [Bartolo et al., 2008]
displayed NFAT5 activation and target gene expression in the kidney during prolonged water-
deprivation periods. Their studies demonstrated that NFAT5 activation can be achieved without
a continuous increase in plasma osmolality. In addition, their data showed a rise in urinary
osmolality with concurrent weight reductions that were consistent with our results. Lastly, our observations were also similar to their report in the kidney; NFAT5 was shown to be
accumulated in the nucleus with mild increases in target gene expression.
136
Dehydration-induced NFAT5 disposition is poorly understood in tissues outside the renal system, because systemic plasma osmolality is maintained within physiological levels through water and salt homeostasis [Ho, 2006]. At present, it is unclear if the tonicity regulatory pathways present in renal tissues exist in extra-renal tissues, such as the liver. Furthermore, little data is available on NFAT5 target gene expression or their functional significance in extra-renal tissues. The responses of NFAT5 and target genes in the liver and kidney of cyclic water- deprived animals are consistent with NFAT5 activation; therefore we speculate that slight, but sustained increases in plasma osmolality within normal physiological ranges could promote
NFAT5 activation.
Section 4.3.2 Localized intestinal hypertonicity in mice:
Results from our human intestinal cell lines suggested that the tonicity-responsive pathway was intact in this tissue. However, only Slc6a12 (Bgt1) and Akr1b3 (mouse aldose reductase) displayed a statistically significant increase by hypertonicity in mouse CMT93 cells (Figure
3.4.1.2). In our early in vivo experiments, we provided a hyperosmolar sucrose solution via gavage to create a localized hypertonic state in the intestinal lumen. NFAT5 target genes did not respond despite force feeding (per os.) of a hypertonic sucrose solution (Appendix 3.4.2.A). It is unclear as to why NFAT5 was not activated within 12 hours; other studies have shown that
NFAT5 nuclear trafficking can occur as early as 3 hours with systemic hypertonicity [Loyher et al., 2004].
We conducted several pilot experiments using normal-salt (0.49% NaCl content) against the high-salt diet (8% salt) in animals. However, no significant changes in NFAT5 target genes were 137
detected after 24 hours of food availability (data not shown). This lack of response may be
attributable to deficient food consumption; therefore we increased the duration of the high-salt
diet to one week to ensure hunger-mediated consumption. This time frame was chosen as a
comparable approach to cyclic water-deprivation studies. Furthermore, equal food consumption
was observed between these experimental arms (Appendix 4.4.2.B).
NFAT5 does not transcriptionally regulate itself, but added sodium (NaCl) in culture medium
leads to mRNA stability and a subsequent protein increase [Cai et al., 2005]. In our experiments,
NFAT5 expression was clearly seen and localized to the nucleus of duodenal villi cells after one- week of the high-salt diet, compared with the low-salt diet control (Figure 3.4.2.1). It is likely
that dietary salts may influence the overall expression of NFAT5 in the gut under normal
physiological conditions. The amount of available NFAT5 would modulate the expression of
NFAT5 target genes, thus protecting luminal cells from the possibly detrimental effects of
hypertonic shock following food consumption [Kalantzi et al., 2006a]. The extent and
requirement for such a regulatory response could be an interesting area of research worthy of
pursuit.
NFAT5 target gene expression in the mouse gut has a different profile than that observed in
intestinal cell lines. First, Akr1b3 (aldose reductase) and Slc5a3 (Smit) showed a weak, but
statistically significant decrease in expression after the high-salt diet, whilst in vitro cell models
showed hypertonicity-triggered induction of these genes. Second, the hypertonicity-unresponsive
Slc6a6 (Tau-t) in the mouse cell lines was highly responsive in vivo, whilst the sensitive NFAT5-
activation indicator Slc6a12 (Bgt1) showed robust in vivo expression. Differences observed
138
between in vivo and in vitro systems may be attributed to multitudes of confounding factors such
as culture conditions and regulatory pathways. Further discussion on these items would be speculative at best and possibly beyond the scope for this thesis.
Excessive salts are eliminated via the urinary concentration system in the kidney. Therefore, we expect a strong hypertonic signal to persist within the renal medulla during the course of our high-salt diet experiments. Similar to the results seen in cyclic water-deprivation studies, renal
Slc6a12 was increased in the high-salt diet group. In contrast, NFAT5 target gene responses in the liver to the high-salt diet were unremarkable, suggesting a lack of a hypertonic environment in this tissue in animals under a high-salt diet.
In summary, we showed that NFAT5 activation and target gene induction required a repeated or sustained hypertonic stimulus over a relatively long period. The highly sensitive NFAT5 target gene Slc6a12 showed consistent in vitro and in vivo tonicity-responsiveness, and seemed to be an appropriate indicator target gene for NFAT5 activation in vivo.
139
Section 4.4 Mouse and human CYP3A in the CYP3A4/CYP3A7-humanized mouse:
The CYP3A4/CYP3A7-humanized mouse [Cheung et al., 2006] is a suitable in vivo model to
assess hypertonic response of human CYP3A, because of its intact 5’- regulatory elements and
native introns that housed the active intronic TonE motif found in our earlier studies. Moreover,
developmental stage-dependency and tissue distribution profiles of CYP3A4 expression in this
transgenic mouse model are similar to those of humans, expressing high CYP3A4 in the liver
and the proximal portions of the gastrointestinal tract.
Section 4.4.1 Hypertonic response of mouse Cyp3a genes:
Human and mouse CYP3A have evolutionarily branched apart and no defined ortholog pairs
exist between these two species [Williams et al., 2004b]. Nonetheless, the existence of a tonicity-
dependent regulatory pathway for rodent Cyp3a genes may be possible, because NFAT5 is expressed across different mammalian species. Aside from human CYP2E1 and CYP3A, no other CYPs in humans or mouse were identified as tonicity-responsive. Evidence which supports the hypothesis of tonicity-responsive rodent CYP3A comes from a recent study from Kang et al.
(2008). In that study, it was shown that rats consuming a high-salt diet expressed higher than
normal amounts of CYP3A1 in the liver, kidney and ileum. Protein and mRNA levels of CYP3A
nuclear receptors were also measured, but the underlying mechanism for CYP3A1 induction
cannot be explained by changes in these nuclear receptors alone. The reason for this was that
inconsistent tissue-specific responses for the nuclear receptors that regulate CYP3A were also
observed (For example, PXR and FXR were increased in the gut, but were actually decreased in
the liver).
140
We found no equivalent intronic TonE motifs with similar spatial positions to the human CYP3A
counterpart within mouse Cyp3a11 and Cyp3a13 genes in an in silico search (Appendix 4.4.1.A).
Furthermore, the majority of murine Cyp3a genes were not detected in our in vitro hepatic and intestinal studies (hepa1c1c7 and CMT93 cells, respectively). In vivo experiments also revealed tissue-specific hypertonic responses for mouse Cyp3a (Figures 3.3.3.1 and 3.4.3.1). Cyp3a11
was upregulated in the liver and kidney in the cyclic water-deprived animals, whilst only
Cyp3a13 responded positively in the duodenum in animals fed with the high-salt diet. Other
Cyp3a isoforms do not display consistent responses between in vitro and in vivo studies.
PXR was examined to determine whether it was involved in the upregulation of mouse Cyp3a11
and Cyp3a13 genes in the in vivo experiments. Figure 3.3.3.1 and Figure 3.4.3.1 showed PXR mRNA levels did not change to reach statistically significant levels compared with control after
one week of experimentation, suggesting endogenous PXR levels did not change in response to
our interventions. Furthermore, other mouse Cyp3a genes that shared common PXR regulatory
pathways were also unresponsive, which imply PXR itself was not activated. Combined with
these findings, it is unlikely that PXR was involved in the in vivo hypertonic activation of mouse
Cyp3a11 and Cyp3a13.
Our results here are the first experiments to show a Cyp3a mRNA response to hypertonic
challenge in mice. Considering CYP3A11 and CYP3A13 are highly expressed in the liver and
intestine, drug metabolism studies in mice in vivo, or experiments in vitro should also consider
the impact of ambient tonicity in the experimental protocol.
141
Section 4.4.2 Hypertonic response of human CYP3A in the CYP3A4/CYP3A7-humanized
transgenic mouse:
The ability of mouse NFAT5 to activate a human CYP3A TonE reporter in vitro, was a first indication that a hypertonic stimulus in the CYP3A4/CYP3A7-humanized mouse could possibly activate human CYP3A genes in vivo (Figures 3.3.1.3 and 3.4.1.3). In the cyclic water-
deprivation studies, the liver and kidney experienced hypertonic states where NFAT5 was
accumulated in the nucleus. NFAT5 target genes were also increased suggesting NFAT5 was
activated (Figures 3.3.2.2 and 3.4.2.2). CYP3A4 showed robust mRNA expression in these
tissues, although CYP3A7 mRNA was elevated, but did not reach statistical significance in the
liver.
The results from cyclic water-deprivation studies were obtained in male mice. This was because
weight changes in the female mice after water-deprivation periods were weak compared with
baseline values (Appendix 3.3.2.E); our data suggested a sex difference in hydration status for
these animals. The laboratory which created this transgenic mouse model showed human
CYP3A4 expression was age-dependent and sexually dimorphic, with hepatic CYP3A4
decreasing in male pups after 4 weeks of age and female mice showing constant CYP3A4
expression [Cheung et al., 2006]. Because our experiments were designed strictly to observe the
induction of human CYP3A by a hypertonic signal, we felt the use of older male mice was still
in line with our research goal. Furthermore, we showed that human CYP3A was abundantly
expressed when animals were treated with phenobarbital, demonstrating inducible pathways
were still intact (Appendix 4.4.2.A).
142
Osmolality values from contents arriving at the jejunum in canines after ingesting a
predetermined nutrient drink were hyperosmolar for up to 60 minutes, whereas fasting states
resulted in a hypoosmolar state [Kalantzi et al., 2006a]. Similar hyperosmolar states in the intestinal lumens after feeding were also observed in pigs and humans, but the values depend on concomitant water consumption [Houpt 1991, Ladas et al., 1983]. Although we cannot specifically measure the osmolality of intestinal contents in our experiments due to technical difficulties, we are under the assumption that the osmotic environment in the intestine created by the high-salt diet (8% NaCl) is sufficiently hyperosmolar compared with the normal-salt diet
(0.49% NaCl). Furthermore, total food consumption and animal weights between the treatment arms appeared to be similar (Appendix 4.4.2.B) and that crushed chow osmolality was relatively hyperosmolar for the high-salt chow (Appendix 3.3.2.A); therefore any difference in gene expression must be caused by salt content alone.
In our experiments, high-salt diet was associated with elevated intestinal CYP3A4 expression and increased protein activity. These results provided an explanation of previous human salt-diet studies [Darbar et al., 1997, 1998], which were consistent with increased intestinal human
CYP3A expression and metabolism of target substrates. In their studies, 10 mEq/day and 400 mEq/day in total sodium content were used for the low-salt and high-salt groups, respectively, with the 100 mEq/day considered the “normal” dietary content (Note: 10, 100, 400 mEq/day represents 230, 2300, and 9200 mg of sodium, respectively). Human CYP3A expression due to high dietary salt could be of importance considering most North Americans consume higher than normal daily sodium (>4000 mg per day in males between age 12–59 vs. recommended value of
2300 mg) [Centers for disease control and prevention (CDC), 2012]. These average human daily
143
consumption values represent almost double the recommended sodium consumption. The true
impact of real-world high-salt consumption in the human population remains to be seen, but
nevertheless, in vivo results showed a possible link between dietary factors and drug metabolism.
Glucocorticoids, such as endogenous hydrocortisone, can bind to the glucocorticoid receptor to promote CYP3A expression. At sufficient levels, the potent glucocorticoid dexamethasone can also lead to PXR activation [Pascussi et al., 2001]. PXR activation was unlikely in our experiments because of isoform-specific induction of endogenous mouse Cyp3a genes, which are common targets genes for PXR. However, it is possible that GR may be activated by glucocorticoids (if any) released by stress within the course of the experiments. Examination of the mRNA levels of tyrosine aminotransferase (TAT), which is a known target gene of GR, revealed no change in any of our animal protocols (Appendix 3.3.3.A). The lack of TAT mRNA increase suggested that GR was not involved, and that human CYP3A expression in the transgenic mouse was likely to be attributable to the hypertonic signal alone.
