Faculty of Medicine and Department of Health Sciences Medical Protein Sciences Department of Biochemistry

SOCS proteins and cytokine signalling: The many faces of the SOCS box

Julie Piessevaux

Promotor: Prof. Dr. Jan Tavernier

Thesis submitted to fulfil the requirements for achievement of the grade of PhD in Biomedical Sciences Department of biochemistry, Faculty of medicine and health sciences, 2008

dedicated to Jacques Piessevaux Table of Contents

Table of Contents...... 3 Abbreviations ...... 6 Summary ...... 8 Samenvatting...... 9 Résumé ...... 10

PART I: General Introduction

CHAPTER 1: Cytokine receptors and signal transduction ...... 13 I. Cytokines ...... 13 II. Cytokine receptors...... 16 III. The JAK-STAT pathway ...... 18 A. The JAK family ...... 19 B. The STAT family...... 22 IV. A selection of other cytokine-induced signalling pathways ...... 29 V. References...... 32

CHAPTER 2: Major mechanisms controlling cytokine signalling...... 35 I. Soluble receptors...... 35 II. Internalisation and degradation...... 36 III. Phosphatases...... 38 IV. PIAS proteins...... 40 V. References...... 41

CHAPTER 3: The SOCS protein family...... 45 I. Expression of SOCS proteins ...... 45 II. SOCS protein structure and molecular mechanisms of action ...... 47 The N-terminal domain: JAK kinase inhibition...... 48 The SH2 domain: substrate specificity and competition for receptor motifs...... 50 The SOCS box: proteasomal targeting and protein stability...... 51 III. Posttranslational modification of SOCS proteins...... 54 IV. Structural determination of SOCS proteins ...... 55 V. The physiology of SOCS functions ...... 56 SOCS1 ...... 57

- 3 -

SOCS3...... 58 CIS...... 60 SOCS2...... 61 SOCS5...... 62 SOCS6...... 63 SOCS7...... 64 SOCS proteins and immunity ...... 65 VI. SOCS proteins in disease...... 67 Infectious disease pathogenesis (hijacking the host’s SOCS system) ...... 67 Inflammatory diseases...... 68 Metabolic diseases (leptin and insulin resistance) ...... 69 Growth related pathologies...... 69 Cancers and haematopoietic disorders ...... 70 Therapeutic applications of SOCS...... 72 VII. References ...... 74

CHAPTER 4: MAPPIT, a mammalian two-hybrid system ...... 87 I. Techniques to study protein-protein interactions...... 87 Biochemical approaches ...... 87 Genetic approaches ...... 88 II. Mammalian protein-protein interaction trap (MAPPIT) ...... 90 III. References ...... 93

CHAPTER 5: Biological functions and signal transduction of leptin ……………………….. 95 I. Leptin and its receptor ………………………………………………………………….. 95 II. Leptin: function and importance ……………………………………………………….. 97 Body weight regulation ...... 97 A broader role for leptin...... 99 Leptin: clinical use and beyond...... 102 III. Signalling via the leptin receptor ………………………………………. ……………..104 The JAK/STAT pathway ...... 105 The PI3K pathway ...... 106 The MAPK pathway...... 106 IV. Negative regulation of leptin receptor signalling ……………………………………..107 V. References ……………………………………………………………………………….108

Scope of the thesis ...... 115

- 4 - PART II: The role of SOCS proteins in regulation of leptin receptor signalling

CHAPTER 6: Interaction pattern of CIS and SOCS2 with the leptin receptor ...... 121 I. Introduction...... 121 II. Article: A complex interaction pattern of CIS and SOCS2 with the leptin receptor.122 III. References ...... 122

CHAPTER 7: Leptin signalling in haematopoietic cells...... 135 I. Introduction...... 135 II. Article: Analysis of leptin signalling in haematopoietic cells using an adapted MAPPIT strategy...... 136 III. References ...... 136

CHAPTER 8: Modulation of leptin receptor signalling...... 145 I. Review: Negative regulation of leptin receptor signalling ...... 145

PART III: The many faces of the SOCS box

CHAPTER 9: Enhanced cytokine signalling by SOCS box-dependent cross-regulation between SOCS proteins...... 157 I. Introduction...... 157 II. Article: Functional cross-modulation between SOCS proteins can stimulate cytokine signalling...... 158 III. References ...... 158

CHAPTER 10: CIS functions are controlled by Elongin B/C binding...... 173 I. Introduction...... 173 II. Article: Elongin B/C recruitment regulates substrate binding by CIS...... 173 III. References ...... 173

CHAPTER 11: Versatility of the SOCS box domain ………………………………...... 195 I. Review: The many faces of the SOCS box ………………………………………….195 II. References ……………………………………………………………………...... 213

Conclusions and future prospects ...... 219

Curriculum vitae………………………………………………………………………………… 227 Dank u …………………………………………………………………………………………… 231

- 5 - Abbreviations

AA amino acids BBB blood-brain barrier

βc common beta chain BRET bioluminescence resonance energy transfer CIS cytokine inducible SH2 containing protein CNS central nervous system CNTF ciliary neurotrophic factor CRH cytokine receptor homology db mouse diabetes gene, coding for the leptin receptor DIO diet-induced obesity DNA deoxyribonucleic acid EGF epidermal growth factor Epo erythropoietin Erk extracellular-signal-regulated kinase FNIII fibronectin type III domain FRET fluorescence resonance energy transfer

γc common gamma chain G-CSF granulocyte colony stimulating factor GFP green fluorescence protein GGS Gly-Gly-Ser GHR growth hormone receptor GH growth hormone GM-CSF granulocyte macrophage colony stimulating factor gp130 glycoprotein 130 Grb2 growth receptor bound protein 2 HIF-1α hypoxia induced factor-1 α IFN interferon Ig immunoglobulin IGF insulin-like growth factor IL interleukin IP3 inositoltrisphosphate IRS insulin receptor substrate ISRE interferon stimulated response element JAK Janus kinase JH JAK homology JNK c-Jun amino-terminal kinase

- 6 - KIR kinase inhibitory region LR leptin receptor LIF leukaemia inhibitory factor LPS lipopolysaccharides MAPK mitogen activated protein kinase MAPPIT mammalian protein-protein interaction trap MS mass spectrometry NES nuclear export signal NF-κB nuclear factor κB NGF nerve growth factor NK natural killer cell NLS nuclear localisation signal ob mouse obese gene, coding for leptin OSM oncostatin M PDE3B phosphodiesterase 3B PH pleckstrin-homology PI3K phosphoinositol 3-kinase PIAS protein inhibitor of activated STAT PIP2 phosphatidylinositolbiphosphate PKC phosphokinase C molecules PLCγ phospholipase C gamma PRL prolactin PTB phosphotyrosine-binding PTP 1B protein tyrosine phosphatase 1B Φ hydrophobic SH2 Src homology 2 SHP SH2 domain containing phosphatase SOCS suppressors of cytokine signalling STAT signal transducer and activator of transcription SUMO small Ub-related modifier TAP tandem affinity purification Th T helper subtype TLR toll-like receptors TNF tumour necrosis factor Ub ubiquitin VEGF vascular endothelial growth factor VHL Von Hippel Lindau

- 7 - Summary

SOCS proteins are regulators of various signal transduction cascades that are essential to normal physiology. The importance of a strict control of signalling is underscored by the contribution of aberrant SOCS functions in several pathologies. So far, eight SOCS members have been identified (CIS and SOCS1-7) and they are all characterised by common structural motifs: a central SH2 domain and a C-terminal SOCS box. The SH2 domain defines substrate selectivity, while the SOCS box domain mediates the interaction of SOCS proteins with the Elongin B/C complex, linking them to the ubiquitin/proteasome degradation system. Upon stimulation, SOCS proteins are recruited to activated receptors, where they suppress signalling by different mechanisms including targeting of the receptor complex for proteasomal degradation. The first part of this thesis focuses on the role of SOCS proteins in leptin receptor (LR) signalling. Hypothalamic leptin responses play a central role in body weight regulation. In addition, leptin also has direct effects on peripheral cell types involved in regulation of diverse body functions including immune response, haematopoiesis and reproduction. Since alterations in normal leptin action have severe pathological implications, it is important to understand the mechanisms that regulate leptin signalling. Previous studies have demonstrated the important role of SOCS3 in leptin physiology. Using MAPPIT, a cytokine receptor-based two-hybrid method operating in intact mammalian cells, we showed that CIS and SOCS2 can also bind to the LR and we further characterised the binding mode and functionality of these interactions. Next, we studied the signalling events of the LR in haematopoiesis. Therefore, we designed a novel MAPPIT variant, βc-MAPPIT, which allows analysis in a haematopoietic environment. We identified several reported as well as novel interactions with the LR, including binding of SOCS proteins. The SOCS box domain of SOCS molecules was known to be involved in targeting associated proteins for degradation and in SOCS protein stability. In the second part of the thesis, we reported novel roles for this domain. First, the SOCS box was demonstrated to be implicated in cross-modulation between SOCS proteins. This way, some SOCS members can interfere with the inhibitory functions of other SOCS proteins by targeting them for proteasomal degradation. This cross-regulatory mechanism may be involved in restoring the basal cellular responsiveness for subsequent stimulation. Secondly, we showed that the SOCS box can regulate substrate binding. Receptor interaction and functionality of CIS were found to crucially require Elongin B/C recruitment to the SOCS box. This Elongin B/C-dependency appears to be unique for CIS and represents a novel regulatory mechanism by which the SOCS box may form an on/off switch acting on the SH2 domain. Together, our findings indicate multiple roles for the SOCS box.

- 8 - Samenvatting

De familie van SOCS eiwitten zijn essentiële regulatoren in verscheidene signalisatie cascades. Het belang van een strikte controle van de signalisatie wordt benadrukt door het voorkomen van aberrante SOCS functies die bijdragen tot verschillende ziektepatronen. Tot op heden zijn acht SOCS proteinen geïdentificeerd (CIS en SOCS1-7) en ze worden gekenmerkt door gemeenschappelijke structurele motieven: een centraal SH2 domein en een eindstandige SOCS box. Het SH2 domein bepaalt de substraat selectiviteit en het SOCS box domein staat in voor de interactie met het Elongine B/C complex dat een link vormt naar het ubiquitine/proteasoom afbraaksysteem. Na stimulatie worden de SOCS eiwitten gerecruteerd naar de geactiveerde receptor waar ze door verschillende mechanismen de signaalweg zullen onderdrukken. In het eerste deel van dit werk gaan we dieper in op de functies van de SOCS eiwitten in leptine signalisatie. Leptine heeft een centrale rol in de regulatie van het lichaamsgewicht. Bovendien heeft leptine ook effecten op bepaalde perifere weefsels die ondermeer betrokken zijn bij immuniteit, haematopoiesis en vruchtbaarheid. Aangezien ongepaste wijzigingen in leptine responsen betrokken zijn bij verscheidene ziektes, is het van groot belang om de mechanismen die de leptine signaalweg regelen te ontrafelen. Vorige studies hebben een belangrijke rol voor SOCS3 in leptine fysiologie aangetoond. Gebruikmakend van MAPPIT, een twee-hybride methode die werkzaam is in intacte zoogdiercellen, tonen wij aan dat CIS en SOCS2 ook met de leptine receptor (LR) kunnen binden. Vervolgens werden de signalisatie cascades van de LR in hematopoëse bestudeerd. Daarvoor ontwierpen we een nieuwe MAPPIT variant, βc-MAPPIT, die analyse in haematopoëtische cellen toelaat. Hiermee konden we zowel gekende als nieuwe interacties met de LR identificeren waaronder ook die met SOCS eiwitten. De SOCS box was gekend om zijn sleutelfunctie in het regelen van de SOCS stabiliteit en het merken van geassocieerde eiwitten voor proteasomale afbraak. In het tweede deel van deze thesis bewijzen we nieuwe functies voor dit domein. Eerst tonen we aan dat de SOCS box een functie heeft in de onderlinge modulatie van SOCS eiwitten. Op deze manier kunnen sommige SOCS leden interferen met de inhiberende werking van andere SOCS eiwitten. Dit interfererend mechanisme zou van belang kunnen zijn in het herstellen van de cellulaire gevoeligheid. Vervolgens tonen we aan dat de SOCS box substraat binding kan regelen. Receptor interactie en functionaliteit van CIS bleken immers Elongine B/C recrutering aan de SOCS box te vereisen. Deze Elongine B/C afhankelijkheid is uniek voor CIS en vertegenwoordigt een nieuw regulatorisch mechanisme waarmee de SOCS box de functies van het SH2 domein kan beïnvloeden. Samengevat wijzen onze bevindingen op veelvoudige functies voor de SOCS box.

- 9 - Résumé

Les protéines SOCS forment une famille de régulateurs impliquée dans diverses cascades de signalisation. Le disfonctionnement des SOCS contribue au développement de plusieurs maladies. Il est donc nécessaire de contrôler la signalisation rigoureusement afin d’éviter cela. Jusqu’à présent, huit membres SOCS on été identifiés (CIS et SOCS1-7). Ils sont caractérisés par des motifs communs : un domaine SH2 au centre et le SOCS box à la fin. Le domaine SH2 définit l’interaction avec le substrat et le SOCS box maintient l’association avec le complexe des Elongines B et C, reliant les SOCS au système de dégradation par le protéasome. Après stimulation, les SOCS sont recrutées vers les récepteurs activés et suppriment la signalisation par différents mécanismes. Dans la première partie de cette thèse nous approfondissons les fonctions des protéines SOCS dans la signalisation de la leptine. Non seulement la leptine joue un rôle central dans le réglage du poids corporel mais elle a également des effets directs sur les tissus périphériques où elle module diverses fonctions comme l’immunité, l’hématopoïèse et la reproduction. Il est nécessaire d’obtenir une meilleure compréhension des mécanismes qui règlent la signalisation de la leptine car un dérèglement mènerait vers des implications pathologiques. Plusieurs études démontrent le rôle crucial de SOCS3 dans la physiologie de la leptine. En utilisant MAPPIT, une stratégie deux-hybride opérant dans des cellules mammifères intactes, nous prouvons que CIS et SOCS2 peuvent également s’associer au récepteur de la leptine. Nous avons également étudié les cascades de signalisation du récepteur de la leptin dans l’hématopoïèse. Pour cela, nous avons conçu une variante de la technique MAPPIT, βc-MAPPIT, qui permet des études de cellules hématopoïétiques. Nous avons relevé plusieurs interactions connues mais également des nouvelles y compris celles des SOCS. Le SOCS box est connu pour son implication dans la modulation de la stabilité des SOCS, ainsi que pour son rôle dans la dégradation protéasomale de protéines associées. Dans la seconde partie de cette thèse, nous identifions de nouveaux rôles pour ce domaine. Nous rapportons que le SOCS box est impliqué dans la modulation réciproque entre protéines SOCS. Suite à cela certains membres peuvent interférer avec les fonctions suppressives d’autres SOCS en les marquant pour la destruction protéasomale. Il est probable que le mécanisme de modulation réciproque entre SOCS soit impliqué dans la reconstitution des réponses cellulaires à de nouvelles stimulations. Nous démontrerons ensuite que le domaine SOCS box est capable de régler l’association de SOCS avec leur substrat. Il s’avère que l’interaction avec le récepteur et la fonctionnalité de CIS nécessitent le recrutement du complexe Elongin B/C au SOCS box. Cette dépendance est unique pour CIS et représente un nouveau mécanisme régulateur par lequel le SOCS box peut contrôler les interactions du domaine SH2. En conclusion, nos résultats démontrent des rôles variés et complexes pour le SOCS box.

- 10 -

Part I : General Introduction

- 11 -

- 12 - CHAPTER 1: Cytokine receptors and signal transduction

The complexity of multicellular organisms is made possible by the evolution of systems enabling cells to communicate and consequently respond to distinct cues. Cytokines and their receptors represent one such system that plays a key role in cell proliferation, differentiation, migration and apoptosis. These biological activities are critical to processes as diverse as haematopoiesis, immune responses, growth and embryonic development.

I. Cytokines

Cytokines are defined as a highly heterogeneous group of small and secreted messenger proteins, some of which remain cell bound, that are involved in intercellular communication in multicellular organisms. Two crucial features that characterize the cytokine network are their pleiotropy and redundancy. Pleiotropy indicates that one cytokine can provoke a broad range of responses depending on the cell type or the differentiation stage. This way, cytokines can orchestrate a coordinated response of different cellular processes. Redundancy implies that different cytokines can exert similar biological activities. In this way, important cellular mechanisms are preserved by a back-up mechanism, in which one cytokine can compensate for the loss of another. These compensatory mechanisms can be explained in part by the common use of certain receptor chains and signalling molecules by the different cytokines. A cytokines’ sphere of action is limited: they are secreted in very low amounts, and producer and responder cells are often physically located close to each other (thereby cytokines differ from classical hormones). Dispersal of some cytokines is also limited by binding to the extracellular matrix and soluble cytokine receptors that bind and inhibit the biological actions of cytokines.

Chapter 1: Cytokine receptors and signal transduction

- 13 - Originally, cytokines were classified based on their biological responses. But given the apparent functional pleiotropy and low sequence homology, current cytokine classification relies on structural similarities. According to the Cytokine Web (http://cmbi.bjmu.edu.cn/cmbidata/cgf/CGF_Database/cytweb/index.html) different fold families can be distinguished (table 1).

Table 1: Classification of the cytokines based on similarity in protein folding

α-helical long chain 4-α-helix bundle superfamily structure interleukin-6 (IL-6), growth hormone (GH), Leptin, erythropoietin (Epo), prolactin (PRL), granulocyte-colony stimulating factor (G-CSF), myelomonocytic growth factor, leukemia inhibitory factor (LIF), oncostatin M (OSM), ciliary neurotrophic factor (CNTF), cholinergic differentiation factor (CDF)

short chain 4-α-helix bundle superfamily IL-2, IL-3, IL-4, IL-5, granulocyte macrophage colony-stimulating factor (GM-CSF), macrophage-colony stimulating factor (M-CSF)

dimeric 4-α-helix bundle superfamily

interferon γ (IFNγ), interferon β (IFNβ), IL-10

β-sheet Β-Trefoil structure IL1-α, IL1-β, fibroblast growth factor (FGF)

β-sandwich

tumour necrosis factor α (TNFα), tumour necrosis factor β (TNFβ)

β-EGF-like

transforming growth factor α (TGF-α)

β-Cystine knot dimerization domains gonadotropin, nerve growth factor (NGF), platelet-derived growth factor (PDGF), transforming growth factor-β2 (TGF-β2) α/β-structure IL-8, platelet factor 4 (PF-4), macrophage inflammatory protein 1 alpha (MIP-1α), MIP- 1β, melanoma growth stimulating activity (MGSA)

Chapter 1: Cytokine receptors and signal transduction

- 14 - Cytokines studied in this work, including leptin, GH, Epo and IFNβ, belong to the 4- α-helical bundle cytokine family. These share a typical fold consisting of 4 α-helices arranged in an up-up-down-down orientation, linked together with 2 loops. The ‘long chain’ subgroup has long α-helices and their loops contain additional helices, while the subgroup of the ‘short chain’ cytokines has shorter α-helices and their loops comprise two short antiparallel β-strands. Cytokines of the third subgroup form dimeric structures (figure 1).

Figure 1: Structures of 4 α-helix bundle cytokines GH, a long chain 4-α-helical bundle cytokine (left). GM-CSF, a short chain 4-α- helical bundle cytokine (right). IFNγ, a dimeric 4-α-helical bundle cytokine (under) (adapted from ‘The Cytokine Web’)

Chapter 1: Cytokine receptors and signal transduction

- 15 - II. Cytokine receptors

Since cytokines are unable to cross the cellular membrane themselves and have no intrinsic enzymatic activity, they require specific transmembrane receptor proteins to transmit their signal to the inside of cells. Based on (predicted) secondary and tertiary structure similarities, cytokine receptors can be divided into 4 classes (table 2). In general, there is a clear correlation between the structural class of the cytokine ligands and their receptors.

Table 2: Classification of the cytokine receptors based on structure similarities.

class name characteristics

I. haematopoietin/interferon receptors Ig-like and FNIII-like domains in the extracellular part unstructured intracellular part

II. TNF/IL-1 receptors repeat of 6 Cys in the extracellular part often presence of a death domain (induction of apoptosis) in the intracellular part

III. receptor kinases intrinsic kinase activity: phosphorylation of Tyr (e.g. insulin receptor) or Ser/Thr (e.g. TGFβR)

IV. serpentine receptors cross the cellular membrane seven times Ser/Thr residues in intracellular part, acting as phosphorylation sites for receptor regulation

Cytokine receptors examined in this thesis are part of the class I receptor family. Members of this receptor class are characterized by a conserved extracellular module, known as the cytokine receptor homology domain (CRH), along with a range of other structural modules including immunoglobulin (Ig)-like and fibronectin type III (FNIII)-like domains, a transmembrane and intracellular domains (Bazan, 1990; Kishimoto et al., 1994). The CRH domains consist of two homologous barrel- like structures of 7 β strands resembling the FNIII fold. The cytoplasmatic domains of the members of this receptor class are more heterogeneous. Unstructured intracellular part (see table 2) points to the lack of structural information, either by NMR or by crystallography studies, on the cytoplasmatic domains of the class I

Chapter 1: Cytokine receptors and signal transduction

- 16 - cytokine receptors. This may well reflect the absence of clearly structured subdomains. Moreover, beside the membrane-proximal box1 and box2 motifs and conserved tyrosine residues there are no well-conserved sequences or elements within the cytosolic tails of these receptors. Haematopoietin receptors are divided into two groups which have divergent CRHs (Bazan, 1990).

Figure 2: Structure of a class I cytokine receptor GH in complex with two extracellular domains of its receptor (adapted from ‘The Cytokine Web’)

The type I receptors are characterized by two conserved disulfide bonds and a canonical Trp-Ser-X-Trp-Ser (WSXWS) motif in their CRH (Bazan, 1990). Some members are composed of a single receptor subunit, like the GH receptor (GHR), Epo receptor (EpoR) or PRL receptor (PRLR) and are assembled in homomeric structures (figure 2). However, the majority of type I cytokine receptors consists of different receptor chains and fall into three major families based on usage of shared receptor chains. These receptor complexes combine a ligand-specific subunit with a shared signal transducing chain. Such shared receptor subunits are (i) the gamma

Chapter 1: Cytokine receptors and signal transduction

- 17 - common receptor (γc) chain, predominantly utilized by the IL-2 subfamily (IL-2, IL-4,

IL-7 and others) (Ozaki and Leonard, 2002); (ii) the beta common (βc) chain, used by the IL-3 subfamily (IL-3, IL-5 and GM-CSF) (Boulay et al., 2003; Ozaki and Leonard, 2002) and (iii) the glycoprotein 130 (gp130) chain, shared by the IL-6 subfamily (IL-6, IL-11, LIF and others). Type II receptors have also two pairs of cysteines but with a different arrangement and they lack the WSXWS motif (Bazan, 1990). The common use of receptor chains results in 10 receptor complexes formed from a pool of 12 type II receptor chains (Kotenko and Langer, 2004; Langer et al., 2004). Type II receptor members are activated by the IFN and IL-10 family and they are primarily involved in antiviral and inflammatory responses (Renauld, 2003)

III. The JAK-STAT pathway

Members of the class I cytokine receptor family have no intrinsic kinase activity and therefore typically depend on intracellular associated janus kinases (JAKs) to trigger signal transduction. A schematic outline of the JAK-STAT pathway is shown in figure 3. Binding of a cytokine to its receptor complex (step 1) will induce clustering and/or reorganization of the receptor chains in such a way that the associated JAKs will be brought in close proximity, allowing them to activate each other by cross- phosphorylation (step 2). These activated kinases will then phosphorylate tyrosine residues in the cytoplasmatic portion of the receptor (step 3). These phosphotyrosines provide docking sites for various signalling proteins containing a phosphotyrosine-binding domain, like a Src homology 2 (SH2) domain or the less common phosphotyrosine-binding domain (PTB). Signal transducers and activators of transcription (STAT) proteins dock to these phosphotyrosine containing motifs. The STAT molecules then become phosphorylated themselves by the JAKs upon receptor association (step 4). Subsequently, the activated STATs dissociate from the receptor (step 5) and migrate to the nucleus as dimers (step 6), where they act as transcription factors to initiate transcription of specific target genes (Ihle et al., 1994; Kisseleva et al., 2002; O'Shea et al., 2002).

Chapter 1: Cytokine receptors and signal transduction

- 18 -

Figure 3: Schematic representation of the JAK/STAT pathway (for more details, see text)

A. The JAK family

This kinase family is named after Janus, the Roman god of gates and doors, beginnings and endings. Therefore Janus is represented with a double-faced head, each looking in an opposite direction. This is reminiscent of the distinctive feature of JAK structure: their kinase and pseudokinase domain. In mammals, the JAK family comprises four members: JAK1-3 and Tyk2. JAK1, JAK2 and Tyk2 are expressed ubiquitously, while the expression of JAK3 is restricted to cells of haematopoietic origin (Leonard and O'Shea, 1998).

Structure of JAKs

JAKs are relatively large proteins of approximately one thousand amino acids (AA). Comparison of JAK sequences reveals seven regions of high similarity, called JAK homology (JH) domains 1 to 7 (for an overview see (Leonard and O'Shea, 1998) (figure 4). The C-terminal JH1 and JH2 domains encode respectively a kinase and pseudokinase domain. Although this latter domain contains structural features of a Chapter 1: Cytokine receptors and signal transduction

- 19 - tyrosine kinase, it is devoid of any catalytic activity. Reports suggest that this domain modulates the catalytic activity of the kinase domain (Saharinen et al., 2000; Velazquez et al., 1995; Yeh et al., 2000). The JH1 kinase domain behaves like a classical tyrosine kinase: it contains tyrosine residues that become phosphorylated upon activation, thereby inducing conformational changes that allow binding of the substrates in the catalytic site of the JAK (Rane and Reddy, 2000). The N-terminal part of the JAKs, containing JH3-7, is involved in association with the receptor. Specifically, JAKs associate with the proline-rich, membrane-proximal box1 and box2 domains of class I cytokine receptors. The JH3-JH4 regions form a structural domain resembling a SH2 domain, but appear not to be implicated in phosphotyrosine-dependent interactions, as SH2 domains typically do. However, this region is structurally important for receptor association and receptor surface expression (Radtke et al., 2005). Finally, the structure of the N-terminal (JH5-JH7) domains resembles that of Four-point-one, Ezrin, Radixin and Moesin (FERM) domains, which are known to mediate protein-protein interactions with for example phosphatidylinositolbisphosphate (PIP2) and inositoltrisphosphate (IP3) (Girault et al., 1998). This region mediates receptor binding and is involved in the maintenance of catalytical activity (Hilkens et al., 2001; Zhou et al., 2001).

Figure 4: Schematic representation of the JAK structure JAKs share seven regions of high similarity (JH1-7). N-terminal domains mediate receptor association; JH1 and JH2 encode respectively a kinase and pseudokinase domain. The ruler underneath indicates the number of AA.

Chapter 1: Cytokine receptors and signal transduction

- 20 - Biological functions – lessons learned from JAK knock-outs

JAKs have non-redundant functions in vivo as is reflected by the phenotypes of JAK knock-out mice (table 3).

JAK1 - JAK1 knock-out mice die perinatally of a poorly characterized defect that may be neurologic. JAK1-deficient cells are unresponsive to IFNs, γc-dependent cytokines, and to most cytokines signalling through the gp130 receptor subunit (Rodig et al., 1998).

JAK2 – Targeted disruption of the JAK2 gene results in embryonic lethality due to failure of erythropoiesis. Cells from these mice showed that this kinase is essential for different cytokine responses including IL-3, IL-5, GM-CSF and IFNγ (Neubauer et al., 1998; Parganas et al., 1998). Humans with JAK2 mutations exhibit myeloproliferative disorders (Baxter et al., 2005; James et al., 2005).

JAK3 - Deletion of the murine JAK3 gene results in a viable phenotype. Nevertheless, these mice suffer from severe combined immune deficiency (SCID) and profound B and T cell defects due to impaired signalling via the γc receptors (Nosaka et al., 1995; Park et al., 1995). Humans that are deficient for JAK3 have SCID and suffer from severe T cell defects, but their B cell populations remain unaffected (Thomis and Berg, 1997).

TYK2 – In comparison to the other JAKs, TYK2 deficiency in mice caused only a modest phenotype characterized by a shift toward Th2 immune responses and an impaired response to lipopolysaccharide (LPS) (Karaghiosoff et al., 2003). Surprisingly, only subtle defects were observed in IL-12, type I and II IFNs (Karaghiosoff et al., 2000; Karaghiosoff et al., 2003; Shimoda et al., 2000). The role of TYK2 in murine IFN-dependent signalling appears to be limited to specific antiviral activities at low IFN concentrations. By comparison, TYK2-deficient humans exhibit a more severe phenotype. In those individuals, the combined aberrations in IFN, IL-6, IL-10, IL-12 and IL-23 responses are associated with

Chapter 1: Cytokine receptors and signal transduction

- 21 - enhanced allergic and impaired antimicrobial responses (Watford and O'Shea, 2006).

Table 3: Overview of the major phenotypical differences associated with JAK deficient mice

knock-out major phenotypical differences references

JAK1 early postnatal lethality, neurological deficiencies, Rodig et al., 1998 defective responses to IFNs and cytokines using γc or gp130 receptor subunits

JAK2 embryonic lethality, impaired erythropoiesis Neubauer et al., 1998 Parganas et al., 1998

JAK3 viable, fertile, defective lymphoid development Nosaka et al., 1995 Park et al., 1995

TYK2 viable, fertile, defective type I and II IFN responses, Karaghiosoff et al., 2000 reduced antiviral response Shimoda et al., 2000

B. The STAT family

The family of mammalian STAT proteins consists of seven members: STAT1, STAT2, STAT3, STAT4, STAT5a, STAT5b and STAT6. They function as transcription factors which reside predominantly in the cytoplasm in unstimulated cells, most probably as preformed dimers (Mertens et al., 2006; Neculai et al., 2005; Schroder et al., 2004). STAT1, STAT3 and STAT4 can form both homo- and heterodimers while for STAT5 and STAT6 only homodimers have been observed. STAT2 is only functional when complexed with STAT1 or STAT4. Receptor binding and subsequent phosphorylation on tyrosine and serine residues will activate STATs followed by their nuclear translocation. In the nucleus, they initiate transcription by associating with specific response elements in the promoter of target genes. These consensus binding sites are typically palindromic sequences.

Chapter 1: Cytokine receptors and signal transduction

- 22 - The mechanisms underlying the transport of the STATs between the cytoplasm and the nucleus are only partially understood. The predominantly cytosolic localisation for inactive STATs has been shown to reflect a steady-state, where continuous basal nuclear import is balanced by continuous basal nuclear export. After activation, the balance is shifted toward nuclear accumulation and during signal decay toward nuclear export. Translocation of STAT dimers to the nucleus is mediated by specific nuclear localisation signals (NLS) and involves an active nuclear import mechanism depending on Ran and importin-α5 (Fagerlund et al., 2002). An alternative way of nuclear import by which activated receptors mediate nuclear transport of whole receptor/STAT complexes has been proposed (Larkin et al., 2000; Subramaniam et al., 2000). A nuclear export signal (NES) drives the nuclear export of STATs mediated by Ran and exportin 1. STAT dephosphorylation and dissociation from the DNA unmasks the NES sequence and activates the export mechanism (Bhattacharya and Schindler, 2003; McBride and Reich, 2003; Vinkemeier, 2004).

Structure of STATs

STATs are about 800 AA long and six structurally and functionally conserved domains have been identified (figure 5). The N-terminus contains a dimer-dimer interaction domain that apparently allows STAT dimers to form tetramers that can cooperatively associate with multiple tandem STAT response elements in the promoter (John et al., 1999; Murphy et al., 2000; Vinkemeier et al., 1996; Xu et al., 1996). It was also reported that this domain is involved in nuclear translocation and STAT deactivation (Strehlow and Schindler, 1998). The N-terminal region is linked to the DNA binding domain by a coiled-coil domain which consists of four helices. This domain can interact with other transcription factors and is also implicated in receptor binding, tyrosine phosphorylation and nuclear export (Begitt et al., 2000; Zhang et al., 2000). The centrally located DNA binding domain harbours a typical β- barrel with an Ig fold, a structure found in various transcription factors, like NF-κB and p53. Obviously, it is implicated in DNA association but there are only little direct interaction sites (Becker et al., 1998; Chen et al., 1998).

Chapter 1: Cytokine receptors and signal transduction

- 23 -

Figure 5 : Schematic representation of the STAT structure P indicates phosphorylated residues. The ruler underneath indicates the number of AA.

The SH2 domain is crucial for docking of the STAT to the phosphorylated tyrosine motifs in the receptor or in JAK kinases and it also mediates dimerisation of the STATs. The SH2 domain consists of a β-sheet flanked by two α-helices, which form a pocket structure. A conserved arginine residing in this pocket is essential for the interaction with phosphotyrosine residues (Chen et al., 1998). C-terminal to the SH2 domain, STATs have a conserved tyrosine residue which becomes phosphorylated by the JAK kinases upon receptor binding. Dimerization of the activated STATs is based on the reciprocal interaction of the SH2 domain with this phosphorylated tyrosine. The more variable C-terminus of STATs encodes a transcription activation domain (TAD). This divergence provides an opportunity to associate with distinct transcriptional regulators. This domain can be serine phosphorylated, which enhances the transcription of some genes (Decker and Kovarik, 2000).

Biological functions – lessons learned from STAT knock-outs

Specific deletion of STAT genes revealed distinctive functions for the various STAT proteins. An overview of the different knock-out mice phenotypes is given in table 4.

STAT1 - STAT1 deficient mice confirmed the pivotal role that STAT1 plays in the biological response to both type I and type II IFNs. These mice are highly

Chapter 1: Cytokine receptors and signal transduction

- 24 - susceptible to bacterial and viral infections (Durbin et al., 1996; Meraz et al., 1996). Consistent with this, naturally occurring mutations in human STAT1 exhibit increased susceptibility to viral and bacterial infections (Chapgier et al., 2006). STAT1 seems to be also implicated in non immune-responses, like chondrocyte proliferation (Sahni et al., 1999) and IFNγ-mediated growth inhibition, as was revealed by the enhanced tumor susceptibility of STAT1-/- mice (Shankaran et al., 2001).

Table 4: Overview of the major phenotypical differences associated with STAT deficient mice knock-out major phenotypical differences references

STAT1 viable, IFN responses absent, highly Durbin et al., 1996 sensitive to viral/microbial infection Meraz et al., 1996

STAT2 viable, type I IFN responses impaired, Park et al., 2000 defective antiviral response

STAT3 embryonic lethality Takeda et al., 1997

STAT4 viable, defective Th1 differentiation Kaplan et al., 1996b Thierfelder et al., 1996

STAT5a viable, impaired mammalian gland development Liu et al., 1997

STAT5b viable,impaired growth Udy et al., 1997

STAT6 viable, defective Th2 differentiation, Kaplan et al., 1996a impaired B cell functions Takeda et al., 1996

STAT2 - STAT2 null mice also display deficiencies in antiviral responses. Their defective phenotype is principally due to impaired type I IFN signalling that is dependent on STAT1/STAT2 heterodimers (Park et al., 2000). STAT1/STAT2 double knock-out mice are totally refractory to both classes of IFNs and are more vulnerable to infections than either single knock-out mice.

STAT3 - STAT3 gene targeting has underscored the vital developmental role for STAT3 as deficient mice die embryologically before gastrulation (Takeda et al.,

Chapter 1: Cytokine receptors and signal transduction

- 25 - 1997). In contrast, tissue-specific knock-outs have highlighted an important anti- inflammatory role for STAT3. Macrophages and neutrophils depleted of STAT3 exhibit a higher susceptibility to endotoxin shock and a higher production of inflammatory cytokines due to impaired IL-10 responsiveness (Takeda et al., 1999). STAT3 deficiency in T cells abrogates their proliferative response to IL-6 (Takeda et al., 1998). STAT3 deficient hepatocytes have an impaired induction of acute phase genes in response to IL-6 (Alonzi et al., 2001). Finally, lack of STAT3 in keratinocytes results in impaired wound healing and hair growth (Sano et al., 1999). Consistent with these findings, STAT3 directs the expression of pro-proliferative and anti-inflammatory cytokines, thereby contrasting with the anti-proliferative and pro- inflammatory activities of STAT1.

STAT4 - Genetic targeting of STAT4 has revealed a crucial role in directing the biological response to IL-12 and in regulating the differentiation of Th1 and Th2 cells. STAT4 deficient mice have defects in IL-12 mediated responses by natural killer cells and T lymphocytes, including the production of IFNγ, mitogenesis, enhancement of natural killer cytolytic function and Th1 differentiation (Kaplan et al., 1996b; Thierfelder et al., 1996). More recently, STAT4 was shown to be important in the IL-23 dependent expansion of Th17 cells and associated autoimmunity (Hunter, 2005).

STAT5 - Although extensive sequence similarity between STAT5a and STAT5b (~96% AA identity) explains their functional redundancy observed in vitro, the phenotypes of the single knock-outs reflect striking differences. STAT5a null mice are predominantly defective in PRL-mediated gland development (Liu et al., 1997), whereas STAT5b deficiency causes aberrations in sexual dimorphic growth, reminiscent of the phenotype of GH deficient mice (Udy et al., 1997). STAT5a/b double knock-outs exhibit a more severe phenotype. Many of these mice die within weeks after birth. The surviving mice are smaller and infertile with mammary gland defects, underscoring the essential role of the STAT5 proteins in GH and PRL responses {Teglund, 1998 #34}. Recent STAT5a/b gene targeting studies have revealed an important role for the STAT5 molecules in erythropoiesis and lymphopoiesis (Yao et al., 2006). Chapter 1: Cytokine receptors and signal transduction

- 26 - STAT6 - STAT6 deficient mice have confirmed a critical role for STAT6 in the IL-4 and IL-13 dependent polarization of naive lymphocytes into Th2 effector cells, as well as in mast cell activation. The gene targeting studies have also highlighted an important role for STAT6 in promoting B cell function, including proliferation, maturation, and MHC-II and IgE expression (Kaplan et al., 1996a; Takeda et al., 1996).

Table 5: Cytokine-specific JAK and STAT activation Based on the composition of receptor chains and their use of JAKs and STATs, cytokine receptors can be divided into five subfamilies. Adapted from (O'Sullivan et al., 2007).

ligand JAK kinase STATs IFN family IFNα/β Tyk2, JAK1 STAT1, STAT2 (STAT3, STAT5) IFNγ JAK1, JAK2 STAT1 (STAT3, STAT5) IL-10 Tyk2, JAK1 STAT3 (STAT1, STAT5)

gp130 family IL-6 JAK1, JAK2, TYK2 STAT1, STAT3 (STAT5) IL-11 JAK1, JAK2, TYK2 STAT1, STAT3 (STAT5) IL-12 JAK2, TYK2 STAT4 OSM JAK1, JAK2, TYK2 STAT1, STAT3 (STAT5) LIF JAK1, JAK2, TYK2 STAT1, STAT3 (STAT5) G-CSF JAK1, JAK2, TYK2 STAT3 (STAT1, STAT5) Leptin JAK1, JAK2 STAT3 (STAT1, STAT5)

γc family IL-2 JAK1, JAK3 STAT5 IL-4 JAK1, JAK3 STAT6 IL-7 JAK1, JAK3 STAT5 IL-9 JAK1, JAK3 STAT5 IL-15 JAK1, JAK3 STAT5

βc family IL-3 JAK2 STAT5 IL-5 JAK2 STAT5 GM-CSF JAK2 STAT5

Single chain family Epo JAK2 STAT5 GH JAK2 STAT5 (STAT3) PRL JAK2 STAT5 TPO JAK2 STAT5

Chapter 1: Cytokine receptors and signal transduction

- 27 - Text box 1: Specificity of the JAK-STAT pathway

Almost 40 cytokine receptors signal through combinations of four JAK and seven STAT family members, suggesting commonality in the JAK-STAT signalling cascade. Based on their use of JAKs and STATs, cytokine receptors are divided into five subfamilies (overview in table 4). Although only a limited number of JAK and STAT proteins are implicated, activation of the pathway by divergent stimuli will lead to unique biological responses.