Hypertonic activation of NFAT5 involves several signalling pathways, which include, but are not restricted to, p38 mitogen-activated protein kinase (MAPK) and fyn [Ko et al., 2002], protein kinase A [Ferraris et al., 2002a] and ATM [Irarrazabal et al., 2004]. The hypertonic signal itself also activates signalling pathways like mitogen-activated protein kinase kinase (MAPKK) [Itoh et al., 1994], extracellular signal-regulated kinases (ERK1 and ERK2) [Berl et al., 1997] and jun
N-terminal kinase (JNK) [Zhang et al., 1996]; some of these activated pathways do not contribute to NFAT5-mediated upregulation of target genes. For example, Kojima et al. (2010) showed that JNK and AP1 were not involved in the hypertonic activation MCP1 mRNA, a novel
144
NFAT5 target gene. Furthermore, JNK has been shown to mediate vitamin D-induced expression
of CYP3A4 mRNA through VDR in intestinal cultures, but the addition of a JNK inhibitor did not change CYP3A4 baseline expression [Fukumori et al., 2007]. These findings suggested that if JNK was activated by a hypertonic signal in our in vivo experiments, it is unlikely to affect the overall expression of the human CYP3A4 transgene.
NF-κB is yet another signalling pathway activated by hypertonicity, where the presence of
NFAT5 enhances its activity and expression of proinflammatory genes [Roth et al., 2010].
Interestingly, activated NF-κB has been documented to suppress PXR transactivation of target genes by disrupting PXR-RXRα/DNA complex [Gu et al., 2006 and Zhou et al., 2006]. In addition, interleukin 1-beta activation of NF-κB represses GR-mediated CAR expression, which results in lowered expression of CAR target genes, such as: CYP2B6, CYP2C9, and CYP3A4
[Assenat et al., 2004]. These previous findings suggested that hypertonic activation of NF-κB would actually inhibit transcriptional activation of human CYP3A, whereas our in vivo results showed a consistent upregulation of human CYP3A. Clearly, the positive factors in our experiments (i.e., NFAT5), surpasses the effects of negative factors (i.e., NF-κB) to promote an overall increase in CYP3A expression. The full interactions between osmosensitive factors,
CYP3A nuclear receptors, and tissue specificity will need further characterization.
145
In summary, we showed that hypertonic signals can induce in vivo human CYP3A4 expression in the CYP3A4/CYP3A7-humanized mouse model. It is likely that NFAT5 mediated the
CYP3A4 hypertonic response, as NFAT5 activation and target gene expression was observed simultaneously. However, possible secondary mechanisms through interactions with nuclear receptors known to regulate CYP3A may have confounded our results.
146
Section 4.5 Hyperosmolar disease states:
Several pathologies and disease states are associated with local or systemic hyperosmolality
[Neuhofer 2010]. Osmolality of the tear film in dry eye syndrome ranges from 330-365 mOsm/kg [Tomlinson et al., 2006]; in diabetes mellitus, serum osmolality ranges from 310-350 mOsm/kg [Hoffman et al., 2001, Campos et al., 2003]; bronchial fluid was measured at 350 mOsm/kg in exercise-induced obstructive pulmonary disorders [Kotaru et al., 2003]; hypernatremia experiences osmolality value of 340 mOsm/kg [Palevsky et al., 1996, Lindner et al., 2009]; and fecal fluids was measured at 490 mOsm/kg in inflammatory bowel disease
[Schilli et al., 1982, Vernia et al., 1988]. Profiling of P450 enzymes in these disease states could reveal valuable information on potential hypertonicity-mediated expression.
Xenobiotic-induced hepatotoxicity is known in diabetic patients and diabetic animals models
[Wang et al., 2007]. Although the precise mechanisms for xenobiotic-induced hepatotoxicity in
diabetes are relatively unknown, altered P450 expression has been shown to contribute to this
process. For example, CYP2E1 is induced in the liver of Type I diabetic patients and animals
models through transcriptional activation, post-transcriptional and translational stabilization via
the effects of ketone bodies, insulin and growth hormone [Wang et al., 2007]. CYP2E1 is also a
novel NFAT5 target gene [Ito et al., 2007], where its induction in diabetic patients may be
partially attributed by the increase in plasma osmolality. In contrast, little information on human
CYP3A expression in Type I diabetes is available. Dostalek et al. (2011) measured CYP3A4,
CYP3A5 and CYP2E1 mRNA and protein content, along with enzymatic activities, in 12
diabetic mellitus patients. In that study, CYP2E1 protein expression and activity were increased,
147
but CYP3A4 showed a decrease in protein expression and activity levels, while CYP3A5 contents were unaltered. Although human CYP3A expression was opposite than the expected
NFAT5-hypertonic response in diabetic mellitus patients in that study, it was unclear if other factors associated with Type I diabetes could be responsible for the overall decrease in human
CYP3A expression. Nevertheless, careful consideration must be taken when evaluating disease states for possible underlying factors in P450 expression.
148
Section 4.6 Conclusions:
In this thesis, a task was set to examine the osmoregulation of the human cytochrome P450 3A
genes. A possible molecular mechanism to explain hypertonic upregulation of human CYP3A
was provided. NFAT5 binds to a CYP3A7 intronic TonE, which was shown to transactivate other
human CYP3A promoter activities in vitro. In vivo experiments with the CYP3A4/CYP3A7-
humanized mouse showed that cyclic water-deprivation, and high dietary salt promoted human
CYP3A4 and NFAT5 target genes expression. Examination of PXR and GR target genes
suggested these two nuclear receptors were unlikely to be involved in the hypertonic activation of human CYP3A4. Positive factors such as NFAT5 could explain these observations, but conclusive remarks would require further tests. The observations accumulated in this thesis may further our understanding of CYP3A variability and drug response under physiological conditions.
149
References: Anakk S, Kalsotra A, Kikuta Y, Huang W, Zhang J, Staudinger JL, Moore DD, Strobel HW. Car/PXR provide directives for Cyp3a41 gene regulation differently from Cyp3a11. Pharmacogenomics J. 2004; 4: 91-101.
Aninat C, Piton A, Glaise D, Le Charpentier T, Langouet S, Morel F, Guguen-Guillouzo C. Guillouzo A. Expression of cytochromes P450, conjugating enzymes and nuclear receptors in human hepatoma HepaRG cells. Drug Metab Dispos. 2006; 34: 75-83. Aramburu J, Drews-Elger K, Estrada-Gelonch A, Minguillon J, Morancho B, Santiago V, Lopez- Rodriguez C. Regulation of the hypertonic stress response and other cellular functions by the Rel-like transcription factor NFAT5. Biochem Pharmacol. 2006; 72: 1597-1604. Assenat E, Gerbal-Chaloin S, Larrey D, Saric J, Fabre JM, Maurel P, Vilarem MJ, Pascussi JM. Interleukin 1beta inhibits CAR-induced expression of hepatic genes involved in drug and bilirubin clearance. Hepatology. 2004; 40: 951-960. Bachmann O, Riederer B, Rossmann H, Groos S, Schultheis PJ, Shull GE, Gregor M, Manns MP, Seidler U. The Na+/H+ exchanger isoform 2 is the predominant NHE isoform in murine colonic crypts and its lack causes NHE3 upregulation. Am J Physiol Gastrointest Liver Physiol. 2004; 287: G125-133. Baes M, Gulick T, Choi HS, Martinoli MG, Simha D, Moore DD. A new orphan member of the nuclear hormone receptor superfamily that interacts with a subset of retinoid acid response elements. Mol Cell Biol. 1994; 14: 1544-1552. Bailey DG, Malcolm J, Arnold O, Spence JD. Grapefruit juice-drug interactions. Br J Clin Pharmacol. 1998; 46: 101-110. Bailey DG, Spence JD, Edgar B, Bayliff CD, Arnold JM. Ethanol enhances the hemodynamic effects of felodipine. Clin Invest Med. 1989; 12: 357-362. Baird L, Dinkova-Kostova AT. The cytoprotective role of the keap1-Nrf2 pathway. Arch Toxicol. 2011; 85: 241-272. Barthel R, Goldfeld AE. T cell-specific expression of the human TNF-alpha gene involves a functional and highly conserved chromatin signature in intron 3. J Immunol. 2003; 171:3612- 3619. Bartolo RC, Donald JA. The effect of water deprivation on the tonicity responsive enhancer binding protein (TonEBP) and TonEBP-regulated genes in the kidney of the Spinifex hopping mouse Notomys alexis. J Exp Biol. 2008; 211:852-859. Beaune PH, Umbenhauer DR, Bork RW, Lloyd RS, Guengerich FP. Isolation and sequence determination of a cDNA clone related to human cytochrome P-450 nifedipine oxidase. Proc Natl Acad Sci USA. 1986; 83:8064-8068.
150
Bertilsson G, Heidrich J, Svensson K, Asman M, Jendeberg L, Sydow-Backman M, Ohlsson R, Postlind H, Blomquist P, Berkenstam A. Identification of a human nuclear receptor defines a new signaling pathway for CYP3A induction. Proc Natl Acad Sci USA. 1998; 95:12208-12213. Bertilsson G, Berkenstam A, Blomquist P. Functionally conserved xenobiotic responsive enhancer in cytochrome P450 3A7. Biochem Biophys Res Commun. 2001; 280:139-144. Biller BM, Grossman AB, Steward PM, Melmed S, Bertagna X, Bertherat J, Buchfelder M, Colao A, Hermus AR, Hofland LJ, Klibanski A, Lacroix A, Lindsay JR, Newell-Price J, Nieman LK, Petersenn S, Sonino N, Stalla GK, Swearingen B, Vance ML, Wass JA, Boscaro M. Treatment of adrenocorticotrophin-dependent Cushing’s syndrome: a consensus statement. J Clinc Endocrinol Metab. 2008; 93: 2454-2462. Blumberg B, Sabbagh W, Jr., Juguilon H, Bolado J, Jr., van Meter CM, Ong ES, Evans RM. SXR, a novel steroid and xenobiotic-sensing nuclear receptor. Genes Dev. 1998; 12:3195-3205. Bochud M, Eap CB, Elston RC, Bovet P, Maillard M, Schild L, Shamlaye C, Burnier M. Association of CYP3A5 genotypes with blood pressure and renal function in African families. J Hypertens. 2006; 24: 923-929. Bombail V, Taylor K, Gibson GG, Plant N. Role of Sp1, C/EBP alpha, HNF3, and PXR in the basal- and xenobiotics-mediated regulation of CYP3A4 gene. Drug Metab Dispos. 2004; 32:525- 535. Bonn B, Masimirembwa CM, Castagnoli N Jr. Exploration of catalytic properties of CYP2D6 and CYP3A4 through metabolic studies of levorphanol and levallorphan. Drug Metab Dispos 2010; 38: 187-199. Burg MB, Ferraris JD, Dmitrieva NI. Cellular response to hyperosmotic stresses. Physiol Rev. 2007; 87:1441-1474. Burk O, Koch I, Raucy J, Hustert E, Eichelbaum M, Brockmoller J, Zanger UM, Wojnowski L. The induction of cytochrome P450 3A5 (CYP3A5) in the human liver and intestine is mediated by the xenobiotic sensors pregnane X receptor (PXR) and constitutively activated receptor (CAR). J Biol Chem. 2004a; 279:38379-38385. Burk O, Tegude H, Koch I, Hustert E, Wolbold R, Glaeser H, Klein J, Fromm MF, Nuessler AK, Neuhaus P, Zanger UM, Eichelbaum M, Wojnowski L. Molecular mechanism of polymorphic CYP3A7 expression in adult human liver and intestine. J Biol Chem. 2002. 277: 24280-24288. Burk O, Wojnowski L. Cytochrome P450 3A and their regulation. Naunyn Schmiedebergs Arch Pharmacol. 2004b; 369:105-124. Busi F, Cresteil T. CYP3A5 mRNA degradation by nonsense-mediated mRNA decay. Mol Pharmacol. 2005; 68: 808-15. Cai Q, Ferraris JD, Burg MB. High NaCl increases TonEBP/OREBP mRNA and protein by stabilizing its mRNA. Am J Physiol, Renal Physiol 2005; 289: F803-F807.
151
Campos MV. Bastos M, Martins T, Leitao P, Lemos M, Carvalheiro M, Ruas A. Diabetic hyperosmolality. Retrospective study of 60 cases. Acta Med Port. 2003; 16: 13-19. Caporaso NE, Shaw GL. Clinical implications of the competitive inhibition of the debrisoquin- metabolizing isozyme by quinidine. Arch Intern Med. 1991; 151: 1985-1992. Centers for disease control and prevention (CDC). Vitl signs: food categories contributing the most to sodium consumption –United States, 2007-2008. MMWR Morb Mortal Wkly Rep. 2012; 61: 92-98. Cha JH, Woo SK, Han KH, Kim YH, Handler JS, Kim J, Kwon HM. Hydration status affects nuclear distribution of transcription factor tonicity responsive enhancer binding protein in rat kidney. J Am Soc Nephrol. 2001; 12:2221-2230. Chen J, Raymond K. Roles of rifampicin in drug-drug interactions: underlying molecular mechanisms involving the nuclear pregnane X receptor. Ann Clin Microbiol Antimicrob. 2006; 5: 3 Cheng J, Ma X, Gonzalez FJ. Pregnane X receptor- and CYP3A4- humanized mouse models and their applications. Br J Pharmacol. 2011; 163: 461-468. Cheung C, Yu AM, Chen CS, Krausz KW, Byrd LG, Feigenbaum L, Edwards RJ, Waxman DJ, Gonzalez FJ. Growth hormone determines sexual dimorphism of hepatic cytochrome P450 3A4 expression in transgenic mice. 2006; J Pharmacol Exp Ther. 316:1328-1334. Chuang AI, Ito S. Ambient tonicity and intestinal cytochrome CYP3A. Expert Opin Drug Metab Toxicol. 2010; 6:883-893. Clarysse S, Tack J, Lammert F, Duchateau G, Reppas C, Augustijns P. Postprandial evolution in composition and characteristics of human duodenal fluids in different nutritional states. J Pharm Sci. 2009; 98:1177-1192. Copp J, Wiley S, Ward MW, Van Der Geer P. Hypertonic shock inhibits growth factor receptor signaling, induces caspase 3 activation and causes reversible fragmentation of the mitochondria network. Am J Physiol Cell Physiol. 2005; 288:C403-C415. Daly AK. Significance of the minor cytochrome P450 3A isoforms. Clin Pharmacokinet. 2006. 45: 13-31. Darbar D, Dell’Orto S, Mörike K, Wilkinson GR, Roden DM. Dietary salt increases first-pass elimination of oral quinidine. Clin Pharmacol Ther. 1997; 61:292-300. Darbar D, Fromm MF, Dell’Orto S, Kim RB, Kroemer HK, Eichelbaum M, Roden DM. Modulation by dietary salt of verapamil disposition in humans. Circulation. 1998; 98:2702-2708. Decker M, Arand M, Cronin A. Mammalian epoxide hydrolases in xenobiotics metabolism and signalling. Arch Toxicol. 2009; 83: 297-318.
152
Dekker J, Rippe K, Dekker M, Kleckner N. Capturing chromosome conformation. Science. 2002; 295:1306–1311.
Di Ciano C, Nie Z, Szaszi K, Lewis A, Uruno T, Zhan X, Rotstein OD, Mak A, Kapus A. Osmotic stress-induced remodeling of the cortical cytoskeleton. Am J Physiol Cell Physiol. 2002; 283: C850-C865.
Dmitrieva NI, Michea LF, Burg M. P53 protects renal inner medullary cells from hypertonicity stress by restricting DNA replication. Am J Physiol Renal Physiol. 2001a; 281: F522-F530. Dmitrieva NI, Michea LF, Rocha GM, Burg M. Cell cycle delay and apoptosis in response to osmotic stress. Comp Biochem Phyisol A Mol Integr Physiol. 2001b; 130: 411-420 Dmitrieva NI, Cai Q, Burg MB. Cells adapted to high NaCl have many DNA breaks and impaired DNA repair on in cell culture and in vivo. Proc Natl Acad Sci USA. 2004; 101:2317- 2322. Dostalek M, Court MH, Yan B, Akhlaghi F. Significantly reduced cytochrome P450 3A4 expression and activity in liver from humans with diabetes mellitus. Br J Pharmacol. 2011; 163: 937-947. Down MJ, Arkle S, Mills JJ. Regulation and induction of CYP3A11, CYP3A13 and CYP3A25 in C57BL/6J mouse liver. Arch Biochem Biophys. 2007; 457: 105-110.
Drocourt L, Ourlin JC, Pascussi JM, Maurel P, Vilarem MJ. Expression of CYP3A4, CYP2B6 and CYP2C9 is regulated by the vitamin D receptor pathway in primary human hepatocytes. J Biol Chem. 2002; 277: 25125-25132.
Duncan RL, Grogan WM, Kramer LB, Watlington CO. Corticosterone’s metabolite is an agonist for Na+ transport stimulation in A6 cells. Am J Physiol. 1988; 255: F736-F748. Faucette SR, Zhang TC, Moore R, Sueyoshi T, Omiecinski CJ, LeCluyse EL, Negishi M, Wang H. Relative activation of human pregnane X receptor versus constitutive androstane receptor defines distinct classes of CYP2B6 and CY3A4 inducer. J Pharmacol Exp Ther. 2007; 520: 72- 80. Ferraris JD, Persaud P, Williams CK, Chen Y, Burg MB. cAMP-independent role of PKA in tonicity-induced transactivation of tonicity-responsive enhancer/osmotic response element- binding protein. Proc Natl Acad Sci USA. 2002a; 99:16800-16805. Ferraris JD, Williams CK, Persaud P, Zhang Z, Chen Y, Burg MB. Activity of the TonEBP/OREBP transactivation domain varies directly with extracellular NaCl concentration. Proc Natl Acad Sci USA. 2002b; 99: 739-744. Fromm MF, Busse D, Kroemer HK, Eichelbaum M. Differential induction of prehepatic and hepatic metabolism of verapamil by rifampin. Hepatology. 1996; 24: 796-801.
153
Fujita T. Aldosterone in salt-sensitive hypertension and metabolic syndrome. J Mol Med. 2008; 86: 729-734. Fukumori S, Murata T, Taguchi M, Hashimoto Y. Rapid and drastic induction of CYP3A4 mRNA expression via vitamin D receptor in human intestinal LS180 cells. Drug Metab Pharmacokinet. 2007; 22: 377-381. Galetin A, Clarke SE, Houston JB. Multisite kinetic analysis of interactions between prototypical CYP3A4 subgroup substrates: midazolam, testosterone, and nifedipine. Drug Metab Dispos. 2003; 31: 1108-1116. Galteau MM, Shamsa F. Urinary 6beta-hydroxycortisol: a validated test for evaluating drug induction or drug inhibition mediated through CYP3A in humans and in animals. Eur J Clin Pharmacol. 2003; 59: 713-733. Garner MM, Burg MB. Macromolecular crowding and confinement in cells exposed to hypertonicity. Am J Physiol. 1994; 266:C877-C892. Gellner KM, Eiselt R, Hustert E, Arnhold H, Loch I, Jabberl M, Deglmann CJ, Burk O, Buntefuss D, Escher D, Bishop C, Koebe HG, Brinkmann U, Klenk HP, Kleine K, Meyer UA, Wojnowski L. Genomic organization of the human CYP3A locus: identification of a new, inducible CYP3A gene. Pharmacogenetics. 2001; 11:111-121. Ghosh S, Grogan WM, Basu A, Watlington C. Renal corticosterone 6 beta-hydroxylase in the spontaneously hypertensive rat. Biochim Biophys Acta. 1993; 1182: 152-156. Gibson GG, Plant NJ, Swales KE, Aryton A, El-Sankary W. Receptor-dependent transcriptional activation of cytochrome P4503A genes: induction mechanisms, species differences and interindividual variation in man. Xenobiotica. 2002; 32: 165-206. Gisolfi CV, Summers RW, Lambert GP, Xia T. Effect of beverage osmolality on intestinal fluid absorption during exercise. J Appl Physiol. 1998; 85: 1941-1948. Givens RC, Lin YS, Dowling AL, Thummel KE, Lamba JK, Schuetz EG, Stewart PW, Watkins PB. CYP3A5 genotype predicts renal CYP3A activity and blood pressure in health adults. J Appl Physiol. 2003; 95: 1297-1300. Gnerre C, Blättler S, Kaufmann MR, Looser R, Meyer UA. Regulation of CYP3A4 by the bile acid receptor FXR: evidence for functional binding sites in the CYP3A4 gene. Pharmacogenetics. 2004; 14: 635-645. Go WY, Liu X, Roti MA, Liu F, Ho SN. NFAT5/TonEBP mutant mice define osmotic stress as a critical feature of the lymphoid microenvironment. Proc Natl Acad Sci USA. 2004; 101:10673- 10678. Gonzalez FJ. Role of cytochrome P450 in chemical toxicity and oxidative stress: studies with CYP2E1. Muat Res. 2005; 569: 101-110.
154
Gonzalez FJ, Yu AM. Cytochrome P450 and xenobiotics receptor humanized mice. Annu Rev Pharmacol Toxicol. 2006; 46: 41-64. Gonzalez FJ. CYP3A4 and pregnane X receptor humanized mice. J Biochem Mol Toxicol. 2007; 21: 158-162. Goodwin B, Hodgson E, Liddle C. The orphan human pregnane X receptor mediates the transcriptional activation of CYP3A4 by rifampicin through a distal enhancer module. Mol Pharmacol. 1999; 56:1329-39. Gravil CP, Yu AM, Elizondo G, Akiyama TE, Cheung C, Feigenbaum L, Krausz KW, Gonzalez FJ. Expression of the human CYP3A4 gene in the small intestine of transgenic mice: in vitro metabolism and pharmacokinetics of midazolam. Drug Metab Dispos. 2003; 31: 548-558. Greenblatt DJ, Venkatakrishnan K, Harmatz JS, Parent SJ, von Moltke LL. Sources of variability in ketoconazole inhibition of human cytochrome P450 3A in vitro. Xenobiotica. 2010; 40: 713-720. Grogan WM, Philips VM, Schuetz EG, Guzelian PS, Watlington CO. Corticosterone 6 beta- hydroxylase in A6 epithelia: a steroid-inducible cytochrome P-450. Am J Physiol. 1990; 258: C480-C488. Gu X, Ke S, Duan Liu, Sheng T, Thomas PE, Rabson AB, Gallo MA, Xie W, Tian Y. Role of NF-κB in regulation of PXR-mediated gene expression: A mechanism for the suppression of cytochrome P-450 3A4 by proinflammatory agents. J Biol Chem 2006; 281:17882-17889
Guengerich FP. Characterization of human microsomal cytochrome P-450 enzymes. Annu Rev. Pharmacol. Toxicol. 1989; 29: 241-64. Guengerich FP. Reaction and significance of cytochrome P-450 enzymes. J Biol Chem. 1991; 266: 10019-10022. Guengerich FP. Cytochrome P-450 3A4: regulation and role in drug metabolism. Annu Rev Pharmacol Toxciol. 1999; 39:1-17. Guengerich FP. Mechanisms of cytochrome P450 substrate oxidation: MiniReview. J Biochem Mol Toxicol. 2007; 21:163-168. Guengerich FP. Cytochrome P450 and chemical toxicity. Chem Res Toxicol. 2008; 21:70-83 Haehner BD, Gorski JC, Vandenbranden M, Wrighton SA, Janardan SK, Watkins PB, Hall SD. Bimodal distribution of renal cytochrome P450 3A activity in humans. Mol Pharmacol. 1996; 50: 52-59. Hardison R, Slightom JL, Gumucio DL, Goodman M, Stojanovic N, Miller W. Locs control regions of mammalian beta-globin gene clusters: combining phylogenetic analyses and experimental results to gain functional insights. Gene. 1996; 50: 52-59.