The specificity of JAK-STAT signalling first originates from the preferential association of one JAK (or JAK combination) to certain receptor classes. Second, each receptor will use its own set of STAT molecules, leading to transcription of a defined collection of target genes. STAT specificity is largely determined by the binding preference of their SH2 domains for phosphorylated tyrosine residues on specific receptors. Third, posttranslational modifications and formation of STAT heterodimers, tetramers or higher order complexes expands the range of STAT/DNA binding opportunities. Fourth, specific gene expression is refined by genomic accessibility and other cofactors that act in synergy with STATs. These cofactors are often cell type specific or are activated by other receptor signalling pathways.

Despite extensive study, there remain substantial gaps in understanding how the JAK- STAT cascades are activated and regulated. There is for example still a lack of structural information on the cytoplasmatic domains of cytokine receptors, particularly in association with JAKs and STATs. We also do not fully understand how specificity in gene expression is generated by receptors that use identical JAK and STAT members. Further, it is intriguing that despite the large amount of cytokine receptors, the number of JAKs or JAK combinations remained so small during evolution.

IV. A selection of other cytokine-induced signalling pathways

In mammals, the JAK-STAT pathway is the principal signalling mechanism for a wide array of cytokines and growth factors. However, other pathways are also contributing to the signal transduction originating from cytokine receptors. A number of adaptor molecules can be recruited to the receptor or the kinase and may provide a link to other signalling pathways upon JAK-dependent phosphorylation. This

Chapter 1: Cytokine receptors and signal transduction

- 28 - further emphasizes the major role of JAK kinases in the total signalling event induced by a cytokine. Most cellular responses are derived from a combined effort of several activated signalling pathways, which are often intertwined by cross-talk actions. An example is the potential role of mitogen-activated protein kinases (MAPK) in activation of STAT proteins by serine phosphorylation.

Figure 6: Schematic overview of the MAPK and PI3K/Akt pathways. Transcription factors that are activated in the different pathways are shown in yellow.

The MAPK pathway - The MAPK signalling cascade is initiated by receptor and/or JAK binding of a set of adaptors including SH2 domain containing phosphatase-2 (SHP2), growth receptor bound protein 2 (Grb2), insulin receptor substrate (IRS) and Shc to the activated receptor complex. As illustrated in figure 6, binding of Grb2 can link the receptor to a guanine nucleotide exchange factor like son of sevenless (SOS). The latter protein activates membrane-anchored small GTP binding proteins Chapter 1: Cytokine receptors and signal transduction

- 29 - like Ras, which in turn stimulate the core unit of this cascade composed of series of serine-threonine kinases: MAPKKK (Raf), MAPKK (MEK1/2) and MAPK (Erk1/2) (Morrison and Cutler, 1997; Rubinfeld and Seger, 2005). Three major groups of MAP kinases exist: the p38 MAP kinase family, the extracellular signal-regulated kinase (Erk) family, and the c-Jun NH2-terminal kinase (JNK) family (Chang and Karin, 2001; Johnson and Lapadat, 2002). Activation of the different MAPKs will generate diverse, often conflicting cellular responses including inflammation, cell growth, differentiation and survival (Dong et al., 2002; Platanias, 2003).

The PI3K/Akt pathway - Another example is the phosphatidylinositide 3-kinase (PI3K)/Akt pathway that induces cell growth and anti-apoptotic mechanisms upon stimulation by many cytokines. The PI3K family is a group of related lipid kinases, of which the classical form is built up of two subunits, a regulatory (p85) and a catalytic subunit (p110) (Fruman et al., 1998). The p85 subunit can interact with phosphotyrosines of activated receptors or adaptor proteins and thereby recruits the p110 subunit to the membrane, where it phosphorylates phosphoinositides (Fruman et al., 1998; Okkenhaug and Vanhaesebroeck, 2001). These phosphorylated lipids serve as docking sites for several signalling molecules containing a pleckstrin- homology (PH) domain, like the Ser-Thr kinases Akt and phosphoinositide- dependent kinase 1 (PDK1) (Coffer et al., 1998). Phosphorylation of Akt by PDK1 and other kinases stimulates the catalytic activity of Akt (Anderson et al., 1998; Brazil et al., 2002), resulting in the phosphorylation of other signalling proteins, thereby altering their function in cell growth and survival (Krasilnikov, 2000). This pathway is often deregulated in cancer, since aberrations in this signalling can lead to uncontrolled cell growth (Fresno Vara et al., 2004; Hennessy et al., 2005; Krasilnikov, 2000).

Other pathways - Activated JAK kinases can phosphorylate other adaptor proteins including Vav, resulting in the activation of the Rho family of GTPases and phospholipase C gamma (PLCγ), which will induce the release of Ca2+ from intracellular stores and activate the family of phosphokinase C (PKC) molecules (Carpenter and Ji, 1999; Nobes and Hall, 1995; Patterson et al., 2005).

Chapter 1: Cytokine receptors and signal transduction

- 30 - V. References

Alonzi, T., Maritano, D., Gorgoni, B., Rizzuto, G., Libert, C., and Poli, V. (2001). Essential role of STAT3 in the control of the acute-phase response as revealed by inducible gene inactivation [correction of activation] in the liver. Mol Cell Biol 21, 1621-1632. Anderson, K. E., Coadwell, J., Stephens, L. R., and Hawkins, P. T. (1998). Translocation of PDK-1 to the plasma membrane is important in allowing PDK-1 to activate protein kinase B. Curr Biol 8, 684-691. Baxter, E. J., Scott, L. M., Campbell, P. J., East, C., Fourouclas, N., Swanton, S., Vassiliou, G. S., Bench, A. J., Boyd, E. M., Curtin, N., et al. (2005). Acquired mutation of the tyrosine kinase JAK2 in human myeloproliferative disorders. Lancet 365, 1054-1061. Bazan, J. F. (1990). Structural design and molecular evolution of a cytokine receptor superfamily. Proc Natl Acad Sci U S A 87, 6934-6938. Becker, S., Groner, B., and Muller, C. W. (1998). Three-dimensional structure of the Stat3beta homodimer bound to DNA. Nature 394, 145-151. Begitt, A., Meyer, T., van Rossum, M., and Vinkemeier, U. (2000). Nucleocytoplasmic translocation of Stat1 is regulated by a leucine-rich export signal in the coiled-coil domain. Proc Natl Acad Sci U S A 97, 10418-10423. Bhattacharya, S., and Schindler, C. (2003). Regulation of Stat3 nuclear export. J Clin Invest 111, 553-559. Boulay, J. L., O'Shea, J. J., and Paul, W. E. (2003). Molecular phylogeny within type I cytokines and their cognate receptors. Immunity 19, 159-163. Brazil, D. P., Park, J., and Hemmings, B. A. (2002). PKB binding proteins. Getting in on the Akt. Cell 111, 293-303. Carpenter, G., and Ji, Q. (1999). Phospholipase C-gamma as a signal-transducing element. Exp Cell Res 253, 15-24. Chang, L., and Karin, M. (2001). Mammalian MAP kinase signalling cascades. Nature 410, 37-40. Chapgier, A., Boisson-Dupuis, S., Jouanguy, E., Vogt, G., Feinberg, J., Prochnicka-Chalufour, A., Casrouge, A., Yang, K., Soudais, C., Fieschi, C., et al. (2006). Novel STAT1 alleles in otherwise healthy patients with mycobacterial disease. PLoS Genet 2, e131. Chen, X., Vinkemeier, U., Zhao, Y., Jeruzalmi, D., Darnell, J. E., Jr., and Kuriyan, J. (1998). Crystal structure of a tyrosine phosphorylated STAT-1 dimer bound to DNA. Cell 93, 827-839. Coffer, P. J., Jin, J., and Woodgett, J. R. (1998). Protein kinase B (c-Akt): a multifunctional mediator of phosphatidylinositol 3-kinase activation. Biochem J 335 ( Pt 1), 1-13. Decker, T., and Kovarik, P. (2000). Serine phosphorylation of STATs. Oncogene 19, 2628-2637. Dong, C., Davis, R. J., and Flavell, R. A. (2002). MAP kinases in the immune response. Annu Rev Immunol 20, 55-72. Durbin, J. E., Hackenmiller, R., Simon, M. C., and Levy, D. E. (1996). Targeted disruption of the mouse Stat1 gene results in compromised innate immunity to viral disease. Cell 84, 443-450. Fagerlund, R., Melen, K., Kinnunen, L., and Julkunen, I. (2002). Arginine/lysine-rich nuclear localization signals mediate interactions between dimeric STATs and importin alpha 5. J Biol Chem 277, 30072-30078. Fresno Vara, J. A., Casado, E., de Castro, J., Cejas, P., Belda-Iniesta, C., and Gonzalez-Baron, M. (2004). PI3K/Akt signalling pathway and cancer. Cancer Treat Rev 30, 193-204. Fruman, D. A., Meyers, R. E., and Cantley, L. C. (1998). Phosphoinositide kinases. Annu Rev Biochem 67, 481-507. Girault, J. A., Labesse, G., Mornon, J. P., and Callebaut, I. (1998). Janus kinases and focal adhesion kinases play in the 4.1 band: a superfamily of band 4.1 domains important for cell structure and signal transduction. Mol Med 4, 751-769. Hennessy, B. T., Smith, D. L., Ram, P. T., Lu, Y., and Mills, G. B. (2005). Exploiting the PI3K/AKT pathway for cancer drug discovery. Nat Rev Drug Discov 4, 988-1004. Hilkens, C. M., Is'harc, H., Lillemeier, B. F., Strobl, B., Bates, P. A., Behrmann, I., and Kerr, I. M. (2001). A region encompassing the FERM domain of Jak1 is necessary for binding to the cytokine receptor gp130. FEBS Lett 505, 87-91. Hunter, C. A. (2005). New IL-12-family members: IL-23 and IL-27, cytokines with divergent functions. Nat Rev Immunol 5, 521-531. Chapter 1: Cytokine receptors and signal transduction

- 31 - Ihle, J. N., Witthuhn, B. A., Quelle, F. W., Yamamoto, K., Thierfelder, W. E., Kreider, B., and Silvennoinen, O. (1994). Signaling by the cytokine receptor superfamily: JAKs and STATs. Trends Biochem Sci 19, 222-227. James, C., Ugo, V., Le Couedic, J. P., Staerk, J., Delhommeau, F., Lacout, C., Garcon, L., Raslova, H., Berger, R., Bennaceur-Griscelli, A., et al. (2005). A unique clonal JAK2 mutation leading to constitutive signalling causes polycythaemia vera. Nature 434, 1144-1148. John, S., Vinkemeier, U., Soldaini, E., Darnell, J. E., Jr., and Leonard, W. J. (1999). The significance of tetramerization in promoter recruitment by Stat5. Mol Cell Biol 19, 1910-1918. Johnson, G. L., and Lapadat, R. (2002). Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases. Science 298, 1911-1912. Kaplan, M. H., Schindler, U., Smiley, S. T., and Grusby, M. J. (1996a). Stat6 is required for mediating responses to IL-4 and for development of Th2 cells. Immunity 4, 313-319. Kaplan, M. H., Sun, Y. L., Hoey, T., and Grusby, M. J. (1996b). Impaired IL-12 responses and enhanced development of Th2 cells in Stat4-deficient mice. Nature 382, 174-177. Karaghiosoff, M., Neubauer, H., Lassnig, C., Kovarik, P., Schindler, H., Pircher, H., McCoy, B., Bogdan, C., Decker, T., Brem, G., et al. (2000). Partial impairment of cytokine responses in Tyk2-deficient mice. Immunity 13, 549-560. Karaghiosoff, M., Steinborn, R., Kovarik, P., Kriegshauser, G., Baccarini, M., Donabauer, B., Reichart, U., Kolbe, T., Bogdan, C., Leanderson, T., et al. (2003). Central role for type I interferons and Tyk2 in lipopolysaccharide-induced endotoxin shock. Nat Immunol 4, 471-477. Kishimoto, T., Taga, T., and Akira, S. (1994). Cytokine signal transduction. Cell 76, 253-262. Kisseleva, T., Bhattacharya, S., Braunstein, J., and Schindler, C. W. (2002). Signaling through the JAK/STAT pathway, recent advances and future challenges. Gene 285, 1-24. Kotenko, S. V., and Langer, J. A. (2004). Full house: 12 receptors for 27 cytokines. Int Immunopharmacol 4, 593-608. Krasilnikov, M. A. (2000). Phosphatidylinositol-3 kinase dependent pathways: the role in control of cell growth, survival, and malignant transformation. Biochemistry (Mosc) 65, 59-67. Langer, J. A., Cutrone, E. C., and Kotenko, S. (2004). The Class II cytokine receptor (CRF2) family: overview and patterns of receptor-ligand interactions. Cytokine Growth Factor Rev 15, 33-48. Larkin, J., 3rd, Johnson, H. M., and Subramaniam, P. S. (2000). Differential nuclear localization of the IFNGR-1 and IFNGR-2 subunits of the IFN-gamma receptor complex following activation by IFN-gamma. J Interferon Cytokine Res 20, 565-576. Leonard, W. J., and O'Shea, J. J. (1998). Jaks and STATs: biological implications. Annu Rev Immunol 16, 293-322. Liu, X., Robinson, G. W., Wagner, K. U., Garrett, L., Wynshaw-Boris, A., and Hennighausen, L. (1997). Stat5a is mandatory for adult mammary gland development and lactogenesis. Genes Dev 11, 179-186. McBride, K. M., and Reich, N. C. (2003). The ins and outs of STAT1 nuclear transport. Sci STKE 2003, RE13. Meraz, M. A., White, J. M., Sheehan, K. C., Bach, E. A., Rodig, S. J., Dighe, A. S., Kaplan, D. H., Riley, J. K., Greenlund, A. C., Campbell, D., et al. (1996). Targeted disruption of the Stat1 gene in mice reveals unexpected physiologic specificity in the JAK-STAT signaling pathway. Cell 84, 431-442. Mertens, C., Zhong, M., Krishnaraj, R., Zou, W., Chen, X., and Darnell, J. E., Jr. (2006). Dephosphorylation of phosphotyrosine on STAT1 dimers requires extensive spatial reorientation of the monomers facilitated by the N-terminal domain. Genes Dev 20, 3372-3381. Morrison, D. K., and Cutler, R. E. (1997). The complexity of Raf-1 regulation. Curr Opin Cell Biol 9, 174-179. Murphy, T. L., Geissal, E. D., Farrar, J. D., and Murphy, K. M. (2000). Role of the Stat4 N domain in receptor proximal tyrosine phosphorylation. Mol Cell Biol 20, 7121-7131. Neculai, D., Neculai, A. M., Verrier, S., Straub, K., Klumpp, K., Pfitzner, E., and Becker, S. (2005). Structure of the unphosphorylated STAT5a dimer. J Biol Chem 280, 40782-40787. Neubauer, H., Cumano, A., Muller, M., Wu, H., Huffstadt, U., and Pfeffer, K. (1998). Jak2 deficiency defines an essential developmental checkpoint in definitive hematopoiesis. Cell 93, 397-409. Nobes, C. D., and Hall, A. (1995). Rho, rac and cdc42 GTPases: regulators of actin structures, cell adhesion and motility. Biochem Soc Trans 23, 456-459.

Chapter 1: Cytokine receptors and signal transduction

- 32 - Nosaka, T., van Deursen, J. M., Tripp, R. A., Thierfelder, W. E., Witthuhn, B. A., McMickle, A. P., Doherty, P. C., Grosveld, G. C., and Ihle, J. N. (1995). Defective lymphoid development in mice lacking Jak3. Science 270, 800-802. Okkenhaug, K., and Vanhaesebroeck, B. (2001). New responsibilities for the PI3K regulatory subunit p85 alpha. Sci STKE 2001, PE1. O'Shea, J. J., Gadina, M., and Schreiber, R. D. (2002). Cytokine signaling in 2002: new surprises in the Jak/Stat pathway. Cell 109 Suppl, S121-131. O'Sullivan, L. A., Liongue, C., Lewis, R. S., Stephenson, S. E., and Ward, A. C. (2007). Cytokine receptor signaling through the Jak-Stat-Socs pathway in disease. Mol Immunol 44, 2497-2506. Ozaki, K., and Leonard, W. J. (2002). Cytokine and cytokine receptor pleiotropy and redundancy. J Biol Chem 277, 29355-29358. Parganas, E., Wang, D., Stravopodis, D., Topham, D. J., Marine, J. C., Teglund, S., Vanin, E. F., Bodner, S., Colamonici, O. R., van Deursen, J. M., et al. (1998). Jak2 is essential for signaling through a variety of cytokine receptors. Cell 93, 385-395. Park, C., Li, S., Cha, E., and Schindler, C. (2000). Immune response in Stat2 knockout mice. Immunity 13, 795-804. Park, S. Y., Saijo, K., Takahashi, T., Osawa, M., Arase, H., Hirayama, N., Miyake, K., Nakauchi, H., Shirasawa, T., and Saito, T. (1995). Developmental defects of lymphoid cells in Jak3 kinase- deficient mice. Immunity 3, 771-782. Patterson, R. L., van Rossum, D. B., Nikolaidis, N., Gill, D. L., and Snyder, S. H. (2005). Phospholipase C-gamma: diverse roles in receptor-mediated calcium signaling. Trends Biochem Sci 30, 688-697. Platanias, L. C. (2003). Map kinase signaling pathways and hematologic malignancies. Blood 101, 4667-4679. Radtke, S., Haan, S., Jorissen, A., Hermanns, H. M., Diefenbach, S., Smyczek, T., Schmitz- Vandeleur, H., Heinrich, P. C., Behrmann, I., and Haan, C. (2005). The Jak1 SH2 domain does not fulfill a classical SH2 function in Jak/STAT signaling but plays a structural role for receptor interaction and up-regulation of receptor surface expression. J Biol Chem 280, 25760-25768. Rane, S. G., and Reddy, E. P. (2000). Janus kinases: components of multiple signaling pathways. Oncogene 19, 5662-5679. Renauld, J. C. (2003). Class II cytokine receptors and their ligands: key antiviral and inflammatory modulators. Nat Rev Immunol 3, 667-676. Rodig, S. J., Meraz, M. A., White, J. M., Lampe, P. A., Riley, J. K., Arthur, C. D., King, K. L., Sheehan, K. C., Yin, L., Pennica, D., et al. (1998). Disruption of the Jak1 gene demonstrates obligatory and nonredundant roles of the Jaks in cytokine-induced biologic responses. Cell 93, 373-383. Rubinfeld, H., and Seger, R. (2005). The ERK cascade: a prototype of MAPK signaling. Mol Biotechnol 31, 151-174. Saharinen, P., Takaluoma, K., and Silvennoinen, O. (2000). Regulation of the Jak2 tyrosine kinase by its pseudokinase domain. Mol Cell Biol 20, 3387-3395. Sahni, M., Ambrosetti, D. C., Mansukhani, A., Gertner, R., Levy, D., and Basilico, C. (1999). FGF signaling inhibits chondrocyte proliferation and regulates bone development through the STAT-1 pathway. Genes Dev 13, 1361-1366. Sano, S., Itami, S., Takeda, K., Tarutani, M., Yamaguchi, Y., Miura, H., Yoshikawa, K., Akira, S., and Takeda, J. (1999). Keratinocyte-specific ablation of Stat3 exhibits impaired skin remodeling, but does not affect skin morphogenesis. Embo J 18, 4657-4668. Schroder, M., Kroeger, K. M., Volk, H. D., Eidne, K. A., and Grutz, G. (2004). Preassociation of nonactivated STAT3 molecules demonstrated in living cells using bioluminescence resonance energy transfer: a new model of STAT activation? J Leukoc Biol 75, 792-797. Shankaran, V., Ikeda, H., Bruce, A. T., White, J. M., Swanson, P. E., Old, L. J., and Schreiber, R. D. (2001). IFNgamma and lymphocytes prevent primary tumour development and shape tumour immunogenicity. Nature 410, 1107-1111. Shimoda, K., Kato, K., Aoki, K., Matsuda, T., Miyamoto, A., Shibamori, M., Yamashita, M., Numata, A., Takase, K., Kobayashi, S., et al. (2000). Tyk2 plays a restricted role in IFN alpha signaling, although it is required for IL-12-mediated T cell function. Immunity 13, 561-571. Strehlow, I., and Schindler, C. (1998). Amino-terminal signal transducer and activator of transcription (STAT) domains regulate nuclear translocation and STAT deactivation. J Biol Chem 273, 28049-28056. Chapter 1: Cytokine receptors and signal transduction

- 33 - Subramaniam, P. S., Larkin, J., 3rd, Mujtaba, M. G., Walter, M. R., and Johnson, H. M. (2000). The COOH-terminal nuclear localization sequence of interferon gamma regulates STAT1 alpha nuclear translocation at an intracellular site. J Cell Sci 113 ( Pt 15), 2771-2781. Takeda, K., Clausen, B. E., Kaisho, T., Tsujimura, T., Terada, N., Forster, I., and Akira, S. (1999). Enhanced Th1 activity and development of chronic enterocolitis in mice devoid of Stat3 in macrophages and neutrophils. Immunity 10, 39-49. Takeda, K., Kaisho, T., Yoshida, N., Takeda, J., Kishimoto, T., and Akira, S. (1998). Stat3 activation is responsible for IL-6-dependent T cell proliferation through preventing apoptosis: generation and characterization of T cell-specific Stat3-deficient mice. J Immunol 161, 4652-4660. Takeda, K., Noguchi, K., Shi, W., Tanaka, T., Matsumoto, M., Yoshida, N., Kishimoto, T., and Akira, S. (1997). Targeted disruption of the mouse Stat3 gene leads to early embryonic lethality. Proc Natl Acad Sci U S A 94, 3801-3804. Takeda, K., Tanaka, T., Shi, W., Matsumoto, M., Minami, M., Kashiwamura, S., Nakanishi, K., Yoshida, N., Kishimoto, T., and Akira, S. (1996). Essential role of Stat6 in IL-4 signalling. Nature 380, 627-630. Thierfelder, W. E., van Deursen, J. M., Yamamoto, K., Tripp, R. A., Sarawar, S. R., Carson, R. T., Sangster, M. Y., Vignali, D. A., Doherty, P. C., Grosveld, G. C., and Ihle, J. N. (1996). Requirement for Stat4 in interleukin-12-mediated responses of natural killer and T cells. Nature 382, 171-174. Thomis, D. C., and Berg, L. J. (1997). The role of Jak3 in lymphoid development, activation, and signaling. Curr Opin Immunol 9, 541-547. Udy, G. B., Towers, R. P., Snell, R. G., Wilkins, R. J., Park, S. H., Ram, P. A., Waxman, D. J., and Davey, H. W. (1997). Requirement of STAT5b for sexual dimorphism of body growth rates and liver gene expression. Proc Natl Acad Sci U S A 94, 7239-7244. Velazquez, L., Mogensen, K. E., Barbieri, G., Fellous, M., Uze, G., and Pellegrini, S. (1995). Distinct domains of the protein tyrosine kinase tyk2 required for binding of interferon-alpha/beta and for signal transduction. J Biol Chem 270, 3327-3334. Vinkemeier, U. (2004). Getting the message across, STAT! Design principles of a molecular signaling circuit. J Cell Biol 167, 197-201. Vinkemeier, U., Cohen, S. L., Moarefi, I., Chait, B. T., Kuriyan, J., and Darnell, J. E., Jr. (1996). DNA binding of in vitro activated Stat1 alpha, Stat1 beta and truncated Stat1: interaction between NH2-terminal domains stabilizes binding of two dimers to tandem DNA sites. Embo J 15, 5616- 5626. Watford, W. T., and O'Shea, J. J. (2006). Human tyk2 kinase deficiency: another primary immunodeficiency syndrome. Immunity 25, 695-697. Xu, X., Sun, Y. L., and Hoey, T. (1996). Cooperative DNA binding and sequence-selective recognition conferred by the STAT amino-terminal domain. Science 273, 794-797. Yao, Z., Cui, Y., Watford, W. T., Bream, J. H., Yamaoka, K., Hissong, B. D., Li, D., Durum, S. K., Jiang, Q., Bhandoola, A., et al. (2006). Stat5a/b are essential for normal lymphoid development and differentiation. Proc Natl Acad Sci U S A 103, 1000-1005. Yeh, T. C., Dondi, E., Uze, G., and Pellegrini, S. (2000). A dual role for the kinase-like domain of the tyrosine kinase Tyk2 in interferon-alpha signaling. Proc Natl Acad Sci U S A 97, 8991-8996. Zhang, T., Kee, W. H., Seow, K. T., Fung, W., and Cao, X. (2000). The coiled-coil domain of Stat3 is essential for its SH2 domain-mediated receptor binding and subsequent activation induced by epidermal growth factor and interleukin-6. Mol Cell Biol 20, 7132-7139. Zhou, Y. J., Chen, M., Cusack, N. A., Kimmel, L. H., Magnuson, K. S., Boyd, J. G., Lin, W., Roberts, J. L., Lengi, A., Buckley, R. H., et al. (2001). Unexpected effects of FERM domain mutations on catalytic activity of Jak3: structural implication for Janus kinases. Mol Cell 8, 959-969.

Chapter 1: Cytokine receptors and signal transduction

- 34 - CHAPTER 2: Major mechanisms controlling cytokine signalling

Cytokines are involved in many vital biological processes. Therefore, it is of crucial importance that cytokine signals are rapidly and finely tuned to avoid physiological derangements. In order to keep signalling events under tight control, cellular mechanisms have evolved to ensure that adequate signalling thresholds are achieved and maintained for the correct duration. Regulation of the initiation, duration and magnitude of cytokine signalling occurs at multiple levels: limiting the availability of cytokine to initiate a response, regulating the expression and half-life of cell surface receptor components, controlling the intracellular signal transduction machinery and transcriptional control. Some of the most important mechanisms and protein families involved in negative regulation of signalling will be discussed in this chapter (figure 7). Since the scope of the thesis concerns suppressor of cytokine signalling (SOCS) proteins, the following chapter will discuss this important family of regulatory proteins in greater detail.

I. Soluble receptors

Soluble receptors regulate biological responses by functioning as agonists or antagonists of cytokine signalling. A soluble counterpart of a cytokine receptor can be generated in two distinct ways: alternative mRNA splicing or proteolytic cleavage, which sheds the ectodomain of membrane-spanning receptors. Secreted receptor subunits were initially proposed to be antagonists, blocking or reducing cytokine potency by competing with their membrane-anchored homologues for common ligands. In this respect, the activity of IL-18 can be neutralized by the IL-18-binding protein (IL-18BP) that binds IL-18 with high affinity (Novick et al., 1999). In many cases however, soluble receptors are protecting the ligand from degradation or excretion. In this case, the receptor variant acts as a carrier for the ligand, thereby increasing the halflife of the cytokine. This function is for example of particular interest in case of the GH, where the site of cytokine production is remote from the

Chapter 2: Major mechanisms controlling cytokine signalling

- 35 - target tissue (Baumann, 1995). A secreted receptor may also substitute for an absent endogenous binding subunit, thereby converting a ligand-resistant cell into a sensitive one. This principle of transsignalling was originally described for IL-6 signalling. This cytokine can bind its soluble receptor and signal through the gp130 receptor subunit on a target cell, not expressing the membrane bound IL-6R subunit (Heinrich et al., 1995; Peters et al., 1996).

II. Internalisation and degradation

Internalisation and subsequent degradation of the receptor complex is an effective mechanism to turn of cytokine actions. Several internalisation mechanisms using the clathrin-coated pit pathway or clathrin-independent ways have been described. Frequently, a di-leucine motif in the cytoplasmatic part is found to be involved in receptor internalization (Aarts et al., 2004; Dittrich et al., 1994; Thiel et al., 1999). Internalised receptors are routed to the lysosomes and degraded, although receptor subunits may be recycled back to the plasma membrane like was for example demonstrated for the IL-2Rα (Hemar et al., 1995). The ubiquitin/proteasome system is another way of dismantling the receptor complex. Destruction of a protein via this system involves two successive steps: attachment of a chain of ubiquitin molecules to the target, resulting in recognition and degradation of the poly-ubiquinated protein by the 26S proteasome complex with release of reusable ubiquitin. Ubiquitination is described in more detail in text box2. Several signalling molecules are susceptible to ubiquitination, predestining them for proteasomal degradation (Callus and Mathey-Prevot, 1998; Kim and Maniatis, 1996; Wang et al., 2000; Yu and Burakoff, 1997). In this context, it was reported that proteasome-dependent degradation of receptor complexes including the GHR and EpoR can be mediated by members of the family of SOCS proteins (see further) (Verdier et al., 1998). Beside proteasomal degradation, SOCS proteins can also direct the internalisation and routing of cytokine receptors as was for example demonstrated for the GHR, granulocyt-colony stimulating factor receptor (G-CSFR) and epidermal growth factor receptor (EGFR) (Irandoust et al., 2007; Kario et al., 2005; Landsman and Waxman, 2005).

Chapter 2: Major mechanisms controlling cytokine signalling

- 36 - Text box 2: The Ubiquitination System

Ubiquitin (Ub) is a highly conserved protein of 76 amino acids that functions as a protein-modifier by covalent coupling via its C-terminus to target proteins. This ubiquitination marks these proteins, thereby affecting their stability, activity and/or subcellular localization. The binding of Ub to its substrates is a multi- step process that involves successive action of three classes of enzymes. The Ub-activating enzyme E1 activates Ub by forming a thioester bond. Activated Ub is then transferred to an Ub-conjugating enzyme E2 by transthiolation. Finally, an Ub ligase E3 couples Ub to a lysine residue or the N-terminus of the E3 associated target protein (Breitschopf et al., 1998; Glickman and Ciechanover, 2002). The association of the E3 ligases with their target protein determines substrate specificity for ubiquitination. Ubiquitination is a reversible and dynamic process, balanced by deubiquitinating enzymes (DUBs) that decouple Ub (Weissman, 2001).

Proteins can be modified by a single or multiple Ub moieties, termed mono-, multi- or poly-ubiquitination. Poly-Ub chains are formed by coupling of Ub to any of the seven lysines in the previously conjugated Ub. The different types of ubiquitination are proposed to direct the target protein for different cellular events. Mono-ubiquitination is for instance involved in receptor internalisation and histone regulation (Belouzard and Rouille, 2006; Hicke and Dunn, 2003; Osley, 2004). In many cases, poly-ubiquitination results in protein turnover by the proteasome, but it can also be involved in ribosomal function, DNA repair or signal transduction (Geetha et al., 2005; Spence et al., 2000; Wilkinson et al., 2005). Lys48-linked poly-Ub chains usually target proteins for destruction by the 26S proteasome (Kim and Rao, 2006; Pickart, 2001; Thrower et al., 2000). A well-studied example is the degradation of the hypoxia-inducible transcription factor (HIF)-1α by the Von Hippel Lindau (VHL) tumor suppressor. The turnover of HIF-1α is oxygen-regulated: under normal oxygen conditions, hydroxylation of HIF-1α will result in its recognition and destruction by VHL (Hon et al., 2002; Iliopoulos et al., 1996; Iwai et al., 1999; Lisztwan et al., 1999; Salceda and Caro, 1997). Conversely, in hypoxic conditions, HIF-1α is refractory to ubiquitination by VHL and will be able to induce expression of hypoxia-inducible genes regulating angiogenesis and erythrocytosis (Huang et al., 1996; Semenza, 1999; Wang and Semenza, 1993). VHL acts as the substrate recognition unit for an E3 ubiquitin ligase complex. It contains a substrate-interaction domain and a SOCS box which is conserved amongst different protein families, including the SOCS protein family. The SOCS box is proposed to serve as a common link of these proteins with the proteasomal degradation system (Hilton et al., 1998; Kile et al., 2002; Zhang et al., 1999). A small conserved motif in the SOCS box, named the B/C box, functions as a docking site for the adaptor molecules Elongin C and B (Aso et al., 1996; Duan et al., 1995; Kibel et al., 1995). Together with a Cullin box motif that is situated downstream of the B/C box (Kamura et al., 2004), the Elongin B/C dimer will bridge the substrate to a Cullin2 scaffold protein. Cullin2 in turn binds a RING finger-containing protein Rbx1 and together these proteins form an E3 ubiquitin ligase complex which will ultimately direct the ubiquitination and proteasomal degradation of HIF-1α (Iwai et al., 1999; Pause et al., 1997). Poly-ubiquitination that is not based on Lys48-linked Ub chains can be associated with processes as diverse as protein translation, activation of transcription factors and DNA repair (Geetha et al., 2005; Kim and Rao, 2006; Spence et al., 2000; Wilkinson et al., 2005).

Besides Ub, several other Ub-like (Ubl) proteins can also modify target proteins using a similar mechanism for their covalent conjugation. Examples include SUMO (small Ub-related modifier), ISG15 (interferon stimulated gene product 15), Nedd8 and Atg8, and these Ubls function as critical regulators of many cellular processes such as transcription, DNA repair, signal transduction and cell-cycle control (Dohmen, 2004; Kerscher et al., 2006; Ritchie and Zhang, 2004). Ub-like domains with a characteristic Ub fold can occur as stable regions within other proteins, as was demonstrated for Elongin B (Stebbins et al., 1999). These domains do not couple to other proteins but probably function in Ub-mediated processes (Pickart and Eddins, 2004; Weissman, 2001).

Chapter 2: Major mechanisms controlling cytokine signalling

- 37 - The turnover of some receptors such as the EGFR and IFNaR1 is dependent on both lysosomal and proteasomal activity (Kumar et al., 2003; Longva et al., 2002). Also for the EpoR it was suggested that the receptor complex is degraded by two proteolytic systems that proceed successively: the proteasome removes part of the intracellular domain of the EpoR at the cell surface, and the remaining part of the receptor-hormone complex is degraded in the lysosomes (Walrafen et al., 2005).

A number of receptors are subjected to regulated intramembrane proteolysis (RIP). After ectodomain cleavage, the cytoplasmatic part is recognized by intracellular proteases, resulting in proteolysis and release of the intracellular domain. This domain may then translocate to the nucleus, where it participates in transcriptional activation or functions as a substrate for proteasomal degradation.

III. Phosphatases

Since phosphorylation is a crucial trigger in the activation of cytokine signalling cascades, dephosphorylation by protein tyrosine phosphatases (PTPs) is an obvious mechanism that contributes to negative control.

SHP-1 and -2 - SH2 domain containing phosphatase (SHP)-1 and -2 are constitutively expressed phosphatases responsible for the dephosphorylation and inactivation of JAK kinases. Both proteins bind to either phosphorylated JAKs or receptors via two src homology (SH2) domains. Whereas SHP-2 is broadly expressed, SHP-1 expression is restricted to haematopoietic cells (Ahmad et al., 1993; Yi et al., 1992). The important role of the SHP-1 and -2 phosphatases is underscored by the lethal phenotype of their knock-outs. Mice with a naturally occurring mutation in the SHP-1 gene die shortly after birth, due to multiple abnormalities in immune responses (Kamata et al., 2003; Shultz et al., 1997). SHP- 2 deficient mice are embryonic lethal and this is caused by defects in EGF signalling (Qu et al., 1999; Saxton et al., 1997). A positive regulatory role for SHP-2 in the MAPK pathway was reported for several cytokine systems: SHP-2 becomes phosphorylated itself, which in turn can lead to docking of the Grb2/Sos complex, thereby activating the MAPK pathway (Bennett et al., 1994; Cunnick et al., 2002). Chapter 2: Major mechanisms controlling cytokine signalling

- 38 - SHP-2 was also reported to interact with STAT molecules and positively regulate their phosphorylation and activity (Chughtai et al., 2002). In contrast, SHP-2 may be responsible for tyrosine dephosphorylation of STAT5 in the cytosolic compartment (Yu et al., 2000).

Figure 7: Schematic overview of the negative regulation of cytokine signalling. For detailed information, see text.

Chapter 2: Major mechanisms controlling cytokine signalling

- 39 - Others - Genetic and biochemical approaches have implicated several other phosphatases in the inhibition of JAK kinase activity, including CD45 (Irie-Sasaki et al., 2001), PTPεC (Tanuma et al., 2000) and PTP1B (Elchebly et al., 1999; Myers et al., 2001). Similar approaches have underscored a role for SHP-2, PTP1B, TC45 and PTP-basophile like (PTP-BL) in STAT dephosphorylation (Aoki and Matsuda, 2000; Kerscher et al., 2006; Lund et al., 2005; Mustelin et al., 2005; Nakahira et al., 2007; ten Hoeve et al., 2002), which appears to be critical for STAT nuclear export (McBride and Reich, 2003; Vinkemeier, 2004).

IV. PIAS proteins

The Protein inhibitors of activated STAT (PIAS) protein family consists of four members; PIAS1, PIAS2 (also referred to as PIASx), PIAS3 and PIAS4 (also referred to as PIASy) (Shuai and Liu, 2005). Except for PIAS1, two isoforms were identified for each PIAS protein. These proteins have a central Zn-binding RING- finger domain, a conserved SAP (SAF-A/Acinus/PIAS) domain at the N-terminus, and a less conserved C-terminal part. The latter domains are involved in substrate binding. PIAS proteins bind to activated STAT dimers and prevent them from binding DNA. STAT1 and STAT3 are specifically inhibited by respectively PIAS1 and PIAS3 (Chung et al., 1997; Liu et al., 1998). Yet, PIAS2 and PIAS4 recruit additional co-repressing factors to inhibit the STAT transcriptional activity of respectively STAT4 and STAT1 (Arora et al., 2003; Liu et al., 2001). Furthermore, PIAS proteins have been shown to function as E3 type SUMO ligases that conjugate SUMO moieties to target proteins (Jackson, 2001). Although there is evidence that STATs can be modified by sumoylation (Rogers et al., 2003; Schmidt and Muller, 2003), the function of that modification in negative regulation is not yet clear.