155
Harmsen S, Meijerman I, Beijnen JH, Schellens JH. Nuclear receptor mediated induction of cytochrome P450 3A4 by anticancer drugs: a key role for the pregnane X receptor. Cancer Chemother Pharmacol. 2009; 64: 35-43. Hart SN, Cui Y, Klaassen CD, Zhong XB. Three patterns of cytochrome P450 gene expression during liver maturation in mice. Drug Metab Dispos. 2009; 37: 116-121. Harvey JL, Paine AJ, Maurel P, Wright MC. Effect of the adrenal 11-beta-hydroxylase inhibitor meyrapone on human hepatic cytochrome P-450 expression: induction of cytochrome P-450 3A4. Drug metab Dispos. 2000; 28: 96-101. Hasegawa M, Kapelyukh Y, Tahara H, Seibler J, Rode A, Krueger S, Lee DN, Wolf CR, Scheer N. Quantitative prediction of human pregnane X receptor and cytochrome P450 3A4 mediated drug-drug interaction in a novel multiple humanized mouse line. Mol Pharmacol. 2011; 80: 518- 528. Ho SN. Intracellular water homeostasis and the mammalian cellular osmotic stress response. J Cell Physiol. 2006; 206:9-15. Hoffman WH, Helman SW, Passmore G. Acute activation of peripheral lymphocytes during treatment of diabetes ketoacidosis. J Diabetes Complications. 2001; 15: 144-149. Hoffmann ML, DenBleyker M, Smith JC, Stricker EM. Inhibition of thirst when dehydrated rats drink water or saline. Am J Physiol Regul Integr Comp Physiol. 2006; 290: R1199-1207. Holtbecker N, Fromm MF, Kroemer HK, Ohnhaus EE, Heidemann H. The nifedipine-rifampin interaction. Evidence for induction of gut wall metabolism. Drug Metab Dispos. 1996; 24:1121- 1123. Honkakoski P, Zelko I, Sueyoshi T, Negish M. the nuclear orphan receptor CAR-retinoid X receptor heterodimer activates the Phenobarbital-responsive enhancer module of the CYP2B gene. Mol Cell Biol. 1998; 18: 5652-5658. Honkakoski P, Negishi M. Regulation of cytochrome P450 genes by nuclear receptors. Biochem J. 1999; 347: 321-337. Houpt TR. Patterns of duodenal osmolality in young pigs fed solid food. Am J Physiol. 1991; 261:R569-575. Irarrazabal CE, Liu JC, Burg MB, Ferraris JD. ATM, a DNA damage-inducible kinase, contributes to activation by high NaCl of the transcription factor TonEBP/OREBP. Proc Natl Acad Sci USA. 2004; 101:8809-8814. Isin EM, Guengerich FP. Substrate binding to cytochromes P450. Anal Bioanal Chem. 2008; 392:1019-1030.
156
Ito T, Fujio Y, Hirata M, Takatani T, Matsuda T, Muraoka S, Takahashi K, Azuma J. Expression of taurine transporter is regulated through the TonE (tonicity-responsive element)/TonEBP (TonE-binding protein) pathway and contributes to cytoprotection in HepG2 cells. Biochem J. 2004; 382:177-182. Ito T, Asakura K, Tougou K, Fukuda T, Kubota R, Nonen S, Fujio Y, Azuma J. Regulation of cytochrome P450 2E1 under hypertonic environment through TonEBP in human hepatocytes. Mol Pharmacol. 2007; 72:173-181. Itoh T, Yamauchi A, Miyai A, Yokoyama K, Kamada T, Ueda N, Fujiwara Y. Mitogen- activated protein kinase and its activator are regulated by hypertonic stress in Madin–Darby canine kidney cells. J Clin Invest. 1994; 93:2387–2392. Jancova P, Anzenbacher P, Anzenbacherova E. Phase II drug metabolizing enzymes. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub. 2010; 154: 103-116. Jeon S, Kim KH, Yun CH, Hong BW, Chang YS, Han HS, Yoon US, Choi WB, Kim S, Lee AY. An NH2-terminal truncated cytochrome P450 CYP3A4 showing catalytic activity is present in the cytoplasm of human liver cells. Ex Mol Med. 2008; 40: 254-260. Jounaïdi Y, Hyrailles V, Gervot L, Maurel P. Detection of CYP3A5 allelic variant: a candidate for the polymorphic expression of the protein. Biochem Biophy Res Commun. 1996. 221: 466- 470. Kalantzi L, Goumas K, Kalioras V, Abrahamsson B, Dressman JB, Reppas C. Characterization of the human upper gastrointestinal contents under conditions simulating bioavailability/ bioequivalence studies. Pharm Res. 2006a; 23: 165-176. Kalantzi L, Persson E, Polentarutti B, Abrahamsson B, Goumas K, Dressman JB, Reppas C. Canine intestinal contents vs. stimulated media for the assessment of solubility of two weak bases in the human small intestinal contents. Pharm Res. 2006b; 23:1373-1381. Kang HJ, Song IS, Lee SS, Yoo MA, Shin JG. Effects of dietary salt on the expression of drug transporters cytochrome P4503a, and nuclear receptors in rats. Xenobiotica 2008; 38:147-155. Kato M. Intestinal first-pass metabolism of CYP3A4 substrates. Drug Metab Pharmacokinet. 2008; 23:87-9. Kawamoto T, Kakizaki S, Yoshinari K, Negishi M. Estrogen activation of the nuclear orphan receptor CAR (constitutive active receptor) in induction of the mouse Cyp2b10 gene. Mol Endocrinol. 2000; 14: 1897-1905. Khojasteh SC, Prabhu S, Kenny JR, Halladay JS, Lu AY. Chemical inhibitors of cytochrome P450 isoforms in human liver microsomes: a re-evaluation of P450 isoforms selectivity. Eur J Drug Metab Pharmacokinet. 2011; 36: 1-16. Kitada M, Kamataki T, Itahashi K, Rikihisa T, Kanakubo Y. P-450 HLFa, a form of cytochrome P-450 purified from human fetal livers, is the 16 alpha-hydroxylase of dehydroepiandrosterone 3-sulfate. J Biol Chem. 1987. 262: 13534-13537
157
Khan AA, Chow EC, van Loenen-Weemaes AM, Porte RJ, Pang KS, Grootuis GM. Comparison of effects of VDR versus PXR, FXR and GR ligands on the regulation of CYP3A isozymes in rat and human intestine and liver. Eur J Pharm Sci. 2009; 37:115-125. Kliewer SA, Moore JT, Wade L, Staudinger JL, Watson MA, Jones SA, McKee DD, Oliver BB, Willson TM, Zetterstrom RH, Perlmann T, Lehmann JM. An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway. Cell. 1998; 92:73-82. Kliewer SA, Wilson TM. Regulation of xenobiotics and bile acid metabolism by the nuclear pregnane X receptor. J Lipid Res. 2002; 43: 359-364. Ko BC, Ruepp B, Bohren KM, Gabbay KH, Chung SS. Identification and characterization of multiple osmotic response sequence in the human aldose reductase gene. J Biol Chem. 1997; 272: 16431-16437. Ko BC, Lam AK, Kapus A, Fan L, Chung SK, Chung SS. Fyn and p38 signaling are both required for maximal hypertonic activation of the osmotic response element-binding protein/tonicity-responsive enhancer-binding protein (OREBP/TonEBP). J Biol Chem. 2002; 277: 46085-46092. Ko BC, Turck CW, Lee KW, Yang Y, Chung SS. Purification, identification, and characterization of an osmotic response element binding protein. Biochem Biophys Res Commun. 2000; 270:52-61. Kocarek TA, Scheutz EG, Strom SC, Fisher RA, Guzelian PS. Comparative analysis of cytochrome P450 3A induction in primary cultures of rat, rabbit and human hepatocytes. Drug Metab Dispos. 1995; 23: 415-421. Kojima R. Taniguchi H, Tsuzuki A, Nakamura K, Sakakura Y, Ito M. Hypertonicity-induced expression of monocyte chemoattractant protein-1 through a novel cis-acting element and MAPK signalling pathways. J Immunol. 2010; 184: 5253-5262. Kolar JC, Awni WM, Merion RM, Watkins PB. First-pass metabolism of cyclosporine by the gut. Lancet. 1991; 14: 1488-1490. Kolar JC, Schmiedlin-Pen P, Schuetz JD, Fang C, Watkins PB. Identification of rifampin- inducible P450IIIA4 (CYP3A4) in human small bowel enterocytes. J Clin Invest. 1992; 90:1871- 1878. Komura H, Iwaki M. Species differences in in vitro and in vivo small intestinal metabolism of CYP3A substrates. J Pharm Sci. 2008; 97: 1775-1800. Kong F, Singh RP. Disintegration of solid foods in human stomach. J Food Sci. 2008; 73:R67- 80. Kosuge K, Chuang AI, Uematsu S, Tan KP, Ohashi K, Ko BC, Ito S. Discovery of osmosensitive transcriptional regulation of human cytochrome P450 3As by the tonicity- responsive enhancer binding protein (nuclear factor of activated T cells 5). Mol Pharmacol. 2007; 72:826-837. 158
Kotaru C, Hejal RB, Finigan JH, Coreno AJ, Skowronski ME, Brianas L, McFadden Jr. ER. Desiccation and hypertonicity of the airway surface fluid and thermally induced asthma. J. Appl. Physiol. 2003; 94: 227-233. Krusekopf S, Roots I, Kleeberg U. Differential drug-induced mRNA expression of human CYP3A4 compared to CYP3A5, CY3A7 and CYP3A43. Eur J Pharmacol. 2003; 466: 7-12. Kuehl P, Zhang J, Lin Y, Lamba J, Assem M, Schuetz J, Watkins PB, Daly A, Wrighton SA, Hall SD, Mauel P, Relling M, Brimers C, Yasuda K, Venkataramanan R, Strom S, Thummel K, Boguski MS, Schuetz E. Sequence diversity in CYP3A promoters and characterization of the genetic basis of polymorphic CYP3A expression. Nat Genet. 2001; 27:383-391. Kultz D, Chakravavarty D. Hyperosmolality in the form of elevated NaCl but not urea causes DNA damage in murine kidney cells. Proc Natl Acad Sci USA. 2001; 98:1999-2004. Ladas SD, Isaacs PE, Sladen GE. Post-prandial changes of osmolality and electrolyte concentration in the upper jejunum of normal man. Digestion. 1983; 26:218-23. Lam AK, Ko BC, Tam S, Morris R, Yang JY, Chung SK, Chung SS. Osmotic response element- binding protein (OREBP) is an essential regulator of the urine concentrating mechanism. J Biol Chem. 2004; 279:48048-54. Lamb DC, Waterman MR, Kelly SL, Guengerich FP. Cytochromes P450 and drug discovery. Curr Opin Biotechnol. 2007; 18:504-512. Lamba JK, Lin YS, Schuetz EG, Thummel KE. Genetic contribution to variable human CYP3A- mediated metabolism. Adv Drug Deliv Rev. 2002. 54: 1271-1294. Landes N, Pfluger P, Kluth D, Birringer M, Rühl R, Böl GF, Glatt H, Brigelius-Flohè R. Vitamin E activates gene expression via the pregnane X receptor. Biochem Pharmacol. 2003; 65:269-273. Lang F, Busch GL, Ritter M, Volkl H, Waldegger S, Gulbins E, Haussinger D. Functional significance of cell volume regulatory mechanisms. Physiol Rev. 1998; 78:247-306. Li Y, Wang q, Yao X, Li Y. Induction of CYP3A4 and MDR1 gene expression by baicalin, baicalein, chlorogeneic acid, and ginsenoside Rf through constitutive androstane receptor- and pregnane X receptor-mediated pathways. Eur J Pharmacol. 2010; 640: 45-54 Lin YS, Dowling AL, Quigley SD, Farin FM, Zhang J, Lamba J, Schuetz EG, Thummel KE. Co- regulation of CYP3A4 and CYP3A5 and contribution to hepatic and intestinal midazolam metabolism. Mol Pharmacol. 2002; 62: 162-172. Lindahl A, Ungel AL, Knutson L, Lennernas H. Characterization of fluids from the stomach and proximal jejunum in men and women. Pharm Res. 1997; 14:497-502. Lindner G, Kneidinger N, Holzinger U, Druml W, Schwarz C. Tonicity balance in patients with hypernatremia acquired in the intensive care unit. Am J Kidney Dis. 2009; 54: 674-679.
159
Liu Z, Garrard WT. Long-range interactions between three transcriptional enhancers, active Vkappa gene promoters, and a 3’ boundary sequence spanning 46 kilobases. Mol Cell Biol. 2005; 25: 3220-3231. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001; 25:402-408. Lee SD, Woo SK, Kwon HM. Dimerization is required for phosphorylation and DNA binding of TonEBP/NFAT5. Biochem Biophys Res Commun. 2002; 294: 968-975. Lee SD, Colla E, Sheen MR, Na KY, Kwon HM. Multiple domains of TonEBP cooperate to stimulate transcription in response to hypertonicity. J Biol Chem. 2003; 278: 47571-47577. Lee JH, Kim M, Im YS, Choi W, Byeon SH, Lee HK. NFAT5 induction and its role in hyperosmolar stressed human limbal epithelial cells. Invest Ophthalmol Vis Sci. 2008; 49:1827- 1835. Lee SD, Woo SK, Kwon HM. Dimerization is required for phosphorylation and DNA binding of TonEBP/NFAT5. Biochem Biophys Res Commun. 2002; 294: 968-975. Liu J, Callahan SM, Brunner LJ. Effects of sodium alternations on hepatic cytochrome P450 3A2 and 2C11 and renal function in rats. Drug Dev Ind Pharm. 2003; 29:767-775. Lopez-Rodriguez C, Antos CL, Shelton JM, Richardson JA, Lin F, Novobrantseva TI, Bronson RT, Igarashi P, Rao A, Olson EN. Loss of NFAT5 result in renal atrophy and lack of tonicity- responsive gene expression. Proc Natl Acad USA. 2004; 101: 2392-2397. Lopez-Rodriguez C, Aramburu J, Jin L, Rakeman AS, Michino M, Rao A. Bridging the NFAT and NF-kappaB families: NFAT5 dimerization regulates cytokine gene transcription in response to osmotic stress. Immunity. 2001; 15:47-58. Lopez-Rodriguez C, Aramburu J, Rakeman AS, Rao A. NFAT5, a constitutively nuclear NFAT protein that does not cooperate with Fos and Jun. Proc Natl Acad Sci USA. 1999; 96:7214-7219. Lown KS, Bailey DG, Fontana RJ, Janardan SK, Adair CH, Fortlage LA, Brown MB, Guo W, Watkins PB. Grapefruit juice increases felodipine oral availability in humans by decreasing intestinal protein expression. J Clinc. Invest. 1997; 99:2545-2553. Loyher ML, Mutin M, Woo SK, Kwon HM, Tappaz ML. Transcription factor tonicity- responsive enhancer-binding protein (TonEBP) which transactivates osmoprotective genes is expressed and upregulated following acute systemic hypertonicity in neurons in brain. Neruoscience. 2004; 124:89-104 Luo G, Cuningham M, Kim S, Burn T, Lin J, Sinz M, Hamilton G, Rizzo C, Jolley S, Gilbert D, Downey A, Mudra D, Graham R, Carroll K, Xie K, Madan A, Parkinson A, Christ D, Selling B, LeCluyse E, Gan LS. CYP3A4 induction by drugs: correlation between a pregnane X receptor reporter gene assay and CYP3A4 expression in human hepatocytes. Drug Metab Dispos. 2002; 30: 795-804.
160
Ma Q, Lu AY. CYP1A induction and human risk assessment: an evolving tale of in vitro and in vivo studies. Drug Metab Dispos. 2007a; 35:1009-1016. Ma X, Shah Y, Cheung C, Guo GL, Feigenbaum L, Krausz KW, Idle JR, Gonzalez FJ. The Pregnane X receptor gene-humanized mouse: a model for investigating drug-drug interactions mediated by cytochrome P450 3A. Drug Metab Dispos. 2007b; 35: 194-200. Mäkinen J, Frank C, Jyrkkärinne J, Gynther J, Carlberg C, Honkakoshi P. Modulation of mouse and human Phenobarbital-responsive enhancer module by nuclear receptors. Mol Pharmacol. 2002; 62: 366-378. Ma X, Cheung C, Krausz KW, Shah YM, Wang T, Idle JR, Gonzalez FJ. A double transgenic mouse model epressing human pregnane x receptor and cytochrome P450 3A4. Drug Metab Dispos. 2008; 36: 2506-2512. Mahajan MC, Narlikar GJ, Boyapaty G, Kingston RE, Weissman SM. Heterogeneous nuclear ribonucleoprotein C1/C2, MeCP1, and SWI/SNF form a chromatin remodeling complex at the beta globin locus control region. Proc Natl Acad Sci USA. 2005; 102: 15012-15017. Maouyo D, Kim JY, Lee SD, Wu Y, Woo SK, Kwon HM. Mouse TonEBP-NFAT5: expression in early development and alternative splicing. Am J Physiol Renal Physiol. 2002; 282: F802-809. McKinnon RA, Burgess WM, Hall PM, Roberts-Thomson SJ, Gonzalez FJ, McManus ME. Characterization of CYP3A gene subfamily expression in human gastrointestinal tissues. Gut. 1995; 36:259-267. Mei Q, Tang C, Assang C, Lin Y, Slaughter D, Rodrigues AD, Baillie TA, Rushmore TH, Shou M. Role of a potent inhibitory monoclonal antibody to cytochrome P-450 3A4 in assessment of human drug metabolism. J Pharmacol Exp Ther. 1999; 291: 749-459. Mignen O, Le Gall C, Harvey BJ, Thomas S. Volume regulation following hypotonic shock in isolated crypts of mouse distal colon. J Physiol. 1999; 515: 501-510. Miyakawa H, Woo SK, Chen CP, Dahl SC, Handler JS, Kwon HM. Cis- and trans-acting regulating transcription of the BGT1 gene in response to hypertonicity. Am J Physiol. 1998; 274:F753-761. Miyakawa H, Woo SK, Dahl SC, Handler JS, Kwon HM. Tonicity-responsive enhancer binding protein, a rel-like protein that stimulates transcription in response to hypertonicity. Proc Natl Acad Sci USA. 1999; 96: 2538-2542. Mizuno N, Niwa T, Yotsumoto Y, Sugiyama Y. Impact of drug transporter studies on drug discovery and development. Pharmacol Rev. 2003; 55: 425-461. Molowa DT. Schuetz EG, Wrighton SA, Watkins PB, Kremers P, Mendez-Picon G, Parker GA, Guzelian PS. Complete cDNA sequence of a cytochrome P-450 inducible by glucocorticoids in human liver. Proc Natl Acad Sci USA. 1986. 83: 5311-5315.
161
Moore JT, Kliewer SA. Use of the nuclear receptor PXR to predict drug interactions. Toxicology. 2000; 152: 1-10. Morancho B, Minguillon J, Molkentin JD, Lopez-Rodriguez C, Aramburu J. Analysis of the transcriptional activity of endogenous NFAT5 in primary cells using transgenic NFAT-luciferase reporter mice. BMC Mol Biol. 2008; 9:13 Morley SJ, Naegele S. Phosphorylation of eukaryotic initiation factor (eIF) 4E is not required for de novo protein synthesis following recovery from hypertonic stress in human kidney cells. J Biol Chem 2002; 277:32855-32859. Moriguchi T, Motohashi H, Hosoya T, Nakajima O, Takahashi S, Ohsako S, Aoki Y, Nishimura N, Tohyama C, Fujii-Kuriyama Y, Yamamoto M. Distict response to dioxin in an arylhydrocarbon receptor (AHR)-humanized mouse. Proc Natl Acad Sci USA. 2003; 100: 5652-5627. Na KY, Woo SK, Lee SD, Kwon HM. Silencing of TonEBP/NFAT5 transcriptional activator by RNA interference. J Am Soc Nephrol. 2003; 14:283-8. Navarro P, Chiong M, Volkwein K, Moraga F, Oscaranza MP, Jalil JE, Lim SW, Kim JA, Kwon HM, Lavandero S. Osmotically-induced genes are controlled by the transcription factor TonEBP in cultured cardiomyocytes. Biochem Biophys Res Commun. 2008; 372:326-330. Nelson DR, Koymans L, Kamataki T, Stegeman JJ, Feyereisen R, Waman DJ, Waterman MR, Gotoh O, Coon MJ, Estabrook RW, Gunsalus IC, Nebert DW. P450 superfamily: update on new sequences, gene mapping, accession numbers and nomenclature. Pharmacogenetics. 1996. 6: 1- 42 Nelson DR, Zeldin DC, Hoffman SM, Maltais LJ, Wain HM, Nebert DW. Comparison of cytochrome P450 (CYP) genes from the mouse and human genomes, including nomenclature recommendations for genes, pseudogenes and alternative-splice variants. Pharmacogenetics. 2004; 14: 1-18. Neuhofer W. Role of NFAT5 in inflammatory disorders associated with osmotic stress. Curr Genomics. 2010; 11: 584-590. Nishinaka D, Kishino F, Matuura A. Water and electrolyte absorption from hypotonic oral rehydration solution in rat small intestine and colon. Pediatr Int. 2004; 46: 315-321. Nishimura M, Yaguti H, Yoshitsugu H, Naito S, Satoh T. Tissue distribution of mRNA expression of human cytochrome P450 isoforms assessed by high-sensitivity real-time reverse transcription PCR. Yakugaku Zasshi. 2003. 123:369-375. Ohnishi A, Matsuo H, Yamada S, Takanaga H, Morimoto S, Shoyama Y, Ohtani H, Sawada Y. Effect of furanocoumarin derivatives in grapefruit juice on the uptake of vinblastine by Caco-2 cells and on the activity of cytochrome P450 3A4. Br J Pharmacol. 2000; 130:1369-77.
162
Ogg MS, Williams JM, Tarbit M, Goldfarb PS, Gray TJ, Gibson GG. A reporter gene assay to assess the molecular mechanisms of xenobiotics-dependent induction of the human CYP3A4 gene in vitro. Xenobiotica. 1999; 29:269-279. Osaka T, Kobayashi A, Inoue S. Therogenesis induced by osmotic stimulation of the intestines in the rat. J Physiol. 2001; 532: 261-269. Palevsky PM, Bhagrath R, Greenberg A. Hypernatremia in hospitalized patients. Ann Intern Med. 1996; 124: 197-203. Pang XY, Cheng J, Kim JH, Matsubara T, Krausz KW, Gonzalez FJ. Expression and regulation of human fetal-specific CYP3A7 in mice. Endocrinology. 2012; 153: 1453-1463. Parks DJ, Blanchard SG, Bledsoe RK, Chandra G, Consler TG, Kliewer SA, Stimmel JB, Wilson TM, Zavacki AM, Moore DD, Lehmann JM. Bile acids: natural ligands for an orphan nuclear receptor. Science. 1999; 284: 1365-1368. Pascussi JM Drocourt L, Gerbal-Chaloin S, Fabre JM, Maurel P, Vilarem MJ. Dual effect of dexamethasone on CYP3A4 gene expression in human hepatocytes: sequential role of glucocorticoid receptor and pregnane X receptor. Eur J Biochem. 2001; 268:6346-6358. Pascussi JM, Gerbal-Chaloin S, Drocourt L, Maruel P, Vilarem MJ. The expression of CYP2B6, CYP2C9 and CYP3A4 genes: a tangle of networks of nuclear and steroid receptors. Biochim Biophys Acta. 2003; 1619: 243-253. Pelkonen O, Turpeinen M, Hakkola J, Honkakoski P, Hukkanen J, Raunio H. Inhibition and induction of human cytochrome P450 enzymes: current status. Arch Toxicol. 2008; 82: 667-715. Peterson M, Mooseker M. Characterization of the enterocytes-like brush border cytoskeleton of the C2BBe clones of the human intestinal cell line, Caco-2. J Cell Sci. 1992; 102: 581-600. Pihl L, Wilander E, Nylander O. Comparative study of the effects of luminal hypotonicity on mucosal permeability in rat upper gastrointestinal tract. Acta Physiol (Oxf). 2008; 193: 67-78. Rims JS, Atta MG, Dahl SC, Berry GT, Handler JS, Kwon HM. Transcription of the sodium/myo-inositol cotransporter gene is regulated by multiple tonicity-responsive enhancers spread over 50 kilobase pairs in the 5’-flanking region. J Biol Chem. 1998; 273:20615-20621. Rodriguez-Antona C, Donato MT, Boobis A, Edwards RJ, Watts PS, Castel JV, Gomez-Lechon MJ. Cytochrome P450 expression in human hepatocytes and hepatoma cell lines: molecular mechanisms that determine lower expression in cultured cells. Xenobiotica 2002; 32: 505-520. Roncoroni C, Rizzi N, Brunialti E, Cali JJ, Klaubert DH, Maggi A, Ciana P. Molecular imaging of cytochrome P450 activity in mice. Pharmcol Res. 2012; 65: 531-536. Sakaguchi M, Mihar K, Sato R. Signal reconition particle is required for co-translation inservertion of cytochrome P-450 into microsomal membranes. Proc Natl Acad Sci USA. 1984; 81: 3361-3364.