Chapter 2: Major mechanisms controlling cytokine signalling

- 40 - V. References

Aarts, L. H., Roovers, O., Ward, A. C., and Touw, I. P. (2004). Receptor activation and 2 distinct COOH-terminal motifs control G-CSF receptor distribution and internalization kinetics. Blood 103, 571-579. Ahmad, S., Banville, D., Zhao, Z., Fischer, E. H., and Shen, S. H. (1993). A widely expressed human protein-tyrosine phosphatase containing src homology 2 domains. Proc Natl Acad Sci U S A 90, 2197-2201. Aoki, N., and Matsuda, T. (2000). A cytosolic protein-tyrosine phosphatase PTP1B specifically dephosphorylates and deactivates prolactin-activated STAT5a and STAT5b. J Biol Chem 275, 39718-39726. Arora, T., Liu, B., He, H., Kim, J., Murphy, T. L., Murphy, K. M., Modlin, R. L., and Shuai, K. (2003). PIASx is a transcriptional co-repressor of signal transducer and activator of transcription 4. J Biol Chem 278, 21327-21330. Aso, T., Haque, D., Barstead, R. J., Conaway, R. C., and Conaway, J. W. (1996). The inducible elongin A elongation activation domain: structure, function and interaction with the elongin BC complex. Embo J 15, 5557-5566. Baumann, G. (1995). Growth hormone binding to a circulating receptor fragment--the concept of receptor shedding and receptor splicing. Exp Clin Endocrinol Diabetes 103, 2-6. Belouzard, S., and Rouille, Y. (2006). Ubiquitylation of leptin receptor OB-Ra regulates its clathrin- mediated endocytosis. Embo J 25, 932-942. Bennett, A. M., Tang, T. L., Sugimoto, S., Walsh, C. T., and Neel, B. G. (1994). Protein-tyrosine- phosphatase SHPTP2 couples platelet-derived growth factor receptor beta to Ras. Proc Natl Acad Sci U S A 91, 7335-7339. Breitschopf, K., Bengal, E., Ziv, T., Admon, A., and Ciechanover, A. (1998). A novel site for ubiquitination: the N-terminal residue, and not internal lysines of MyoD, is essential for conjugation and degradation of the protein. Embo J 17, 5964-5973. Callus, B. A., and Mathey-Prevot, B. (1998). Interleukin-3-induced activation of the JAK/STAT pathway is prolonged by proteasome inhibitors. Blood 91, 3182-3192. Chughtai, N., Schimchowitsch, S., Lebrun, J. J., and Ali, S. (2002). Prolactin induces SHP-2 association with Stat5, nuclear translocation, and binding to the beta-casein gene promoter in mammary cells. J Biol Chem 277, 31107-31114. Chung, C. D., Liao, J., Liu, B., Rao, X., Jay, P., Berta, P., and Shuai, K. (1997). Specific inhibition of Stat3 signal transduction by PIAS3. Science 278, 1803-1805. Cunnick, J. M., Meng, S., Ren, Y., Desponts, C., Wang, H. G., Djeu, J. Y., and Wu, J. (2002). Regulation of the mitogen-activated protein kinase signaling pathway by SHP2. J Biol Chem 277, 9498-9504. Dittrich, E., Rose-John, S., Gerhartz, C., Mullberg, J., Stoyan, T., Yasukawa, K., Heinrich, P. C., and Graeve, L. (1994). Identification of a region within the cytoplasmic domain of the interleukin-6 (IL-6) signal transducer gp130 important for ligand-induced endocytosis of the IL-6 receptor. J Biol Chem 269, 19014-19020. Dohmen, R. J. (2004). SUMO protein modification. Biochim Biophys Acta 1695, 113-131. Duan, D. R., Pause, A., Burgess, W. H., Aso, T., Chen, D. Y., Garrett, K. P., Conaway, R. C., Conaway, J. W., Linehan, W. M., and Klausner, R. D. (1995). Inhibition of transcription elongation by the VHL tumor suppressor protein. Science 269, 1402-1406. Elchebly, M., Payette, P., Michaliszyn, E., Cromlish, W., Collins, S., Loy, A. L., Normandin, D., Cheng, A., Himms-Hagen, J., Chan, C. C., et al. (1999). Increased insulin sensitivity and obesity resistance in mice lacking the protein tyrosine phosphatase-1B gene. Science 283, 1544-1548. Geetha, T., Jiang, J., and Wooten, M. W. (2005). Lysine 63 polyubiquitination of the nerve growth factor receptor TrkA directs internalization and signaling. Mol Cell 20, 301-312. Glickman, M. H., and Ciechanover, A. (2002). The ubiquitin-proteasome proteolytic pathway: destruction for the sake of construction. Physiol Rev 82, 373-428. Heinrich, P. C., Graeve, L., Rose-John, S., Schneider-Mergener, J., Dittrich, E., Erren, A., Gerhartz, C., Hemann, U., Lutticken, C., Wegenka, U., and et al. (1995). Membrane-bound and soluble interleukin-6 receptor: studies on structure, regulation of expression, and signal transduction. Ann N Y Acad Sci 762, 222-236; discussion 236-227. Hemar, A., Subtil, A., Lieb, M., Morelon, E., Hellio, R., and Dautry-Varsat, A. (1995). Endocytosis of interleukin 2 receptors in human T lymphocytes: distinct intracellular localization and fate of the receptor alpha, beta, and gamma chains. J Cell Biol 129, 55-64. Chapter 2: Major mechanisms controlling cytokine signalling

- 41 - Hicke, L., and Dunn, R. (2003). Regulation of membrane protein transport by ubiquitin and ubiquitin- binding proteins. Annu Rev Cell Dev Biol 19, 141-172. Hilton, D. J., Richardson, R. T., Alexander, W. S., Viney, E. M., Willson, T. A., Sprigg, N. S., Starr, R., Nicholson, S. E., Metcalf, D., and Nicola, N. A. (1998). Twenty proteins containing a C-terminal SOCS box form five structural classes. Proc Natl Acad Sci U S A 95, 114-119. Hon, W. C., Wilson, M. I., Harlos, K., Claridge, T. D., Schofield, C. J., Pugh, C. W., Maxwell, P. H., Ratcliffe, P. J., Stuart, D. I., and Jones, E. Y. (2002). Structural basis for the recognition of hydroxyproline in HIF-1 alpha by pVHL. Nature 417, 975-978. Huang, L. E., Arany, Z., Livingston, D. M., and Bunn, H. F. (1996). Activation of hypoxia-inducible transcription factor depends primarily upon redox-sensitive stabilization of its alpha subunit. J Biol Chem 271, 32253-32259. Iliopoulos, O., Levy, A. P., Jiang, C., Kaelin, W. G., Jr., and Goldberg, M. A. (1996). Negative regulation of hypoxia-inducible genes by the von Hippel-Lindau protein. Proc Natl Acad Sci U S A 93, 10595-10599. Irandoust, M. I., Aarts, L. H., Roovers, O., Gits, J., Erkeland, S. J., and Touw, I. P. (2007). Suppressor of cytokine signaling 3 controls lysosomal routing of G-CSF receptor. Embo J 26, 2822. Irie-Sasaki, J., Sasaki, T., Matsumoto, W., Opavsky, A., Cheng, M., Welstead, G., Griffiths, E., Krawczyk, C., Richardson, C. D., Aitken, K., et al. (2001). CD45 is a JAK phosphatase and negatively regulates cytokine receptor signalling. Nature 409, 349-354. Iwai, K., Yamanaka, K., Kamura, T., Minato, N., Conaway, R. C., Conaway, J. W., Klausner, R. D., and Pause, A. (1999). Identification of the von Hippel-lindau tumor-suppressor protein as part of an active E3 ubiquitin ligase complex. Proc Natl Acad Sci U S A 96, 12436-12441. Jackson, P. K. (2001). A new RING for SUMO: wrestling transcriptional responses into nuclear bodies with PIAS family E3 SUMO ligases. Genes Dev 15, 3053-3058. Kamata, T., Yamashita, M., Kimura, M., Murata, K., Inami, M., Shimizu, C., Sugaya, K., Wang, C. R., Taniguchi, M., and Nakayama, T. (2003). src homology 2 domain-containing tyrosine phosphatase SHP-1 controls the development of allergic airway inflammation. J Clin Invest 111, 109-119. Kamura, T., Maenaka, K., Kotoshiba, S., Matsumoto, M., Kohda, D., Conaway, R. C., Conaway, J. W., and Nakayama, K. I. (2004). VHL-box and SOCS-box domains determine binding specificity for Cul2-Rbx1 and Cul5-Rbx2 modules of ubiquitin ligases. Genes Dev 18, 3055-3065. Kario, E., Marmor, M. D., Adamsky, K., Citri, A., Amit, I., Amariglio, N., Rechavi, G., and Yarden, Y. (2005). Suppressors of cytokine signaling 4 and 5 regulate epidermal growth factor receptor signaling. J Biol Chem 280, 7038-7048. Kerscher, O., Felberbaum, R., and Hochstrasser, M. (2006). Modification of proteins by ubiquitin and ubiquitin-like proteins. Annu Rev Cell Dev Biol 22, 159-180. Kibel, A., Iliopoulos, O., DeCaprio, J. A., and Kaelin, W. G., Jr. (1995). Binding of the von Hippel- Lindau tumor suppressor protein to Elongin B and C. Science 269, 1444-1446. Kile, B. T., Schulman, B. A., Alexander, W. S., Nicola, N. A., Martin, H. M., and Hilton, D. J. (2002). The SOCS box: a tale of destruction and degradation. Trends Biochem Sci 27, 235-241. Kim, I., and Rao, H. (2006). What's Ub chain linkage got to do with it? Sci STKE 2006, pe18. Kim, T. K., and Maniatis, T. (1996). Regulation of interferon-gamma-activated STAT1 by the ubiquitin-proteasome pathway. Science 273, 1717-1719. Kumar, K. G., Tang, W., Ravindranath, A. K., Clark, W. A., Croze, E., and Fuchs, S. Y. (2003). SCF(HOS) ubiquitin ligase mediates the ligand-induced down-regulation of the interferon-alpha receptor. Embo J 22, 5480-5490. Landsman, T., and Waxman, D. J. (2005). Role of the cytokine-induced SH2-containing protein CIS in growth hormone receptor internalization. J Biol Chem. Lisztwan, J., Imbert, G., Wirbelauer, C., Gstaiger, M., and Krek, W. (1999). The von Hippel-Lindau tumor suppressor protein is a component of an E3 ubiquitin-protein ligase activity. Genes Dev 13, 1822-1833. Liu, B., Gross, M., ten Hoeve, J., and Shuai, K. (2001). A transcriptional corepressor of Stat1 with an essential LXXLL signature motif. Proc Natl Acad Sci U S A 98, 3203-3207. Liu, B., Liao, J., Rao, X., Kushner, S. A., Chung, C. D., Chang, D. D., and Shuai, K. (1998). Inhibition of Stat1-mediated gene activation by PIAS1. Proc Natl Acad Sci U S A 95, 10626-10631. Longva, K. E., Blystad, F. D., Stang, E., Larsen, A. M., Johannessen, L. E., and Madshus, I. H. (2002). Ubiquitination and proteasomal activity is required for transport of the EGF receptor to inner membranes of multivesicular bodies. J Cell Biol 156, 843-854.

Chapter 2: Major mechanisms controlling cytokine signalling

- 42 - Lund, I. K., Hansen, J. A., Andersen, H. S., Moller, N. P., and Billestrup, N. (2005). Mechanism of protein tyrosine phosphatase 1B-mediated inhibition of leptin signalling. J Mol Endocrinol 34, 339-351. McBride, K. M., and Reich, N. C. (2003). The ins and outs of STAT1 nuclear transport. Sci STKE 2003, RE13. Mustelin, T., Vang, T., and Bottini, N. (2005). Protein tyrosine phosphatases and the immune response. Nat Rev Immunol 5, 43-57. Myers, M. P., Andersen, J. N., Cheng, A., Tremblay, M. L., Horvath, C. M., Parisien, J. P., Salmeen, A., Barford, D., and Tonks, N. K. (2001). TYK2 and JAK2 are substrates of protein-tyrosine phosphatase 1B. J Biol Chem 276, 47771-47774. Nakahira, M., Tanaka, T., Robson, B. E., Mizgerd, J. P., and Grusby, M. J. (2007). Regulation of signal transducer and activator of transcription signaling by the tyrosine phosphatase PTP-BL. Immunity 26, 163-176. Novick, D., Kim, S. H., Fantuzzi, G., Reznikov, L. L., Dinarello, C. A., and Rubinstein, M. (1999). Interleukin-18 binding protein: a novel modulator of the Th1 cytokine response. Immunity 10, 127-136. Osley, M. A. (2004). H2B ubiquitylation: the end is in sight. Biochim Biophys Acta 1677, 74-78. Pause, A., Lee, S., Worrell, R. A., Chen, D. Y., Burgess, W. H., Linehan, W. M., and Klausner, R. D. (1997). The von Hippel-Lindau tumor-suppressor gene product forms a stable complex with human CUL-2, a member of the Cdc53 family of proteins. Proc Natl Acad Sci U S A 94, 2156- 2161. Peters, M., Jacobs, S., Ehlers, M., Vollmer, P., Mullberg, J., Wolf, E., Brem, G., Meyer zum Buschenfelde, K. H., and Rose-John, S. (1996). The function of the soluble interleukin 6 (IL-6) receptor in vivo: sensitization of human soluble IL-6 receptor transgenic mice towards IL-6 and prolongation of the plasma half-life of IL-6. J Exp Med 183, 1399-1406. Pickart, C. M. (2001). Ubiquitin enters the new millennium. Mol Cell 8, 499-504. Pickart, C. M., and Eddins, M. J. (2004). Ubiquitin: structures, functions, mechanisms. Biochim Biophys Acta 1695, 55-72. Qu, C. K., Yu, W. M., Azzarelli, B., and Feng, G. S. (1999). Genetic evidence that Shp-2 tyrosine phosphatase is a signal enhancer of the epidermal growth factor receptor in mammals. Proc Natl Acad Sci U S A 96, 8528-8533. Ritchie, K. J., and Zhang, D. E. (2004). ISG15: the immunological kin of ubiquitin. Semin Cell Dev Biol 15, 237-246. Rogers, R. S., Horvath, C. M., and Matunis, M. J. (2003). SUMO modification of STAT1 and its role in PIAS-mediated inhibition of gene activation. J Biol Chem 278, 30091-30097. Salceda, S., and Caro, J. (1997). Hypoxia-inducible factor 1alpha (HIF-1alpha) protein is rapidly degraded by the ubiquitin-proteasome system under normoxic conditions. Its stabilization by hypoxia depends on redox-induced changes. J Biol Chem 272, 22642-22647. Saxton, T. M., Henkemeyer, M., Gasca, S., Shen, R., Rossi, D. J., Shalaby, F., Feng, G. S., and Pawson, T. (1997). Abnormal mesoderm patterning in mouse embryos mutant for the SH2 tyrosine phosphatase Shp-2. Embo J 16, 2352-2364. Schmidt, D., and Muller, S. (2003). PIAS/SUMO: new partners in transcriptional regulation. Cell Mol Life Sci 60, 2561-2574. Semenza, G. L. (1999). Regulation of mammalian O2 homeostasis by hypoxia-inducible factor 1. Annu Rev Cell Dev Biol 15, 551-578. Shuai, K., and Liu, B. (2005). Regulation of gene-activation pathways by PIAS proteins in the immune system. Nat Rev Immunol 5, 593-605. Shultz, L. D., Rajan, T. V., and Greiner, D. L. (1997). Severe defects in immunity and hematopoiesis caused by SHP-1 protein-tyrosine-phosphatase deficiency. Trends Biotechnol 15, 302-307. Spence, J., Gali, R. R., Dittmar, G., Sherman, F., Karin, M., and Finley, D. (2000). Cell cycle- regulated modification of the ribosome by a variant multiubiquitin chain. Cell 102, 67-76. Stebbins, C. E., Kaelin, W. G., Jr., and Pavletich, N. P. (1999). Structure of the VHL-ElonginC- ElonginB complex: implications for VHL tumor suppressor function. Science 284, 455-461. Tanuma, N., Nakamura, K., Shima, H., and Kikuchi, K. (2000). Protein-tyrosine phosphatase PTPepsilon C inhibits Jak-STAT signaling and differentiation induced by interleukin-6 and leukemia inhibitory factor in M1 leukemia cells. J Biol Chem 275, 28216-28221. ten Hoeve, J., de Jesus Ibarra-Sanchez, M., Fu, Y., Zhu, W., Tremblay, M., David, M., and Shuai, K. (2002). Identification of a nuclear Stat1 protein tyrosine phosphatase. Mol Cell Biol 22, 5662- 5668.

Chapter 2: Major mechanisms controlling cytokine signalling

- 43 - Thiel, S., Behrmann, I., Timmermann, A., Dahmen, H., Muller-Newen, G., Schaper, F., Tavernier, J., Pitard, V., Heinrich, P. C., and Graeve, L. (1999). Identification of a Leu-lle internalization motif within the cytoplasmic domain of the leukaemia inhibitory factor receptor. Biochem J 339 ( Pt 1), 15-19. Thrower, J. S., Hoffman, L., Rechsteiner, M., and Pickart, C. M. (2000). Recognition of the polyubiquitin proteolytic signal. Embo J 19, 94-102. Verdier, F., Chretien, S., Muller, O., Varlet, P., Yoshimura, A., Gisselbrecht, S., Lacombe, C., and Mayeux, P. (1998). Proteasomes regulate erythropoietin receptor and signal transducer and activator of transcription 5 (STAT5) activation. Possible involvement of the ubiquitinated Cis protein. J Biol Chem 273, 28185-28190. Vinkemeier, U. (2004). Getting the message across, STAT! Design principles of a molecular signaling circuit. J Cell Biol 167, 197-201. Walrafen, P., Verdier, F., Kadri, Z., Chretien, S., Lacombe, C., and Mayeux, P. (2005). Both proteasomes and lysosomes degrade the activated erythropoietin receptor. Blood 105, 600-608. Wang, D., Moriggl, R., Stravopodis, D., Carpino, N., Marine, J. C., Teglund, S., Feng, J., and Ihle, J. N. (2000). A small amphipathic alpha-helical region is required for transcriptional activities and proteasome-dependent turnover of the tyrosine-phosphorylated Stat5. Embo J 19, 392-399. Wang, G. L., and Semenza, G. L. (1993). General involvement of hypoxia-inducible factor 1 in transcriptional response to hypoxia. Proc Natl Acad Sci U S A 90, 4304-4308. Weissman, A. M. (2001). Themes and variations on ubiquitylation. Nat Rev Mol Cell Biol 2, 169-178. Wilkinson, K. D., Ventii, K. H., Friedrich, K. L., and Mullally, J. E. (2005). The ubiquitin signal: assembly, recognition and termination. Symposium on ubiquitin and signaling. EMBO Rep 6, 815-820. Yi, T. L., Cleveland, J. L., and Ihle, J. N. (1992). Protein tyrosine phosphatase containing SH2 domains: characterization, preferential expression in hematopoietic cells, and localization to human chromosome 12p12-p13. Mol Cell Biol 12, 836-846. Yu, C. L., and Burakoff, S. J. (1997). Involvement of proteasomes in regulating Jak-STAT pathways upon interleukin-2 stimulation. J Biol Chem 272, 14017-14020. Yu, C. L., Jin, Y. J., and Burakoff, S. J. (2000). Cytosolic tyrosine dephosphorylation of STAT5. Potential role of SHP-2 in STAT5 regulation. J Biol Chem 275, 599-604. Zhang, J. G., Farley, A., Nicholson, S. E., Willson, T. A., Zugaro, L. M., Simpson, R. J., Moritz, R. L., Cary, D., Richardson, R., Hausmann, G., et al. (1999). The conserved SOCS box motif in suppressors of cytokine signaling binds to elongins B and C and may couple bound proteins to proteasomal degradation. Proc Natl Acad Sci U S A 96, 2071-2076.

Chapter 2: Major mechanisms controlling cytokine signalling

- 44 - CHAPTER 3: The SOCS protein family

SOCS are a family of intracellular proteins that play a major role in the regulation of cytokine responses. The founding member of the SOCS family, the cytokine- inducible SH2 domain containing (CIS) protein, was cloned in 1995 and was originally identified as an immediate early response gene induced in haematopoietic cells in response to Epo or IL-3 (Yoshimura et al., 1995). Following that report, SOCS1 was identified by three different groups in 1997 as a novel JAK regulatory protein (Endo et al., 1997; Naka et al., 1997; Starr et al., 1997). Database searches led to the identification and cloning of 6 additional SOCS proteins based on sequence homology (Hilton et al., 1998; Masuhara et al., 1997; Starr et al., 1997). So at present, the SOCS family counts eight members: CIS and SOCS1 through SOCS7.

I. Expression of SOCS proteins

SOCS proteins are often expressed at low or undetectable levels in resting cells. They are rapidly up-regulated in response to a broad spectrum of cytokines and, in turn, control the duration and intensity of cytokine responses by blocking various aspects of the signalling pathways. SOCS proteins function in a typical negative feedback loop, since they can down-modulate the signalling pathway that stimulates their production. The pattern of SOCS expression by a particular cytokine tends to vary according to the cell type or tissue. The induced SOCS proteins can attenuate responses of various cytokines and may be involved in inhibitory cross-talk between different cytokine systems, providing a mechanism by which concurrent signalling processes can modulate each other. An overview of SOCS induction patterns and inhibition of cytokine signalling is given in table 6. Although SOCS proteins are induced by a range of cytokines and show a high structural and functional overlap, large evidence indicates the potential of specific SOCS proteins to modulate cytokine signalling with exquisite control. The SOCS expression is tightly regulated

Chapter 3: The SOCS protein family

- 45 - through multiple mechanisms in order to avoid inappropriate interference with physiological responses (reviewed in chapter 11).

Table 6: SOCS induction, inhibition patterns and cross-regulation

SOCS induced by inhibits signal transduction of

CIS Leptin, Epo, GH, PRL, LIF, G-CSF, GM-CSF, Leptin, Epo, GH, PRL, IGF1, G-CSF, IL-2, IL-3 TPO, CNTF, IFNα, IFNγ, IL-1, IL-2, IL-3, IL-4, IL-6, IL-9, IL-12, IL-13

SOCS1 Leptin, Epo, GH, PRL, LIF, insulin, G-CSF, GM-CSFLeptin, Epo, GH, LIF, PRL, Epo, Insulin, TNFα, CNTF, IFNα/β, IFNγ, IL-2, IL-3, IL-4, IL-6, OSM, TPO, IGF1, IFNα/β, IFNγ, IL-2, IL-4, IL-13, LPS, CpG DNA IL-6, IL-7, IL-12, IL-15

SOCS2 Leptin, GH, PRL, Insulin, Estrogen, EPO, CNTF, Leptin, GH, PRL, LIF, IFNγ, IGF1, EGF, IL-6 G-CSF, GM-CSF, TNFα, LIF, IFNα, IFNγ, IL-1, IL-2, IL-3, IL-4, IL-6, IL-9, IL-10, Lipoxins

SOCS3 Leptin, Epo, GH, PRL, Insulin, GM-CSF, M-CSF, Leptin, Epo, GH, PRL, OSM, CNTF, IGF1, G-CSF, CNTF, TPO, TNFα, LIF, IFNα, IFNγ, IL-1, Insulin, LIF, IFNα/β, IFNγ, IL-2, IL-3, IL-4, IL-2, IL-3, IL-4, IL-6, IL-7, IL-9, IL-10, IL-11, IL-6, IL-9, IL-11 IL-12, IL-13, LPS, CpG DNA

SOCS4 EGF EGF

SOCS5 EGF, IL-6 EGF, LIF, IL-4, IL-6

SOCS6 Insulin, Kit Leptin, Insulin, Kit

SOCS7 GH, PRL, Insulin, IL-6, IFNγ, IL-1β Leptin, GH, PRL, Insulin

SOCS can be induced by stimuli other than cytokines, including growth factors, chemokines, hormones, pathogens and their products such as CpG DNA or LPS (Baetz et al., 2004; Crespo et al., 2000; Dalpke et al., 2001; Dogusan et al., 2000; Krebs and Hilton, 2003; Leong et al., 2004; Stoiber et al., 1999). SOCS expression was also found to be developmentally regulated in the absence of cytokine signalling (Ilangumaran et al., 2004; Kubo et al., 2003).

STAT proteins are the major regulators of SOCS gene expression. STAT binding sequences were identified in the SOCS promoter region and electrophoretic mobility shift assays confirmed STAT association to these motifs (table 7). In some cases, STAT induced SOCS expression is indirect. STAT1 is for example indirectly implicated in IFNγ mediated upregulaton of SOCS1 since it drives expression of the

Chapter 3: The SOCS protein family

- 46 - interferon regulatory factor-1 (IRF-1) transcription factor which is responsible for SOCS1 induction (Saito et al., 2000).

Table 7: STAT-responsive elements in SOCS promotors

STAT binding elements references CIS STAT5 (Matsumoto et al., 1997)

SOCS1 STAT1, STAT3, STAT6 (Naka et al., 1997; Saito et al., 2000)

SOCS2 STAT5 (Vidal et al., 2007)

SOCS3 STAT1, STAT3, STAT5 (Auernhammer et al., 1999; Davey et al., 1999; Emanuelli et al., 2000; Gatto et al., 2004)

SOCS proteins not only control kinetics and magnitude of signalling but can also be involved in the shaping of the cytokine responses. For example, SOCS3 regulates both the quantity and type of STAT signalling generated from the pro-inflammatory IL-6R. Loss of SOCS3 will alter the functional outcome of IL-6 signalling by prolonging STAT activation. IL-6 then behaves more like the immunosuppressive cytokine IL-10 and induces IFN gene expression owing to respectively an excess of STAT3 and STAT1 phosporylation (see below) (Croker et al., 2003; Lang et al., 2003; Yasukawa et al., 2003).

II. SOCS protein structure and molecular mechanisms of action

Comparative sequence analysis of the SOCS members revealed that CIS and SOCS2, SOCS1 and -3, SOCS4 and -5 and finally SOCS6 and -7 form closely related pairs (Hilton et al., 1998). CIS and SOCS2 are the most related with around 35% of AA identity while the rest of SOCS pairs share approximately 25% of AA sequences. SOCS homologues were also identified in D. melanogaster and C. elegans (Kile et al., 2002; Starr et al., 1997). The general structure of SOCS proteins is evolutionary well preserved and common features include an N-terminal

Chapter 3: The SOCS protein family

- 47 - pre-SH2 domain, a central SH2 domain and a C-terminal SOCS box (figure 8). The N-terminal part varies in length and sequence similarity while the SH2 domain and SOCS box are most conserved.

Figure 8: Domain structure of the SOCS protein family The major structural characteristic of the SOCS family is the presence of two domains with relatively well conserved AA sequence: an SH2 domain in the middle portion and a SOCS box at the C-terminus. Only SOCS1 and -3 possess a KIR immediately upstream of the SH2 domain. Conserved tyrosines in the SOCS box are represented by a black line.

The N-terminal domain: JAK kinase inhibition.

The N-terminus varies greatly in length among the SOCS members and contains no homology to known structural domains. Nevertheless, an extended SH2 subdomain (ESS) helix was identified as a conserved structural element in CIS and SOCS1-3 and appeared to be critical for high affinity SH2 substrate interactions (Yasukawa et al., 1999). Both SOCS1 and 3 can be distinguished from the other SOCS proteins by an additional small kinase inhibitory region (KIR) of 12 AA located in the N- terminal portion and involved in inhibition of the JAK kinases. This region was found functionally interchangeable between the two SOCS suggesting a common inhibitory mechanism (Nicholson et al., 1999). The KIR region displays some sequence similarity with the activation loop of JAK2, suggesting that it acts as a pseudosubstrate by mimicking the activation loop that regulates access to the

Chapter 3: The SOCS protein family

- 48 -

Figure 9: Schematic representation of molecular mechanisms of SOCS actions catalytic groove (Yasukawa et al., 1999). Based on a structural model of SOCS1 in complex with JAK2 it was proposed that the KIR region suppresses JAK activity by obstructing the access of both ATP and substrate to their respective binding sites (Giordanetto and Kroemer, 2003). Although the SH2 domain of SOCS3 does not have a high affinity for JAK kinases, the KIR domain of SOCS3 shows a stronger potential for both binding and inhibition of JAKs than that of SOCS1 (figure 9) (Sasaki et al., 1999). The wide range of actions exhibited by SOCS1 and SOCS3 is most probably due to their additional ability to inhibit the catalytic activity of JAK kinases.

Chapter 3: The SOCS protein family

- 49 - The SH2 domain: substrate specificity and competition for receptor motifs.

The central SH2 domain determines the target of the SOCS protein. It allows interaction with phosphorylated tyrosine residues of other proteins, like receptors, JAKs or adaptors. This way, SOCS proteins can exert their inhibitory effects by competing with other signalling molecules including STATs for phosphorylated tyrosine motifs in the receptor complex. Because of direct association and steric hindrance by the SOCS molecules, the docking sites then become inaccessible for other signal transductors (figure 9). SOCS1 directly interacts with all JAK members, thereby inhibiting their catalytic activity (Endo et al., 1997; Naka et al., 1997; Nicholson et al., 1999). It targets the phosphotyrosine at position Y1007, which lies within the activation loop of JAK2 (Giordanetto and Kroemer, 2003; Yasukawa et al., 1999). Activation of the kinase is dependent on phosphorylation of this particular tyrosine. The SOCS1 SH2 domain is sufficient for JAK2 interaction. However, as mentioned above, an additional region of approximately 30 residues immediately N-terminal to the SH2 domain (the ESS) and the KIR are additionally required for high affinity binding and inhibition of JAK2 activity (Giordanetto and Kroemer, 2003; Yasukawa et al., 1999). Remarkably, SOCS1 has also been shown to bind directly to the type I and type II IFN receptors, which might provide a very efficient inhibitory effect of SOCS1 on IFN signalling (Fenner et al., 2006; Qing et al., 2005). SOCS3 showed only weak affinity for JAK2 itself and it is proposed to bind with phosphotyrosine motifs in the receptor close to the kinase to inhibit its activity through the KIR domain (Suzuki et al., 1998). High affinity interaction of SOCS3 was demonstrated for gp130 (Nicholson et al., 2000) and other related receptors (Bjorbaek et al., 2000; Eyckerman et al., 2000; Hortner et al., 2002; Ram and Waxman, 1999; Yamamoto et al., 2003). NMR and crystal structures of SOCS3 with a bound gp130 phosphotyrosine peptide showed the importance of the residue at position Y+3 (Babon et al., 2006; Bergamin et al., 2006). While residues at positions Y+1 and Y+2 are solvent exposed, the hydrophobic character of the pocket residue is conserved in all SOCS proteins, suggesting a similar hydrophobic pocket. An overview of the reported phosphotyrosine binding preferences of the SH2 domains of SOCS1 and SOCS3 is given in table 8. The SH2 domains of SOCS2 and CIS are reported to interact

Chapter 3: The SOCS protein family

- 50 - primarily with phosphotyrosines of receptors such as the EpoR or the GHR, of which several are known to be STAT recruitment sites (Ram and Waxman, 1999; Verdier et al., 1998).

Table 8: Phosphotyrosine binding preferences of SOCS1 and SOCS3 (Φ = hydrophobic)

-2 -1 Y(p) +1 +2 +3 +4 +5 references SOCS1 E Y K E (Giordanetto and Kroemer, 2003) SOCS3 Y S/A/V/Y/F Φ V/I/L Φ H/V/I/Y (De Souza et al., 2002) V E Y V V H (Bergamin et al., 2006) V Y V V (Babon et al., 2006)

The SOCS box: proteasomal targeting and protein stability

As mentioned before, the C-terminal SOCS box is conserved throughout the SOCS family, thus suggesting an important role for this region in the function and regulation of SOCS proteins. Different SOCS box containing protein families have been identified. Instead of possessing SH2 domains they contain other protein- protein interacting motifs, such as ankyrin repeats, SPRY domains or WD40 repeats (Hilton et al., 1998). Clues to understand the function of the SOCS box came from the initial finding that the Von Hippel-Lindau (VHL) tumor suppressor protein interacts with its Elongin B/C complex via the SOCS box, linking VHL to the ubiquitin/proteasome degradation system (figure 9) (Iwai et al., 1999; Kibel et al., 1995). The Elongin B/C-Cullin-SOCS box (ECS) complex was characterized as a family of E3 ubiquitin ligases in which the SOCS box protein acts as the substrate recognition unit of the complex (Kile et al., 2002). The SOCS box domain of these proteins mediates the interaction with Elongin C by the B/C box, a xxLxxxCxxx(A/I/L/V) conserved sequence (Aso et al., 1996; Duan et al., 1995; Kamura et al., 1998; Kibel et al., 1995). Recently, the B/C box was characterized as a (S,T,P,L)xxx(C,S,A)xxxΦ sequence (Mahrour et al., 2008). Elongin B binds Elongin C and this dimer acts as a linker that bridges the substrate recognized by the SOCS box protein to a Cullin scaffold protein. This association with a Cullin

Chapter 3: The SOCS protein family

- 51 - protein will further be supported by a conserved Cullin box motif, located downstream of the B/C box in the SOCS box (Kamura et al., 2004). Cullin in turns recruits a RING finger-containing protein Rbx, thereby completing the assembly of the E3 ligase complex (figure 10) (Iwai et al., 1999; Pause et al., 1997).

Figure 10: Model for proteasomal target degradation by SOCS proteins

VHL and SOCS1 were shown to interact with a Cul2-Rbx1 module, whereas the other SOCS proteins associate with a Cul5-Rbx2 complex (Kamizono et al., 2001; Kamura et al., 1999).The Cul2 box and Cul5 box were defined as key determinants of the association between Elongin B/C binding proteins and a specific Cullin-Rbx module. The Cul5 box corresponds to the C-terminal portion of the canonical SOCS box and has the consensus sequence ΦxxLPΦPxxΦxx(Y/F)(L/I), where the central LPΦP is particularly important for Cullin5 binding (Hilton et al., 1998; Kamura et al., 2004; Mahrour et al., 2008). Recently, the consensus sequence for the Cul2 box was defined as a ΦPxxΦxxxΦ motif, sharing some sequence similarity with the Cul5 box (Mahrour et al., 2008).

Chapter 3: The SOCS protein family

- 52 -

Figure 11: Model for the assembly of SOCS2-Elongin C-Elongin B into an E3 ubiquitin ligase complex (from (Bullock et al., 2006)).

Together with an E1 ubiquitin activating enzyme and the E2 conjugating enzyme, the E3 ubiquitin ligase participates in the polyubiquitin tagging of associated proteins and is responsible for substrate specificity (figure 11) (Glickman and Ciechanover, 2002). This way, SOCS box proteins may suppress signalling by linking associated signalling components for degradation (Kamura et al., 2001). Consistent with this idea, proteasomal inhibitors block the inhibitory functions of SOCS and induce sustained JAK-STAT signalling (Callus and Mathey-Prevot, 1998; Kim and Maniatis, 1996; Verdier et al., 1998; Yu and Burakoff, 1997). The functional importance of the SOCS box was confirmed by the generation of transgenic mice expressing a C-terminal truncated variant of SOCS1 or SOCS3. These mice exhibit impaired regulation of respectively INFγ and G-CSF signalling, suggesting that the SOCS box is essential for complete SOCS activity (Boyle et al., 2007; Zhang et al., 2001).

Chapter 3: The SOCS protein family

- 53 - In this thesis, we studied the multiple roles of the SOCS box. Other functions of this domain are: (i) the control of protein stability, (ii) an adaptor function linking SOCS to other signalling pathways like the MAPK pathway, (iii) an implication in SOCS cross- regulation (chapter 9) and (iv) regulation of receptor interaction (chapter 10). Considering the different characteristics and functions of the SOCS box, a complex biological role for this domain emerges which is the focus of a review (chapter 11).

III. Posttranslational modification of SOCS proteins

Ubiquitination of CIS and SOCS3 was reported (Sasaki et al., 2003; Verdier et al., 1998), as well as phosphorylation of SOCS1 and SOCS3 (see table 9 for overview). One of the tyrosines phosphorylated in the SOCS box of SOCS3 is highly conserved in all SOCS family members. It will thus be important to determine whether other SOCS proteins can also be regulated as a result of phosphorylation.

Table 9: Phosphorylation of SOCS proteins

phosphorylation kinase/stimulus effect references sites SOCS1 Ser/Thr in the N- PIM kinase stabilisation of SOCS1 (Chen et al., 2002) terminus Ser/Thr PIM kinase potentiates STAT5 (Peltola et al., 2004) inhibition (through SOCS1 stabilisation?) SOCS3 Tyr204 and 221 in JAK kinase disrupts Elongin (Haan et al., 2003) the SOCS box interaction and destabilises SOCS3 Tyr204 and 221 in JAK and Src kinases, maintains activation of (Cacalano et al., the SOCS box RTKs (in response to IL- ERK-MAPK 2001) 2, EPO, EGF, PDGF)

Tyr JAK kinase (in response (Cohney et al., 1999) to IL-2)

Tyr JAK kinase (in response (Peraldi et al., 2001) to insulin)

Tyr221 in the RTK (in response to interacts with and (Sitko et al., 2004) SOCS box PDGFR) regulates Nck and Crk-L adaptors

Ser/Thr PIM kinase potentiates STAT5 (Peltola et al., 2004) inhibition (through SOCS1 stabilisation?)

Chapter 3: The SOCS protein family

- 54 - IV. Structural determination of SOCS proteins

The first SOCS structure to be resolved was that of SOCS3 (lacking the first 21 AA and the SOCS box) in complex with a phosphotyrosine peptide from the gp130 chain (Babon et al., 2006). This structure revealed the basis for an extended SH2 domain that provides an interaction interface for phosphotyrosine motifs. Also an unstructured PEST (proline-, glutamic acid-, serine and threonine rich) motif in the SH2 domain was identified that negatively regulates SOCS3 protein stability (Babon et al., 2006).

Figure 12: Alternative domain organisation in the SOCS2 and -4 ternary complexes Comparison of the SOCS2-ElonginB/C and SOCS4-ElonginB/C structures highlighting the switch in packing between the SOCS2/SOCS4 C-terminus and the N-terminal ESS helix (from (Bullock et al., 2006; Bullock et al., 2007)).

The crystal structures of the ternary complexes of SOCS2 and SOCS4 with Elongin B/C revealed a common tripartite domain structure for SOCS proteins with an N- terminal ESS helix that stabilizes the central SH2 domain and a C-terminal SOCS box that mediates a conserved four helix bundle interaction with Elongin C (figure Chapter 3: The SOCS protein family

- 55 - 12). Nonetheless, two distinct SOCS subclasses were defined that each make alternative use of N- and C-terminal structures to stabilise the SH2-SOCS box interdomain interface (Bullock et al., 2006; Bullock et al., 2007).

Based on the structural information of SOCS2, it was proposed that in SOCS1-3 and CIS the C-terminus is buried in the core of the structure where it stabilizes the interaction between the SH2 domain and the SOCS box. This packing partially exposes the N-terminal ESS providing better accessibility for the SOCS1 and SOCS3 KIR domain. Evidently, this domain organization precludes C-terminal extensions and explains the strictly conserved length of the C-terminal parts in CIS and SOCS1-3 (Bullock et al., 2006). In contrast, the SOCS4-7 subclass contains extended C-termini and there the N-terminal ESS helix is buried in the SOCS box and SH2 interface to fulfil an equivalent packing role as could be demonstrated in the SOCS4 structure. The function of the C-terminus is then redefined to stabilize an interface with the N-terminal domain (Bullock et al., 2007). As a result of the apparent structural and functional interdependence of the different SOCS domains, studies using domain deletions or mutations of core positions in the interface have to be interpreted with caution as these may lead to a loss of structural integrity. However, structural alterations can act as a physiological control mechanism used to regulate the activity and interplay between SOCS family members. Phosphorylation of the SOCS3 C-terminus will for example prevent its core interaction resulting in loss of Elongin C binding and proteasomal degradation (Haan et al., 2003). In the same line, Elongin B/C association to CIS has a structural impact on SH2 functionality as disruption of this interaction can lead to loss of receptor binding (chapter 10).