163
Saeki M, Kurose K, Tohkin M, Hasegawa R. Identification of the function vitamin D response elements in the human MDR1 gene. Biochem Pharmacol. 2008; 76: 531-542. Sakuma T, Bhadhprasit W, Hashita T, Nemoto N. Synergism of glucocorticoid hormone with growth hormone for female-specific mouse Cyp3a44 gene expression. Drug Metab Dispos. 2008; 36:878-884. Sakuma T, Endo Y, Mashino M, Kuroiwa M, Ohara A, Jarukamojorn K, Nemoto N. Regulation of the expression of two female-predominant CYP3A mRNA (CYP3A41 and CYP3A44) in mouse liver by sex and growth hormones. Arch Biochem Biophys. 2002; 404: 234-242. Sakuma T. Takai M, Endo Y. Kuroiwa M, Ohara A,Jarukamjorn K, Honma R, Nemoto N. A novel female-specific member of the CYP3A subfamily in the mouse liver. Arch Biochem Biophys. 2000; 377: 153-162. Sane RS, Buckley DJ, Buckley AR, Nallani SC, Desai PB. Role of human pregnane X receptor in tamoxifen- and 4-hydroxytamoxifen- mediated CYP3A4 induction in primary human hepatocytes and LS174T cells. Drug Metab Dispos. 2008; 36: 946-954. Schilli R, Breuer RI, Klein F, Dunn K, Gnaedinger A, Bernstein J, Paige M, Kaufman M. Comparison of the composition of faecal fluid in Crohn’s disease and ulcerative colitis. Gut 1982; 23: 326-332. Schmiedlin-Ren P, Thummel KE, Fisher JM, Paine MF, Lown KS, Watkins PB. Expression of enzymatically active CYP3A4 by Caco-2 cells grown on extracellular matrix-coated permeable supports in the presence of 1alpha,25-dihydroxyvitamin D3. Mol Pharmacol. 1997; 51:741-754. Schuetz EG, Schuetz JD, Strom SC, Thompson MT, Fisher RA, Molowa DT, Li D, Guzelian PS. Regulation of human liver cytochromes P-450 in family 3A in primary and continous culture of human hepatocytes. Hepatology. 1993; 18: 1254-1262. Schuetz JD, Schuetz EG, Thottassery JV, Guzelian PS, Strom S, Sun D. Identification of a novel dexamethasone responsive enhancer in the human CYP3A5 gene and its activation in human and rat liver cells. Mol Pharmacol. 1996; 49: 63-72.
Sérée E, Villard PH, Hevér A, Guigal N, Puyoou F, Charvet B, Point-Scomma H, Lechevalier E, Lacarelle B, Barra Y. Modulation of MDR1 and CYP3A expression by dexamethasone: evidence for an inverse regulation in adrenals. Biochem Biophys Res Commun. 1998; 252: 392-395.
Sheppard KE. Nuclear receptors. II. Intestinal corticosteroid receptors. Am J Physiol Gastrointest Liver Physiol. 2002; 282: G742-746. Stanley LA, Horsburgh BC, Ross J, Scheer N, Wolf CR. PXR and CAR: nuclear receptors which play a pivotal role in drug disposition and chemical toxicity. Drug Metab Rev. 2006; 38: 515- 597. Street TO, Bolen DW, Rose GD. A molecular mechanism for osmolyte-induced protein stability. Proc Natl Acad Sci USA. 2006; 103:13997-14002.
164
Stresser DM, Broudy MI, Ho T, Cargill CE, Blanchard A, Sharma R, Dandeneau AA, Goodwin JJ, Turner SD, Erve JC, Patten CJ, Dehal SS, Crespi CL. Highly selective inhibition of human CYP3Aa in vitro by azamulin and evidence that inhibition is irreversible. Drug Metab Dispos. 2004; 32: 105-112. Strolin Benedetti M, Whomsley R, Baltes EL. Differences in absorption, distribution, metabolism, and excretion of xenobiotics between the paediatric and adult populations. Expert Opin Drug Metab Toxicol. 2005; 1: 446-471. Subramanian M, Tam H, Zheng H, Tracy TS. CYP2C9-CYP3A4 protein-protein interactions: role of the hydrophobic N terminus. Drug Metab Dipos. 2010; 38: 1003-1009. Sueyoshi T, Negishi M. Phenobarbital response elements of cytochrome P450 genes and nuclear receptors. Annu Rev Pharmacol Toxicol. 2001; 41:123-143. Svecova L, Vrzal R, Burysek L, Anzenbacherova E, Cerveny L, Grim J, Trejtnar F, Kunes J, Pour M, Satud F, Anzenbacher P, Dvorak Z, Pavek P. Azole antimycotics differentially affect rifampicin-induced pregnane X receptor-mediated CYP3A4 gene expression. Drug Metab Dispos. 2008; 36: 339-348. Takara K, Ohnishi N, Horibe S, Yokoyama T. Expression profiles of drug-metabolizing enzymes CYP3A and drug efflux transporter multidrug resistance 1 subfamily mRNA in rat small intestine. Drug Metab Dispos. 2003; 31: 1253-1239. Takeshita A, Koibuchi N, Oka J, Taguchi M, Shishiba Y, Ozawa Y. Bisphenol-A, an environmental estrogen, activates the human orphan nuclear receptor; steroid and xenobiotics receptor mediated transcription. Eur J Endocrinol. 2001; 154: 513-517. Tegude H, Schnabel A, Zanger UM, Klein K, Eichelbaum M, Burk O. Molecular mechanism of basal CYP3A regulation by hepatocyte nuclear factor 4alpha: evidence for direct regulation in the intestine. Drug Metab Dispos. 2007; 35: 946-954. Teng S, Jekerle V, Piquette-Miller M. Induction of ABCC3 (MRP3) by pregnane X receptor activators. Drug Metab Dispos. 2003; 31:1296-1299. Thelen K, Dressman JB. Cytochrome P450-mediated metabolism in the human gut wall. J Pharm Pharmacol. 2009; 61: 541-558. Thompson EE, Kuttab-Boulos H, Witonsky D, Yang L, Roe BA, Di Rienzo A. CYP3A variation and the evolution of salt-sensitivity variants. Am J Hum Genet. 2004; 75:1059-1069. Thompson EE, Kuttab-Boulous H, Yang L, Roe BA, Di Rienzo A. Sequence diversity and haplotype structure at the human CYP3A cluster. Pharmacogenomics J. 2006; 6: 105-114. Thummel KE, Brimer C, Yasuda K, Thottassery J, Senn T, Lin Y, Ishizuka H, Kharasch E, Schuetz J, Schuetz E. Transcriptional control of intestinal cytochrome P-4503A by 1alpha,25- dihydroxy vitamin D3. Mol Pharmacol. 2001; 60:1399-1406.
165
Tirona RG, Lee W, Leake BF, Lan LB, Cline CB, Lamba V, Parviz F, Duncan SA, Inoue Y, Gonzalez FJ, Schuetz EG, Kim RB. The orphan nuclear receptor HNF4alpha determines PXR- and CAR-mediated xenobiotic induction of CYP3A4. Nat Med. 2003; 9:220-224. Tomlinson A, Khanal S, Ramaesh K, Diaper C, McFadyen A. Tear film osmolarity: determination of a referent for dry eye diagnosis. Invest. Ophthalmol. Vis. Sci. 2006; 47: 4309- 3415. Tompkins LM, Wallace AD. Mechanisms of cytochrome P450 induction. J Biochem Mol Toxicol. 2007; 21: 176-181 Tong EH, Guo KK, Huang AL, Liu H, Hu CD, Chung SS, Ko BC. Regulation of nucleocytoplasmic trafficking of transcription factor OREBP/TonEBP/NFAT5. J Biol Chem. 2006; 81:23870-23879. Tracy TS, Korzekwa KR, Gonzalez FJ, Wainer W. Cytochrome P450 isoforms involved in metabolism of the enantiomers of verapamil and norverapamil. Br J Clin Pharmacol. 1999; 47:545-552. Trama J, Lu Q, Hawley RG, Ho SN. The NFAT-related proteinNFATL1 (TonEBP/NFAT5) is induced upon T cell activation in a calcineurin-dependent manner. J Immunol. 2000; 165:4884- 4894. Tsunoda SM, Velez RL, Von Moltke LL, Greenblatt DJ. Differentiation of intestinal and hepatic cytochrome P450 3A activity with use of midazolam as an in vivo probe: Effect of ketoconazole. Clinc Pharmacol Ther. 1999; 66:461-471. Tucker MJ, Kalinowski AE, Orton TC. Carcinogenicity of cyproterone acetate in the mouse. Carcinogenesis. 1996; 17: 1473-1436. van Herwaarden AE, Wagenaar E, vander Kruijssen CM, van Waterschoot RA, Smit JW, Song JY, van der Valk MA, van Tellingen O, van der Hoorn JW, Rosing H, Beijnen JH, Schinkel AH. Knockout of cytochrome P450 3A yields new mouse models for understanding xenobiotic metabolism. J Clin Invest. 2007 117: 3583-3592. van Waterschoot RA, Roosinkel RW, Sparidans RW, van Herwaarden AE, Beijnen JH, Schinkel AH. Inhibition and stimulation of intestinal and hepatic CYP3A activity: studies in humanized CYP3A4 transgenic mice using triazolam. Drug Metab Dispos. 2009; 37: 2305-2313. Vernia P, Gnaedinger A, Hauck W, Breuer RI. Organic anions and the diarrhea of inflammatory bowel disease. Dig Dis Sci. 1988; 33: 1353-1358. Wang K, Chen S, Xie W, Wang YJ. Retinoids induce cytochrome P450 3A4 through RXR/VDR-mediated pathway. Biochem Pharmacol 2008; 75:2204-2213. Wang T, Shankar K, Ronis MJ, Mehendale HM. Mechanism and outcomes of drug- and toxicant-induced liver toxicity in diabetes. Crit Rev Toxicol. 2007; 37:413-459.
166
Wang Y, Ko BC, Yang JY, Lam TT, Jiang Z, Zhang J, Chung SK, Chung SS. Transgenic mice expressing dominant-negative osmotic-response element-binding protein (OREBP) in lens exhibit fiber cell elongation defect associated with increased DNA breaks. J Biol Chem. 2005; 280:19986-91. Wang YX, Crofton JT, Miller J, Sigman CJ, Liu H, Huber JM, Brooks DP, Share L. Sex difference in urinary concentrating ability of rats with water deprivation. Am J Physiol. 1996; 270: R550-555. Watkins PB, Wrighton SA, Maurel P, Schuetz EG, Mendez-Picon G, Parker GA, Guezelian PS. Identification of an inducbile form of cytochrome P-450 in human liver. Proc Natl Acad Sci USA. 1985; 82: 6310-6314. Watkins RE, Wiseley GB, Moore LB, Collins JL, Lambert MH, Williams S, Wilson TM, Kliewer SA, Redinbo MR. The human nuclear xenobiotics receptor PXR: structural determinants of directed promiscuity. Science. 2001; 292: 2329-2333. Westlind A, Malmebo S, Johansson I, Otter C, Andersson TB, Ingelman-Sundberg M, Oscarson M. Cloning and tissue distribution of a novel human cytochrome p450 of the CYP3A subfamily, CYP3A43. Biochem Biophys Res Commun. 2001; 182: 1349-1355. Whiteworth JA, Williamson PM, Mangos G, Kelly JJ. Cardiovascular consequences of cortisol excess. Vasc Health Risk Manag. 2005; 1: 291-299. Williams PA, Cosme J, Vinkovic DM, Ward A, Angove HC, Day PJ, Vonrhein C, Tickle IJ, Jhoti J. Crystal structures of human cytochrome P450 3A4 bound to metyrapone and progesterone. Science. 2004a; 305: 683-686. Williams ET, Rodin AS, Strobel HW. Defining relationships between known members of the cytochrome P450 3A subfamily, including five putative chimpanzee members. Mol Phylogenet Evol. 2004b; 33: 300-308. Wrighton SA, Ring BJ, Watkins PB, VandenBranden M. Identification of a polymorphically expressed member of the human cytochrome P-450III family. Mol Pharmacol 1989. 36: 97-105. Woo SK, Lee SD, Na KY, Park WK, Kwon HM. TonEBP/NFAT5 stimulates transcription of HSP70 in response to hypertonicity. Mol Cell Biol 2002; 22:5753-60. Xie W, Barwick JL, Downes M, Blumberg B, Simon CM, Nelson MC, Neuschwander-Tetri BA, Brunt EM, Guzelian PS, Evans RM. Humanized xenobiotics response in mice expressing nuclear receptor SXR. Nature. 2000a; 406: 435-349. Xie W, Barwick JL, Simon CM, Pierce AM, Safe S, Blumberg B, Guzelian PS, Evans RM. Reciprocal activation of xenobiotic response genes by nuclear receptors SXR/PXR and CAR. Genes Dev. 2000b; 14:3014-3023. Xie W, Radominska-Pandya A, Shi Y, Simon CM, Nelson MC, Ong ES, Waxman DJ, Evans RM. An essential role for nuclear receptors SXR/PXR in detoxification of cholestatic bile acids. Proc Natl Acad Sci USA. 2001; 98: 3375-3380. 167
Xie H, Afsharian P, Terelius Y, Mirghani RA, Yasar U, Hagbjörk AL, Lundgren S, Hu Y, Rane A, Hassan M. Cyclophosphamide induces mRNA, protein and enzyme activity of cytochrome P450 in rat. Xenobiotica. 2005; 35:239-251. Xu C, Li CY, Kong AN. Induction of phase I, II, and III drug metabolism/transport by xenobiotics. Arch Pharm Res. 2005; 28:249-268. Yamauchi A, Uchida S, Preston AS, Kwon HM, Handler JS. Hypertonicity stimulates transcription of gene for Na(+)-myo-inositol cotransporter in MDCK cells. Am J Physiol. 1993; 264:F20-F23. Yanagimoto T, Itoh S, Sawada M, Kamataki T. Mouse cytochrome P450 (Cyp3a11): Predominant expression in liver and capacity to activate alfatoxin B1. Arch Biochem Biophys. 1997; 340: 215-218. Yano JK, Wester MR, Schoch GA, Griffin KJ, Stout CD, Johnson EF. The structure of human microsomal cytochrome P450 3A4 determined by X-ray crystallography to 2.05-A resolution. J Biol Chem. 2004; 279: 38091-38094. Yu AM, Fukamachi K, Krausz KW, Cheung C, Gonzalez FJ. Potential role for human cytochrome P450 3A4 in estradiol homeostasis. Endocrinology. 2005; 146: 2911-2919. Zelko I, Negishi M. Phenobarbital-elicited activation of nuclear receptor CAR in induction of cytochrome P450 genes. Biochem Biophys Res Commun. 2000; 277:1-6. Zhang Z, Cohen DM. NaCl but not urea activates p38 and jun kinase in IMCD3 murine inner medullary cells. Am J Physiol Renal Physiol. 1996; 271: F1234–F1238
Zhang Z, Dmitrieva NI, Park HK, Levine RL, Burg MB. High urea and NaCl carbonylate proteins in renal cells in culture and in vivo, and high urea causes 8-oxoguanine lesions in their DNA. Proc Natl Acad Sci USA. 2004; 101: 9491-9496. Zhou C, Tabb MM, Nelson EL, Grün F, Verma S, Sadatrafiei A, Lin M, Mallick S, Forman BM, Thummel KE, Blumberg B. Mutual repression between steroid and xenobiotic receptor and NF- κB signaling pathways links xenobiotic metabolism and inflammation. J Clin Inv 2006;116: 2280-2289
168
Acknowledgment of works completed:
All figures, tables, graphs, experiments and analysis in this thesis were completed by Andrew
Chuang, unless otherwise stated. Several figures from the thesis were taken directly from Kosuge and Chuang et al., 2007. In some cases, figures were redrawn by Andrew Chuang to include statistical treatments from the initial data (refer to figure legends). Kazuhiro Kosuge was the initial discoverer of the hypertonic upregulation of CYP3A, and was responsible for the data collection and figures from Section 3.1.1, Figure 3.2.3.1 and Figure 3.2.3.5. Kazushiro Kosuge and Satoko Uemastu were responsible for the data collected for Figure 3.1.3.1, Figure 3.2.2.1,
Figure 3.2.2.2, Figure 3.2.3.4, Figure 3.2.3.6 and Figure 3.2.3.7.
For Figure 3.2.3.2, characterization of ±10 kb putative TonE sites were completed by Kazuhiro
Kosuge except constructs containing the anti-sense TonE sites at +4688/+4698 from the
CYP3A7 transcriptional start site, and +5636/+5646 from the CYP3A4 transcriptional start site.
Additional characterization of ±20 kb putative TonE sites for each major CYP3A promoters were completed by Andrew Chuang but were partially shown in the thesis as negative results
(Appendix 3.2.3.A).
Mingdong Yang was a laboratory technician who was responsible for animal well-being and assisted with tissue extraction. Pooja Dalvi performed the staining procedures in immunohistochemistry for liver, kidney and duodenum samples.
169
List of publications and poster presentations:
Publications: First-authorship: Chuang AI, Ito S. Ambient tonicity and intestinal cytochrome CYP3A. Expert Opin Drug Metab Toxicol. 2010; 6:883-893. Chuang AI, Ito S. Osmosensitive Expression of Human CYP3A In Vitro. Medimond Inernational Proceedings: 17th International Symposium on Microsomes and Drug Oxidation; 2008.
Co-first-authorship: Kosuge K, Chuang AI, Uematsu S, Tan KP, Ohashi K, Ko BC, Ito S. Discovery of osmosensitive transcriptional regulation of human cytochrome P450 3As by the tonicity- responsive enhancer binding protein (nuclear factor of activated T cells 5). Mol Pharmacol. 2007; 72:826-837.
Authorship: Tan KP, Wang B, Yang M, Butros PC, Macaulay J, Xu H, Chuang AI, Kosuge K, Yamamoto M, Takahashi S, Wu AM, Ross DD, Harper PA, Ito S. Aryl hydrocarbon receptor is a transcriptional activator of the human breast cancer resistance protein (BCRP/ABCG2). Mol Pharmacol. 2010; 78: 175-185.
Poster presentations: Canadian Society of Pharmacology and Therapeutics, Banff, Alberta, Canada, 2007: “Discovery of Osmo-Sensitive Transcriptional Regulation of Human Cytochrome P450 3As (CYP3A) by the Tonicity-Responsive Enhancer Binding Protein (TonEBP/NFAT5)” International Symposium on Microsomes & Drug Oxidations. Saratoga Springs NY USA, 2008: “Cytochrome P450 Expression Profile in Cultured and Primary Hepatocytes Under NaCl- Induced Hyperosmolality” Hospital for Sick Children, Research Institute Retreat, Toronto, Ontario, Canada, 2008: “Cytochrome P450 Expression Profile in Cultured and Primary Hepatocytes Under NaCl- Induced Hyperosmolality.” Hospital for Sick Children, Research Institute Retreat, Toronto, Ontario, Canada, 2009: “Effects of Hypertonicity on CYP3A Expression In Vivo” Experimental Biology, Anaheim, California, USA, 2010: “Effects of Hypertonicity on Transgenic Human CYP3A Expression In Vivo” Canadian Society of Pharmacology and Therapeutics, Montreal, Ontario, Canada, 2011: “Hypertonicity-Induced Expression of Human CYP3A in a Humanized Transgenic Mouse Model” 170
Appendices:
Appendix 3.1.1.A Actinomycin D experiments
Actinomycin D experiments in C2bbe1 cells. mRNA levels of CYP3A4 and CYP3A7 were examined via real‐time RT‐PCR after treatment with or without actinomycin D.
171
Appendix 3.1.3.A Demographics of primary hepatocyte donors
CYP3A5 Xenobiotic Vendor Donor Age Gender Race Medical History/COD genotype Exposure (Lot #)
Lonza 1 21 M CA *1/*3 Healthy (Tan16336)
2 32 M CA *1/*3 Healthy Celsis-IVT
Lonza 3 37 M CA *1/*3 Hypertension (Tan17691)
Celsis-IVT
4 45 M AA *1/*6 Hypertension/CVA (MHU-L- 020709
Celsis-IVT
5 50 M AA *1/*6 Head trauma Alcohol (MHU-L- 051309)
Celsis-IVT Alcohol, 6 66 M AA *1/*1 CVA tobacco (MHU-L- 071109)
Healthy/Cardiac arrest BD Gentest 7 5 M AA *1/*1 secondary to stroke (260)
obesity, hypertension, BD Gentest 8 53 M AA *1/*1 COPD, schizophrenia, type Tobacco (MHU-L- II diabetes/anoxia 082809)
BD Gentest CMV, cirrhosis, heart Alcohol, 9 40 M AA *1/*6 attacks/ICH tobacco (MHU-L- 101409)
10 50 M AA *1/*1 Healthy/Anoxia Lonza
172
Appendix 3.1.3.B
Rifampicin induced human CYP3A mRNA in primary human hepatocytes. Fresh primary hepatocytes were incubated with 25 μm rifampicin for 24 hours and mRNA measured with real‐ time RT‐PCR. Results are normalized to GAPDH levels, and expressed as ratios to untreated baseline conditions (mean ± S.E.M., N = 10, *P < 0.05).
173
Appendix 3.1.4.A
7
6
5
4
3
2
1 mRNA fold induction to isotonic mRNA 0 CYP3A4 CYP3A5 CYP3A7 AKR1B1 SLC5A3
Hypertonicity induced CYP3A5 mRNA in HepaRG cells. HepaRG cells were incubated in hypertonic medium (+50 mM NaCl) for 24 hours and mRNA levels measured with real‐time RT‐ PCR. Results are normalized to GAPDH levels, and expressed as ratios to isotonic conditions. A representative figure is shown from two independent experiments.
174
Appendix 3.1.4.B
4
3
2
1 mRNA fold induction to isotonic mRNA 0 CYP3A4 CYP3A5 CYP3A7
Rifampicin induction of CYP3A4 mRNA in HepaRG cells. HepaRG cells were incubated with 25 μm rifampicin for 24 hours and mRNA levels were measured with real‐time RT‐PCR. Results are normalized to GAPDH levels, and expressed as ratios to isotonic conditions. A representative figure is shown from two independent experiments.