V. The physiology of SOCS functions

In vitro studies reveal the potential of SOCS family members to inhibit multiple cytokine induced signalling pathways. Studies based on ectopic expression of SOCS have provided valuable insights into the mechanisms of SOCS functions. But as they rely on overexpression, these studies may overestimate the range of Chapter 3: The SOCS protein family

- 56 - SOCS actions and have to be interpreted in function of physiological expression levels. Therefore, gene targeting analyses have been used in order to elucidate the physiological actions of SOCS proteins (table 10). Studies in transgenic mice revealed that SOCS have essential roles in the regulation of various cytokines and exert more specific actions than those expected from overexpression studies in vitro (Greenhalgh and Alexander, 2004). Of note, loss-of-function studies can only identify the non-redundant functions of each SOCS protein. It will be interesting to explore whether SOCS have overlapping actions that are not revealed by mice lacking single SOCS genes.

SOCS1

In vitro studies implicated SOCS1 in the inhibition of multiple signalling systems including GH, Epo, PRL, IL-6, IFNα/β, IFNγ and IL-4 (Adams et al., 1998; Dif et al., 2001; Hansen et al., 1999; Song and Shuai, 1998). The potent inhibition and wide range of action exhibited by SOCS1 is most probably due to its ability to inhibit the catalytic activity of JAK kinases. Moreover, SOCS1 induces the ubiquitination and destruction of VAV, JAK2 and the TEL-JAK2 oncogene in a SOCS box dependent fashion (De Sepulveda et al., 2000; Frantsve et al., 2001; Kamizono et al., 2001; Ungureanu et al., 2002). Regulation of NF-κB by ubiquitin-mediated proteolysis of its p65/RelA subunit was also found to be facilitated by SOCS1 (Ryo et al., 2003). Furthermore, SOCS1 (and SOCS3) can promote destruction of Insulin Receptor Substrate (IRS) 1 or IRS2 and focal adhesion kinase (FAK), inhibiting respectively insulin- and FAK-dependent signalling events (Liu et al., 2003; Rui et al., 2002). Despite these observations, in vitro studies have generally failed to prove a requirement of the SOCS box for the inhibitory functions of SOCS1 (Narazaki et al., 1998; Nicholson et al., 1999; Yasukawa et al., 1999). Nevertheless, a clear contribution of this domain was found for the inhibition of in vivo cytokine action. Mice expressing a C-terminal truncated variant of SOCS1 were hyper-responsive to IFNγ and died prematurely due to an inflammatory disease similar to, but less severe than the pathology SOCS1-/- mice (Zhang et al., 2001). This demonstrates that the SOCS box is required for optimal functioning.

Chapter 3: The SOCS protein family

- 57 - SOCS1 knock-out mice die within three weeks after birth with a phenotype characterized by stunted growth, fatty degeneration of the liver, severe lymphopenia, monocytic infiltration of major organs and peripheral T cell activation (Naka et al., 1998; Starr et al., 1998). These multiple deregulations of the immune system were attributed to uncontrolled IFNγ signalling caused by constitutive activation of STAT1. In support of this, the complex disease in SOCS1-/- mice was prevented by administration of neutralizing anti-IFNγ antibodies and did not occur in double knock-out mice also lacking the IFNγ gene (Alexander et al., 1999; Marine et al., 1999b). Anyway, SOCS1 is not restricted to IFNγ actions, as studies in the combined SOCS1-/-IFNγ-/- double knock-out mice revealed lethality at later stages due to a range of inflammatory diseases (Metcalf et al., 2002). Indeed, SOCS1 deficient mice also lacking STAT6 or STAT4 that are downstream effectors of IL-4 or IL-12 signalling, respectively, are rescued from neonatal lethality (Eyles et al., 2002; Naka et al., 2001), suggesting that SOCS1 affects not only IFNγ but also IL-4 and IL-12 signalling in vivo. Further studies of SOCS1-/- mice revealed that SOCS1 regulates signals of TNFα, LPS and insulin (Kawazoe et al., 2001; Kinjyo et al., 2002; Morita et al., 2000; Nakagawa et al., 2002). SOCS1 conditional knock-out mice demonstrated an inhibitory role for SOCS1 on γc cytokines, such as IL-2 or IL- 7 (Chong et al., 2003; Cornish et al., 2003). SOCS1 transgenic mice are characterized by defective thymocyte development and perturbed homeostasis of T cells (Fujimoto et al., 2000).

SOCS3

Although SOCS3 is structurally similar to SOCS1, the mechanisms by which these two molecules negatively regulate signalling differ in more than one aspect. Whereas SOCS1 blocks signalling by binding directly to JAK kinases, SOCS3 adequately inhibits activation of JAKs only when bound in close proximity to the kinase. Membrane proximal association of SOCS3 was found for different cytokine receptors including gp130, LR, EpoR, LIFR, IL-6R, IL-12R and GHR (Bjorbaek et al., 2000; Eyckerman et al., 2000; Hortner et al., 2002; Lehmann et al., 2003; Ram and Waxman, 1999; Sasaki et al., 2000; Yamamoto et al., 2003). SOCS3 was also found to promote degradation of target proteins like IRS adaptors, FAK kinase and

Chapter 3: The SOCS protein family

- 58 - Siglec receptors (Liu et al., 2003; Orr et al., 2007a; Orr et al., 2007b; Rui et al., 2002). Deletion of the SOCS box of SOCS3 in transgenic mice leads to impaired regulation of G-CSF signalling and response to inflammatory stimuli, establishing a role for the SOCS box in the in vivo actions of SOCS3 (Boyle et al., 2007).

Table 10: Overview of the phenotypes of SOCS knock-out and transgenic mice SOCS knock-out phenotype transgenic phenotype references

SOCS1 neonathal lethality due to severe defects in T cell development Naka et al., 1998 defects in immune system Starr et al., 1998 Fujimoto et al., 2000

SOCS3 embryonic lethality due to embryonic lethality due to defective Marine et al., 1999a placental insufficiency foetal liver erythropoiesis Roberts et al., 2001 Takahashi et al., 2003

CIS no defects defective in growth, immune responses Marine et al., 1999a and mammary gland development Matsumoto et al., 1999

SOCS2 excessive growth excessive growth Metcalf et al., 2000 Greenhalgh et al., 2002b

SOCS4 not reported not reported

SOCS5 no defects altered Th1/Th2 cell balance Seki et al., 2002 Brender et al., 2004

SOCS6 mild growth retardation improved insulin and glucose tolerance Krebs et al., 2002 Li et al., 2004

SOCS7 high lethality due to hydrocephalus not reported Krebs et al., 2004

Both SOCS3 knock-out mice and transgenic mice die in utero. Lack of SOCS3 results in placental insufficiencies caused by uncontrolled LIF signalling, while SOCS3 overexpression results in defective foetal liver erythropoiesis (Marine et al., 1999a; Roberts et al., 2001; Takahashi et al., 2003). Studies in conditional SOCS3 knock-out mice demonstrated that SOCS3 is an important negative regulator of G- CSF (Croker et al., 2004; Kimura et al., 2004) and IL-6 (Croker et al., 2003; Lang et al., 2003; Yasukawa et al., 2003). As mentioned before, SOCS3 not only controls the magnitude of IL-6 signalling but also shapes its responses. Upon deletion of SOCS3 in macrophages IL-6 loses its pro-inflammatory function but elicits STAT3- mediated immunosuppressive actions, similar to IL-10 (Yasukawa et al., 2003). Furthermore, IL-6 also strongly activates STAT1, thereby inducing the expression of

Chapter 3: The SOCS protein family

- 59 - IFN-responsive genes in these SOCS3 deficient macrophages (Croker et al., 2003; Lang et al., 2003). Together, these data suggest that SOCS3 is a negative regulator of the gp130 family of cytokine receptors in vivo. Essential roles for SOCS3 in the endocrine system like in leptin and insulin signalling have also been identified (Bjorbaek et al., 1998; Emanuelli et al., 2000). Consequently, SOCS3 was reported to be involved in leptin and insulin resistance associated with respectively obesity and type II diabetis (see below) (Howard et al., 2004; Mori et al., 2004; Ueki et al., 2004).

CIS

CIS is induced by cytokines that activate STAT5, such as Epo, GH, PRL, IL-2 and IL-3 and was reported to subsequently suppress these particular signalling cascades by masking the STAT5 binding sites in their receptors (Aman et al., 1999; Dif et al., 2001; Endo et al., 2003; Hansen et al., 1996; Matsumoto et al., 1997; Ram and Waxman, 1999; Verdier et al., 1998; Yoshimura et al., 1995). Based on the non-overlapping binding pattern, direct competition of CIS with STAT5 for common phosphotyrosine binding sites was recently excluded for the GHR (Uyttendaele et al., 2007). Also at the G-CSFR CIS does not compete with STAT5 for binding to receptor motifs, reflecting a reliance on other inhibitory mechanisms. Indeed, CIS association was found to induce proteasome-dependent degradation of the EpoR and GHR and in the latter case, CIS also was reported to play a role in GHR internalization (Landsman and Waxman, 2005; Ram and Waxman, 2000; Verdier et al., 1998).

Mice deficient for CIS expression are phenotypically normal, perhaps due to functional compensation by other SOCS proteins (Marine et al., 1999a). CIS transgenic mice exhibit growth retardation, impaired mammary gland development and immune defects like reduced numbers of natural killer (NK) and NK T cells (Matsumoto et al., 1999). These phenotypes are remarkably similar to those observed in STAT5a and/or STAT5b knock-out mice, lending support for CIS as a specific negative regulator of STAT5-mediated cytokine signalling (Matsumoto et al., 1999; Teglund et al., 1998).

Chapter 3: The SOCS protein family

- 60 - SOCS2

The mechanism by which SOCS2 exerts its regulatory functions remains more elusive. SOCS2 can probably attenuate signalling in a similar way as CIS, involving competition at receptor sites. Interaction of SOCS2 with phosphotyrosine motifs on the GHR, PRLR, EGFR, EpoR and LR has been reported (Eyckerman et al., 2001; Goldshmit et al., 2004; Greenhalgh et al., 2005; Lavens et al., 2006; Pezet et al., 1999). Receptor association of CIS and SOCS2 are studied in more detail in part II. SOCS2 might act as an ubiquitin ligase as the SOCS box of SOCS2 appeared to be crucial for the negative regulation of GH signalling (Greenhalgh et al., 2005). Furthermore, the solving of the SOCS2-Elongin B/C crystal structure revealed a prototypical SOCS box ubiquitin ligase architecture (Bullock et al., 2006), further supporting a role for SOCS2 in E3 ligase activity. Initial in vitro studies reported a dual effect of SOCS2 in GH signalling: low SOCS2 concentrations moderately inhibit GH signalling while higher levels positively regulate signalling by blocking the inhibitory effects of other SOCS proteins (Favre et al., 1999). Interference of SOCS2 with other SOCS proteins was observed in several cytokine receptor systems including PRL (Dif et al., 2001; Pezet et al., 1999), IL-2 and IL-3 (Tannahill et al., 2005), IFN type I and leptin signalling (Lavens et al., 2006; Piessevaux et al., 2006). A positive role for SOCS2 was also proposed in mesenchymal precursor cells where it could potentiate osteoblast differentiation through upregulation of JunB expression, possibly through its negative effect on other SOCS proteins (Ouyang et al., 2006). While SOCS1 and SOCS3 are typically induced in a rapid and transient manner upon receptor activation, expression of SOCS2 usually occurs later after cytokine stimulation and is more prolonged (Adams et al., 1998; Brender et al., 2001; Pezet et al., 1999; Rico-Bautista et al., 2004; Tannahill et al., 2005; Tollet-Egnell et al., 1999). This is in line with the cross- regulatory potential of SOCS2 that can downregulate expression of other SOCS molecules and restore cellular sensitivity (discussed in chapter 9).

Mice lacking SOCS2 exhibit gigantism associated with increases in bone and body length and enhanced weight of organs and carcass (Metcalf et al., 2000). This phenotype is due to prolonged STAT5 signalling in response to GH stimulation

Chapter 3: The SOCS protein family

- 61 - (Greenhalgh et al., 2002a). SOCS2-/-STAT5b-/- double knock-out mice showed normal growth (Greenhalgh et al., 2002a), suggesting that SOCS2 is involved in negative regulation of the GH signalling pathway. SOCS2 transgenic mice also grew significantly larger than their wild type littermates, further supporting a dual role for SOCS2 (Greenhalgh et al., 2002b).

SOCS4

The remaining SOCS members, SOCS4-SOCS7, which represent the direct orthologs of ancestral SOCS family members, have been poorly examined. Especially about SOCS4 very little is known concerning expression and molecular mode of action. It was reported that Mycobacterium tuberculosis infection in mice is correlated with augmented levels of type IFNs, SOCS4 (and SOCS5) (Manca et al., 2005), suggesting a role in immunity. SOCS4 (and its closest homolog SOCS5) are upregulated upon epidermal growth factor (EGF) stimulation and markedly reduce EGFR levels thereby inhibiting the mitogenic signalling (Kario et al., 2005). The STAT3 binding site in EGFR was identified as a high affinity SOCS4 substrate and the structural resolution of the SOCS4-Elongin B/C complex defined a molecular basis for SOCS mediated EGFR degradation (Bullock et al., 2007). No SOCS4 knock-out or transgenic mice are reported, leaving the biological role of this SOCS member unclear.

SOCS5

SOCS5 is expressed in many tissues and especially in hematopoietic tissues (Magrangeas et al., 2000). As mentioned above SOCS5 is induced upon EGF stimulation and subsequently promotes SOCS box dependent turnover of EGFR (Kario et al., 2005; Nicholson et al., 2005). Accordingly, the Drosophila SOCS36E, highly similar to mammalian SOCS5, was found to temper EGF responses (Callus and Mathey-Prevot, 2002). SOCS5 was also demonstrated to mildly suppress IL-6 and LIF-induced signalling (Nicholson et al., 1999) and to promote Th1 differentiation by inhibiting STAT6 dependent IL-4 signalling (Seki et al., 2002).

Chapter 3: The SOCS protein family

- 62 -

Accordingly, T cells from transgenic mice constitutively expressing SOCS5 exhibited a significant reduction of IL-4 mediated Th2 development. Unexpectedly, no abnormalities in Th1/Th2 differentiation were found in SOCS5 deficient T cells and SOCS5 knock-out mice showed normal susceptibility to pathogen infections (Brender et al., 2004). This may be explained by SOCS5 being compensated for by other SOCS proteins such as SOCS4, as SOCS4 shares significant identity with SOCS5. Analyses of SOCS4-/-SOCS5-/- double knockout mice will be required to address the function of SOCS5 in vivo.

SOCS6

SOCS6 is induced by insulin and subsequently interacts with the insulin receptor (Li et al., 2004; Mooney et al., 2001). This association may occur indirectly since SOCS6 binding with signal transductors including IRS-2, IRS-4 and the p85 regulatory subunit of PI-3K, was reported in response to insulin stimulation (as well as IGF-1 stimulation) (Krebs et al., 2002). SOCS6 expression can also be upregulated by stem cell factor (SCF) and the interaction of SOCS6 with the KIT receptor upon SCF stimulation was shown to affect upstream signalling components leading to MAPK activation (Bayle et al., 2004). After insulin or SCF stimulation, an inhibitory effect is observed on ERK1/2 stimulation but not on Akt activation (Bayle et al., 2004; Li et al., 2004; Mooney et al., 2001). SOCS6 may even have a positive effect on activation of Akt upon insulin stimulation, possibly due to binding to the p85 subunit of PI3K, thereby overcoming the negative effects that p85 monomers have on PI-3K signalling (Li et al., 2004). SOCS6 was found to associate with the leptin receptor (Montoye et al., 2006). It also interacts with haem-oxidized IRP2 ubiquitin ligase 1 (HOIL1), driving ubiquitination and degradation of proteins associated with SOCS6 (Bayle et al., 2006). Recently, SOCS6 was proposed to negatively regulate STAT3 protein levels and a nuclear function for SOCS6 was proposed, depending on its N-terminus (Hwang et al., 2007).

SOCS6 deficient mice develop normally and exhibit no defects in haematopoiesis or glucose homeostasis. However, they weighed approximately 10% less than wild- type littermates (Krebs et al., 2002). It was suggested that the closely related Chapter 3: The SOCS protein family

- 63 - SOCS7 could functionally compensate for SOCS6 deficiency. By contrast, SOCS6 transgenic mice displayed improvement in insulin signalling and glucose metabolism (Li et al., 2004).

SOCS7

In contrast to other SOCS proteins, the N-terminal domain of SOCS7 contains several recognizable motifs: multiple poly-proline motifs, which are possible docking sites for SH3 domain containing proteins and a putative nuclear localisation signal (NLS), indicating a potential role for SOCS7 in the nucleus (Matuoka et al., 1997). The N-terminus of SOCS7 mediates interactions with the cytoskeletal protein vinexin and several signalling molecules like PLCγ, Grb2 and Nck, which are involved in signalling mediated by a large number of receptors (Martens et al., 2004; Matuoka et al., 1997). SH2 dependent interactions of SOCS7 were demonstrated with the EGFR and LR and several components of the insulin pathway including IRS1, IRS2, IRS4, p85 and the insulin receptor (Banks et al., 2005; Krebs et al., 2002; Matuoka et al., 1997; Montoye et al., 2006). SOCS7 can suppress PRL, GH and leptin signalling by interacting with STAT5 or STAT3 and attenuating their nuclear translocation (Martens et al., 2005).

SOCS7 deficient mice exhibit no defects in haematopoiesis or circulating glucose or insulin concentrations but they are smaller than their wild-type littermates (Krebs et al., 2004). The pancreatic islets of Langerhans are in some cases exceptionally large (Banks et al., 2005; Krebs et al., 2004). Within 15 weeks however, about 50% of the SOCS7 knock-outs died as a result of hydrocephalus (Krebs et al., 2004). Accordingly, prominent expression of SOCS7 was found in the brain, suggestive of an important functional role of SOCS7 in this organ (Banks et al., 2005; Krebs et al., 2002). Older mice also develop increased glucose tolerance and insulin sensitivity together with a mild hyperglycaemia and hyperinsulinemia (Banks et al., 2005). Although deficiency of SOCS6 or SOCS7 in mice results in relatively mild phenotypes at birth (Krebs et al., 2004; Krebs et al., 2002), the double knock-out animals are embryonically lethal, perhaps pointing to the loss of redundant functions of SOCS6 and SOCS7 (Dr. Hilton, personal communication).

Chapter 3: The SOCS protein family

- 64 -

SOCS proteins and immunity

Cytokines mediate communication between cells of the immune system and a tight control of cytokine receptor signalling is of crucial importance to balance anti- microbial and tissue-destructive effects. Mainly SOCS1 and SOCS3 are critical mediators of both innate and adaptive immunity through the regulation of cytokine signalling in T cells and antigen-presenting cells, including macrophages and dendritic cells (DCs).

SOCS in innate immunity - Toll-like receptor (TLR) signalling that initiates innate immune responses to pathogens, induces expression of SOCS proteins (Baetz et al., 2004; Dalpke et al., 2001; Naka et al., 2005; Stoiber et al., 1999). SOCS1- deficient mice are highly sensitive to sepsis induced by lipopolysaccharide (LPS), a known TLR activator, and endotoxin tolerance was absent. Additionally, macrophages, DCs and fibroblasts from SOCS1-/- mice produce increased levels of pro-inflammatory cytokines such as TNF, IL-12 and IFNγ, as well as nitric oxide, in response to TLR ligands (Chinen et al., 2006; Hanada et al., 2005; Kinjyo et al., 2002; Nakagawa et al., 2002). A direct effect of SOCS1 on the TLR pathway has been proposed as SOCS1 was found to bind to the p65 subunit of NF-κB and promotes its turnover (Ryo et al., 2003). SOCS1 also mediates ubiquitination and degradation of the tyrosine phosphorylated TLR adaptor MyD88 Adaptor-Like (Mal), thereby leading to the suppression of Mal-dependent p65 phosphorylation and transactivation of NF-κB (Mansell et al., 2006). In addition to the NF-κB pathway, SOCS1 might also target the JUN N-terminal kinase (JNK) and p38 MAPK cascades by inducing the degradation of the upstream activator apoptosis signal- regulating kinase 1 (ASK1) (He et al., 2006). Other groups reported that the principal mode of suppression of SOCS1 is the inhibition of the secondary activated type I IFN signalling pathway (Baetz et al., 2004; Gingras et al., 2004). The induction of SOCS1 by chemotactic factors such as fMLP and IL-8 provides evidence for SOCS mediated cross-talk between chemoattractants and cytokine signalling pathways (Johnston, 2004).

Chapter 3: The SOCS protein family

- 65 - SOCS3 is a key determinant for regulating and shaping the divergent activities of IL- 6 and IL-10 in macrophages following TLR stimulation (Croker et al., 2003; Lang et al., 2003; Yasukawa et al., 2003). SOCS2 was found to be crucial for the anti- inflammatory effects of lipoxins, although the molecular mechanism remains elusive (Machado et al., 2006).

SOCS in adaptive immunity - SOCS proteins are crucially involved in T-helper cell differentiation and T and B cell responses of the adaptive immunity. This is well illustrated by the SOCS1-/- mice in which those aspects are massively disturbed (Alexander et al., 1999; Chong et al., 2003; Eyles et al., 2002; Fujimoto et al., 2002; Marine et al., 1999b; Naka et al., 1998). The pivotal role of SOCS1 in Th1 differentiation and inhibition of IFNγ and other cytokines involved in lymphocyte homeostasis, such as IL-2, IL-4, IL-7 and IL-12 appeared from studies in knock-out mice (see above) (Eyles et al., 2002; Naka et al., 2001). More specific effects have been reported for SOCS family members such as SOCS5 that has the capacity to impair IL-4 mediated Th2 differentiation and thus promote Th1 cell differentiation (Seki et al., 2002). SOCS3 displays an expression pattern reciprocal to that of SOCS1 and SOCS5 and is exclusively associated with Th2 cell differentiation (Egwuagu et al., 2002; Li et al., 2006). CD25(+)CD4(+) regulatory T cells (Tregs) are actively engaged in the maintenance of immunologic self-tolerance by suppressing the autoreactive responses mediated by effector T cell functions. SOCS1, SOCS2 and CIS are highly induced in activated CD4(+)CD25(+) Tregs (McHugh et al., 2002). In a DNA microarray analysis, performed to identify Treg-specific molecules controlled by the transcription factor Foxp3, SOCS2 was one of the predominantly expressed genes (Sugimoto et al., 2006). SOCS1 was reported to prevent the development of dextran sulfate sodium (DSS)-induced colitis (a model of colitis resembling human IBD) by inhibiting IFNγ/STAT1 signalling and by subsequently regulating Treg cell development.(Horino et al., 2008). Elevated SOCS levels in Tregs may be required to strictly control their immunosuppressive functions to achieve a balance between the necessity to suppress autoreactivity and the ability to allow appropriate responses to foreign antigens.

Chapter 3: The SOCS protein family

- 66 - VI. SOCS proteins in disease

Through their impact on cytokine- and growth factor-activated signalling pathways, it seems inevitable that disruption of normal SOCS function will contribute to disease onset and progression. Accordingly, therapeutic strategies based on the manipulation of SOCS activity might be of clinical benefit.

Infectious disease pathogenesis (hijacking the host’s SOCS system)

Interfering with SOCS regulation of cytokine signalling is an effective strategy used by various microbial pathogens to manipulate cytokine signalling and as a result escape detrimental immune responses. The parasites Toxoplasma gondii and Leishmania can for instance induce host SOCS expression to evade immune responses (Alexander et al., 1999; Mun et al., 2005; Zimmermann et al., 2006). Also, bacteria such as Mycobacteria, Salmonella typhimurium and Listeria pseudomellei, are able to induce endogenous SOCS and consequently exploit these host negative regulatory mechanisms for their own purpose (Blumenthal et al., 2005; Manca et al., 2005; Stoiber et al., 2001; Uchiya and Nikai, 2005; Vazquez et al., 2006). Finally, viruses will also target host immunity by misusage of endogenous SOCS proteins. Hepatitis C Virus (HCV) core protein was reported to impair IFNα-induced signal transduction via SOCS3 expression in hepatic cells (Bode et al., 2003). Human immunodeficiency virus (HIV) induces SOCS expression known to interfere with Th differentiation and Ig class switching, thereby promoting HIV infection (Moutsopoulos et al., 2006; Qiao et al., 2006). Recently, SOCS1 was reported to associate with the HIV-1 p55 Gag polyprotein to enhance its stability and trafficking, resulting in the efficient production of HIV-1 particles (Ryo et al., 2008). It is of note that, similar to SOCS molecules, some viral proteins can act as the substrate recognition unit of an E3 ligase complex, targeting host proteins for ubiquitination and proteasomal degradation. In this respect, HIV-1 encoded viral infectivity factor (Vif) associates with an ElonginB/C-Cullin 5 module in order to direct the turnover of APOBEC3G, a host factor that induces hypermutations in newly synthesized viral DNA (Rose et al., 2004). Other examples of viral proteins Chapter 3: The SOCS protein family

- 67 - that assemble ECS-based E3 ligases are the Respiratory Syncytial Virus NS1 and the adenovirus E4orf6 that respectively target STAT2 and p53 for proteasomal destruction (Elliott et al., 2007; Luo et al., 2007). Possibly, this sequestering of E3 components and especially Elongin B/C, will further deregulate the host SOCS actions. Targeting SOCS proteins for improving the defense against pathogens might thus be a beneficial approach in case of infection. Nevertheless, therapeutic modulation of SOCS will have to be done cautiously since inhibition of SOCS to counter microbial infection may also lead to an enhanced immune response associated with pro-inflammatory effects.

Inflammatory diseases

SOCS proteins are crucially implicated in the regulation of JAK/STAT signalling in inflammation. Accordingly, alterations in SOCS protein levels, and more specific SOCS3, has been associated with the pathogenesis of various inflammatory diseases including rheumatoid arthritis (RA), Crohn’s disease and inflammatory bowel diseases (IBD) (Egan et al., 2003; Isomaki et al., 2007; Lovato et al., 2003; Rakoff-Nahoum et al., 2006; Suzuki et al., 2001). SOCS3 expression is induced by a wide variety of inflammatory and anti-inflammatory cytokines, including IFNγ, IL-3, IL-6 and IL-10 and will function to counteract STAT3 activation associated with inflammatory disorders. Additionally, exogenous SOCS3 delivery was proven to be an effective therapy to attenuate inflammation as was shown in different models including mice with experimental induced colitis and arthritis (Fang et al., 2005; Jo et al., 2005; Shouda et al., 2001; Suzuki et al., 2001). SOCS3 was also demonstrated to have an important role in regulating the onset and maintenance of Th2 mediated allergic immune diseases. Enhanced SOCS3 levels in T cells have for example been associated with asthma pathogenesis (Seki et al., 2003). Humans with allergic conjunctivitis showed a correlation between the level of expression of SOCS3 and the severity of the disease (Ozaki et al., 2005; Seki et al., 2003). A similar role for SOCS5 has also been reported in a mouse model of this disease (Ozaki et al., 2005), as well as in murine experimental autoimmune uveitis, an autoimmune disease of the retina (Takase et al., 2005). Single nuclear polymorphisms (SNPs) in

Chapter 3: The SOCS protein family

- 68 - SOCS1 that result in SOCS1 upregulation in T cells have been associated with asthma pathogenesis (Harada et al., 2007). Clearly, therapeutical targeting of SOCS might attenuate inflammatory cytokine circuits in autoimmune and other inflammatory diseases. Modulation of SOCS expression or function will also be an important therapeutic strategy for immunological diseases induced by an abnormal Th1/Th2 balance.

Metabolic diseases (leptin and insulin resistance)

Different observations put SOCS3 forward as a crucial inhibitor of LR signalling and suggest a prominent role for increased SOCS3 levels in leptin resistance and consequent obesity (Bjorbaek et al., 1998; Dunn et al., 2005; Howard et al., 2004; Mori et al., 2004). SOCS factors are critically implicated in attenuation of insulin signalling and SOCS1 and SOCS3 might be players in the development of insulin resistance associated with type 2 diabetes (Emanuelli et al., 2001; Emanuelli et al., 2000; Kawazoe et al., 2001; Ueki et al., 2005; Ueki et al., 2004). Some evidence also points to SOCS2 as a modulator of insulin signalling (Rico-Bautista et al., 2006) and interestingly, the prevalence of SNPs in the SOCS2 gene was correlated with type 2 diabetes (Kato et al., 2006). Additionally, it was suggested that aberrations in the ubiquitin-proteasome pathway might as well be one of the molecular mechanism behind insulin resistance through inappropriate degradation of IRS1 or IRS2 by SOCS proteins (Balasubramanyam et al., 2005). It can be envisaged that blocking SOCS actions can be used clinically to treat leptin or insulin resistance, and accordingly SOCS3 might be a potential therapeutic target for prevalent human metabolic disorders such as obesity and diabetis.

Growth related pathologies

Haplotype insufficiency for SOCS2 promotes trophic actions of GH in small intestine and promotes preneoplastic growth in colon during excess GH. Small variations in SOCS2 expression levels may thus significantly influence the outcome of therapeutic GH or acromegaly in intestine (Michaylira et al., 2006). Hepatic growth

Chapter 3: The SOCS protein family

- 69 - hormone resistance during sepsis is associated with increased SOCS expression and impaired growth hormone signalling (Yumet et al., 2006). Pharmacological targeting of specific negative regulators of growth signalling, like SOCS2, may be valuable in the development of novel therapies targeting growth disorders. Moreover, it may have the potential to enhance the beneficial actions of GH in growth and metabolism, without the side effects associated with direct GH treatment.

Cancers and haematopoietic disorders

Several oncologic disorders are associated with enhanced JAK-STAT activity, promoting cell proliferation and survival which will contribute to malignant growth (Chai et al., 1997; Frank et al., 1997; Gouilleux-Gruart et al., 1996). Inactivation of SOCS by gene mutation/deletion or reduced SOCS expression due to silencing by DNA hypermethylation are frequently found in hepatocellular, pancreatic, lung, ovarian and breast carcinomas (Farabegoli et al., 2005; He et al., 2003; Komazaki et al., 2004; Nagai et al., 2003; Wikman et al., 2002; Yoshikawa et al., 2001). Compellingly, constitutive activation of the JAK-STAT pathway in several haematological malignancies including leukemia and lymphoma was also associated with SOCS downregulation (Galm et al., 2003; Melzner et al., 2005; Watanabe et al., 2004; Weniger et al., 2006). SOCS proteins appear to have tumor suppressor functions that need to be bypassed for transformation to occur. This implies that the forced expression of SOCS might be beneficial for the treatment of some malignancies.

However, tumor cells upregulating or constitutively expressing SOCS have also been described (Arany et al., 2001; Evans et al., 2007; Faderl et al., 2003; Haffner et al., 2007; Hakansson et al., 2008; Huang et al., 2007; Raccurt et al., 2003; Roman-Gomez et al., 2004) and this may be indicative of a tumor protecting function for SOCS proteins. The in vivo elevation of SOCS gene expression will confer resistance to some host cytokines and may be part of the host/tumour response. In this respect, constitutive SOCS3 expression was found to grant a growth advantage to human melanoma cells by inducing resistance towards the

Chapter 3: The SOCS protein family

- 70 - growth inhibitory effects of cytokines like IL-6 and oncostatin M (OSM) (Komyod et al., 2007). A therapeutic consequence is that anti-tumoral therapy with IFN may fail in some cancers due to constitutive SOCS1 or SOCS3 expression levels (Fojtova et al., 2007; Roman-Gomez et al., 2004; Sakai et al., 2002). In the case of SOCS2, increased expression levels may enhance sensitivity to cytokine signalling by overcoming the inhibitory effects of other SOCS molecules, thereby contributing to the constitutive active phenotype related to oncogenesis. It was proposed that the increased JAK activity in VHL-mediated renal cell carcinoma (RCC) may be due to SOCS2 recruiting SOCS1 for proteasomal destruction (Wu et al., 2007). SOCS2 expression was enhanced by several cytokines and hormones in leukemic leukocytes (Dogusan et al., 2000). Furthermore, SOCS2 overexpression was clearly found to correlate with advanced stages of chronic myeloid leukemia (CML) (Schultheis et al., 2002; Zheng et al., 2006) or acute myeloid leukemia (AML) (personal communication, Dr. I Touw) (Faderl et al., 2003). This upregulation can be abrogated by STI571, a compound that inhibits the activity of the BCR-ABL tyrosine kinase, which is fundamental for CML pathogenesis (Schultheis et al., 2002). Surprisingly, no haematologic abnormalities were observed in SOCS2 deficient mice. However, as SOCS2 is clearly involved in the development of leukemia, it is conceivable that in the haematopoietic system aberrant SOCS2 upregulation rather than a deficient expression is the important pathologic determinant. As Elongin C overexpression was observed in a number of prostate and breast cancer cell lines (Porkka et al., 2002), this could also possibly lead to a deregulation of signalling via its effect on SOCS stability and functionality.

Some transformation processes result from aberrant SOCS phosphorylation thereby hindering the assembly of the E3 ligase complex and consequently allowing JAKs to evade SOCS regulation. In this context, the JAK2V617F mutant that is associated with myeloproliferative disorders has been demonstrated to evade negative regulation due to hyperphosphorylation of SOCS3. This modification extends SOCS3 half-life time but renders it unable to suppress the activity of the mutant kinase and even stabilizes the mutant JAK, thus potentiating its myeloproliferative capacity (Hookham et al., 2007). Another example concerns the cytokine independent Ser/Thr phosphorylation of SOCS1 by v-Abl in transformed pre-B cells.

Chapter 3: The SOCS protein family

- 71 - This will disrupt the interaction with Elongin B/C, thereby stabilizing SOCS1 expression and blocking JAK degradation, which will contribute to the transformation process (Limnander et al., 2004).

Therapeutic applications of SOCS

As mentioned above, therapeutic application of SOCS proteins could be valuable for the treatment of diseases in which overshoot cytokine signalling is involved, such as those related with inflammation or cancer. One approach would be the overexpression of SOCS molecules. In this respect, the adenovirus-mediated administration of SOCS3 was demonstrated to prevent the development of RA in experimental mouse models (Shouda et al., 2001). Fusion of SOCS proteins with membrane-permeable peptides might be an alternative way to introduce them into cells. In this context, intracellular delivery of a cell-penetrating form of SOCS3 was proven to be effective for treatment of various types of inflammation and septic shock (Jo et al., 2005). A second approach is the generation of small-molecule mimetics of SOCS proteins. The tyrosine kinase inhibitor peptide (TKIP) is an example of a mimetic of SOCS1 and effectively inhibits JAK2-mediated phosphorylation of STATs. This peptide prevented the development of experimental allergic encephalomyelitis (EAE) in mice (Mujtaba et al., 2005) and blocked the proliferation of prostate cancer cell lines (Flowers et al., 2005). A third approach might be blocking SOCS degradation in vivo.

On the contrary, inhibiting SOCS effects could be beneficial in case cytokine action needs to be enhanced. This may be useful for enhancing anti-tumoral or anti-viral immunity, modulating the Th1/Th2 balance, promoting GH signalling or blocking SOCS-mediated resistance against cytokine therapies. Neutralization of SOCS functions could be achieved by the use of their dominant-negative forms. SOCS gene expression could also be silenced by a siRNA or antisense oligonucleotide approach or by the use of specific transcriptional inhibitors. Administration of SOCS1 siRNA by a nanotube carrier could for instance retard the growth of B16 tumours in mice (Yang et al., 2006). siRNA based SOCS1 silencing in DCs elicit HIV-specific T cell and antibody responses, which may open an alternative

Chapter 3: The SOCS protein family

- 72 - possibility for the development of effective HIV vaccines (Song et al., 2006). Another example is the downregulation of SOCS1 and SOCS3 expression in livers of obese diabetic mice by antisense RNA therapy that improved insulin sensitivity and ameliorated hepatic steatosis and hypertriglyceridemia (Ueki et al., 2005). Alternatively, the structural insights in SOCS interactions may provide a basis for the design of SOCS inhibitors.

Chapter 3: The SOCS protein family

- 73 - VII. References

Adams, T. E., Hansen, J. A., Starr, R., Nicola, N. A., Hilton, D. J., and Billestrup, N. (1998). Growth hormone preferentially induces the rapid, transient expression of SOCS-3, a novel inhibitor of cytokine receptor signaling. J Biol Chem 273, 1285-1287. Alexander, W. S., Starr, R., Fenner, J. E., Scott, C. L., Handman, E., Sprigg, N. S., Corbin, J. E., Cornish, A. L., Darwiche, R., Owczarek, C. M., et al. (1999). SOCS1 is a critical inhibitor of interferon gamma signaling and prevents the potentially fatal neonatal actions of this cytokine. Cell 98, 597-608. Aman, M. J., Migone, T. S., Sasaki, A., Ascherman, D. P., Zhu, M., Soldaini, E., Imada, K., Miyajima, A., Yoshimura, A., and Leonard, W. J. (1999). CIS associates with the interleukin-2 receptor beta chain and inhibits interleukin-2-dependent signaling. J Biol Chem 274, 30266-30272. Arany, I., Muldrow, M., and Tyring, S. K. (2001). The endogenous interferon system in anal squamous epithelial lesions with different grades from HIV-positive individuals. Int J STD AIDS 12, 229-233. Aso, T., Haque, D., Barstead, R. J., Conaway, R. C., and Conaway, J. W. (1996). The inducible elongin A elongation activation domain: structure, function and interaction with the elongin BC complex. Embo J 15, 5557-5566. Auernhammer, C. J., Bousquet, C., and Melmed, S. (1999). Autoregulation of pituitary corticotroph SOCS-3 expression: characterization of the murine SOCS-3 promoter. Proc Natl Acad Sci U S A 96, 6964-6969. Babon, J. J., McManus, E. J., Yao, S., DeSouza, D. P., Mielke, L. A., Sprigg, N. S., Willson, T. A., Hilton, D. J., Nicola, N. A., Baca, M., et al. (2006). The structure of SOCS3 reveals the basis of the extended SH2 domain function and identifies an unstructured insertion that regulates stability. Mol Cell 22, 205-216. Baetz, A., Frey, M., Heeg, K., and Dalpke, A. H. (2004). Suppressor of cytokine signaling (SOCS) proteins indirectly regulate toll-like receptor signaling in innate immune cells. J Biol Chem 279, 54708-54715. Balasubramanyam, M., Sampathkumar, R., and Mohan, V. (2005). Is insulin signaling molecules misguided in diabetes for ubiquitin-proteasome mediated degradation? Mol Cell Biochem 275, 117-125. Banks, A. S., Li, J., McKeag, L., Hribal, M. L., Kashiwada, M., Accili, D., and Rothman, P. B. (2005). Deletion of SOCS7 leads to enhanced insulin action and enlarged islets of Langerhans. J Clin Invest 115, 2462-2471. Bayle, J., Letard, S., Frank, R., Dubreuil, P., and De Sepulveda, P. (2004). Suppressor of cytokine signaling 6 associates with KIT and regulates KIT receptor signaling. J Biol Chem 279, 12249- 12259. Bayle, J., Lopez, S., Iwai, K., Dubreuil, P., and De Sepulveda, P. (2006). The E3 ubiquitin ligase HOIL- 1 induces the polyubiquitination and degradation of SOCS6 associated proteins. FEBS Lett 580, 2609-2614. Bergamin, E., Wu, J., and Hubbard, S. R. (2006). Structural basis for phosphotyrosine recognition by suppressor of cytokine signaling-3. Structure 14, 1285-1292. Bjorbaek, C., Elmquist, J. K., Frantz, J. D., Shoelson, S. E., and Flier, J. S. (1998). Identification of SOCS-3 as a potential mediator of central leptin resistance. Mol Cell 1, 619-625. Bjorbaek, C., Lavery, H. J., Bates, S. H., Olson, R. K., Davis, S. M., Flier, J. S., and Myers, M. G., Jr. (2000). SOCS3 mediates feedback inhibition of the leptin receptor via Tyr985. J Biol Chem 275, 40649-40657. Blumenthal, A., Lauber, J., Hoffmann, R., Ernst, M., Keller, C., Buer, J., Ehlers, S., and Reiling, N. (2005). Common and unique gene expression signatures of human macrophages in response to four strains of Mycobacterium avium that differ in their growth and persistence characteristics. Infect Immun 73, 3330-3341. Bode, J. G., Ludwig, S., Ehrhardt, C., Albrecht, U., Erhardt, A., Schaper, F., Heinrich, P. C., and Haussinger, D. (2003). IFN-alpha antagonistic activity of HCV core protein involves induction of suppressor of cytokine signaling-3. Faseb J 17, 488-490. Boyle, K., Egan, P., Rakar, S., Willson, T. A., Wicks, I. P., Metcalf, D., Hilton, D. J., Nicola, N. A., Alexander, W. S., Roberts, A. W., and Robb, L. (2007). The SOCS box of suppressor of cytokine signaling-3 contributes to the control of G-CSF responsiveness in vivo. Blood.

Chapter 3: The SOCS protein family

- 74 - Brender, C., Columbus, R., Metcalf, D., Handman, E., Starr, R., Huntington, N., Tarlinton, D., Odum, N., Nicholson, S. E., Nicola, N. A., et al. (2004). SOCS5 is expressed in primary B and T lymphoid cells but is dispensable for lymphocyte production and function. Mol Cell Biol 24, 6094-6103. Brender, C., Nielsen, M., Ropke, C., Nissen, M. H., Svejgaard, A., Billestrup, N., Geisler, C., and Odum, N. (2001). Interferon-alpha induces transient suppressors of cytokine signalling expression in human T cells. Exp Clin Immunogenet 18, 80-85. Bullock, A. N., Debreczeni, J. E., Edwards, A. M., Sundstrom, M., and Knapp, S. (2006). Crystal structure of the SOCS2-elongin C-elongin B complex defines a prototypical SOCS box ubiquitin ligase. Proc Natl Acad Sci U S A 103, 7637-7642. Bullock, A. N., Rodriguez, M. C., Debreczeni, J. E., Songyang, Z., and Knapp, S. (2007). Structure of the SOCS4-ElonginB/C Complex Reveals a Distinct SOCS Box Interface and the Molecular Basis for SOCS-Dependent EGFR Degradation. Structure 15, 1493-1504. Cacalano, N. A., Sanden, D., and Johnston, J. A. (2001). Tyrosine-phosphorylated SOCS-3 inhibits STAT activation but binds to p120 RasGAP and activates Ras. Nat Cell Biol 3, 460-465. Callus, B. A., and Mathey-Prevot, B. (1998). Interleukin-3-induced activation of the JAK/STAT pathway is prolonged by proteasome inhibitors. Blood 91, 3182-3192. Callus, B. A., and Mathey-Prevot, B. (2002). SOCS36E, a novel Drosophila SOCS protein, suppresses JAK/STAT and EGF-R signalling in the imaginal wing disc. Oncogene 21, 4812-4821. Chai, S. K., Nichols, G. L., and Rothman, P. (1997). Constitutive activation of JAKs and STATs in BCR-Abl-expressing cell lines and peripheral blood cells derived from leukemic patients. J Immunol 159, 4720-4728. Chen, X. P., Losman, J. A., Cowan, S., Donahue, E., Fay, S., Vuong, B. Q., Nawijn, M. C., Capece, D., Cohan, V. L., and Rothman, P. (2002). Pim serine/threonine kinases regulate the stability of Socs- 1 protein. Proc Natl Acad Sci U S A 99, 2175-2180. Chinen, T., Kobayashi, T., Ogata, H., Takaesu, G., Takaki, H., Hashimoto, M., Yagita, H., Nawata, H., and Yoshimura, A. (2006). Suppressor of cytokine signaling-1 regulates inflammatory bowel disease in which both IFNgamma and IL-4 are involved. Gastroenterology 130, 373-388. Chong, M. M., Cornish, A. L., Darwiche, R., Stanley, E. G., Purton, J. F., Godfrey, D. I., Hilton, D. J., Starr, R., Alexander, W. S., and Kay, T. W. (2003). Suppressor of cytokine signaling-1 is a critical regulator of interleukin-7-dependent CD8+ T cell differentiation. Immunity 18, 475-487. Cohney, S. J., Sanden, D., Cacalano, N. A., Yoshimura, A., Mui, A., Migone, T. S., and Johnston, J. A. (1999). SOCS-3 is tyrosine phosphorylated in response to interleukin-2 and suppresses STAT5 phosphorylation and lymphocyte proliferation. Mol Cell Biol 19, 4980-4988. Cornish, A. L., Chong, M. M., Davey, G. M., Darwiche, R., Nicola, N. A., Hilton, D. J., Kay, T. W., Starr, R., and Alexander, W. S. (2003). Suppressor of cytokine signaling-1 regulates signaling in response to interleukin-2 and other gamma c-dependent cytokines in peripheral T cells. J Biol Chem 278, 22755-22761. Crespo, A., Filla, M. B., Russell, S. W., and Murphy, W. J. (2000). Indirect induction of suppressor of cytokine signalling-1 in macrophages stimulated with bacterial lipopolysaccharide: partial role of autocrine/paracrine interferon-alpha/beta. Biochem J 349, 99-104. Croker, B. A., Krebs, D. L., Zhang, J. G., Wormald, S., Willson, T. A., Stanley, E. G., Robb, L., Greenhalgh, C. J., Forster, I., Clausen, B. E., et al. (2003). SOCS3 negatively regulates IL-6 signaling in vivo. Nat Immunol 4, 540-545. Croker, B. A., Metcalf, D., Robb, L., Wei, W., Mifsud, S., DiRago, L., Cluse, L. A., Sutherland, K. D., Hartley, L., Williams, E., et al. (2004). SOCS3 is a critical physiological negative regulator of G- CSF signaling and emergency granulopoiesis. Immunity 20, 153-165. Dalpke, A. H., Opper, S., Zimmermann, S., and Heeg, K. (2001). Suppressors of cytokine signaling (SOCS)-1 and SOCS-3 are induced by CpG-DNA and modulate cytokine responses in APCs. J Immunol 166, 7082-7089. Davey, H. W., McLachlan, M. J., Wilkins, R. J., Hilton, D. J., and Adams, T. E. (1999). STAT5b mediates the GH-induced expression of SOCS-2 and SOCS-3 mRNA in the liver. Mol Cell Endocrinol 158, 111-116. De Sepulveda, P., Ilangumaran, S., and Rottapel, R. (2000). Suppressor of cytokine signaling-1 inhibits VAV function through protein degradation. J Biol Chem 275, 14005-14008. De Souza, D., Fabri, L. J., Nash, A., Hilton, D. J., Nicola, N. A., and Baca, M. (2002). SH2 domains from suppressor of cytokine signaling-3 and protein tyrosine phosphatase SHP-2 have similar binding specificities. Biochemistry 41, 9229-9236. Dif, F., Saunier, E., Demeneix, B., Kelly, P. A., and Edery, M. (2001). Cytokine-inducible SH2- containing protein suppresses PRL signaling by binding the PRL receptor. Endocrinology 142, 5286-5293. Chapter 3: The SOCS protein family

- 75 - Dogusan, Z., Hooghe-Peters, E. L., Berus, D., Velkeniers, B., and Hooghe, R. (2000). Expression of SOCS genes in normal and leukemic human leukocytes stimulated by prolactin, growth hormone and cytokines. J Neuroimmunol 109, 34-39. Duan, D. R., Pause, A., Burgess, W. H., Aso, T., Chen, D. Y., Garrett, K. P., Conaway, R. C., Conaway, J. W., Linehan, W. M., and Klausner, R. D. (1995). Inhibition of transcription elongation by the VHL tumor suppressor protein. Science 269, 1402-1406. Dunn, S. L., Bjornholm, M., Bates, S. H., Chen, Z., Seifert, M., and Myers, M. G., Jr. (2005). Feedback inhibition of leptin receptor/Jak2 signaling via Tyr1138 of the leptin receptor and suppressor of cytokine signaling 3. Mol Endocrinol 19, 925-938. Egan, P. J., Lawlor, K. E., Alexander, W. S., and Wicks, I. P. (2003). Suppressor of cytokine signaling- 1 regulates acute inflammatory arthritis and T cell activation. J Clin Invest 111, 915-924. Egwuagu, C. E., Yu, C. R., Zhang, M., Mahdi, R. M., Kim, S. J., and Gery, I. (2002). Suppressors of cytokine signaling proteins are differentially expressed in Th1 and Th2 cells: implications for Th cell lineage commitment and maintenance. J Immunol 168, 3181-3187. Elliott, J., Lynch, O. T., Suessmuth, Y., Qian, P., Boyd, C. R., Burrows, J. F., Buick, R., Stevenson, N. J., Touzelet, O., Gadina, M., et al. (2007). Respiratory syncytial virus NS1 protein degrades STAT2 by using the Elongin-Cullin E3 ligase. J Virol 81, 3428-3436. Emanuelli, B., Peraldi, P., Filloux, C., Chavey, C., Freidinger, K., Hilton, D. J., Hotamisligil, G. S., and Van Obberghen, E. (2001). SOCS-3 inhibits insulin signaling and is up-regulated in response to tumor necrosis factor-alpha in the adipose tissue of obese mice. J Biol Chem 276, 47944-47949. Emanuelli, B., Peraldi, P., Filloux, C., Sawka-Verhelle, D., Hilton, D., and Van Obberghen, E. (2000). SOCS-3 is an insulin-induced negative regulator of insulin signaling. J Biol Chem 275, 15985- 15991. Endo, T., Sasaki, A., Minoguchi, M., Joo, A., and Yoshimura, A. (2003). CIS1 interacts with the Y532 of the prolactin receptor and suppresses prolactin-dependent STAT5 activation. J Biochem 133, 109-113. Endo, T. A., Masuhara, M., Yokouchi, M., Suzuki, R., Sakamoto, H., Mitsui, K., Matsumoto, A., Tanimura, S., Ohtsubo, M., Misawa, H., et al. (1997). A new protein containing an SH2 domain that inhibits JAK kinases. Nature 387, 921-924. Evans, M. K., Yu, C. R., Lohani, A., Mahdi, R. M., Liu, X., Trzeciak, A. R., and Egwuagu, C. E. (2007). Expression of SOCS1 and SOCS3 genes is differentially regulated in breast cancer cells in response to proinflammatory cytokine and growth factor signals. Oncogene 26, 1941-1948. Eyckerman, S., Broekaert, D., Verhee, A., Vandekerckhove, J., and Tavernier, J. (2000). Identification of the Y985 and Y1077 motifs as SOCS3 recruitment sites in the murine leptin receptor. FEBS Lett 486, 33-37. Eyckerman, S., Verhee, A., Van der Heyden, J., Lemmens, I., Van Ostade, X., Vandekerckhove, J., and Tavernier, J. (2001). Design and application of a cytokine-receptor-based interaction trap. Nat Cell Biol 3, 1114-1119. Eyles, J. L., Metcalf, D., Grusby, M. J., Hilton, D. J., and Starr, R. (2002). Negative regulation of interleukin-12 signaling by suppressor of cytokine signaling-1. J Biol Chem 277, 43735-43740. Faderl, S., Harris, D., Van, Q., Kantarjian, H. M., Talpaz, M., and Estrov, Z. (2003). Granulocyte- macrophage colony-stimulating factor (GM-CSF) induces antiapoptotic and proapoptotic signals in acute myeloid leukemia. Blood 102, 630-637. Fang, M., Dai, H., Yu, G., and Gong, F. (2005). Gene delivery of SOCS3 protects mice from lethal endotoxic shock. Cell Mol Immunol 2, 373-377. Farabegoli, F., Ceccarelli, C., Santini, D., and Taffurelli, M. (2005). Suppressor of cytokine signalling 2 (SOCS-2) expression in breast carcinoma. J Clin Pathol 58, 1046-1050. Favre, H., Benhamou, A., Finidori, J., Kelly, P. A., and Edery, M. (1999). Dual effects of suppressor of cytokine signaling (SOCS-2) on growth hormone signal transduction. FEBS Lett 453, 63-66. Fenner, J. E., Starr, R., Cornish, A. L., Zhang, J. G., Metcalf, D., Schreiber, R. D., Sheehan, K., Hilton, D. J., Alexander, W. S., and Hertzog, P. J. (2006). Suppressor of cytokine signaling 1 regulates the immune response to infection by a unique inhibition of type I interferon activity. Nat Immunol 7, 33-39. Flowers, L. O., Subramaniam, P. S., and Johnson, H. M. (2005). A SOCS-1 peptide mimetic inhibits both constitutive and IL-6 induced activation of STAT3 in prostate cancer cells. Oncogene 24, 2114-2120. Fojtova, M., Boudny, V., Kovarik, A., Lauerova, L., Adamkova, L., Souckova, K., Jarkovsky, J., and Kovarik, J. (2007). Development of IFN-gamma resistance is associated with attenuation of SOCS genes induction and constitutive expression of SOCS 3 in melanoma cells. Br J Cancer 97, 231-237. Chapter 3: The SOCS protein family

- 76 - Frank, D. A., Mahajan, S., and Ritz, J. (1997). B lymphocytes from patients with chronic lymphocytic leukemia contain signal transducer and activator of transcription (STAT) 1 and STAT3 constitutively phosphorylated on serine residues. J Clin Invest 100, 3140-3148. Frantsve, J., Schwaller, J., Sternberg, D. W., Kutok, J., and Gilliland, D. G. (2001). Socs-1 inhibits TEL-JAK2-mediated transformation of hematopoietic cells through inhibition of JAK2 kinase activity and induction of proteasome-mediated degradation. Mol Cell Biol 21, 3547-3557. Fujimoto, M., Naka, T., Nakagawa, R., Kawazoe, Y., Morita, Y., Tateishi, A., Okumura, K., Narazaki, M., and Kishimoto, T. (2000). Defective thymocyte development and perturbed homeostasis of T cells in STAT-induced STAT inhibitor-1/suppressors of cytokine signaling-1 transgenic mice. J Immunol 165, 1799-1806. Fujimoto, M., Tsutsui, H., Yumikura-Futatsugi, S., Ueda, H., Xingshou, O., Abe, T., Kawase, I., Nakanishi, K., Kishimoto, T., and Naka, T. (2002). A regulatory role for suppressor of cytokine signaling-1 in T(h) polarization in vivo. Int Immunol 14, 1343-1350. Galm, O., Yoshikawa, H., Esteller, M., Osieka, R., and Herman, J. G. (2003). SOCS-1, a negative regulator of cytokine signaling, is frequently silenced by methylation in multiple myeloma. Blood 101, 2784-2788. Gatto, L., Berlato, C., Poli, V., Tininini, S., Kinjyo, I., Yoshimura, A., Cassatella, M. A., and Bazzoni, F. (2004). Analysis of SOCS-3 promoter responses to interferon gamma. J Biol Chem 279, 13746- 13754. Gingras, S., Parganas, E., de Pauw, A., Ihle, J. N., and Murray, P. J. (2004). Re-examination of the role of suppressor of cytokine signaling 1 (SOCS1) in the regulation of toll-like receptor signaling. J Biol Chem 279, 54702-54707. Giordanetto, F., and Kroemer, R. T. (2003). A three-dimensional model of Suppressor Of Cytokine Signalling 1 (SOCS-1). Protein Eng 16, 115-124. Glickman, M. H., and Ciechanover, A. (2002). The ubiquitin-proteasome proteolytic pathway: destruction for the sake of construction. Physiol Rev 82, 373-428. Goldshmit, Y., Walters, C. E., Scott, H. J., Greenhalgh, C. J., and Turnley, A. M. (2004). SOCS2 induces neurite outgrowth by regulation of epidermal growth factor receptor activation. J Biol Chem 279, 16349-16355. Gouilleux-Gruart, V., Gouilleux, F., Desaint, C., Claisse, J. F., Capiod, J. C., Delobel, J., Weber-Nordt, R., Dusanter-Fourt, I., Dreyfus, F., Groner, B., and Prin, L. (1996). STAT-related transcription factors are constitutively activated in peripheral blood cells from acute leukemia patients. Blood 87, 1692-1697. Greenhalgh, C. J., and Alexander, W. S. (2004). Suppressors of cytokine signalling and regulation of growth hormone action. Growth Horm IGF Res 14, 200-206. Greenhalgh, C. J., Bertolino, P., Asa, S. L., Metcalf, D., Corbin, J. E., Adams, T. E., Davey, H. W., Nicola, N. A., Hilton, D. J., and Alexander, W. S. (2002a). Growth enhancement in suppressor of cytokine signaling 2 (SOCS-2)-deficient mice is dependent on signal transducer and activator of transcription 5b (STAT5b). Mol Endocrinol 16, 1394-1406. Greenhalgh, C. J., Metcalf, D., Thaus, A. L., Corbin, J. E., Uren, R., Morgan, P. O., Fabri, L. J., Zhang, J. G., Martin, H. M., Willson, T. A., et al. (2002b). Biological evidence that SOCS-2 can act either as an enhancer or suppressor of growth hormone signaling. J Biol Chem 277, 40181-40184. Greenhalgh, C. J., Rico-Bautista, E., Lorentzon, M., Thaus, A. L., Morgan, P. O., Willson, T. A., Zervoudakis, P., Metcalf, D., Street, I., Nicola, N. A., et al. (2005). SOCS2 negatively regulates growth hormone action in vitro and in vivo. J Clin Invest 115, 397-406. Haan, S., Ferguson, P., Sommer, U., Hiremath, M., McVicar, D. W., Heinrich, P. C., Johnston, J. A., and Cacalano, N. A. (2003). Tyrosine phosphorylation disrupts elongin interaction and accelerates SOCS3 degradation. J Biol Chem 278, 31972-31979. Haffner, M. C., Petridou, B., Peyrat, J. P., Revillion, F., Muller-Holzner, E., Daxenbichler, G., Marth, C., and Doppler, W. (2007). Favorable prognostic value of SOCS2 and IGF-I in breast cancer. BMC Cancer 7, 136. Hakansson, P., Nilsson, B., Andersson, A., Lassen, C., Gullberg, U., and Fioretos, T. (2008). Gene expression analysis of BCR/ABL1-dependent transcriptional response reveals enrichment for genes involved in negative feedback regulation. Genes Chromosomes Cancer. Hanada, T., Tanaka, K., Matsumura, Y., Yamauchi, M., Nishinakamura, H., Aburatani, H., Mashima, R., Kubo, M., Kobayashi, T., and Yoshimura, A. (2005). Induction of hyper Th1 cell-type immune responses by dendritic cells lacking the suppressor of cytokine signaling-1 gene. J Immunol 174, 4325-4332.

Chapter 3: The SOCS protein family

- 77 - Hansen, J. A., Lindberg, K., Hilton, D. J., Nielsen, J. H., and Billestrup, N. (1999). Mechanism of inhibition of growth hormone receptor signaling by suppressor of cytokine signaling proteins. Mol Endocrinol 13, 1832-1843. Hansen, L. H., Wang, X., Kopchick, J. J., Bouchelouche, P., Nielsen, J. H., Galsgaard, E. D., and Billestrup, N. (1996). Identification of tyrosine residues in the intracellular domain of the growth hormone receptor required for transcriptional signaling and Stat5 activation. J Biol Chem 271, 12669-12673. Harada, M., Nakashima, K., Hirota, T., Shimizu, M., Doi, S., Fujita, K., Shirakawa, T., Enomoto, T., Yoshikawa, M., Moriyama, H., et al. (2007). Functional polymorphism in the suppressor of cytokine signaling 1 gene associated with adult asthma. Am J Respir Cell Mol Biol 36, 491-496. He, B., You, L., Uematsu, K., Zang, K., Xu, Z., Lee, A. Y., Costello, J. F., McCormick, F., and Jablons, D. M. (2003). SOCS-3 is frequently silenced by hypermethylation and suppresses cell growth in human lung cancer. Proc Natl Acad Sci U S A 100, 14133-14138. He, Y., Zhang, W., Zhang, R., Zhang, H., and Min, W. (2006). SOCS1 inhibits tumor necrosis factor- induced activation of ASK1-JNK inflammatory signaling by mediating ASK1 degradation. J Biol Chem 281, 5559-5566. Hilton, D. J., Richardson, R. T., Alexander, W. S., Viney, E. M., Willson, T. A., Sprigg, N. S., Starr, R., Nicholson, S. E., Metcalf, D., and Nicola, N. A. (1998). Twenty proteins containing a C-terminal SOCS box form five structural classes. Proc Natl Acad Sci U S A 95, 114-119. Hookham, M. B., Elliott, J., Suessmuth, Y., Staerk, J., Ward, A. C., Vainchenker, W., Percy, M. J., McMullin, M. F., Constantinescu, S. N., and Johnston, J. A. (2007). The myeloproliferative disorder-associated JAK2 V617F mutant escapes negative regulation by suppressor of cytokine signaling 3. Blood 109, 4924-4929. Horino, J., Fujimoto, M., Terabe, F., Serada, S., Takahashi, T., Soma, Y., Tanaka, K., Chinen, T., Yoshimura, A., Nomura, S., et al. (2008). Suppressor of cytokine signaling-1 ameliorates dextran sulfate sodium-induced colitis in mice. Int Immunol. Hortner, M., Nielsch, U., Mayr, L. M., Heinrich, P. C., and Haan, S. (2002). A new high affinity binding site for suppressor of cytokine signaling-3 on the erythropoietin receptor. Eur J Biochem 269, 2516-2526. Howard, J. K., Cave, B. J., Oksanen, L. J., Tzameli, I., Bjorbaek, C., and Flier, J. S. (2004). Enhanced leptin sensitivity and attenuation of diet-induced obesity in mice with haploinsufficiency of Socs3. Nat Med 10, 734-738. Huang, Y., Feld, J. J., Sapp, R. K., Nanda, S., Lin, J. H., Blatt, L. M., Fried, M. W., Murthy, K., and Liang, T. J. (2007). Defective hepatic response to interferon and activation of suppressor of cytokine signaling 3 in chronic hepatitis C. Gastroenterology 132, 733-744. Hwang, M. N., Min, C. H., Kim, H. S., Lee, H., Yoon, K. A., Park, S. Y., Lee, E. S., and Yoon, S. (2007). The nuclear localization of SOCS6 requires the N-terminal region and negatively regulates Stat3 protein levels. Biochem Biophys Res Commun 360, 333-338. Ilangumaran, S., Ramanathan, S., and Rottapel, R. (2004). Regulation of the immune system by SOCS family adaptor proteins. Semin Immunol 16, 351-365. Isomaki, P., Alanara, T., Isohanni, P., Lagerstedt, A., Korpela, M., Moilanen, T., Visakorpi, T., and Silvennoinen, O. (2007). The expression of SOCS is altered in rheumatoid arthritis. Rheumatology (Oxford) 46, 1538-1546. Iwai, K., Yamanaka, K., Kamura, T., Minato, N., Conaway, R. C., Conaway, J. W., Klausner, R. D., and Pause, A. (1999). Identification of the von Hippel-lindau tumor-suppressor protein as part of an active E3 ubiquitin ligase complex. Proc Natl Acad Sci U S A 96, 12436-12441. Jo, D., Liu, D., Yao, S., Collins, R. D., and Hawiger, J. (2005). Intracellular protein therapy with SOCS3 inhibits inflammation and apoptosis. Nat Med 11, 892-898. Johnston, J. A. (2004). Are SOCS suppressors, regulators, and degraders? J Leukoc Biol 75, 743-748. Kamizono, S., Hanada, T., Yasukawa, H., Minoguchi, S., Kato, R., Minoguchi, M., Hattori, K., Hatakeyama, S., Yada, M., Morita, S., et al. (2001). The SOCS box of SOCS-1 accelerates ubiquitin-dependent proteolysis of TEL-JAK2. J Biol Chem 276, 12530-12538. Kamura, T., Burian, D., Yan, Q., Schmidt, S. L., Lane, W. S., Querido, E., Branton, P. E., Shilatifard, A., Conaway, R. C., and Conaway, J. W. (2001). Muf1, a novel Elongin BC-interacting leucine- rich repeat protein that can assemble with Cul5 and Rbx1 to reconstitute a ubiquitin ligase. J Biol Chem 276, 29748-29753. Kamura, T., Koepp, D. M., Conrad, M. N., Skowyra, D., Moreland, R. J., Iliopoulos, O., Lane, W. S., Kaelin, W. G., Jr., Elledge, S. J., Conaway, R. C., et al. (1999). Rbx1, a component of the VHL tumor suppressor complex and SCF ubiquitin ligase. Science 284, 657-661.

Chapter 3: The SOCS protein family

- 78 - Kamura, T., Maenaka, K., Kotoshiba, S., Matsumoto, M., Kohda, D., Conaway, R. C., Conaway, J. W., and Nakayama, K. I. (2004). VHL-box and SOCS-box domains determine binding specificity for Cul2-Rbx1 and Cul5-Rbx2 modules of ubiquitin ligases. Genes Dev 18, 3055-3065. Kamura, T., Sato, S., Haque, D., Liu, L., Kaelin, W. G., Jr., Conaway, R. C., and Conaway, J. W. (1998). The Elongin BC complex interacts with the conserved SOCS-box motif present in members of the SOCS, ras, WD-40 repeat, and ankyrin repeat families. Genes Dev 12, 3872- 3881. Kario, E., Marmor, M. D., Adamsky, K., Citri, A., Amit, I., Amariglio, N., Rechavi, G., and Yarden, Y. (2005). Suppressors of cytokine signaling 4 and 5 regulate epidermal growth factor receptor signaling. J Biol Chem 280, 7038-7048. Kato, H., Nomura, K., Osabe, D., Shinohara, S., Mizumori, O., Katashima, R., Iwasaki, S., Nishimura, K., Yoshino, M., Kobori, M., et al. (2006). Association of single-nucleotide polymorphisms in the suppressor of cytokine signaling 2 (SOCS2) gene with type 2 diabetes in the Japanese. Genomics 87, 446-458. Kawazoe, Y., Naka, T., Fujimoto, M., Kohzaki, H., Morita, Y., Narazaki, M., Okumura, K., Saitoh, H., Nakagawa, R., Uchiyama, Y., et al. (2001). Signal transducer and activator of transcription (STAT)-induced STAT inhibitor 1 (SSI-1)/suppressor of cytokine signaling 1 (SOCS1) inhibits insulin signal transduction pathway through modulating insulin receptor substrate 1 (IRS-1) phosphorylation. J Exp Med 193, 263-269. Kibel, A., Iliopoulos, O., DeCaprio, J. A., and Kaelin, W. G., Jr. (1995). Binding of the von Hippel- Lindau tumor suppressor protein to Elongin B and C. Science 269, 1444-1446. Kile, B. T., Schulman, B. A., Alexander, W. S., Nicola, N. A., Martin, H. M., and Hilton, D. J. (2002). The SOCS box: a tale of destruction and degradation. Trends Biochem Sci 27, 235-241. Kim, T. K., and Maniatis, T. (1996). Regulation of interferon-gamma-activated STAT1 by the ubiquitin- proteasome pathway. Science 273, 1717-1719. Kimura, A., Kinjyo, I., Matsumura, Y., Mori, H., Mashima, R., Harada, M., Chien, K. R., Yasukawa, H., and Yoshimura, A. (2004). SOCS3 is a physiological negative regulator for granulopoiesis and granulocyte colony-stimulating factor receptor signaling. J Biol Chem 279, 6905-6910. Kinjyo, I., Hanada, T., Inagaki-Ohara, K., Mori, H., Aki, D., Ohishi, M., Yoshida, H., Kubo, M., and Yoshimura, A. (2002). SOCS1/JAB is a negative regulator of LPS-induced macrophage activation. Immunity 17, 583-591. Komazaki, T., Nagai, H., Emi, M., Terada, Y., Yabe, A., Jin, E., Kawanami, O., Konishi, N., Moriyama, Y., Naka, T., and Kishimoto, T. (2004). Hypermethylation-associated inactivation of the SOCS-1 gene, a JAK/STAT inhibitor, in human pancreatic cancers. Jpn J Clin Oncol 34, 191-194. Komyod, W., Bohm, M., Metze, D., Heinrich, P. C., and Behrmann, I. (2007). Constitutive suppressor of cytokine signaling 3 expression confers a growth advantage to a human melanoma cell line. Mol Cancer Res 5, 271-281. Krebs, D. L., and Hilton, D. J. (2003). A new role for SOCS in insulin action. Suppressor of cytokine signaling. Sci STKE 2003, PE6. Krebs, D. L., Metcalf, D., Merson, T. D., Voss, A. K., Thomas, T., Zhang, J. G., Rakar, S., O'Bryan M, K., Willson, T. A., Viney, E. M., et al. (2004). Development of hydrocephalus in mice lacking SOCS7. Proc Natl Acad Sci U S A 101, 15446-15451. Krebs, D. L., Uren, R. T., Metcalf, D., Rakar, S., Zhang, J. G., Starr, R., De Souza, D. P., Hanzinikolas, K., Eyles, J., Connolly, L. M., et al. (2002). SOCS-6 binds to insulin receptor substrate 4, and mice lacking the SOCS-6 gene exhibit mild growth retardation. Mol Cell Biol 22, 4567-4578. Kubo, M., Hanada, T., and Yoshimura, A. (2003). Suppressors of cytokine signaling and immunity. Nat Immunol 4, 1169-1176. Landsman, T., and Waxman, D. J. (2005). Role of the cytokine-induced SH2-containing protein CIS in growth hormone receptor internalization. J Biol Chem. Lang, R., Pauleau, A. L., Parganas, E., Takahashi, Y., Mages, J., Ihle, J. N., Rutschman, R., and Murray, P. J. (2003). SOCS3 regulates the plasticity of gp130 signaling. Nat Immunol 4, 546-550. Lavens, D., Montoye, T., Piessevaux, J., Zabeau, L., Vandekerckhove, J., Gevaert, K., Becker, W., Eyckerman, S., and Tavernier, J. (2006). A complex interaction pattern of CIS and SOCS2 with the leptin receptor. J Cell Sci 119, 2214-2224. Lehmann, U., Schmitz, J., Weissenbach, M., Sobota, R. M., Hortner, M., Friederichs, K., Behrmann, I., Tsiaris, W., Sasaki, A., Schneider-Mergener, J., et al. (2003). SHP2 and SOCS3 contribute to Tyr- 759-dependent attenuation of interleukin-6 signaling through gp130. J Biol Chem 278, 661-671. Leong, G. M., Moverare, S., Brce, J., Doyle, N., Sjogren, K., Dahlman-Wright, K., Gustafsson, J. A., Ho, K. K., Ohlsson, C., and Leung, K. C. (2004). Estrogen up-regulates hepatic expression of suppressors of cytokine signaling-2 and -3 in vivo and in vitro. Endocrinology 145, 5525-5531. Chapter 3: The SOCS protein family

- 79 - Li, L., Gronning, L. M., Anderson, P. O., Li, S., Edvardsen, K., Johnston, J., Kioussis, D., Shepherd, P. R., and Wang, P. (2004). Insulin induces SOCS-6 expression and its binding to the p85 monomer of phosphoinositide 3-kinase, resulting in improvement in glucose metabolism. J Biol Chem 279, 34107-34114. Li, Y., Chu, N., Rostami, A., and Zhang, G. X. (2006). Dendritic cells transduced with SOCS-3 exhibit a tolerogenic/DC2 phenotype that directs type 2 Th cell differentiation in vitro and in vivo. J Immunol 177, 1679-1688. Limnander, A., Danial, N. N., and Rothman, P. B. (2004). v-Abl signaling disrupts SOCS-1 function in transformed pre-B cells. Mol Cell 15, 329-341. Liu, E., Cote, J. F., and Vuori, K. (2003). Negative regulation of FAK signaling by SOCS proteins. Embo J 22, 5036-5046. Lovato, P., Brender, C., Agnholt, J., Kelsen, J., Kaltoft, K., Svejgaard, A., Eriksen, K. W., Woetmann, A., and Odum, N. (2003). Constitutive STAT3 activation in intestinal T cells from patients with Crohn's disease. J Biol Chem 278, 16777-16781. Luo, K., Ehrlich, E., Xiao, Z., Zhang, W., Ketner, G., and Yu, X. F. (2007). Adenovirus E4orf6 assembles with Cullin5-ElonginB-ElonginC E3 ubiquitin ligase through an HIV/SIV Vif-like BC-box to regulate p53. Faseb J 21, 1742-1750. Machado, F. S., Johndrow, J. E., Esper, L., Dias, A., Bafica, A., Serhan, C. N., and Aliberti, J. (2006). Anti-inflammatory actions of lipoxin A4 and aspirin-triggered lipoxin are SOCS-2 dependent. Nat Med 12, 330-334. Magrangeas, F., Apiou, F., Denis, S., Weidle, U., Jacques, Y., and Minvielle, S. (2000). Cloning and expression of CIS6, chromosome assignment to 3p22 and 2p21 by in situ hybridization. Cytogenet Cell Genet 88, 78-81. Mahrour, N., Redwine, W. B., Florens, L., Swanson, S. K., Martin-Brown, S., Bradford, W. D., Staehling-Hampton, K., Washburn, M. P., Conaway, R. C., and Conaway, J. W. (2008). Characterization of cullin-box sequences that direct recruitment of and Cul5-Rbx2 modules to elongin BC-based ubiquitin ligases. J Biol Chem. Manca, C., Tsenova, L., Freeman, S., Barczak, A. K., Tovey, M., Murray, P. J., Barry, C., and Kaplan, G. (2005). Hypervirulent M. tuberculosis W/Beijing strains upregulate type I IFNs and increase expression of negative regulators of the Jak-Stat pathway. J Interferon Cytokine Res 25, 694-701. Mansell, A., Smith, R., Doyle, S. L., Gray, P., Fenner, J. E., Crack, P. J., Nicholson, S. E., Hilton, D. J., O'Neill, L. A., and Hertzog, P. J. (2006). Suppressor of cytokine signaling 1 negatively regulates Toll-like receptor signaling by mediating Mal degradation. Nat Immunol 7, 148-155. Marine, J. C., McKay, C., Wang, D., Topham, D. J., Parganas, E., Nakajima, H., Pendeville, H., Yasukawa, H., Sasaki, A., Yoshimura, A., and Ihle, J. N. (1999a). SOCS3 is essential in the regulation of fetal liver erythropoiesis. Cell 98, 617-627. Marine, J. C., Topham, D. J., McKay, C., Wang, D., Parganas, E., Stravopodis, D., Yoshimura, A., and Ihle, J. N. (1999b). SOCS1 deficiency causes a lymphocyte-dependent perinatal lethality. Cell 98, 609-616. Martens, N., Uzan, G., Wery, M., Hooghe, R., Hooghe-Peters, E. L., and Gertler, A. (2005). Suppressor of cytokine signaling 7 inhibits prolactin, growth hormone, and leptin signaling by interacting with STAT5 or STAT3 and attenuating their nuclear translocation. J Biol Chem 280, 13817-13823. Martens, N., Wery, M., Wang, P., Braet, F., Gertler, A., Hooghe, R., Vandenhaute, J., and Hooghe- Peters, E. L. (2004). The suppressor of cytokine signaling (SOCS)-7 interacts with the actin cytoskeleton through vinexin. Exp Cell Res 298, 239-248. Masuhara, M., Sakamoto, H., Matsumoto, A., Suzuki, R., Yasukawa, H., Mitsui, K., Wakioka, T., Tanimura, S., Sasaki, A., Misawa, H., et al. (1997). Cloning and characterization of novel CIS family genes. Biochem Biophys Res Commun 239, 439-446. Matsumoto, A., Masuhara, M., Mitsui, K., Yokouchi, M., Ohtsubo, M., Misawa, H., Miyajima, A., and Yoshimura, A. (1997). CIS, a cytokine inducible SH2 protein, is a target of the JAK-STAT5 pathway and modulates STAT5 activation. Blood 89, 3148-3154. Matsumoto, A., Seki, Y., Kubo, M., Ohtsuka, S., Suzuki, A., Hayashi, I., Tsuji, K., Nakahata, T., Okabe, M., Yamada, S., and Yoshimura, A. (1999). Suppression of STAT5 functions in liver, mammary glands, and T cells in cytokine-inducible SH2-containing protein 1 transgenic mice. Mol Cell Biol 19, 6396-6407. Matuoka, K., Miki, H., Takahashi, K., and Takenawa, T. (1997). A novel ligand for an SH3 domain of the adaptor protein Nck bears an SH2 domain and nuclear signaling motifs. Biochem Biophys Res Commun 239, 488-492.