175
Appendix 3.2.1.A
NFAT5 distribution in C2bbe1 cells treated with hypertonicity. After a 4‐hour treatment with iso‐ or hyperosmolality medium (400 mOsmol/kg), C2bbe1 cells were fixed, incubated with the NFAT5 antibody, and visualized using Cy3‐conjugated anti‐rabbit IgG. [Republished from Kosuge and Chuang et al. (2007), with permission from the publisher].
176
Appendix 3.2.2.A
siNFAT5 knockdown of NFAT5 mRNA. mRNA level of NFAT5 and its target genes were measured using real‐time RT‐PCR following transfection of pooled siRNA against NFAT5 in HepG2 cells. Results are expressed against untreated control with non‐specific siRNA.
177
Appendix 3.2.3.A
3A4+16973+17339+18160-luc
3A4+15040+15160-luc
3A4-19273-luc No Treatment +NaCl CYP3A4 minimal promoter
012 Relative Luciferase Activity
Examples of unresponsive CYP3A TonE motifs. Reporter constructs that contained single or multiple putative TonE sites within the CYP3A4 gene were placed 5’ of the CYP3A4 minimal
promoter. C2bbe1 cells were transfected with these constructs and treated with NaCl (+50 mM NaCl) for 24 hours. Results are expressed as relative luciferase activity compared with the CYP3A4 minimal promoter. Numbers represent the position of putative TonE sites relative to the CYP3A4 transcriptional start site. These putative TonE sites are expansions of the original search criteria of ±10 kb of CYP3A transcriptional start sites (Figure 3.2.3.2) to ±20kb.
178
Appendix 3.3.2.A
Interventions Plasma osmolality (mOsm/kg)
Baseline 318.7±2.2
Water (I.P. injected) 319.3±9.9
PBS (I.P. injected) 328.3±8.8
Sucrose (I.P. injected) 397.3±19.3*
Cyclic water-deprivation 321.6±3.5
Pooled Urinary Osmolality (mOsm/kg)
Baseline 2700
Cyclic water-deprivation 4155
Crushed diet osmolalitya
Sodium-deficient (Low-salt chow) 57
Normal-salt chow (0.49% NaCl) 61
High-salt chow (8% NaCl) 243
Osmolality measurements in animal‐use protocols. Male CYP3A4/CYP3A7‐humanized mice were given I.P. injections of water, PBS or 2 M sucrose solution at 2.0 mL/100g body mass. After 6 hrs of water deprivation, blood from animals was obtained by cardiac puncture and plasma osmolality were measured using a freezing point osmometer. In other experiments, blood and urine samples were collected from animals undergoing cyclic water‐deprivation where animals experienced four periods of 24‐hour water deprivation phases interspersed by three periods of 24‐hour water ad lib phases. Plasma osmolality values are shown as mean ± S.E.M., N = 4–10, with *P < 0.05 as compared with PBS injection values. For urinary samples, a pooled sample of 3 animals was used in each group. Acrushed diet osmolality was measured by crushing 0.4 grams of chow and resuspended in 750μL of ddH2O.
179
Appendix 3.3.2.B
mRNA levels in mice under acute systemic hypertonicity (expressed as fold induction compared to water-injected control) Genes Liver Kidney NFAT5- Akr1b3 1.04±0.08 1.05±0.01 Responsive (Aldose Reductase) Genes Slc6a12 2.64±0.44 2.50±1.54 (Bgt1) Slc5a3 0.45±0.03 1.02±0.14 (Smit) Slc6a6 ↑3.90±0.21* 1.39±0.26 (TauT) Mouse Cyp3a Cyp3a11 1.22±0.35 4.40±1.37 Cyp3a16 Not detected Not detected Cyp3a25 1.77±0.31 3.01±2.02 Cyp3a41 1.40±0.57 Not detected Human CYP3A4 0.46±0.21 0.69±0.37 CYP3A CYP3A7 Not detected Not detected Transgenes mRNA response to acute plasma hypertonicity in CYP3A4/CYP3A7‐humanized transgenic mouse. Male CYP3A4/CYP3A7‐humanized mice were given I.P. injections of water or 2 M sucrose solution at 2.0 mL/100g body weight. After 6 hours of water deprivation, animals were sacrificed and RNA was harvested. mRNA levels were measured by real‐time RT‐PCR and normalized to respective Gapdh values. NFAT5 target genes: Akr1b3 (Aldose Reductase); Slc6a12 (betaine GABA transporter, Bgt1), Slc5a3 (sodium‐myo‐inositol transporter, Smit) and Slc6a6 (taurine transporter, TauT). Results are expressed as fold inductions as compared to the water injected group (mean ± S.E.M., N = 3, *P < 0.05).
180
Appendix 3.3.2.C
NFAT5 target genes are unresponsive after 24 water deprivation in CYP3A4/CYP3A7‐ humanized transgenic mouse. Animals were water‐deprived for 24 hours and mRNA levels measured using real‐time RT‐PCR. Results are shown as mRNA fold inductions to untreated control. N = 4 with SEM. Grubbs test with α = 0.05 was performed to remove any outliers. a = significant decrease, p < 0.05
181
Appendix 3.3.2.D
Weight changes during the course of cyclic water‐deprivation. Male CYP3A4/CYP3A7‐ humanized transgenic mice were placed on cyclic water‐deprivation as described in materials and methods. Animal weights were measured at the end of each day, and the percentage change in body weight from day 0 was calculated. A representative pair is shown.
182
Appendix 3.3.2.E
Weight changes after cyclic water‐deprivation. CYP3A4/CYP3A7‐humanized mice undergoing cyclic water‐deprivation experienced four periods of 24‐hour water deprivation phases interspersded by three periods of 24‐hour water ad lib phases. The weight was measured every day, and changes from the respective baseline values were expressed as % change in male and female mice separately. The results at the end of Day 7 are shown as median (bar) and the inter‐quartile range (IQR, box). NS: not significant.
183
Appendix 3.3.2.F
NFAT5 target genes are unresponsive after one week of cyclic water‐deprivation in female CYP3A4/CYP3A7‐humanized transgenic mouse. Female CYP3A4/CYP3A7‐humanized mice were placed on cyclic water‐deprivation as described in materials and methods and mRNA levels measured using real‐time RT‐PCR. Results are shown as mRNA fold inductions to untreated control. N = 3–4 with SEM. Grubbs test with α = 0.05 was performed to remove any outliers. * = significant increase, p < 0.05
184
Appendix 3.3.3.A
1 mRNA fold induction to untreated mRNA
0
Selected glucocorticoid target genes are not increased in cyclic water‐deprived animals. Livers from male CYP3A4/CYP3A7‐humanized mice were taken from the cyclic water‐deprived group as described in materials and methods. RNA was extracted and mRNA levels were measured using real‐time RT‐PCR. Results are shown as mRNA fold inductions to untreated control. N = 3– 7 with SEM. Grubbs test with α = 0.05 was performed to remove any outliers.
185
Appendix 3.4.2.A
Duodenal mRNA fold induction Gene Female Male Akr1b3 0.87±0.10 (N=6) 0.97±0.02 (N=3) (Aldose Reductase) Slc6a12 Not Detected Not detected (Bgt1) After Treatment (N=3) Slc5a3 1.36±0.05 (N=5) 1.13±0.09 (N=3) (Smit) Slc6a6 1.18±0.30 (N=6) Not detected (TauT)
mRNA response to acute intestinal hypertonicity in C57/BL6 mice. C57/BL6 mice were given water or 200 g/L sucrose solution at 1 mL/100g body weight by gavage three times every 4 hours. At the 12‐hour mark, animals were killed and duodenal scrapings were collected. mRNA levels were measured with real‐time RT‐PCR and normalized to Gadph values. NFAT5 target genes: Akr1b3 (aldose reductase); Slc6a12 (betaine GABA transporter, Bgt1), Slc5a3 (sodium‐ myo‐inositol transporter, Smit) and Slc6a6 (taurine transporter, TauT).
186
Appendix 4.1.A
Relative CYP3A and PXR mRNA levels of C2bbe1 cells compared to HepG2. mRNA levels of various CYP3A isoforms and PXR were measured from C2bbe1 cells with real‐time RT‐PCR. Results are shown as relative mRNA‐fold levels as compared to HepG2 cells.
187
Appendix 4.2.A
Human CYP3A TonE is active in a long promoter construct. CYP3A7 intron 2 TonE
CYP3A7[+4910/+5590] was placed in front of the CYP3A4 long promoter construct (CYP3A4[‐10466/+53]) in the sense (black shaded bars), or anti‐sense (open bars) direction. Results are expressed as fold‐luciferase activity to the enhancer‐less CYP3A4 long promoter construct. N = 3 with SEM shown. *represents statistical increase (p < 0.05) compared with the enhancer‐less CYP3A4 promoter construct with medium alone. # represent a statistical increase (p < 0.05) compared with both the enhancer‐less CYP3A4 promoter construct, and its own construct with medium alone.
188
Appendix 4.2.B
Genotype mRNA average fold against N P value against CYP3A5*1/*1 isotonic control (±SEM) mRNA average fold-induction
CYP3A5*1/*1 1.65±0.39 4 -
CYP3A5*1/*3 3.37±0.50 3 0.053
CYP3A5*1/*6 1.40±0.20 3 0.599
Genotype and average fold‐induction of CYP3A5 mRNA transcripts in primary hepatocytes. Primary hepatocytes were subjected to 24‐hour hypertonic treatment (+50 mM NaCl, +100 mOsm/kg) and mRNA levels were measured using real‐time RT‐PCR. The real‐time RT‐PCR probe used detects the wild‐type CYP3A5*1 transcripts. A student T‐test was used to compare the fold difference against the CYP3A5*1/*1 genotype.
189
Appendix 4.4.1.A
Gene Sense Anti-sense
CYP3A7 -7900/-7890
-551/-541 +4688/+4698 (intron 2)
+5076/+5086 (intron 2)
+5417+5427 (intron 2*)
Cyp3a11 -7932/-7922 -4983/-4973
-3122/-3112 -2639/-2629
+3968/+3978 (intron 2)
+4419/+4429 (exon 3)
+4444/+4454 (intron 3) +6064/+6076 (intron 3)
+8564/+8574 (intron 4)
Cyp3a13 -9698/-9688
-8786/-8776 -7715/-7705
-2076/-2066
+122/+132 (exon1)
+7751/+7761 (intron 4)
+8854/+8864 (intron 4)
+9093/+9103 (intron 4)
Putative TonE motifs of mouse Cyp3a11 and Cyp3a13. Positions of putative TonE motifs with the following sequence TGGAAANNYNY (N = any nucleotide, Y = C/T) within ±10,000 bp of the transcriptional initiation sites of CYP3A7, Cyp3a11 and Cyp3a13 are shown. * represents the active TonE site found in Kosuge and Chuang et al. (2007).
190
Appendix 4.4.2.A
Phenobarbital induction of human CYP3A4 mRNA in the CYP3A4/CY3A7‐humanized transgenic mouse. CYP3A4 mRNA levels of various tissues in male and female transgenic mice were measured via real‐time RT‐PCR after IP injection of phenobarbital at 60 mg/kg/day for two days. Results are shown as mRNA fold‐induction to untreated controls. A representative figure of two independent samplings is shown.
191
Appendix 4.4.2.B
High-salt diet (8% NaCl) Average(g) S.E.M. Starting weight 18.78 0.77 End weight 18.08 0.80 % change in weight -3.76% 1.17% Food eaten 23.10 1.26
Normal-salt diet (0.5% NaCl) Average(g) S.E.M. Starting weight 17.70 0.47 End weight 17.37 0.67 % change in weight -1.93% 1.75% Food eaten 22.27 1.45
Low-salt diet (0% NaCl) Average(g) S.E.M. Starting weight 17.57 0.41 End weight 17.23 0.27 % change in weight -1.55% 1.57% Food eaten 22.57 0.82
Food and animal weight measurements in salt diet experiments. Female CYP3A4/CYP3A7‐ humanized mice were given free access to low, normal or high‐salt food pellets. Initial weights of each animal were measured and averaged before and after experiments. N=3‐6 for each group.
192