Chapter 3: The SOCS protein family

- 80 - McHugh, R. S., Whitters, M. J., Piccirillo, C. A., Young, D. A., Shevach, E. M., Collins, M., and Byrne, M. C. (2002). CD4(+)CD25(+) immunoregulatory T cells: gene expression analysis reveals a functional role for the glucocorticoid-induced TNF receptor. Immunity 16, 311-323. Melzner, I., Bucur, A. J., Bruderlein, S., Dorsch, K., Hasel, C., Barth, T. F., Leithauser, F., and Moller, P. (2005). Biallelic mutation of SOCS-1 impairs JAK2 degradation and sustains phospho-JAK2 action in the MedB-1 mediastinal lymphoma line. Blood 105, 2535-2542. Metcalf, D., Greenhalgh, C. J., Viney, E., Willson, T. A., Starr, R., Nicola, N. A., Hilton, D. J., and Alexander, W. S. (2000). Gigantism in mice lacking suppressor of cytokine signalling-2. Nature 405, 1069-1073. Metcalf, D., Mifsud, S., Di Rago, L., Nicola, N. A., Hilton, D. J., and Alexander, W. S. (2002). Polycystic kidneys and chronic inflammatory lesions are the delayed consequences of loss of the suppressor of cytokine signaling-1 (SOCS-1). Proc Natl Acad Sci U S A 99, 943-948. Michaylira, C. Z., Ramocki, N. M., Simmons, J. G., Tanner, C. K., McNaughton, K. K., Woosley, J. T., Greenhalgh, C. J., and Lund, P. K. (2006). Haplotype insufficiency for suppressor of cytokine signaling-2 enhances intestinal growth and promotes polyp formation in growth hormone- transgenic mice. Endocrinology 147, 1632-1641. Montoye, T., Piessevaux, J., Lavens, D., Wauman, J., Catteeuw, D., Vandekerckhove, J., Lemmens, I., and Tavernier, J. (2006). Analysis of leptin signalling in hematopoietic cells using an adapted MAPPIT strategy. FEBS Lett 580, 3301-3307. Mooney, R. A., Senn, J., Cameron, S., Inamdar, N., Boivin, L. M., Shang, Y., and Furlanetto, R. W. (2001). Suppressors of cytokine signaling-1 and -6 associate with and inhibit the insulin receptor. A potential mechanism for cytokine-mediated insulin resistance. J Biol Chem 276, 25889-25893. Mori, H., Hanada, R., Hanada, T., Aki, D., Mashima, R., Nishinakamura, H., Torisu, T., Chien, K. R., Yasukawa, H., and Yoshimura, A. (2004). Socs3 deficiency in the brain elevates leptin sensitivity and confers resistance to diet-induced obesity. Nat Med 10, 739-743. Morita, Y., Naka, T., Kawazoe, Y., Fujimoto, M., Narazaki, M., Nakagawa, R., Fukuyama, H., Nagata, S., and Kishimoto, T. (2000). Signals transducers and activators of transcription (STAT)-induced STAT inhibitor-1 (SSI-1)/suppressor of cytokine signaling-1 (SOCS-1) suppresses tumor necrosis factor alpha-induced cell death in fibroblasts. Proc Natl Acad Sci U S A 97, 5405-5410. Moutsopoulos, N. M., Vazquez, N., Greenwell-Wild, T., Ecevit, I., Horn, J., Orenstein, J., and Wahl, S. M. (2006). Regulation of the tonsil cytokine milieu favors HIV susceptibility. J Leukoc Biol 80, 1145-1155. Mujtaba, M. G., Flowers, L. O., Patel, C. B., Patel, R. A., Haider, M. I., and Johnson, H. M. (2005). Treatment of mice with the suppressor of cytokine signaling-1 mimetic peptide, tyrosine kinase inhibitor peptide, prevents development of the acute form of experimental allergic encephalomyelitis and induces stable remission in the chronic relapsing/remitting form. J Immunol 175, 5077-5086. Mun, H. S., Aosai, F., Norose, K., Piao, L. X., Fang, H., Akira, S., and Yano, A. (2005). Toll-like receptor 4 mediates tolerance in macrophages stimulated with Toxoplasma gondii-derived heat shock protein 70. Infect Immun 73, 4634-4642. Nagai, H., Naka, T., Terada, Y., Komazaki, T., Yabe, A., Jin, E., Kawanami, O., Kishimoto, T., Konishi, N., Nakamura, M., et al. (2003). Hypermethylation associated with inactivation of the SOCS-1 gene, a JAK/STAT inhibitor, in human hepatoblastomas. J Hum Genet 48, 65-69. Naka, T., Fujimoto, M., Tsutsui, H., and Yoshimura, A. (2005). Negative regulation of cytokine and TLR signalings by SOCS and others. Adv Immunol 87, 61-122. Naka, T., Matsumoto, T., Narazaki, M., Fujimoto, M., Morita, Y., Ohsawa, Y., Saito, H., Nagasawa, T., Uchiyama, Y., and Kishimoto, T. (1998). Accelerated apoptosis of lymphocytes by augmented induction of Bax in SSI-1 (STAT-induced STAT inhibitor-1) deficient mice. Proc Natl Acad Sci U S A 95, 15577-15582. Naka, T., Narazaki, M., Hirata, M., Matsumoto, T., Minamoto, S., Aono, A., Nishimoto, N., Kajita, T., Taga, T., Yoshizaki, K., et al. (1997). Structure and function of a new STAT-induced STAT inhibitor. Nature 387, 924-929. Naka, T., Tsutsui, H., Fujimoto, M., Kawazoe, Y., Kohzaki, H., Morita, Y., Nakagawa, R., Narazaki, M., Adachi, K., Yoshimoto, T., et al. (2001). SOCS-1/SSI-1-deficient NKT cells participate in severe hepatitis through dysregulated cross-talk inhibition of IFN-gamma and IL-4 signaling in vivo. Immunity 14, 535-545. Nakagawa, R., Naka, T., Tsutsui, H., Fujimoto, M., Kimura, A., Abe, T., Seki, E., Sato, S., Takeuchi, O., Takeda, K., et al. (2002). SOCS-1 participates in negative regulation of LPS responses. Immunity 17, 677-687.

Chapter 3: The SOCS protein family

- 81 - Narazaki, M., Fujimoto, M., Matsumoto, T., Morita, Y., Saito, H., Kajita, T., Yoshizaki, K., Naka, T., and Kishimoto, T. (1998). Three distinct domains of SSI-1/SOCS-1/JAB protein are required for its suppression of interleukin 6 signaling. Proc Natl Acad Sci U S A 95, 13130-13134. Nicholson, S. E., De Souza, D., Fabri, L. J., Corbin, J., Willson, T. A., Zhang, J. G., Silva, A., Asimakis, M., Farley, A., Nash, A. D., et al. (2000). Suppressor of cytokine signaling-3 preferentially binds to the SHP-2-binding site on the shared cytokine receptor subunit gp130. Proc Natl Acad Sci U S A 97, 6493-6498. Nicholson, S. E., Metcalf, D., Sprigg, N. S., Columbus, R., Walker, F., Silva, A., Cary, D., Willson, T. A., Zhang, J. G., Hilton, D. J., et al. (2005). Suppressor of cytokine signaling (SOCS)-5 is a potential negative regulator of epidermal growth factor signaling. Proc Natl Acad Sci U S A 102, 2328-2333. Nicholson, S. E., Willson, T. A., Farley, A., Starr, R., Zhang, J. G., Baca, M., Alexander, W. S., Metcalf, D., Hilton, D. J., and Nicola, N. A. (1999). Mutational analyses of the SOCS proteins suggest a dual domain requirement but distinct mechanisms for inhibition of LIF and IL-6 signal transduction. Embo J 18, 375-385. Orr, S. J., Morgan, N. M., Buick, R. J., Boyd, C. R., Elliott, J., Burrows, J. F., Jefferies, C. A., Crocker, P. R., and Johnston, J. A. (2007a). SOCS3 targets Siglec 7 for proteasomal degradation and blocks Siglec 7-mediated responses. J Biol Chem 282, 3418-3422. Orr, S. J., Morgan, N. M., Elliott, J., Burrows, J. F., Scott, C. J., McVicar, D. W., and Johnston, J. A. (2007b). CD33 responses are blocked by SOCS3 through accelerated proteasomal-mediated turnover. Blood 109, 1061-1068. Ouyang, X., Fujimoto, M., Nakagawa, R., Serada, S., Tanaka, T., Nomura, S., Kawase, I., Kishimoto, T., and Naka, T. (2006). SOCS-2 interferes with myotube formation and potentiates osteoblast differentiation through upregulation of JunB in C2C12 cells. J Cell Physiol 207, 428-436. Ozaki, A., Seki, Y., Fukushima, A., and Kubo, M. (2005). The control of allergic conjunctivitis by suppressor of cytokine signaling (SOCS)3 and SOCS5 in a murine model. J Immunol 175, 5489- 5497. Pause, A., Lee, S., Worrell, R. A., Chen, D. Y., Burgess, W. H., Linehan, W. M., and Klausner, R. D. (1997). The von Hippel-Lindau tumor-suppressor gene product forms a stable complex with human CUL-2, a member of the Cdc53 family of proteins. Proc Natl Acad Sci U S A 94, 2156- 2161. Peltola, K. J., Paukku, K., Aho, T. L., Ruuska, M., Silvennoinen, O., and Koskinen, P. J. (2004). Pim-1 kinase inhibits STAT5-dependent transcription via its interactions with SOCS1 and SOCS3. Blood 103, 3744-3750. Peraldi, P., Filloux, C., Emanuelli, B., Hilton, D. J., and Van Obberghen, E. (2001). Insulin induces suppressor of cytokine signaling-3 tyrosine phosphorylation through janus-activated kinase. J Biol Chem 276, 24614-24620. Pezet, A., Favre, H., Kelly, P. A., and Edery, M. (1999). Inhibition and restoration of prolactin signal transduction by suppressors of cytokine signaling. J Biol Chem 274, 24497-24502. Piessevaux, J., Lavens, D., Montoye, T., Wauman, J., Catteeuw, D., Vandekerckhove, J., Belsham, D., Peelman, F., and Tavernier, J. (2006). Functional cross-modulation between SOCS proteins can stimulate cytokine signaling. J Biol Chem 281, 32953-32966. Porkka, K., Saramaki, O., Tanner, M., and Visakorpi, T. (2002). Amplification and overexpression of Elongin C gene discovered in prostate cancer by cDNA microarrays. Lab Invest 82, 629-637. Qiao, X., He, B., Chiu, A., Knowles, D. M., Chadburn, A., and Cerutti, A. (2006). Human immunodeficiency virus 1 Nef suppresses CD40-dependent immunoglobulin class switching in bystander B cells. Nat Immunol 7, 302-310. Qing, Y., Costa-Pereira, A. P., Watling, D., and Stark, G. R. (2005). Role of tyrosine 441 of interferon- gamma receptor subunit 1 in SOCS-1-mediated attenuation of STAT1 activation. J Biol Chem 280, 1849-1853. Raccurt, M., Tam, S. P., Lau, P., Mertani, H. C., Lambert, A., Garcia-Caballero, T., Li, H., Brown, R. J., McGuckin, M. A., Morel, G., and Waters, M. J. (2003). Suppressor of cytokine signalling gene expression is elevated in breast carcinoma. Br J Cancer 89, 524-532. Rakoff-Nahoum, S., Hao, L., and Medzhitov, R. (2006). Role of toll-like receptors in spontaneous commensal-dependent colitis. Immunity 25, 319-329. Ram, P. A., and Waxman, D. J. (1999). SOCS/CIS protein inhibition of growth hormone-stimulated STAT5 signaling by multiple mechanisms. J Biol Chem 274, 35553-35561. Ram, P. A., and Waxman, D. J. (2000). Role of the cytokine-inducible SH2 protein CIS in desensitization of STAT5b signaling by continuous growth hormone. J Biol Chem 275, 39487- 39496. Chapter 3: The SOCS protein family

- 82 - Rico-Bautista, E., Flores-Morales, A., and Fernandez-Perez, L. (2006). Suppressor of cytokine signaling (SOCS) 2, a protein with multiple functions. Cytokine Growth Factor Rev 17, 431-439. Rico-Bautista, E., Negrin-Martinez, C., Novoa-Mogollon, J., Fernandez-Perez, L., and Flores-Morales, A. (2004). Downregulation of the growth hormone-induced Janus kinase 2/signal transducer and activator of transcription 5 signaling pathway requires an intact actin cytoskeleton. Exp Cell Res 294, 269-280. Roberts, A. W., Robb, L., Rakar, S., Hartley, L., Cluse, L., Nicola, N. A., Metcalf, D., Hilton, D. J., and Alexander, W. S. (2001). Placental defects and embryonic lethality in mice lacking suppressor of cytokine signaling 3. Proc Natl Acad Sci U S A 98, 9324-9329. Roman-Gomez, J., Jimenez-Velasco, A., Castillejo, J. A., Cervantes, F., Barrios, M., Colomer, D., Heiniger, A., and Torres, A. (2004). The suppressor of cytokine signaling-1 is constitutively expressed in chronic myeloid leukemia and correlates with poor cytogenetic response to interferon-alpha. Haematologica 89, 42-48. Rose, K. M., Marin, M., Kozak, S. L., and Kabat, D. (2004). The viral infectivity factor (Vif) of HIV-1 unveiled. Trends Mol Med 10, 291-297. Rui, L., Yuan, M., Frantz, D., Shoelson, S., and White, M. F. (2002). SOCS-1 and SOCS-3 block insulin signaling by ubiquitin-mediated degradation of IRS1 and IRS2. J Biol Chem 277, 42394- 42398. Ryo, A., Suizu, F., Yoshida, Y., Perrem, K., Liou, Y. C., Wulf, G., Rottapel, R., Yamaoka, S., and Lu, K. P. (2003). Regulation of NF-kappaB signaling by Pin1-dependent prolyl isomerization and ubiquitin-mediated proteolysis of p65/RelA. Mol Cell 12, 1413-1426. Ryo, A., Tsurutani, N., Ohba, K., Kimura, R., Komano, J., Nishi, M., Soeda, H., Hattori, S., Perrem, K., Yamamoto, M., et al. (2008). SOCS1 is an inducible host factor during HIV-1 infection and regulates the intracellular trafficking and stability of HIV-1 Gag. Proc Natl Acad Sci U S A 105, 294-299. Saito, H., Morita, Y., Fujimoto, M., Narazaki, M., Naka, T., and Kishimoto, T. (2000). IFN regulatory factor-1-mediated transcriptional activation of mouse STAT-induced STAT inhibitor-1 gene promoter by IFN-gamma. J Immunol 164, 5833-5843. Sakai, I., Takeuchi, K., Yamauchi, H., Narumi, H., and Fujita, S. (2002). Constitutive expression of SOCS3 confers resistance to IFN-alpha in chronic myelogenous leukemia cells. Blood 100, 2926- 2931. Sasaki, A., Inagaki-Ohara, K., Yoshida, T., Yamanaka, A., Sasaki, M., Yasukawa, H., Koromilas, A. E., and Yoshimura, A. (2003). The N-terminal truncated isoform of SOCS3 translated from an alternative initiation AUG codon under stress conditions is stable due to the lack of a major ubiquitination site, Lys-6. J Biol Chem 278, 2432-2436. Sasaki, A., Yasukawa, H., Shouda, T., Kitamura, T., Dikic, I., and Yoshimura, A. (2000). CIS3/SOCS-3 suppresses erythropoietin (EPO) signaling by binding the EPO receptor and JAK2. J Biol Chem 275, 29338-29347. Sasaki, A., Yasukawa, H., Suzuki, A., Kamizono, S., Syoda, T., Kinjyo, I., Sasaki, M., Johnston, J. A., and Yoshimura, A. (1999). Cytokine-inducible SH2 protein-3 (CIS3/SOCS3) inhibits Janus tyrosine kinase by binding through the N-terminal kinase inhibitory region as well as SH2 domain. Genes Cells 4, 339-351. Schultheis, B., Carapeti-Marootian, M., Hochhaus, A., Weisser, A., Goldman, J. M., and Melo, J. V. (2002). Overexpression of SOCS-2 in advanced stages of chronic myeloid leukemia: possible inadequacy of a negative feedback mechanism. Blood 99, 1766-1775. Seki, Y., Hayashi, K., Matsumoto, A., Seki, N., Tsukada, J., Ransom, J., Naka, T., Kishimoto, T., Yoshimura, A., and Kubo, M. (2002). Expression of the suppressor of cytokine signaling-5 (SOCS5) negatively regulates IL-4-dependent STAT6 activation and Th2 differentiation. Proc Natl Acad Sci U S A 99, 13003-13008. Seki, Y., Inoue, H., Nagata, N., Hayashi, K., Fukuyama, S., Matsumoto, K., Komine, O., Hamano, S., Himeno, K., Inagaki-Ohara, K., et al. (2003). SOCS-3 regulates onset and maintenance of T(H)2- mediated allergic responses. Nat Med 9, 1047-1054. Shouda, T., Yoshida, T., Hanada, T., Wakioka, T., Oishi, M., Miyoshi, K., Komiya, S., Kosai, K., Hanakawa, Y., Hashimoto, K., et al. (2001). Induction of the cytokine signal regulator SOCS3/CIS3 as a therapeutic strategy for treating inflammatory arthritis. J Clin Invest 108, 1781- 1788. Sitko, J. C., Guevara, C. I., and Cacalano, N. A. (2004). Tyrosine-phosphorylated SOCS3 interacts with the Nck and Crk-L adapter proteins and regulates Nck activation. J Biol Chem 279, 37662- 37669.

Chapter 3: The SOCS protein family

- 83 - Song, M. M., and Shuai, K. (1998). The suppressor of cytokine signaling (SOCS) 1 and SOCS3 but not SOCS2 proteins inhibit interferon-mediated antiviral and antiproliferative activities. J Biol Chem 273, 35056-35062. Song, X. T., Evel-Kabler, K., Rollins, L., Aldrich, M., Gao, F., Huang, X. F., and Chen, S. Y. (2006). An alternative and effective HIV vaccination approach based on inhibition of antigen presentation attenuators in dendritic cells. PLoS Med 3, e11. Starr, R., Metcalf, D., Elefanty, A. G., Brysha, M., Willson, T. A., Nicola, N. A., Hilton, D. J., and Alexander, W. S. (1998). Liver degeneration and lymphoid deficiencies in mice lacking suppressor of cytokine signaling-1. Proc Natl Acad Sci U S A 95, 14395-14399. Starr, R., Willson, T. A., Viney, E. M., Murray, L. J., Rayner, J. R., Jenkins, B. J., Gonda, T. J., Alexander, W. S., Metcalf, D., Nicola, N. A., and Hilton, D. J. (1997). A family of cytokine-inducible inhibitors of signalling. Nature 387, 917-921. Stoiber, D., Kovarik, P., Cohney, S., Johnston, J. A., Steinlein, P., and Decker, T. (1999). Lipopolysaccharide induces in macrophages the synthesis of the suppressor of cytokine signaling 3 and suppresses signal transduction in response to the activating factor IFN-gamma. J Immunol 163, 2640-2647. Stoiber, D., Stockinger, S., Steinlein, P., Kovarik, J., and Decker, T. (2001). Listeria monocytogenes modulates macrophage cytokine responses through STAT serine phosphorylation and the induction of suppressor of cytokine signaling 3. J Immunol 166, 466-472. Sugimoto, N., Oida, T., Hirota, K., Nakamura, K., Nomura, T., Uchiyama, T., and Sakaguchi, S. (2006). Foxp3-dependent and -independent molecules specific for CD25+CD4+ natural regulatory T cells revealed by DNA microarray analysis. Int Immunol 18, 1197-1209. Suzuki, A., Hanada, T., Mitsuyama, K., Yoshida, T., Kamizono, S., Hoshino, T., Kubo, M., Yamashita, A., Okabe, M., Takeda, K., et al. (2001). CIS3/SOCS3/SSI3 plays a negative regulatory role in STAT3 activation and intestinal inflammation. J Exp Med 193, 471-481. Suzuki, R., Sakamoto, H., Yasukawa, H., Masuhara, M., Wakioka, T., Sasaki, A., Yuge, K., Komiya, S., Inoue, A., and Yoshimura, A. (1998). CIS3 and JAB have different regulatory roles in interleukin-6 mediated differentiation and STAT3 activation in M1 leukemia cells. Oncogene 17, 2271-2278. Takahashi, Y., Carpino, N., Cross, J. C., Torres, M., Parganas, E., and Ihle, J. N. (2003). SOCS3: an essential regulator of LIF receptor signaling in trophoblast giant cell differentiation. Embo J 22, 372-384. Takase, H., Yu, C. R., Liu, X., Fujimoto, C., Gery, I., and Egwuagu, C. E. (2005). Induction of suppressors of cytokine signaling (SOCS) in the retina during experimental autoimmune uveitis (EAU): potential neuroprotective role of SOCS proteins. J Neuroimmunol 168, 118-127. Tannahill, G. M., Elliott, J., Barry, A. C., Hibbert, L., Cacalano, N. A., and Johnston, J. A. (2005). SOCS2 can enhance interleukin-2 (IL-2) and IL-3 signaling by accelerating SOCS3 degradation. Mol Cell Biol 25, 9115-9126. Teglund, S., McKay, C., Schuetz, E., van Deursen, J. M., Stravopodis, D., Wang, D., Brown, M., Bodner, S., Grosveld, G., and Ihle, J. N. (1998). Stat5a and Stat5b proteins have essential and nonessential, or redundant, roles in cytokine responses. Cell 93, 841-850. Tollet-Egnell, P., Flores-Morales, A., Stavreus-Evers, A., Sahlin, L., and Norstedt, G. (1999). Growth hormone regulation of SOCS-2, SOCS-3, and CIS messenger ribonucleic acid expression in the rat. Endocrinology 140, 3693-3704. Uchiya, K., and Nikai, T. (2005). Salmonella pathogenicity island 2-dependent expression of suppressor of cytokine signaling 3 in macrophages. Infect Immun 73, 5587-5594. Ueki, K., Kadowaki, T., and Kahn, C. R. (2005). Role of suppressors of cytokine signaling SOCS-1 and SOCS-3 in hepatic steatosis and the metabolic syndrome. Hepatol Res 33, 185-192. Ueki, K., Kondo, T., and Kahn, C. R. (2004). Suppressor of cytokine signaling 1 (SOCS-1) and SOCS- 3 cause insulin resistance through inhibition of tyrosine phosphorylation of insulin receptor substrate proteins by discrete mechanisms. Mol Cell Biol 24, 5434-5446. Ungureanu, D., Saharinen, P., Junttila, I., Hilton, D. J., and Silvennoinen, O. (2002). Regulation of Jak2 through the ubiquitin-proteasome pathway involves phosphorylation of Jak2 on Y1007 and interaction with SOCS-1. Mol Cell Biol 22, 3316-3326. Uyttendaele, I., Lemmens, I., Verhee, A., De Smet, A. S., Vandekerckhove, J., Lavens, D., Peelman, F., and Tavernier, J. (2007). MAPPIT analysis of STAT5, CIS and SOCS2 interactions with the growth hormone receptor. Mol Endocrinol 21, 2821-2831. Vazquez, N., Greenwell-Wild, T., Rekka, S., Orenstein, J. M., and Wahl, S. M. (2006). Mycobacterium avium-induced SOCS contributes to resistance to IFN-gamma-mediated mycobactericidal activity in human macrophages. J Leukoc Biol 80, 1136-1144. Chapter 3: The SOCS protein family

- 84 - Verdier, F., Chretien, S., Muller, O., Varlet, P., Yoshimura, A., Gisselbrecht, S., Lacombe, C., and Mayeux, P. (1998). Proteasomes regulate erythropoietin receptor and signal transducer and activator of transcription 5 (STAT5) activation. Possible involvement of the ubiquitinated Cis protein. J Biol Chem 273, 28185-28190. Vidal, O. M., Merino, R., Rico-Bautista, E., Fernandez-Perez, L., Chia, D. J., Woelfle, J., Ono, M., Lenhard, B., Norstedt, G., Rotwein, P., and Flores-Morales, A. (2007). In vivo transcript profiling and phylogenetic analysis identifies suppressor of cytokine signaling 2 as a direct signal transducer and activator of transcription 5b target in liver. Mol Endocrinol 21, 293-311. Watanabe, D., Ezoe, S., Fujimoto, M., Kimura, A., Saito, Y., Nagai, H., Tachibana, I., Matsumura, I., Tanaka, T., Kanegane, H., et al. (2004). Suppressor of cytokine signalling-1 gene silencing in acute myeloid leukaemia and human haematopoietic cell lines. Br J Haematol 126, 726-735. Weniger, M. A., Melzner, I., Menz, C. K., Wegener, S., Bucur, A. J., Dorsch, K., Mattfeldt, T., Barth, T. F., and Moller, P. (2006). Mutations of the tumor suppressor gene SOCS-1 in classical Hodgkin lymphoma are frequent and associated with nuclear phospho-STAT5 accumulation. Oncogene 25, 2679-2684. Wikman, H., Kettunen, E., Seppanen, J. K., Karjalainen, A., Hollmen, J., Anttila, S., and Knuutila, S. (2002). Identification of differentially expressed genes in pulmonary adenocarcinoma by using cDNA array. Oncogene 21, 5804-5813. Wu, K. L., Miao, H., and Khan, S. (2007). JAK Kinases Promote Invasiveness in VHL-Mediated Renal Cell Carcinoma by a Suppressor of Cytokine Signaling-Regulated, HIF-Independent Mechanism. Am J Physiol Renal Physiol. Yamamoto, K., Yamaguchi, M., Miyasaka, N., and Miura, O. (2003). SOCS-3 inhibits IL-12-induced STAT4 activation by binding through its SH2 domain to the STAT4 docking site in the IL-12 receptor beta2 subunit. Biochem Biophys Res Commun 310, 1188-1193. Yang, R., Yang, X., Zhang, Z., Zhang, Y., Wang, S., Cai, Z., Jia, Y., Ma, Y., Zheng, C., Lu, Y., et al. (2006). Single-walled carbon nanotubes-mediated in vivo and in vitro delivery of siRNA into antigen-presenting cells. Gene Ther 13, 1714-1723. Yasukawa, H., Misawa, H., Sakamoto, H., Masuhara, M., Sasaki, A., Wakioka, T., Ohtsuka, S., Imaizumi, T., Matsuda, T., Ihle, J. N., and Yoshimura, A. (1999). The JAK-binding protein JAB inhibits Janus tyrosine kinase activity through binding in the activation loop. Embo J 18, 1309- 1320. Yasukawa, H., Ohishi, M., Mori, H., Murakami, M., Chinen, T., Aki, D., Hanada, T., Takeda, K., Akira, S., Hoshijima, M., et al. (2003). IL-6 induces an anti-inflammatory response in the absence of SOCS3 in macrophages. Nat Immunol 4, 551-556. Yoshikawa, H., Matsubara, K., Qian, G. S., Jackson, P., Groopman, J. D., Manning, J. E., Harris, C. C., and Herman, J. G. (2001). SOCS-1, a negative regulator of the JAK/STAT pathway, is silenced by methylation in human hepatocellular carcinoma and shows growth-suppression activity. Nat Genet 28, 29-35. Yoshimura, A., Ohkubo, T., Kiguchi, T., Jenkins, N. A., Gilbert, D. J., Copeland, N. G., Hara, T., and Miyajima, A. (1995). A novel cytokine-inducible gene CIS encodes an SH2-containing protein that binds to tyrosine-phosphorylated interleukin 3 and erythropoietin receptors. Embo J 14, 2816- 2826. Yu, C. L., and Burakoff, S. J. (1997). Involvement of proteasomes in regulating Jak-STAT pathways upon interleukin-2 stimulation. J Biol Chem 272, 14017-14020. Yumet, G., Shumate, M. L., Bryant, D. P., Lang, C. H., and Cooney, R. N. (2006). Hepatic growth hormone resistance during sepsis is associated with increased suppressors of cytokine signaling expression and impaired growth hormone signaling. Crit Care Med 34, 1420-1427. Zhang, J. G., Metcalf, D., Rakar, S., Asimakis, M., Greenhalgh, C. J., Willson, T. A., Starr, R., Nicholson, S. E., Carter, W., Alexander, W. S., et al. (2001). The SOCS box of suppressor of cytokine signaling-1 is important for inhibition of cytokine action in vivo. Proc Natl Acad Sci U S A 98, 13261-13265. Zheng, C., Li, L., Haak, M., Brors, B., Frank, O., Giehl, M., Fabarius, A., Schatz, M., Weisser, A., Lorentz, C., et al. (2006). Gene expression profiling of CD34+ cells identifies a molecular signature of chronic myeloid leukemia blast crisis. Leukemia 20, 1028-1034. Zimmermann, S., Murray, P. J., Heeg, K., and Dalpke, A. H. (2006). Induction of suppressor of cytokine signaling-1 by Toxoplasma gondii contributes to immune evasion in macrophages by blocking IFN-gamma signaling. J Immunol 176, 1840-1847.

Chapter 3: The SOCS protein family

- 85 -

Chapter 3: The SOCS protein family

- 86 - CHAPTER 4: MAPPIT, a mammalian two-hybrid system

I. Techniques to study protein-protein interactions

Interactions between proteins form the basis of practically all cellular processes. Protein complexes can form stable structures such as the cytoskeleton or the proteasome complex. On the other hand, protein-protein interactions are also involved in the regulation of cellular processes and these interactions are often temporary and dependent on the modification of one or more of the binding partners. Identification of the interaction profile of a given protein can contribute considerably to its functional characterization in a specific cellular context. Mutations in proteins may cause altered protein-protein interactions, which can result in the onset of diseases. Hence, the identification and manipulation of such protein-protein interactions can offer new strategies towards therapeutic interventions. For this reason, a broad range of both biochemical and genetic methods for studying protein-protein interactions has been developed.

Biochemical approaches

Biochemical methods such as protein affinity chromatography and co- immunoprecipitation aim at isolating protein complexes from cell lysates or from solution. Initially, identification of binding partners by these methods was limited to immunological detection and Edman degradation. However, the introduction of sensitive protein identification by mass spectrometry in combination with database searches led to the development of high-throughput biochemical techniques. A widely used large-scale approach relying on tag-based affinity purification is the tandem affinity purification (TAP) procedure (Puig et al., 2001; Rigaut et al., 1999). Following cellular expression of a bait protein linked to a dual affinity-tag and cell lysis, the protein complexes are precipitated in a two-stage purification step. Proteins are then separated by gel electrophoresis and subsequently identified by

Chapter 4: MAPPIT, a mammalian two-hybrid system

- 87 - mass spectrometry. This technique has been successfully used to identify yeast, plant as well as mammalian protein complexes (Bouwmeester et al., 2004; Gavin et al., 2002). Luminescence-based mammalian interactome mapping (LUMIER) is an automated high-throughput technology, to map protein-protein interaction networks systematically in mammalian cells (Barrios-Rodiles et al., 2005). The strategy uses Renilla luciferase enzyme fused to proteins of interest, which are then coexpressed with individual Flag-tagged partners in mammalian cells. The interactions are determined by performing a luciferase enzymatic assay upon immunoprecipitation using an antibody against Flag. A limitation of these techniques is that the lysis step may cause disruption of weak interactions. Another large-scale technology relies on protein micro-array chips. High-throughput screening of binary interactions is done by covalently linking proteins to a solid support and screening with fluorescently labelled protein-probes (MacBeath and Schreiber, 2000; Zhu et al., 2001).

Methods for characterization of known interactions include: analytical ultracentrifugation, isothermal titration calorimetry (ITC) and Biacore. This latter technique relies on surface plasmon resonance (SPR), which is an optical phenomenon that occurs when surface plasmon waves are excited at a metal/liquid interface. Biacore allows real time measurement of binding kinetics between two or more molecules. They do so by monitoring the changes in refractive index at the surface layer of a sensor chip, which results from the interaction between surface immobilized and solution-borne binding partners.

Genetic approaches

Genetic approaches are in vivo techniques that rely on hybrid bait and prey proteins designed in such a way that their interaction will generate a detectable signal. The yeast two-hybrid method is based on reconstitution of a transcription factor (Fields and Song, 1989). Bait and prey are genetically fused to either the DNA binding domain or the transcription activation domain of the transcription factor. Interaction of bait and prey protein restores transcriptional activity, leading to induction of reporter genes or selection markers. The yeast two-hybrid method has become the most widely used genetic technique, mainly because it is cost-effective, relatively

Chapter 4: MAPPIT, a mammalian two-hybrid system

- 88 - easy to implement and scalable. A proteome-wide interactome has for example been generated for yeast and C. elegans (Ito et al., 2001; Reboul et al., 2003) and a human interaction map is on its way (Rual et al., 2005; Stelzl et al., 2005). However, although the yeast two-hybrid method is thus far the only approach capable of proteome-wide analyses, the method also suffers from some intrinsic limitations. As functional complementation must occur in the nucleus, failure in nuclear localisation of either bait or prey results in false negatives. Moreover, correct posttranslational modifications, often essential in eukaryotic signalling transduction processes, are hard to reproduce in yeast. Some of the shortcomings described for the yeast two- hybrid system, can be overcome by the use of mammalian cell systems.

The first mammalian two-hybrid methods were mere adaptations of the yeast two- hybrid system. They make use of a similar transcription factor complementation strategy and are accordingly dependent on nuclear localisation of bait and prey (Dang et al., 1991). Several other mammalian systems have been described allowing detection of protein interactions in their physiological context. These methods include the mammalian Ras recruitment system, split-ubiquitin approaches, protein-splicing based assays, reporter enzyme fragment complementation systems, proximity-ligation in situ assay (P-LISA) and MAPPIT (reviewed in (Eyckerman and Tavernier, 2002; Lievens and Tavernier, 2006)). The MAPPIT technology will be described in more detail in the next section. P-LISA allows the study of endogenous protein complexes in intact cells (Soderberg et al., 2006). The technique makes use of oligonucleotides attached to antibodies against the two target proteins that will direct the formation of circular DNA strands when bound in close proximity. The DNA circles in turn serve as templates for localized rolling-circle amplification (RCA). The RCA reaction product is a single-stranded DNA molecule that remains attached to the antibody-protein complex, and is detected through hybridization of a fluorescently labeled oligonucleotide, allowing individual interacting pairs of protein molecules to be visualized.

To visualise protein interactions in real time, methods like fluorescence resonance energy transfer (FRET), bioluminescence resonance energy transfer (BRET) or bimolecular fluorescence complementation (BiFC) can be applied. The FRET

Chapter 4: MAPPIT, a mammalian two-hybrid system

- 89 - technique depends on the energy transfer between two different fluorophores to monitor the interaction and dissociation of the attached proteins. Light emission of the excited donor fluorophore results in excitation of the acceptor fluorophore only when both are brought in close proximity by their fusion partners (Jares-Erijman and Jovin, 2003; Wallrabe and Periasamy, 2005). In the BRET system, excitation of the acceptor fluorophore is induced via enzymatic bioluminescence instead of a donor fluorescence (Angers et al., 2000). In the case of BiFC the target proteins are fused to fragments of a single fluorescent protein, which results in functional complementation upon protein interaction (Hu et al., 2002; Kerppola, 2006).

II. Mammalian protein-protein interaction trap (MAPPIT)

MAPPIT is a mammalian two hybrid technique that was developed in our laboratory and is based on type I cytokine receptor signalling (Eyckerman et al., 2001). In the MAPPIT system (figure 13), a bait protein is coupled C-terminally to a chimeric receptor consisting of the extracellular part of the EpoR and the transmembrane and intracellular parts of the LR that has been deprived of its STAT3 recruiting tyrosine (Y1138) to prevent STAT activation. The other LR tyrosines (Y985 and Y1077) are also mutated to prevent negative feedback, thereby maximizing the signal intensity. MAPPIT prey proteins are linked to a part of the cytoplasmatic tail of the gp130 receptor carrying several STAT3 recruitment sites. When bait and prey interact, phosphorylation of the prey gp130 tail leads to STAT3 recruitment, activation and migration to the nucleus, ultimately resulting in transcription of a reporter gene under the control of the STAT3-responsive rPAP1 promoter.

The MAPPIT technique offers several advantages: first, the mammalian cell context provides a physiological background for the study of posttranslational-dependent interactions. Intrinsic to the strategy, both modification-independent and tyrosine phosphorylation-dependent interactions can be detected. MAPPIT is therefore very suitable for studying protein-protein interactions involved in signal transduction. Second, the physical separation of the bait-prey interaction (cytosol) and the signal read-out by endogenous STATs (nucleus), avoids interference of the chimeric bait Chapter 4: MAPPIT, a mammalian two-hybrid system

- 90 - and prey proteins with reporter activity, a common drawback in many two-hybrid methods leading to background signals. Third, MAPPIT is an inducible system based on cytokine stimulation which allows exclusion of ligand-independent interactions, further limiting false positives.

Figure 13: Principle of MAPPIT (A) Schematic representation of the JAK/STAT pathway. (B) MAPPIT, for details see text.

Several variants of the basic MAPPIT approach have been developed. The LR- based MAPPIT, GGS-MAPPIT and βc-MAPPIT were used during this thesis (figure 14). The LR-MAPPIT variant was generated to specifically identify interaction partners of the LR. The GGS-MAPPIT was created to improve the flexibility of the system and to avoid interactions due to interaction with the LR. βc-MAPPIT relies on functional complementation of STAT5 signalling and allows the analysis of protein interactions in haematopoietic cells.

Chapter 4: MAPPIT, a mammalian two-hybrid system

- 91 -

Figure 14: Variants of MAPPIT (A) LR-MAPPIT. The LR itself, devoid of its STAT3 recruiting tyrosine (Y1138) functions as bait protein. Upon stimulation, the two membrane proximal tyrosines can be phosphorylated by JAK2. Interaction of the prey protein with the LR, which may depend on phosphorylation, allows STAT3 recruitment and activation via gp130 and subsequent reporter induction. (B)

βc-variant of LR-MAPPIT. In βc-MAPPIT a βc receptor-based prey construct (inset) is used.

The βc receptor contains six tyrosine motifs in its cytoplasmatic tail of which three are known

STAT5 recruitment sites. A prey in the βc-MAPPIT method is fused to a part of the βc receptor containing all three STAT5 recruitment sites. (C) GGS-MAPPIT. The bait protein is attached C-terminally to a variant of the chimeric EpoR-LR receptor. The cytosolic domain of the LR following the JAK2 recruitment site is replaced by 60 GGS triplets, preventing any background activation resulting from prey association with the LR. (D) βc-variant of GGS- MAPPIT.

Chapter 4: MAPPIT, a mammalian two-hybrid system

- 92 - III. References

Angers, S., Salahpour, A., Joly, E., Hilairet, S., Chelsky, D., Dennis, M., and Bouvier, M. (2000). Detection of beta 2-adrenergic receptor dimerization in living cells using bioluminescence resonance energy transfer (BRET). Proc Natl Acad Sci U S A 97, 3684-3689. Barrios-Rodiles, M., Brown, K. R., Ozdamar, B., Bose, R., Liu, Z., Donovan, R. S., Shinjo, F., Liu, Y., Dembowy, J., Taylor, I. W., et al. (2005). High-throughput mapping of a dynamic signaling network in mammalian cells. Science 307, 1621-1625. Bouwmeester, T., Bauch, A., Ruffner, H., Angrand, P. O., Bergamini, G., Croughton, K., Cruciat, C., Eberhard, D., Gagneur, J., Ghidelli, S., et al. (2004). A physical and functional map of the human TNF-alpha/NF-kappa B signal transduction pathway. Nat Cell Biol 6, 97-105. Dang, C. V., Barrett, J., Villa-Garcia, M., Resar, L. M., Kato, G. J., and Fearon, E. R. (1991). Intracellular leucine zipper interactions suggest c-Myc hetero-oligomerization. Mol Cell Biol 11, 954-962. Eyckerman, S., and Tavernier, J. (2002). Methods to map protein interactions in mammalian cells: different tools to address different questions. Eur Cytokine Netw 13, 276-284. Eyckerman, S., Verhee, A., Van der Heyden, J., Lemmens, I., Van Ostade, X., Vandekerckhove, J., and Tavernier, J. (2001). Design and application of a cytokine-receptor-based interaction trap. Nat Cell Biol 3, 1114-1119. Fields, S., and Song, O. (1989). A novel genetic system to detect protein-protein interactions. Nature 340, 245-246. Gavin, A. C., Bosche, M., Krause, R., Grandi, P., Marzioch, M., Bauer, A., Schultz, J., Rick, J. M., Michon, A. M., Cruciat, C. M., et al. (2002). Functional organization of the yeast proteome by systematic analysis of protein complexes. Nature 415, 141-147. Hu, C. D., Chinenov, Y., and Kerppola, T. K. (2002). Visualization of interactions among bZIP and Rel family proteins in living cells using bimolecular fluorescence complementation. Mol Cell 9, 789- 798. Ito, T., Chiba, T., Ozawa, R., Yoshida, M., Hattori, M., and Sakaki, Y. (2001). A comprehensive two- hybrid analysis to explore the yeast protein interactome. Proc Natl Acad Sci U S A 98, 4569-4574. Jares-Erijman, E. A., and Jovin, T. M. (2003). FRET imaging. Nat Biotechnol 21, 1387-1395. Kerppola, T. K. (2006). Visualization of molecular interactions by fluorescence complementation. Nat Rev Mol Cell Biol 7, 449-456. Lievens, S., and Tavernier, J. (2006). Single protein complex visualization: seeing is believing. Nat Methods 3, 971-972. MacBeath, G., and Schreiber, S. L. (2000). Printing proteins as microarrays for high-throughput function determination. Science 289, 1760-1763. Puig, O., Caspary, F., Rigaut, G., Rutz, B., Bouveret, E., Bragado-Nilsson, E., Wilm, M., and Seraphin, B. (2001). The tandem affinity purification (TAP) method: a general procedure of protein complex purification. Methods 24, 218-229. Reboul, J., Vaglio, P., Rual, J. F., Lamesch, P., Martinez, M., Armstrong, C. M., Li, S., Jacotot, L., Bertin, N., Janky, R., et al. (2003). C. elegans ORFeome version 1.1: experimental verification of the genome annotation and resource for proteome-scale protein expression. Nat Genet 34, 35-41. Rigaut, G., Shevchenko, A., Rutz, B., Wilm, M., Mann, M., and Seraphin, B. (1999). A generic protein purification method for protein complex characterization and proteome exploration. Nat Biotechnol 17, 1030-1032. Rual, J. F., Venkatesan, K., Hao, T., Hirozane-Kishikawa, T., Dricot, A., Li, N., Berriz, G. F., Gibbons, F. D., Dreze, M., Ayivi-Guedehoussou, N., et al. (2005). Towards a proteome-scale map of the human protein-protein interaction network. Nature 437, 1173-1178. Soderberg, O., Gullberg, M., Jarvius, M., Ridderstrale, K., Leuchowius, K. J., Jarvius, J., Wester, K., Hydbring, P., Bahram, F., Larsson, L. G., and Landegren, U. (2006). Direct observation of individual endogenous protein complexes in situ by proximity ligation. Nat Methods 3, 995-1000. Stelzl, U., Worm, U., Lalowski, M., Haenig, C., Brembeck, F. H., Goehler, H., Stroedicke, M., Zenkner, M., Schoenherr, A., Koeppen, S., et al. (2005). A human protein-protein interaction network: a resource for annotating the proteome. Cell 122, 957-968. Wallrabe, H., and Periasamy, A. (2005). Imaging protein molecules using FRET and FLIM microscopy. Curr Opin Biotechnol 16, 19-27. Zhu, H., Bilgin, M., Bangham, R., Hall, D., Casamayor, A., Bertone, P., Lan, N., Jansen, R., Bidlingmaier, S., Houfek, T., et al. (2001). Global analysis of protein activities using proteome chips. Science 293, 2101-2105.

Chapter 4: MAPPIT, a mammalian two-hybrid system

- 93 -

Chapter 4: MAPPIT, a mammalian two-hybrid system

- 94 - CHAPTER 5: Biological functions and signal transduction of leptin

The human body is evolutionary conditioned to endure periods of starvation. This is achieved principally by energy storage in adipose tissue, but also by reducing physical activity and lowering thermogenesis. The balanced maintenance of energy reserves throughout life is of vital importance. Therefore, a rigorous equilibrium between eating, physical activity and body metabolism exists and is strictly controlled by dedicated centres in the brain. The adipocyte-derived hormone leptin and its receptor emerged as key players in this control mechanism regulating the body weight. Moreover, there is a growing body of evidence that energy reserves, or the nutritional status, influence important physiological processes like the onset of puberty and reproduction, haematopoiesis and immune reactions.

I. Leptin and its receptor

Leptin refers to the Greek word leptos, which means ‘thin’. It was identified by positional cloning as the product of the obese (ob) gene (Zhang et al., 1994). This gene is truncated in the naturally occurring severely obese ob/ob mice. These mice display an early onset obese phenotype (figure 15) which is associated with a number of endocrinological disorders. Administration of recombinant leptin to ob/ob mice results in a reduced food intake, increased energy expenditure and weight loss, thereby supporting a role for leptin in the regulation of body weight (Halaas et al., 1995). Leptin is expressed as a 16kDa non-glycosylated protein with an intra- molecular disulphide bond necessary for biological activity (Rock et al., 1996). Its structure was solved by crystallography and revealed a typical type I long chain cytokine structure (see chapter 1). The hormone is mainly secreted by white adipose tissue, and its circulating plasma levels correlate positively with body fat mass (Considine et al., 1996; Maffei et al., 1995). Lower levels of leptin production

Chapter 5: Biological functions and signal transduction of leptin

- 95 - could also be shown in other tissues, such as stomach, placenta and skeletal muscle (Bado et al., 1998; Masuzaki et al., 1997; Wang et al., 1998).

Figure 15: Phenotype of the ob/ob mouse A wild type mouse (right) and an obese ob/ob mouse (left)

The leptin receptor (LR) was isolated as the product of the diabetis (db) gene using an expression cloning strategy (Tartaglia et al., 1995). The gene is disrupted in the naturally occurring db/db mice that have the same phenotype as ob/ob mice. So far, six isoforms have been identified: one long form (LRlo or LRb), one soluble variant (LRe) and four short forms (LRsh or LRa, LRc, LRd and LRf) (figure 16). The different LR variants are generated through alternative splicing but a soluble LR can also be created by proteolytic ectodomain shedding of membrane-anchored LRs (Ge et al., 2002; Maamra et al., 2001). All isoforms possess an identical N-terminal extracellular domain but vary in their C-terminal intracellular part. The extracellular domain contains the typical extracellular characteristics of the class I cytokine receptor family. A rather unique feature is the presence of two extracellular CRH (CRH1 and 2) domains. These are separated by an Ig-like domain and followed by two FNIII domains (reviewed in (Zabeau et al., 2003)). The LRlo is the only isoform capable of efficient signalling. This LR variant is highly expressed within specific nuclei of the hypothalamus, known to be involved in body weight regulation. Expression could also be observed in different peripheral tissues (Fruhbeck, 2001; Lam et al., 2006; Sanchez-Margalet et al., 2002; Tian et al., 2002). The short Chapter 5: Biological functions and signal transduction of leptin

- 96 - isoforms of the LR and especially the LRsh, are more abundantly expressed throughout the body (Fei et al., 1997). The short variants of the LR are proposed to be involved in the transport of leptin across the blood-brain barrier, leptin clearance or leptin signal transduction (Hileman et al., 2002; Murakami et al., 1997; Uotani et al., 1999). The secreted LRe is likely involved in the modulation of the plasma levels of circulating free leptin (Huang et al., 2001; Yang et al., 2004).

Figure 16: Schematic representations of the murine LR isoforms The extracellular domain of all isoforms consists of a CRH domain, an Ig-like domain, a second CRH domain and two FNIII domains. The number of AA in each isoform is indicated. The box1 domain represents the proline rich region necessary for JAK binding.

II. Leptin: function and importance

Body weight regulation

Although daily food intake as well as energy expenditure can vary considerably, an individual’s body weight remains remarkably constant over time. The physiological system that regulates body weight by balancing energy intake and expenditure is very strictly controlled by a short-term and long-term strategy. The short-term Chapter 5: Biological functions and signal transduction of leptin

- 97 - system mainly controls feeding via hunger and satiety signals. Satiety signals can be defined as rapidly released gastro-intestinal signals such as the hormone cholecystokinin that signals to the brain to stop an ongoing meal (Strader and Woods, 2005). Long-term regulation of energy balance is dependent on adiposity signal molecules that circulate at levels proportional to the body fat mass. Two cytokine-like hormones appear to be key players in this mechanism indicating sufficient long-term energy stores: leptin and insulin.

weight loss ADIPOSE TISSUE weight gain

Leptin ↓ Leptin ↑

NPY ↑ POMC ↑ AgRP ↑ HYPOTHALAMUS CART ↑

response to starvation response to overweight

food intake ↑ energy expenditure ↓ food intake ↓ energy expenditure ↑

Figure 17: Leptin functions as an adipostat, signalling the body energy stores to the brain

As circulating leptin levels correlate accurately with the body fat content, leptin is considered to function as an adipostat that communicates the status of body energy reserves to the brain (Friedman and Halaas, 1998; Maffei et al., 1995). Administration of leptin to rodents decreases food intake and increases energy expenditure (Campfield et al., 1996; Halaas et al., 1995). This demonstrates that leptin acts as an afferent satiety signal in a negative feedback mechanism that maintains the body weight at a constant level. Starvation leads to a decrease in fat

Chapter 5: Biological functions and signal transduction of leptin

- 98 - stores and concomitant drop in leptin levels, resulting in a reduction in energy expenditure and allows a longer survival. On the other hand, higher energy reserves will correlate with elevated leptin levels, reducing the food intake and augmenting the energy expenditure (figure 17). To enter the CNS, the adipocyte- derived leptin must pass the blood-brain-barrier (BBB), via a specific and saturable transport system that might engage the short isoform of the LR (Banks, 2004; Banks et al., 1996; Bjorbaek et al., 1998b). Once in the brain, leptin binds and activates its receptor expressed by neurons in certain nuclei of the hypothalamus. The importance of the brain and especially the hypothalamus as a direct target of the leptin is demonstrated by neural specific deletion of the LR which leads to obesity in mice (Cohen et al., 2001). LR activation will alter expression and release of neuropeptides, which then activate pathways that engage other brain regions, ultimately leading to a satiated feeling (Broberger, 2005; Friedman and Halaas, 1998). Leptin regulates two different populations of primary target neurons in the hypothalamus: anorexigenic and orexigenic neurons. Increased leptin levels will stimulate the anorexigenic (appetite-suppressive) neurons to express the satiety- related molecules cocaine-amphetamine-regulated transcript (CART) and pro- opionmelanocortin (POMC), the precursor of the α-melanocyte-stimulating hormone (α-MSH). The orexigenic (appetite-stimulating) neurons are responsive to absence or low concentrations of leptin and express neuropeptide Y (NPY) and agouti- related protein (AgRP). The abundant NPY is a very potent orexigenic peptide that stimulates food consumption while AgRP antagonizes α-MSH action. Secondary target neurons process the NPY/AgRP and POMC/CART signals they receive. The orexigenic and anorexigenic systems act together and ultimately determine the response to peripheral signals (Friedman and Halaas, 1998).

A broader role for leptin

A growing body of evidence has qualified leptin as a pleiotropic molecule that is involved in a wide range of functions in the CNS and in the periphery. This is well illustrated by the phenotype of ob/ob and db/db mice: besides obesity, these mice display many defects in haematopoiesis, reproduction, angiogenesis, immune responsiveness, blood pressure control, bone formation and fetal development

Chapter 5: Biological functions and signal transduction of leptin

- 99 - (Ducy et al., 2000; Fruhbeck, 1999; Harigaya et al., 1997; Holness et al., 1999; Lord et al., 1998; Sierra-Honigmann et al., 1998; Umemoto et al., 1997). The link between the energy status of the body and physiological processes might not be surprising, as adequate energy stores are crucial to support energy-demanding functions such as immunity and reproduction. Fasting or starvation leads to an attenuation of these processes, thereby prioritizing food collection and consumption. As mentioned before, expression of the LRlo was reported in many peripheral tissues and immune cells, including bone marrow, pancreatic β cells, endothelial cells, dendritic cells, NK cells and T lymphocytes (figure 18) (Fehmann et al., 1997; Gainsford et al., 1996; Lam et al., 2006; Lord et al., 1998; Sierra-Honigmann et al., 1998; Tian et al., 2002).

hypothalamus REPRODUCTION METABOLISM liver pituitary digestive tract testes

uterus pancreas ovaries adipose tissue spleen LEPTIN muscle thymus

heart lymph nodes endothelium haematopoietic cells kidneys

T cells adrenals ANGIOGENESIS IMMUNITY skin bone BLOOD PRESSURE

OTHER EFFECTS

Figure 18: Localisation of functional LRs showing the involvement of leptin in peripheral effects

Chapter 5: Biological functions and signal transduction of leptin

- 100 - Leptin has been increasingly recognized as a cytokine-like hormone with pleiotropic actions in modulating immune responses. Since cell-mediated immunity is an energy demanding process, leptin may provide an important link between the body’s energy status and the immune system. Leptin was characterized as a pro- inflammatory cytokine that functions as an early-phase reactant (Fantuzzi and Faggioni, 2000). It operates in both innate and adaptive immunity (La Cava and Matarese, 2004). In innate immunity leptin will for example affect functions of monocytes and macrophages including phagocytosis, release of pro-inflammatory cytokines and expression of adhesion molecules (Fantuzzi and Faggioni, 2000; Mancuso et al., 2002; Zarkesh-Esfahani et al., 2001). In adaptive immunity, leptin promotes the development of T cells by reducing apoptosis and it directs memory T cells towards a Th1 response (Howard et al., 1999; Lord et al., 1998). Given its role in regulating T cell-controlled immune responses, leptin may play a role in the onset of T cell-controlled autoimmune diseases. Indeed, studies on mouse models demonstrated an involvement of leptin in the pathogenesis of several autoimmune diseases including inflammatory bowel disease and multiple sclerosis (Matarese et al., 2007; Peelman et al., 2004). Leptin increase in multiple sclerosis associates with reduced number of CD4(+)CD25(+) immunoregulatory T cells (Tregs) (Matarese et al., 2005). Tregs are known to suppress autoreactive responses mediated by CD4+CD25– T cells and may influence the onset and progression of autoimmunity (Sakaguchi, 2004).

As a marker of the nutritional status, leptin has an essential role in reproduction. Leptin and its receptor have been found in reproductive tissues like ovary, oocytes, uterus and endometrium (Cervero et al., 2004; Kawamura et al., 2002; Ramos et al., 2005; Ryan et al., 2002). The hormone appears to be a permissive factor in the onset of puberty since leptin administration accelerates puberty in wild type mice and restores fertility in ob/ob mice (Chehab et al., 1996; Chehab et al., 1997; Gruaz et al., 1998). Leptin affects the hypothalamus-pituitary-gonadal axis, regulating gonadotrophin-releasing hormone and luteinising hormone secretion (Welt et al., 2004; Yu et al., 1997).

Chapter 5: Biological functions and signal transduction of leptin

- 101 - The involvement of leptin in haematopoiesis is suggested by the altered amount of blood cells seen in ob/ob and db/db mice (Bennett et al., 1996; Faderl et al., 2003). A direct role for leptin in haematopoiesis is proposed based on the expression of its receptor in fetal liver, bone marrow stromal cells and several haematopoietic cell lines (Cioffi et al., 1996; Konopleva et al., 1999). The capacity of the bone marrow cells to produce leptin provides further evidence for leptin in promoting the haematopoietic stem cells. This was further supported by colony formation studies where leptin stimulated the proliferation of stem cells and increased the numbers of lymphoid, erythroid and myeloid colonies (Bennett et al., 1996). Nevertheless, a direct role for leptin in the regulation of hematopoietic cells remains unclear.

Leptin: clinical use and beyond

The prevalence of overweight and obesity is escalating at an alarming rate, making it one of the most pressing health problems in the western world. In addition to the aesthetic considerations, obesity is indisputably linked with a number of serious health threats, including cardiovascular disease, stroke, type II diabetes and certain types of cancer (Calle et al., 1999; Kopelman, 2000). Although environmental and behavioural factors caused by economic development, urbanization and the media have been associated to the rise in global obesity, research demonstrated that obesity also has a significant genetic component. Given the remarkable weight loss of treated ob/ob mice, leptin was initially expected to be a miracle drug for curing obesity. In strong contrast, trials in which recombinant leptin was administered to obese patients failed to live up to the expectations as only modest weight decrease was obtained (Heymsfield et al., 1999; Hukshorn et al., 2000). Only in a few cases of obesity, caused by absence of or aberrant leptin production (Montague et al., 1997; Ozata et al., 1999), administration of the hormone led to effective decrease in body weight (Farooqi et al., 1999). The majority of the obesity cases are associated with significantly elevated leptin levels, pointing to a failure to respond correctly to the leptin signal (Considine et al., 1996; El-Haschimi et al., 2000; Maffei et al., 1995). This so-called leptin resistance is discussed in text box 3. Leptin treatment was found to be effective for the treatment of hyperphagia caused by low leptin levels in humans with low body fat content (McDuffie et al., 2004; Welt et al., 2004).

Chapter 5: Biological functions and signal transduction of leptin

- 102 -

Text box 3: Leptin resistance

Desensitization to leptin in obese individuals might result from defects in one of the three levels of leptin responses:

(i) Decreased transport across the blood-brain-barrier (BBB)

Impaired transport of leptin through the BBB has been demonstrated in rodents with diet- induced obesity (DIO), a model of obesity and leptin resistance in which rodents become obese by eating a high-fat diet. These DIO animals are resistant to peripheral leptin administration but lose weight when leptin was injected directly into the brain (El-Haschimi et al., 2000; Halaas et al., 1997).

(ii) Defects in LR activation and signal transduction

Impaired receptor expression results in a marked obese phenotype (e.g. db/db mice). In addition, aberrant signalling inhibition can cause central leptin insensitivity. SOCS3 and PTP1B are the two molecules that are most associated with attenuation of LR signalling and their enhanced activity can contribute to leptin resistance. Supportive of this, SOCS3 haploinsufficient or neural cell-specific deficient mice and PTP1B knock-out mice show hypersensitivity to leptin which protects them from high fat diet obesity (Cheng et al., 2002; Elchebly et al., 1999; Howard et al., 2004; Mori et al., 2004). However, neural PTP1B expression or activity is not altered by leptin or adiposity, suggesting that PTP1B may not underlie tempered leptin signalling in obesity. Conversely, SOCS3 expression increases in response to leptin and is elevated in the hypothalami of obese animals (Bjorbaek et al., 1998a; Munzberg et al., 2005; Tups et al., 2004). At present, most data confirm that alterations in cellular LR signalling, with a major role for SOCS3, have a major contribution in leptin resistance (El-Haschimi et al., 2000; Munzberg et al., 2005; Munzberg et al., 2004).

(iii) Impaired secondary leptin signalling

Defects in downstream effects of leptin in the neuronal circuit may also underlie leptin resistance. This comprises mutations in the genes encoding components of the neural circuit activated by leptin such as NPY, AgRP, POMC or CART. This is well illustrated by the obese phenotype observed for mice with loss-of-function mutations in the POMC encoding gene (Challis et al., 2004).

Chapter 5: Biological functions and signal transduction of leptin

- 103 -

Accumulating evidence points to leptin as a potential link between obesity and cancer, especially in the development of breast, colorectal and prostate cancers (Garofalo and Surmacz, 2006). Leptin has been shown to act as a proliferative, mitogenic and pro-angiogenic agent promoting tumorigenesis of certain cancer cells (Bouloumie et al., 1998; Dieudonne et al., 2002; Horiguchi et al., 2006; Hu et al., 2002; Iversen et al., 2002; Sierra-Honigmann et al., 1998). The relevance of leptin signalling in cancer is reinforced by the fact that the LR is (over)expressed in several cancer cells (Garofalo et al., 2006; Hardwick et al., 2001; Ishikawa et al., 2004; Stattin et al., 2001). Until now, the association between circulating leptin levels and cancer risk has not been clear. Anyhow, recent studies suggest that for example breast carcinogenesis could also be induced by overabundance of locally produced leptin (Garofalo et al., 2006; Ishikawa et al., 2004).

In respect to its diverse functions in immunity, leptin has been explored as a potential target for therapeutic application in treating autoimmune diseases. Modulation of the hormone has been shown to target autoimmune disease in some mice models and further studies are on the way to test if antagonizing leptin activity can affect the pathogenesis of these immunological disorders in humans.

III. Signalling via the leptin receptor

The LR appears as pre-assembled dimers at the plasma membrane (Biener et al., 2005; Couturier and Jockers, 2003; White and Tartaglia, 1999). Leptin binding induces further clustering and conformational reorganisation of LR chains, thereby reorienting the intracellular domains in such a way that the associated JAKs become activated (Peelman et al., 2006; Zabeau et al., 2005; Zabeau et al., 2004). Three conserved tyrosine residues in the LR (Y985, Y1077 and Y1138, murine numbering) act as docking sites for downstream signalling molecules upon phosphorylation (figure 19) (Banks et al., 2000; Gong et al., 2007).

Chapter 5: Biological functions and signal transduction of leptin

- 104 - The JAK/STAT pathway

The LR can associate and activate both JAK1 and JAK2, but it is generally accepted that JAK2 is the main player under physiological conditions (Bjorbaek et al., 1997; Kloek et al., 2002; Muraoka et al., 2003). Interaction with JAK2 is mediated by the conserved box 1 motif, while the less conserved box 2, dispensable for JAK2 activation, likely functions in JAK2 selectivity (Bahrenberg et al., 2002; Kloek et al., 2002). Leptin stimulation was found to principally activate STAT3 in different in vivo studies (El-Hefnawy et al., 2000; Martin-Romero et al., 2000; McCowen et al., 1998).

Figure 19: Overview of the leptin signalling pathways

The Y1138 of the LR is embedded in an YXXQ motif and is responsible for the recruitment of STAT3 (Banks et al., 2000; Haan et al., 1999). Replacement of this residue by a serine in mice abolished STAT3 activation and as a result these knock- in mice became extremely obese (Bates et al., 2003), suggesting that STAT3 is a

Chapter 5: Biological functions and signal transduction of leptin

- 105 - major intracellular mediator of leptin signalling. Nonetheless, these mice do not show the infertility and reduced size that is seen in db/db mice, indicatory for the involvement of other signal transducers. Experiments with mutant LR constructs showed that deletion of the last tyrosine of the LR leads to a complete loss of STAT3 activation while STAT5 activity was still possible (Hekerman et al., 2005; White et al., 1997). Furthermore, leptin can stimulate proliferation of pancreatic β- cells and this effect may be mediated by activation of STAT5 (Islam et al., 2000). Convincingly, phosphorylation of STAT5 was recently demonstrated to regulate leptin signalling pathways in hypothalamic nuclei of mice (Gong et al., 2007). Phosporylated Y1077 and Y1138 were identified as major docking sites for STAT5 (Gong et al., 2007; Hekerman et al., 2005).

The PI3K pathway

Leptin binding to its receptor also activates some components of the insulin signalling cascade including IRS1/2 through phophorylated JAK2 (Elbatarny and Maurice, 2005). The IRS proteins bind to the regulatory unit p85 of PI3K to stimulate the catalytic domain. Recently, it was demonstrated that the association of the IRS4 adaptor to the P-Y1077 motif of the LR could also mediate PI3K recruitment (Wauman et al., 2007). Activated PI3K transforms PIP2 into PIP3, which stimulates PDK1 for the phosphorylation and activation of Akt. This will ultimately result in the induction of cAMP phosphodiesterase PDE3B and a reduction of cAMP levels. In the hypothalamus, regulation of cAMP has been shown to play a critical role in feeding and body weight, making the PI3K pathway an important component of leptin signalling in energy homeostasis (Gillard et al., 1998; Minokoshi et al., 2004; Shimizu-Albergine et al., 2001).

The MAPK pathway

Tyrosine 985 of the LR plays an important role in leptin-induced MAPK activation by acting as a docking site for the protein tyrosine phosphatase, SHP-2 (Li and Friedman, 1999). Since SHP-2 can also negatively regulate leptin-induced

Chapter 5: Biological functions and signal transduction of leptin

- 106 - JAK/STAT signalling, it appears that this phosphatase can have opposite functions (Carpenter et al., 1998; Li and Friedman, 1999; Zhang et al., 2004). SHP-2 is phosphorylated by JAK2 and forms a docking site for the adaptor protein Grb2 leading to activation of the ERK signalling cascade (Banks et al., 2000). Alternatively, ERK can also be activated by direct binding of SHP-2 to JAK2 (Bjorbaek et al., 2001). Leptin-triggered activation of MAPK was observed both centrally and peripherally. Regulation of calcium influxes involving MAPK activity was shown in hypothalamic neurons upon leptin stimulation (Jo et al., 2005). In peripheral tissues, leptin influences adipogenesis in preadipocytes and induces production of nitric oxide (NO) in white adipocytes via MAPK activation (Machinal- Quelin et al., 2002; Mehebik et al., 2005). Furthermore, leptin-induced MAPK is involved in full activation of the DNA binding of STAT3 by mediating serine phosphorylation at position S727 of STAT3 (O'Rourke and Shepherd, 2002).

IV. Negative regulation of leptin receptor signalling

LR signal modulation is reviewed in chapter 8.

Chapter 5: Biological functions and signal transduction of leptin

- 107 - V. References

Bado, A., Levasseur, S., Attoub, S., Kermorgant, S., Laigneau, J. P., Bortoluzzi, M. N., Moizo, L., Lehy, T., Guerre-Millo, M., Le Marchand-Brustel, Y., and Lewin, M. J. (1998). The stomach is a source of leptin. Nature 394, 790-793. Bahrenberg, G., Behrmann, I., Barthel, A., Hekerman, P., Heinrich, P. C., Joost, H. G., and Becker, W. (2002). Identification of the critical sequence elements in the cytoplasmic domain of leptin receptor isoforms required for Janus kinase/signal transducer and activator of transcription activation by receptor heterodimers. Mol Endocrinol 16, 859-872. Banks, A. S., Davis, S. M., Bates, S. H., and Myers, M. G., Jr. (2000). Activation of downstream signals by the long form of the leptin receptor. J Biol Chem 275, 14563-14572. Banks, W. A. (2004). The many lives of leptin. Peptides 25, 331-338. Banks, W. A., Kastin, A. J., Huang, W., Jaspan, J. B., and Maness, L. M. (1996). Leptin enters the brain by a saturable system independent of insulin. Peptides 17, 305-311. Bates, S. H., Stearns, W. H., Dundon, T. A., Schubert, M., Tso, A. W., Wang, Y., Banks, A. S., Lavery, H. J., Haq, A. K., Maratos-Flier, E., et al. (2003). STAT3 signalling is required for leptin regulation of energy balance but not reproduction. Nature 421, 856-859. Bennett, B. D., Solar, G. P., Yuan, J. Q., Mathias, J., Thomas, G. R., and Matthews, W. (1996). A role for leptin and its cognate receptor in hematopoiesis. Curr Biol 6, 1170-1180. Biener, E., Charlier, M., Ramanujan, V. K., Daniel, N., Eisenberg, A., Bjorbaek, C., Herman, B., Gertler, A., and Djiane, J. (2005). Quantitative FRET imaging of leptin receptor oligomerization kinetics in single cells. Biol Cell 97, 905-919. Bjorbaek, C., Buchholz, R. M., Davis, S. M., Bates, S. H., Pierroz, D. D., Gu, H., Neel, B. G., Myers, M. G., Jr., and Flier, J. S. (2001). Divergent roles of SHP-2 in ERK activation by leptin receptors. J Biol Chem 276, 4747-4755. Bjorbaek, C., Elmquist, J. K., Frantz, J. D., Shoelson, S. E., and Flier, J. S. (1998a). Identification of SOCS-3 as a potential mediator of central leptin resistance. Mol Cell 1, 619-625. Bjorbaek, C., Elmquist, J. K., Michl, P., Ahima, R. S., van Bueren, A., McCall, A. L., and Flier, J. S. (1998b). Expression of leptin receptor isoforms in rat brain microvessels. Endocrinology 139, 3485-3491. Bjorbaek, C., Uotani, S., da Silva, B., and Flier, J. S. (1997). Divergent signaling capacities of the long and short isoforms of the leptin receptor. J Biol Chem 272, 32686-32695. Bouloumie, A., Drexler, H. C., Lafontan, M., and Busse, R. (1998). Leptin, the product of Ob gene, promotes angiogenesis. Circ Res 83, 1059-1066. Broberger, C. (2005). Brain regulation of food intake and appetite: molecules and networks. J Intern Med 258, 301-327. Calle, E. E., Thun, M. J., Petrelli, J. M., Rodriguez, C., and Heath, C. W., Jr. (1999). Body-mass index and mortality in a prospective cohort of U.S. adults. N Engl J Med 341, 1097-1105. Campfield, L. A., Smith, F. J., Guisez, Y., Devos, R., and Burn, P. (1996). OB protein: A peripheral signal linking adiposity and central neural networks. Appetite 26, 302. Carpenter, L. R., Farruggella, T. J., Symes, A., Karow, M. L., Yancopoulos, G. D., and Stahl, N. (1998). Enhancing leptin response by preventing SH2-containing phosphatase 2 interaction with Ob receptor. Proc Natl Acad Sci U S A 95, 6061-6066. Cervero, A., Horcajadas, J. A., MartIn, J., Pellicer, A., and Simon, C. (2004). The leptin system during human endometrial receptivity and preimplantation development. J Clin Endocrinol Metab 89, 2442-2451. Challis, B. G., Coll, A. P., Yeo, G. S., Pinnock, S. B., Dickson, S. L., Thresher, R. R., Dixon, J., Zahn, D., Rochford, J. J., White, A., et al. (2004). Mice lacking pro-opiomelanocortin are sensitive to high-fat feeding but respond normally to the acute anorectic effects of peptide-YY(3-36). Proc Natl Acad Sci U S A 101, 4695-4700. Chehab, F. F., Lim, M. E., and Lu, R. (1996). Correction of the sterility defect in homozygous obese female mice by treatment with the human recombinant leptin. Nat Genet 12, 318-320. Chehab, F. F., Mounzih, K., Lu, R., and Lim, M. E. (1997). Early onset of reproductive function in normal female mice treated with leptin. Science 275, 88-90. Cheng, A., Uetani, N., Simoncic, P. D., Chaubey, V. P., Lee-Loy, A., McGlade, C. J., Kennedy, B. P., and Tremblay, M. L. (2002). Attenuation of leptin action and regulation of obesity by protein tyrosine phosphatase 1B. Dev Cell 2, 497-503.

Chapter 5: Biological functions and signal transduction of leptin

- 108 - Cioffi, J. A., Shafer, A. W., Zupancic, T. J., Smith-Gbur, J., Mikhail, A., Platika, D., and Snodgrass, H. R. (1996). Novel B219/OB receptor isoforms: possible role of leptin in hematopoiesis and reproduction. Nat Med 2, 585-589. Cohen, P., Zhao, C., Cai, X., Montez, J. M., Rohani, S. C., Feinstein, P., Mombaerts, P., and Friedman, J. M. (2001). Selective deletion of leptin receptor in neurons leads to obesity. J Clin Invest 108, 1113-1121. Considine, R. V., Sinha, M. K., Heiman, M. L., Kriauciunas, A., Stephens, T. W., Nyce, M. R., Ohannesian, J. P., Marco, C. C., McKee, L. J., Bauer, T. L., and et al. (1996). Serum immunoreactive-leptin concentrations in normal-weight and obese humans. N Engl J Med 334, 292-295. Couturier, C., and Jockers, R. (2003). Activation of the leptin receptor by a ligand-induced conformational change of constitutive receptor dimers. J Biol Chem 278, 26604-26611. Dieudonne, M. N., Machinal-Quelin, F., Serazin-Leroy, V., Leneveu, M. C., Pecquery, R., and Giudicelli, Y. (2002). Leptin mediates a proliferative response in human MCF7 breast cancer cells. Biochem Biophys Res Commun 293, 622-628. Ducy, P., Amling, M., Takeda, S., Priemel, M., Schilling, A. F., Beil, F. T., Shen, J., Vinson, C., Rueger, J. M., and Karsenty, G. (2000). Leptin inhibits bone formation through a hypothalamic relay: a central control of bone mass. Cell 100, 197-207. Elbatarny, H. S., and Maurice, D. H. (2005). Leptin-mediated activation of human platelets: involvement of a leptin receptor and phosphodiesterase 3A-containing cellular signaling complex. Am J Physiol Endocrinol Metab 289, E695-702. Elchebly, M., Payette, P., Michaliszyn, E., Cromlish, W., Collins, S., Loy, A. L., Normandin, D., Cheng, A., Himms-Hagen, J., Chan, C. C., et al. (1999). Increased insulin sensitivity and obesity resistance in mice lacking the protein tyrosine phosphatase-1B gene. Science 283, 1544-1548. El-Haschimi, K., Pierroz, D. D., Hileman, S. M., Bjorbaek, C., and Flier, J. S. (2000). Two defects contribute to hypothalamic leptin resistance in mice with diet-induced obesity. J Clin Invest 105, 1827-1832. El-Hefnawy, T., Ioffe, S., and Dym, M. (2000). Expression of the leptin receptor during germ cell development in the mouse testis. Endocrinology 141, 2624-2630. Faderl, S., Harris, D., Van, Q., Kantarjian, H. M., Talpaz, M., and Estrov, Z. (2003). Granulocyte- macrophage colony-stimulating factor (GM-CSF) induces antiapoptotic and proapoptotic signals in acute myeloid leukemia. Blood 102, 630-637. Fantuzzi, G., and Faggioni, R. (2000). Leptin in the regulation of immunity, inflammation, and hematopoiesis. J Leukoc Biol 68, 437-446. Farooqi, I. S., Jebb, S. A., Langmack, G., Lawrence, E., Cheetham, C. H., Prentice, A. M., Hughes, I. A., McCamish, M. A., and O'Rahilly, S. (1999). Effects of recombinant leptin therapy in a child with congenital leptin deficiency. N Engl J Med 341, 879-884. Fehmann, H. C., Peiser, C., Bode, H. P., Stamm, M., Staats, P., Hedetoft, C., Lang, R. E., and Goke, B. (1997). Leptin: a potent inhibitor of insulin secretion. Peptides 18, 1267-1273. Fei, H., Okano, H. J., Li, C., Lee, G. H., Zhao, C., Darnell, R., and Friedman, J. M. (1997). Anatomic localization of alternatively spliced leptin receptors (Ob-R) in mouse brain and other tissues. Proc Natl Acad Sci U S A 94, 7001-7005. Friedman, J. M., and Halaas, J. L. (1998). Leptin and the regulation of body weight in mammals. Nature 395, 763-770. Fruhbeck, G. (1999). Pivotal role of nitric oxide in the control of blood pressure after leptin administration. Diabetes 48, 903-908. Fruhbeck, G. (2001). A heliocentric view of leptin. Proc Nutr Soc 60, 301-318. Gainsford, T., Willson, T. A., Metcalf, D., Handman, E., McFarlane, C., Ng, A., Nicola, N. A., Alexander, W. S., and Hilton, D. J. (1996). Leptin can induce proliferation, differentiation, and functional activation of hemopoietic cells. Proc Natl Acad Sci U S A 93, 14564-14568. Garofalo, C., Koda, M., Cascio, S., Sulkowska, M., Kanczuga-Koda, L., Golaszewska, J., Russo, A., Sulkowski, S., and Surmacz, E. (2006). Increased expression of leptin and the leptin receptor as a marker of breast cancer progression: possible role of obesity-related stimuli. Clin Cancer Res 12, 1447-1453. Garofalo, C., and Surmacz, E. (2006). Leptin and cancer. J Cell Physiol 207, 12-22. Ge, H., Huang, L., Pourbahrami, T., and Li, C. (2002). Generation of soluble leptin receptor by ectodomain shedding of membrane-spanning receptors in vitro and in vivo. J Biol Chem 277, 45898-45903.

Chapter 5: Biological functions and signal transduction of leptin

- 109 - Gillard, E. R., Khan, A. M., Grewal, R. S., Mouradi, B., Wolfsohn, S. D., and Stanley, B. G. (1998). The second messenger cAMP elicits eating by an anatomically specific action in the perifornical hypothalamus. J Neurosci 18, 2646-2652. Gong, Y., Ishida-Takahashi, R., Villanueva, E. C., Fingar, D. C., Munzberg, H., and Myers, M. G., Jr. (2007). The long form of the leptin receptor regulates STAT5 and ribosomal protein S6 via alternate mechanisms. J Biol Chem 282, 31019-31027. Gruaz, N. M., Lalaoui, M., Pierroz, D. D., Englaro, P., Sizonenko, P. C., Blum, W. F., and Aubert, M. L. (1998). Chronic administration of leptin into the lateral ventricle induces sexual maturation in severely food-restricted female rats. J Neuroendocrinol 10, 627-633. Haan, S., Hemmann, U., Hassiepen, U., Schaper, F., Schneider-Mergener, J., Wollmer, A., Heinrich, P. C., and Grotzinger, J. (1999). Characterization and binding specificity of the monomeric STAT3-SH2 domain. J Biol Chem 274, 1342-1348. Halaas, J. L., Boozer, C., Blair-West, J., Fidahusein, N., Denton, D. A., and Friedman, J. M. (1997). Physiological response to long-term peripheral and central leptin infusion in lean and obese mice. Proc Natl Acad Sci U S A 94, 8878-8883. Halaas, J. L., Gajiwala, K. S., Maffei, M., Cohen, S. L., Chait, B. T., Rabinowitz, D., Lallone, R. L., Burley, S. K., and Friedman, J. M. (1995). Weight-reducing effects of the plasma protein encoded by the obese gene. Science 269, 543-546. Hardwick, J. C., Van Den Brink, G. R., Offerhaus, G. J., Van Deventer, S. J., and Peppelenbosch, M. P. (2001). Leptin is a growth factor for colonic epithelial cells. Gastroenterology 121, 79-90. Harigaya, A., Nagashima, K., Nako, Y., and Morikawa, A. (1997). Relationship between concentration of serum leptin and fetal growth. J Clin Endocrinol Metab 82, 3281-3284. Hekerman, P., Zeidler, J., Bamberg-Lemper, S., Knobelspies, H., Lavens, D., Tavernier, J., Joost, H. G., and Becker, W. (2005). Pleiotropy of leptin receptor signalling is defined by distinct roles of the intracellular tyrosines. Febs J 272, 109-119. Heymsfield, S. B., Greenberg, A. S., Fujioka, K., Dixon, R. M., Kushner, R., Hunt, T., Lubina, J. A., Patane, J., Self, B., Hunt, P., and McCamish, M. (1999). Recombinant leptin for weight loss in obese and lean adults: a randomized, controlled, dose-escalation trial. Jama 282, 1568-1575. Hileman, S. M., Pierroz, D. D., Masuzaki, H., Bjorbaek, C., El-Haschimi, K., Banks, W. A., and Flier, J. S. (2002). Characterizaton of short isoforms of the leptin receptor in rat cerebral microvessels and of brain uptake of leptin in mouse models of obesity. Endocrinology 143, 775-783. Holness, M. J., Munns, M. J., and Sugden, M. C. (1999). Current concepts concerning the role of leptin in reproductive function. Mol Cell Endocrinol 157, 11-20. Horiguchi, A., Sumitomo, M., Asakuma, J., Asano, T., Zheng, R., Nanus, D. M., and Hayakawa, M. (2006). Leptin promotes invasiveness of murine renal cancer cells via extracellular signal- regulated kinases and rho dependent pathway. J Urol 176, 1636-1641. Howard, J. K., Cave, B. J., Oksanen, L. J., Tzameli, I., Bjorbaek, C., and Flier, J. S. (2004). Enhanced leptin sensitivity and attenuation of diet-induced obesity in mice with haploinsufficiency of Socs3. Nat Med 10, 734-738. Howard, J. K., Lord, G. M., Matarese, G., Vendetti, S., Ghatei, M. A., Ritter, M. A., Lechler, R. I., and Bloom, S. R. (1999). Leptin protects mice from starvation-induced lymphoid atrophy and increases thymic cellularity in ob/ob mice. J Clin Invest 104, 1051-1059. Hu, X., Juneja, S. C., Maihle, N. J., and Cleary, M. P. (2002). Leptin--a growth factor in normal and malignant breast cells and for normal mammary gland development. J Natl Cancer Inst 94, 1704-1711. Huang, L., Wang, Z., and Li, C. (2001). Modulation of circulating leptin levels by its soluble receptor. J Biol Chem 276, 6343-6349. Hukshorn, C. J., Saris, W. H., Westerterp-Plantenga, M. S., Farid, A. R., Smith, F. J., and Campfield, L. A. (2000). Weekly subcutaneous pegylated recombinant native human leptin (PEG-OB) administration in obese men. J Clin Endocrinol Metab 85, 4003-4009. Ishikawa, M., Kitayama, J., and Nagawa, H. (2004). Enhanced expression of leptin and leptin receptor (OB-R) in human breast cancer. Clin Cancer Res 10, 4325-4331. Islam, M. S., Sjoholm, A., and Emilsson, V. (2000). Fetal pancreatic islets express functional leptin receptors and leptin stimulates proliferation of fetal islet cells. Int J Obes Relat Metab Disord 24, 1246-1253. Iversen, P. O., Drevon, C. A., and Reseland, J. E. (2002). Prevention of leptin binding to its receptor suppresses rat leukemic cell growth by inhibiting angiogenesis. Blood 100, 4123-4128. Jo, Y. H., Chen, Y. J., Chua, S. C., Jr., Talmage, D. A., and Role, L. W. (2005). Integration of endocannabinoid and leptin signaling in an appetite-related neural circuit. Neuron 48, 1055- 1066. Chapter 5: Biological functions and signal transduction of leptin

- 110 - Kawamura, K., Sato, N., Fukuda, J., Kodama, H., Kumagai, J., Tanikawa, H., Nakamura, A., and Tanaka, T. (2002). Leptin promotes the development of mouse preimplantation embryos in vitro. Endocrinology 143, 1922-1931. Kloek, C., Haq, A. K., Dunn, S. L., Lavery, H. J., Banks, A. S., and Myers, M. G., Jr. (2002). Regulation of Jak kinases by intracellular leptin receptor sequences. J Biol Chem 277, 41547- 41555. Konopleva, M., Mikhail, A., Estrov, Z., Zhao, S., Harris, D., Sanchez-Williams, G., Kornblau, S. M., Dong, J., Kliche, K. O., Jiang, S., et al. (1999). Expression and function of leptin receptor isoforms in myeloid leukemia and myelodysplastic syndromes: proliferative and anti-apoptotic activities. Blood 93, 1668-1676. Kopelman, P. G. (2000). Obesity as a medical problem. Nature 404, 635-643. La Cava, A., and Matarese, G. (2004). The weight of leptin in immunity. Nat Rev Immunol 4, 371- 379. Lam, Q. L., Liu, S., Cao, X., and Lu, L. (2006). Involvement of leptin signaling in the survival and maturation of bone marrow-derived dendritic cells. Eur J Immunol 36, 3118-3130. Li, C., and Friedman, J. M. (1999). Leptin receptor activation of SH2 domain containing protein tyrosine phosphatase 2 modulates Ob receptor signal transduction. Proc Natl Acad Sci U S A 96, 9677-9682. Lord, G. M., Matarese, G., Howard, J. K., Baker, R. J., Bloom, S. R., and Lechler, R. I. (1998). Leptin modulates the T-cell immune response and reverses starvation-induced immunosuppression. Nature 394, 897-901. Maamra, M., Bidlingmaier, M., Postel-Vinay, M. C., Wu, Z., Strasburger, C. J., and Ross, R. J. (2001). Generation of human soluble leptin receptor by proteolytic cleavage of membrane- anchored receptors. Endocrinology 142, 4389-4393. Machinal-Quelin, F., Dieudonne, M. N., Leneveu, M. C., Pecquery, R., and Giudicelli, Y. (2002). Proadipogenic effect of leptin on rat preadipocytes in vitro: activation of MAPK and STAT3 signaling pathways. Am J Physiol Cell Physiol 282, C853-863. Maffei, M., Halaas, J., Ravussin, E., Pratley, R. E., Lee, G. H., Zhang, Y., Fei, H., Kim, S., Lallone, R., Ranganathan, S., and et al. (1995). Leptin levels in human and rodent: measurement of plasma leptin and ob RNA in obese and weight-reduced subjects. Nat Med 1, 1155-1161. Mancuso, P., Gottschalk, A., Phare, S. M., Peters-Golden, M., Lukacs, N. W., and Huffnagle, G. B. (2002). Leptin-deficient mice exhibit impaired host defense in Gram-negative pneumonia. J Immunol 168, 4018-4024. Martin-Romero, C., Santos-Alvarez, J., Goberna, R., and Sanchez-Margalet, V. (2000). Human leptin enhances activation and proliferation of human circulating T lymphocytes. Cell Immunol 199, 15- 24. Masuzaki, H., Ogawa, Y., Sagawa, N., Hosoda, K., Matsumoto, T., Mise, H., Nishimura, H., Yoshimasa, Y., Tanaka, I., Mori, T., and Nakao, K. (1997). Nonadipose tissue production of leptin: leptin as a novel placenta-derived hormone in humans. Nat Med 3, 1029-1033. Matarese, G., Carrieri, P. B., La Cava, A., Perna, F., Sanna, V., De Rosa, V., Aufiero, D., Fontana, S., and Zappacosta, S. (2005). Leptin increase in multiple sclerosis associates with reduced number of CD4(+)CD25+ regulatory T cells. Proc Natl Acad Sci U S A 102, 5150-5155. Matarese, G., Leiter, E. H., and La Cava, A. (2007). Leptin in autoimmunity: many questions, some answers. Tissue Antigens 70, 87-95. McCowen, K. C., Chow, J. C., and Smith, R. J. (1998). Leptin signaling in the hypothalamus of normal rats in vivo. Endocrinology 139, 4442-4447. McDuffie, J. R., Riggs, P. A., Calis, K. A., Freedman, R. J., Oral, E. A., DePaoli, A. M., and Yanovski, J. A. (2004). Effects of exogenous leptin on satiety and satiation in patients with lipodystrophy and leptin insufficiency. J Clin Endocrinol Metab 89, 4258-4263. Mehebik, N., Jaubert, A. M., Sabourault, D., Giudicelli, Y., and Ribiere, C. (2005). Leptin-induced nitric oxide production in white adipocytes is mediated through PKA and MAP kinase activation. Am J Physiol Cell Physiol 289, C379-387. Minokoshi, Y., Alquier, T., Furukawa, N., Kim, Y. B., Lee, A., Xue, B., Mu, J., Foufelle, F., Ferre, P., Birnbaum, M. J., et al. (2004). AMP-kinase regulates food intake by responding to hormonal and nutrient signals in the hypothalamus. Nature 428, 569-574. Montague, C. T., Farooqi, I. S., Whitehead, J. P., Soos, M. A., Rau, H., Wareham, N. J., Sewter, C. P., Digby, J. E., Mohammed, S. N., Hurst, J. A., et al. (1997). Congenital leptin deficiency is associated with severe early-onset obesity in humans. Nature 387, 903-908.

Chapter 5: Biological functions and signal transduction of leptin

- 111 - Mori, H., Hanada, R., Hanada, T., Aki, D., Mashima, R., Nishinakamura, H., Torisu, T., Chien, K. R., Yasukawa, H., and Yoshimura, A. (2004). Socs3 deficiency in the brain elevates leptin sensitivity and confers resistance to diet-induced obesity. Nat Med 10, 739-743. Munzberg, H., Bjornholm, M., Bates, S. H., and Myers, M. G., Jr. (2005). Leptin receptor action and mechanisms of leptin resistance. Cell Mol Life Sci 62, 642-652. Munzberg, H., Flier, J. S., and Bjorbaek, C. (2004). Region-specific leptin resistance within the hypothalamus of diet-induced obese mice. Endocrinology 145, 4880-4889. Murakami, T., Yamashita, T., Iida, M., Kuwajima, M., and Shima, K. (1997). A short form of leptin receptor performs signal transduction. Biochem Biophys Res Commun 231, 26-29. Muraoka, O., Xu, B., Tsurumaki, T., Akira, S., Yamaguchi, T., and Higuchi, H. (2003). Leptin-induced transactivation of NPY gene promoter mediated by JAK1, JAK2 and STAT3 in the neural cell lines. Neurochem Int 42, 591-601. O'Rourke, L., and Shepherd, P. R. (2002). Biphasic regulation of extracellular-signal-regulated protein kinase by leptin in macrophages: role in regulating STAT3 Ser727 phosphorylation and DNA binding. Biochem J 364, 875-879. Ozata, M., Ozdemir, I. C., and Licinio, J. (1999). Human leptin deficiency caused by a missense mutation: multiple endocrine defects, decreased sympathetic tone, and immune system dysfunction indicate new targets for leptin action, greater central than peripheral resistance to the effects of leptin, and spontaneous correction of leptin-mediated defects. J Clin Endocrinol Metab 84, 3686-3695. Peelman, F., Iserentant, H., De Smet, A. S., Vandekerckhove, J., Zabeau, L., and Tavernier, J. (2006). Mapping of binding site III in the leptin receptor and modeling of a hexameric leptin.leptin receptor complex. J Biol Chem 281, 15496-15504. Peelman, F., Waelput, W., Iserentant, H., Lavens, D., Eyckerman, S., Zabeau, L., and Tavernier, J. (2004). Leptin: linking adipocyte metabolism with cardiovascular and autoimmune diseases. Prog Lipid Res 43, 283-301. Ramos, M. P., Rueda, B. R., Leavis, P. C., and Gonzalez, R. R. (2005). Leptin serves as an upstream activator of an obligatory signaling cascade in the embryo-implantation process. Endocrinology 146, 694-701. Rock, F. L., Altmann, S. W., van Heek, M., Kastelein, R. A., and Bazan, J. F. (1996). The leptin haemopoietic cytokine fold is stabilized by an intrachain disulfide bond. Horm Metab Res 28, 649-652. Ryan, N. K., Woodhouse, C. M., Van der Hoek, K. H., Gilchrist, R. B., Armstrong, D. T., and Norman, R. J. (2002). Expression of leptin and its receptor in the murine ovary: possible role in the regulation of oocyte maturation. Biol Reprod 66, 1548-1554. Sakaguchi, S. (2004). Naturally arising CD4+ regulatory t cells for immunologic self-tolerance and negative control of immune responses. Annu Rev Immunol 22, 531-562. Sanchez-Margalet, V., Martin-Romero, C., Gonzalez-Yanes, C., Goberna, R., Rodriguez-Bano, J., and Muniain, M. A. (2002). Leptin receptor (Ob-R) expression is induced in peripheral blood mononuclear cells by in vitro activation and in vivo in HIV-infected patients. Clin Exp Immunol 129, 119-124. Shimizu-Albergine, M., Ippolito, D. L., and Beavo, J. A. (2001). Downregulation of fasting-induced cAMP response element-mediated gene induction by leptin in neuropeptide Y neurons of the arcuate nucleus. J Neurosci 21, 1238-1246. Sierra-Honigmann, M. R., Nath, A. K., Murakami, C., Garcia-Cardena, G., Papapetropoulos, A., Sessa, W. C., Madge, L. A., Schechner, J. S., Schwabb, M. B., Polverini, P. J., and Flores- Riveros, J. R. (1998). Biological action of leptin as an angiogenic factor. Science 281, 1683- 1686. Stattin, P., Soderberg, S., Hallmans, G., Bylund, A., Kaaks, R., Stenman, U. H., Bergh, A., and Olsson, T. (2001). Leptin is associated with increased prostate cancer risk: a nested case- referent study. J Clin Endocrinol Metab 86, 1341-1345. Strader, A. D., and Woods, S. C. (2005). Gastrointestinal hormones and food intake. Gastroenterology 128, 175-191. Tartaglia, L. A., Dembski, M., Weng, X., Deng, N., Culpepper, J., Devos, R., Richards, G. J., Campfield, L. A., Clark, F. T., Deeds, J., et al. (1995). Identification and expression cloning of a leptin receptor, OB-R. Cell 83, 1263-1271. Tian, Z., Sun, R., Wei, H., and Gao, B. (2002). Impaired natural killer (NK) cell activity in leptin receptor deficient mice: leptin as a critical regulator in NK cell development and activation. Biochem Biophys Res Commun 298, 297-302.

Chapter 5: Biological functions and signal transduction of leptin

- 112 - Tups, A., Ellis, C., Moar, K. M., Logie, T. J., Adam, C. L., Mercer, J. G., and Klingenspor, M. (2004). Photoperiodic regulation of leptin sensitivity in the Siberian hamster, Phodopus sungorus, is reflected in arcuate nucleus SOCS-3 (suppressor of cytokine signaling) gene expression. Endocrinology 145, 1185-1193. Umemoto, Y., Tsuji, K., Yang, F. C., Ebihara, Y., Kaneko, A., Furukawa, S., and Nakahata, T. (1997). Leptin stimulates the proliferation of murine myelocytic and primitive hematopoietic progenitor cells. Blood 90, 3438-3443. Uotani, S., Bjorbaek, C., Tornoe, J., and Flier, J. S. (1999). Functional properties of leptin receptor isoforms: internalization and degradation of leptin and ligand-induced receptor downregulation. Diabetes 48, 279-286. Wang, J., Liu, R., Hawkins, M., Barzilai, N., and Rossetti, L. (1998). A nutrient-sensing pathway regulates leptin gene expression in muscle and fat. Nature 393, 684-688. Wauman, J., De Smet, A. S., Catteeuw, D., Belsham, D., and Tavernier, J. (2007). Insulin Receptor Substrate 4 Couples the Leptin Receptor to Multiple Signaling Pathways. Mol Endocrinol 22, 965-977. Welt, C. K., Chan, J. L., Bullen, J., Murphy, R., Smith, P., DePaoli, A. M., Karalis, A., and Mantzoros, C. S. (2004). Recombinant human leptin in women with hypothalamic amenorrhea. N Engl J Med 351, 987-997. White, D. W., Kuropatwinski, K. K., Devos, R., Baumann, H., and Tartaglia, L. A. (1997). Leptin receptor (OB-R) signaling. Cytoplasmic domain mutational analysis and evidence for receptor homo-oligomerization. J Biol Chem 272, 4065-4071. White, D. W., and Tartaglia, L. A. (1999). Evidence for ligand-independent homo-oligomerization of leptin receptor (OB-R) isoforms: a proposed mechanism permitting productive long-form signaling in the presence of excess short-form expression. J Cell Biochem 73, 278-288. Yang, G., Ge, H., Boucher, A., Yu, X., and Li, C. (2004). Modulation of direct leptin signaling by soluble leptin receptor. Mol Endocrinol 18, 1354-1362. Yu, W. H., Walczewska, A., Karanth, S., and McCann, S. M. (1997). Nitric oxide mediates leptin- induced luteinizing hormone-releasing hormone (LHRH) and LHRH and leptin-induced LH release from the pituitary gland. Endocrinology 138, 5055-5058. Zabeau, L., Defeau, D., Iserentant, H., Vandekerckhove, J., Peelman, F., and Tavernier, J. (2005). Leptin receptor activation depends on critical cysteine residues in its fibronectin type III subdomains. J Biol Chem 280, 22632-22640. Zabeau, L., Defeau, D., Van der Heyden, J., Iserentant, H., Vandekerckhove, J., and Tavernier, J. (2004). Functional analysis of leptin receptor activation using a Janus kinase/signal transducer and activator of transcription complementation assay. Mol Endocrinol 18, 150-161. Zabeau, L., Lavens, D., Peelman, F., Eyckerman, S., Vandekerckhove, J., and Tavernier, J. (2003). The ins and outs of leptin receptor activation. FEBS Lett 546, 45-50. Zarkesh-Esfahani, H., Pockley, G., Metcalfe, R. A., Bidlingmaier, M., Wu, Z., Ajami, A., Weetman, A. P., Strasburger, C. J., and Ross, R. J. (2001). High-dose leptin activates human leukocytes via receptor expression on monocytes. J Immunol 167, 4593-4599. Zhang, E. E., Chapeau, E., Hagihara, K., and Feng, G. S. (2004). Neuronal Shp2 tyrosine phosphatase controls energy balance and metabolism. Proc Natl Acad Sci U S A 101, 16064- 16069. Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L., and Friedman, J. M. (1994). Positional cloning of the mouse obese gene and its human homologue. Nature 372, 425-432.

Chapter 5: Biological functions and signal transduction of leptin

- 113 -

Chapter 5: Biological functions and signal transduction of leptin

- 114 - Scope of the thesis

Since the discovery of the SOCS family only a decade ago, important advances have been made in understanding the mode of action by which these regulators attenuate cytokine signalling. However, unresolved issues include the involvement of SOCS in the modulation of specific pathways and the mechanisms controlling stability and regulation of these proteins. The importance of this is underscored by the contribution of inappropriately regulated SOCS activity to several pathologies including growth related diseases, cancer and inflammatory diseases. In this thesis, we aimed at further elucidating the mechanisms underlying SOCS regulation, thereby making extensive use of the mammalian two-hybrid MAPPIT technique. MAPPIT allows analysis of protein-protein interactions in a physiological context and is well suited for examining signal transduction pathways since it is capable of identifying interactions that are transient and weak or that depend on tyrosine phosphorylation. Throughout this thesis, several adaptations of the MAPPIT strategy were developed and applied in order to increase the sensitivity of the system and to expand the technology to different cellular backgrounds.

The pivotal role of leptin in body weight regulation is demonstrated by the extreme obese phenotypes observed in mice containing defects in either leptin or its receptor. The importance of a strict control of leptin activity is underscored by the state of leptin resistance commonly found in obesity which may be caused by aberrant attenuation of hypothalamic leptin signalling. A first part of this work focuses on the role of SOCS proteins in the modulation of LR signal transduction. SOCS3 is considered as a major inhibitor of leptin signalling and is proposed to be involved in the development of this leptin resistance. Still, expression of other SOCS members is induced upon leptin stimulation. A first objective was to define if other SOCS proteins are recruited to the activated LR and thereby contribute to modulation of leptin responses. Using MAPPIT and peptide affinity chromatography we studied interactions between the LR and SOCS in greater detail and identified two novel interactions of SOCS with phosphorylated tyrosine motifs. We further

- 115 - analysed the differential binding mode of these interaction partners and the functionality of the interactions (chapter 6). Beside its effect on hypothalamic body weight regulation, leptin is also involved in a broad range of peripheral functions including immunity, haematopoiesis and reproduction and may also contribute to the development of disorders like auto- immune diseases. The role of leptin in these peripheral effects is far from clear. Since different inconsistencies concerning leptin signalling in haematopoietic cells remain, we investigated signalling events mediated by the LR using a novel MAPPIT variant, βc-MAPPIT, which allows analysis in a haematopoietic background. This way, we characterised several interactions (including SOCS proteins) with the LR that are likely relevant for haematopoietic leptin signalling (chapter 7).

The essential role of the SOCS box was demonstrated by the defective phenotypes of transgenic mice expressing SOCS box deletion mutants of SOCS1 and SOCS3 (Boyle et al., 2007; Zhang et al., 2001). Via Elongin B/C recruitment, the SOCS box links associated molecules to E3 ligase activity and subsequent proteasomal degradation (Kamura et al., 1998; Zhang et al., 1999). The SOCS box can also function as an adaptor, coupling SOCS actions to other downstream signalling pathways including the MAPK pathway. Furthermore, this domain was found to be involved in the regulation of SOCS protein levels. The second part of this thesis deals with the versatile effects of the SOCS box on SOCS functions and cytokine signalling. Increasing evidence makes clear that SOCS proteins not only act as inhibitors of cytokine responses but exert broader regulatory mechanisms. In particular for SOCS2, data indicate that it can have both inhibitory and stimulatory effects on cytokine responses. This dual effect led to the speculation that SOCS2 interferes with the inhibition of other SOCS proteins. We investigated this hypothesis in the context of different cytokine pathways by using functional assays. MAPPIT and co-immunoprecipitation experiments were performed to study the interactions between SOCS2 and other SOCS proteins. The contribution of the SOCS box domain and the involvement of proteasomal degradation in this SOCS cross- modulation were also examined. Finally, we tested whether, in analogy to SOCS2, other SOCS members exerted comparable interfering characteristics (chapter 9). As previous studies reported that the SOCS box of CIS is essential for interaction with receptor motifs (Lavens et al., 2007), we aimed to clarify the role of the SOCS

- 116 - box in substrate interaction of SOCS proteins. More specifically, we evaluated the involvement of Elongin B/C recruitment on substrate binding and functionality of CIS. We pursued by testing if this SOCS box-dependency is unique for CIS. Based on models of CIS, a structural basis was provided for this regulatory mechanism controlling SH2 domain function (chapter 10). Taken together, the SOCS box domain emerges as a versatile regulatory module controlling SOCS activity and cytokine signal transduction pathways at multiple levels (reviewed in chapter 11).

References

Boyle, K., Egan, P., Rakar, S., Willson, T. A., Wicks, I. P., Metcalf, D., Hilton, D. J., Nicola, N. A., Alexander, W. S., Roberts, A. W., and Robb, L. (2007). The SOCS box of suppressor of cytokine signaling-3 contributes to the control of G-CSF responsiveness in vivo. Blood. Kamura, T., Sato, S., Haque, D., Liu, L., Kaelin, W. G., Jr., Conaway, R. C., and Conaway, J. W. (1998). The Elongin BC complex interacts with the conserved SOCS-box motif present in members of the SOCS, ras, WD-40 repeat, and ankyrin repeat families. Genes Dev 12, 3872- 3881. Lavens, D., Ulrichts, P., Catteeuw, D., Gevaert, K., Vandekerckhove, J., Peelman, F., Eyckerman, S., and Tavernier, J. (2007). The C-terminus of CIS defines its interaction pattern. Biochem J 401, 257-267. Zhang, J. G., Farley, A., Nicholson, S. E., Willson, T. A., Zugaro, L. M., Simpson, R. J., Moritz, R. L., Cary, D., Richardson, R., Hausmann, G., et al. (1999). The conserved SOCS box motif in suppressors of cytokine signaling binds to elongins B and C and may couple bound proteins to proteasomal degradation. Proc Natl Acad Sci U S A 96, 2071-2076. Zhang, J. G., Metcalf, D., Rakar, S., Asimakis, M., Greenhalgh, C. J., Willson, T. A., Starr, R., Nicholson, S. E., Carter, W., Alexander, W. S., et al. (2001). The SOCS box of suppressor of cytokine signaling-1 is important for inhibition of cytokine action in vivo. Proc Natl Acad Sci U S A 98, 13261-13265.

- 117 -

- 118 -

Part II : The role of SOCS proteins in regulation of LR signalling

- 119 -

- 120 - CHAPTER 6: Interaction pattern of CIS and SOCS2 with the leptin receptor

I. Introduction

SOCS3 is considered to be one of the main players in the attenuation of leptin signalling and is suggested to underlie the development of leptin resistance commonly found in obesity (Bjorbaek et al., 1999; Bjorbaek et al., 1998). Yet, expression of other SOCS members, including SOCS1, SOCS2 and CIS, is also induced in response to leptin (Emilsson et al., 1999; Lavens et al., 2006; Motta et al., 2004). Within the context of this PhD project, the MAPPIT data set demonstrating the interaction of CIS and SOCS2 with the LR was generated and the interactions were confirmed with biochemical methods. Surprisingly, the closely related proteins CIS and SOCS2 display differential binding capacities: both molecules bind to phospho (P)-Y1077, but only CIS appears to interact with the P- Y985 of the LR. CIS and SOCS2 are believed to mainly inhibit STAT5 signalling. Recently, phosporylated Y1077 of the LR was revealed as a major docking site for STAT5 (Gong et al., 2007). We report here that SOCS2 can block the binding of the SH2 domain of STAT5a at this tyrosine. Surprisingly, we observed that SOCS2 interferes with CIS association at P-Y1077 but also at the Y985 position, although SOCS2 itself does not interact with this tyrosine. We further examined this observation and found that SOCS2 could interact with CIS and that the interfering effect depends on Elongin B/C recruitment to SOCS2. This suggests that proteasomal degradation of CIS might be involved in this inhibitory mechanism. Besides the well-established inhibitory effect of SOCS3 on hypothalamic leptin signalling, other SOCS proteins bind the LR and most probably are involved in the modulation of leptin signalling in other cell types.

Chapter 6: Interaction pattern of CIS and SOCS2 with the leptin receptor

- 121 -

II. Article: A complex interaction pattern of CIS and SOCS2 with the leptin receptor. Published in Journal of Cell Sience, 2006.

III. References

Bjorbaek, C., El-Haschimi, K., Frantz, J. D., and Flier, J. S. (1999). The role of SOCS-3 in leptin signaling and leptin resistance. J Biol Chem 274, 30059-30065. Bjorbaek, C., Elmquist, J. K., Frantz, J. D., Shoelson, S. E., and Flier, J. S. (1998). Identification of SOCS-3 as a potential mediator of central leptin resistance. Mol Cell 1, 619-625. Emilsson, V., Arch, J. R., de Groot, R. P., Lister, C. A., and Cawthorne, M. A. (1999). Leptin treatment increases suppressors of cytokine signaling in central and peripheral tissues. FEBS Lett 455, 170-174. Gong, Y., Ishida-Takahashi, R., Villanueva, E. C., Fingar, D. C., Munzberg, H., and Myers, M. G., Jr. (2007). The long form of the leptin receptor regulates STAT5 and ribosomal protein S6 via alternate mechanisms. J Biol Chem 282, 31019-31027. Lavens, D., Montoye, T., Piessevaux, J., Zabeau, L., Vandekerckhove, J., Gevaert, K., Becker, W., Eyckerman, S., and Tavernier, J. (2006). A complex interaction pattern of CIS and SOCS2 with the leptin receptor. J Cell Sci 119, 2214-2224. Motta, M., Accornero, P., and Baratta, M. (2004). Leptin and prolactin modulate the expression of SOCS-1 in association with interleukin-6 and tumor necrosis factor-alpha in mammary cells: a role in differentiated secretory epithelium. Regul Pept 121, 163-170.

Chapter 6: Interaction pattern of CIS and SOCS2 with the leptin receptor

- 122 - 2214 Research Article A complex interaction pattern of CIS and SOCS2 with the leptin receptor

Delphine Lavens1, Tony Montoye1, Julie Piessevaux1, Lennart Zabeau1, Joël Vandekerckhove1, Kris Gevaert1, Walter Becker2, Sven Eyckerman1 and Jan Tavernier1,* 1Department of Medical Protein Research, Faculty of Medicine and Health Sciences, Flanders Interuniversity Institute for Biotechnology, VIB09, Ghent University, A. Baertsoenkaai 3, 9000 Ghent, Belgium 2Institute of Pharmacology and Toxicology, Medical Faculty of the RWTH Aachen University, 52074 Aachen, Germany *Author for correspondence (e-mail: [email protected])

Accepted 20 February 2006 Journal of Cell Science 119, 2214-2224 Published by The Company of Biologists 2006 doi:10.1242/jcs.02947

Summary Hypothalamic leptin receptor signalling plays a central role in the cytosolic domain of the leptin receptor. SOCS2 only in weight regulation by controlling fat storage and energy interacts with the Y1077 motif, but with higher binding expenditure. In addition, leptin also has direct effects on affinity and can interfere with CIS and STAT5a prey peripheral cell types involved in regulation of diverse body recruitment at this site. Furthermore, although SOCS2 functions including immune response, bone formation and does not associate with Y985 of the leptin receptor, we find reproduction. Previous studies have demonstrated the that SOCS2 can block interaction of CIS with this position. important role of SOCS3 (suppressor of cytokine signalling This unexpected interference can be explained by the direct 3) in leptin physiology. Here, we show that CIS (cytokine- binding of SOCS2 on the CIS SOCS box, whereby elongin inducible SH2 protein) and SOCS2 can also interact with B/C recruitment is crucial to suppress CIS activity. the leptin receptor. Using MAPPIT (mammalian protein- protein interaction trap), a cytokine receptor-based two- hybrid method operating in intact cells, we show specific Key words: Leptin receptor, SOCS proteins, Signalling, Cross- binding of CIS with the conserved Y985 and Y1077 motifs regulation

Introduction The activated receptor recruits STAT3 molecules through their Leptin plays a major role in the regulation of energy SH2 domain (Baumann et al., 1996; Vaisse et al., 1996), and, Journal of Cell Science homeostasis and food intake. Produced mainly in white after tyrosine phosphorylation, they translocate as homodimers adipose tissue (Zhang et al., 1994), it translocates through the to the nucleus to induce specific gene expression. blood-brain-barrier to target the leptin receptor (LR) in the Knock-in mice containing a Y1138S mutation reveal a hypothalamus. Although six LR splice variants can exist, the severe obese phenotype but do not show the infertility and LR isoform with an extended cytoplasmic domain (LRlo) is the reduced size that occurs in db/db mice (Bates et al., 2003). predominant signalling variant (Ghilardi et al., 1996). A short This observation, together with the wide range of leptin- variant (LRsh) is abundantly expressed in the choroid plexus, responsive cell types, suggests that alternative signalling brain microvessels, lung and kidney and may participate in pathways must exist. Leptin-dependent activation of STAT1 leptin transport across the blood-brain barrier (Bjorbaek et al., and STAT5 was demonstrated in vitro (Baumann et al., 1996; 1998b; Boado et al., 1998). Next to its effect in weight Hekerman et al., 2005). In addition, recruitment of SH2- regulation, leptin is also involved in a broad range of other containing phosphatase SHP-2 to the phosphorylated Y985 functions including reproduction, bone formation, growth, position is responsible for leptin-induced MAPK signalling, immune regulation, angiogenesis and glucose and insulin although an additional pathway for activation of this signalling metabolism. cascade directly by JAK2 has been suggested (Bjorbaek et al., The LR was addressed to the type I cytokine receptor family 2001). Leptin also induces phosphorylation of IRS-1 and IRS- based on sequence homology (Tartaglia et al., 1995). It is 2 (Duan et al., 2004) and activates phosphatidylinositol 3- closely related to the gp130 receptor family, especially gp130, kinase (PI-3K), as demonstrated in several cell lines (Cohen oncostatin M (OSM) and leukaemia inhibitory factor (LIF) et al., 1996; Kim et al., 2000). A role for JAK2 in activation receptors, and to the G-CSF receptor (granulocyte-colony of the PI-3K pathway through the JAK2-interacting protein stimulating factor) (Zabeau et al., 2003). Leptin typically SH2-B and recruitment of IRS-1 or IRS-2 was also reported signals through the JAK-STAT pathway. An overview of LR (Duan et al., 2004). SH2-B and leptin-activated hypothalamic signalling events is shown in Fig. 1A. The LR carries three PI-3K both appear essential for weight regulation (Niswender conserved tyrosines in its cytoplasmic tail (positions Y985, et al., 2001; Ren et al., 2005). Recently, an inhibitory effect Y1077 and Y1138 in the murine LR), whereby the membrane of leptin on hypothalamic AMPK (AMP-activated protein distal tyrosine Y1138 is embedded in a STAT3 (signal kinase) activity was reported. AMPK is proposed to act as a transducer and activator of transcription) recruitment motif. ‘fuel gauge’ to an intracellular energy sensor cascade and

- 123 - Leptin receptor and SOCS interactions 2215

its activation in the hypothalamus promotes food intake member of the SOCS (suppressor of cytokine signalling) (Minokoshi et al., 2004). family, now consisting of eight proteins: SOCS1-7 and CIS. CIS (cytokine-inducible SH2 protein) was the founding SOCS proteins typically have an SH2-domain, an N-terminal

A B

C D Journal of Cell Science

Fig. 1. (A) Overview of LR signalling and its interaction partners. The murine LR carries three conserved tyrosines in its cytoplasmic tail at positions Y985, Y1077 and Y1138. JAK2 is constitutively associated with the LR at the conserved Box 1 and 2 motifs. Upon leptin stimulation, the JAKs become fully activated through cross-phosphorylation and phosphorylate the tyrosine residues in the receptor. STAT3 is recruited to the phosphorylated Y1138 docking site. Upon phosphorylation, STAT3 translocates as dimers to the nucleus, and induces specific gene expression. SHP2 is recruited to the Y985 docking site and couples to the Ras/Raf signalling cascade. The PI-3K pathway is also involved in LR signalling. Tyrosines Y985 and Y1077 take part in negative regulation of the leptin signal by binding SOCS3. PTP-1B is involved in negative regulation by dephosphorylation of JAK2 after internalisation of the LR complex. (B) MAPPIT principle. A particular bait protein is linked C-terminally to the chimeric receptor consisting of the extracellular part of the EpoR and the intracellular part of the LR with all three tyrosines mutated to phenylalanine, whereas the prey protein is fused to the STAT3 recruitment sites of the gp130 chain. The bait-receptor is incapable of recruiting STAT3 upon stimulation. However, when bait and prey proteins interact, the C-terminal part of the gp130 chain is brought in close proximity to the JAK kinases allowing its tyrosine phosphorylation and subsequent STAT3 activation. Read-out is based on a STAT3-responsive reporter construct. (C) GGS-MAPPIT. For GGS-MAPPIT the bait protein is attached C-terminally to a variant of the chimeric EpoR-LR receptor. The cytosolic domain of the LR following the JAK2 association domain is replaced by a GGS-array, preventing any background activation resulting from prey association with the LR-F3. (D) LR-MAPPIT. Here, the LR itself functions as bait protein. Owing to the Y1138F mutation, no STAT3 recruitment or activation can occur. Upon stimulation, the two membrane proximal tyrosines can nevertheless be phosphorylated by JAK2. Interaction of the prey protein with the LR, which may depend on phosphorylation, allows STAT3 activation and subsequent reporter induction.

- 124 - 2216 Journal of Cell Science 119 (11)

preSH2-domain and a C-terminal SOCS box (Starr et al., be measured with the STAT3-responsive rat pancreatitis- 1997). The SOCS box targets signalling proteins to the associated protein I (rPAPI) promoter-luciferase reporter (Fig. proteasome for degradation by recruitment of an ubiquitin- 1B). Intrinsic to this strategy, both modification-independent transferase system (Kile et al., 2002). Elongin B or C of the and tyrosine phosphorylation-dependent interactions can be E3 ligase complex is recruited to the BC box in the SOCS box detected. (Kamura et al., 1998). SOCS1 and 3 also carry a KIR (kinase To monitor interactions with isolated tyrosine motifs of the inhibitory region) domain that may act as a pseudosubstrate for LR, we developed a MAPPIT configuration whereby the direct inhibition of JAK kinase activity. Although SOCS1 cytosolic domain of the LR is replaced by a large array of Gly- associates with JAK2, SOCS3 binds the receptor in close Gly-Ser (GGS) repeats (Fig. 1C). The MAPPIT technique also proximity to the kinase and shows only weak affinity for JAK2 allows the analysis of interactions with the LR itself by simple (Kubo et al., 2003). Competition for binding to shared mutation of the Y1138 STAT3-recruitment motif to recruitment sites can also contribute to the negative regulation phenylalanine (Fig. 1D). LRs with different combinations of Y of signalling pathways, as exemplified for CIS and SOCS2 in to F mutations of the two other conserved tyrosine motifs case of STAT5 recruitment at the growth hormone receptor (located at positions Y985 and Y1077) were used. This allows (Greenhalgh et al., 2002a; Ram and Waxman, 1999). the study of protein associations with the LR in its normal SOCS3 was identified as a potent inhibitor of LR signalling. oligomeric configuration. It associates predominantly with the pY985 motif in the LR. Weak interaction at position pY1077 may explain its additive MAPPIT analysis of CIS and SOCS2 interactions with effect on inhibition of LR signalling (Bjorbaek et al., 2000; the LR Eyckerman et al., 2000). SOCS3 is rapidly expressed in the To determine interaction with the LR, the CISprey fusion hypothalamus upon leptin stimulation making it part of a protein was transiently co-expressed with the LR(YYF) mutant STAT3-mediated negative feedback system (Bjorbaek et al., and the luciferase reporter construct (Fig. 2A). Clear induction 1998a; Dunn et al., 2005). Recently, PTP-1B was also of luciferase activity indicated that CIS interacts with the LR. identified as a negative mediator of LR signalling, targeting MAPPIT experiments using LR(YFF), LR(FYF) or LR(F3) both the JAK-STAT and the MAPK pathway (Kaszubska et al., showed that CIS can interact with both Y985 and Y1077 2002). motifs, whereas no interaction was detected with the LR It is well established that in many cytokine receptor systems lacking tyrosines. In a similar way we also tested the SOCS2- multiple SOCS proteins can be involved in regulation. In the LR interaction (Fig. 2A). SOCS2 clearly associates with the case of the growth hormone, erythropoietin and prolactin LR, but only at position Y1077. Expression of the LR mutants receptors, this includes CIS, SOCS2 and SOCS3. Since leptin was analysed using a leptin-SEAP binding assay (Fig. 2B), and can activate STAT5 (Baumann et al., 1996; Hekerman et al., expression of the FLAG-tagged CIS and SOCS2 preys was 2005) and since CIS and SOCS2 are known regulators of revealed by immunoblotting using an anti-FLAG antibody STAT5 recruitment (Ram et al., 1999; Greenhalgh et al., (Fig. 2C). 2002a), we questioned whether CIS or SOCS2 could be

Journal of Cell Science involved in LR signalling. Consistent with this, highly Phosphopeptide binding analysis conserved tyrosine-based motifs compatible with CIS and We confirmed the specific interaction of SOCS2 with pY1077 SOCS2 association are present in the LR. Also, leptin can of the LR using a biochemical strategy (Fig. 3). FLAG-tagged induce CIS and SOCS3 expression, and to a lesser extent SOCS2 or CIS proteins were expressed in HEK293T cells and SOCS2 in insulinoma cells (data not shown). To analyse these total cell lysates were incubated with the biotinylated peptides interactions with the LR we used two alternative versions of encompassing the LR phosphorylated or non-phosphorylated the MAPPIT (mammalian protein-protein interaction trap) Y1077 or Y985 motifs to verify (phospho)tyrosine-specific strategy (Fig. 1). We observed differential binding of CIS and association. SOCS2 clearly interacted with the phosphorylated SOCS2 with the LR and demonstrate two distinct mechanisms Y1077 motif but not with the phosphorylated Y985 motif, for functional interference by SOCS2. confirming its specific phosphorylation-dependent interaction with the LR at position Y1077. Association of CIS was found Results with neither pY985 nor pY1077 indicating that these Cytokine receptor signalling and design of MAPPIT interactions may be to weak or short-lived to be detected by experiments phosphopeptide affinity chromatography (data not shown). An overview of signalling through the leptin receptor (LR) is shown in Fig. 1A, and is described in more detail in the Relative binding affinities of the CIS and SOCS2 introductory section. With MAPPIT we developed a new interactions with the LR method to analyse protein interactions in mammalian cells To gain further insight into their relative binding affinities for (Eyckerman et al., 2001). MAPPIT bait constructs were the LR, the CISprey or SOCS2prey were co-expressed with originally designed as chimeric receptors, consisting of the wild-type CIS. Although CIS expression markedly reduced the extracellular part of the erythropoietin receptor (EpoR) fused CISprey signal through both LR(YFF) and LR(FYF), it did not to the transmembrane and intracellular regions of a STAT3 lead to any inhibition of the SOCS2prey signal through Y1077. recruitment-deficient LR, with a C-terminally attached bait. Conversely, co-expression of wild-type SOCS2 with the MAPPIT prey constructs are composed of a prey polypeptide CISprey protein clearly diminished the MAPPIT signal at the fused to a part of the gp130 chain carrying 4 STAT3 Y1077 position in the LR whereas the SOCS2prey signal is recruitment sites. Co-expression of interacting bait and prey only partially reduced (Fig. 4A). These results confirm that CIS leads to functional complementation of STAT3 activity that can interactions with Y985 and Y1077 of the LR are weak or

- 125 - Leptin receptor and SOCS interactions 2217

Fig. 3. SOCS2 interaction with the peptide matching the Y1077 motif of the LR is phosphorylation dependent. FLAG-tagged SOCS2 was expressed in HEK293T cells and lysates were incubated with phosphorylated or non-phosphorylated peptides corresponding to the Y1077 or Y985 motif. Immunoblotting with anti-FLAG antibody revealed specific interaction of SOCS2 with the tyrosine- phosphorylated Y1077 motif.

Fig. 2. Differential association of CIS and SOCS2 with the LR. (A) HEK293T cells were transiently co-transfected with plasmids encoding different pMET7-LR variants and the pMG2-CIS and

Journal of Cell Science pMG2-SOCS2 prey constructs, or with mock vector, combined with the pXP2d2-rPAP1-luci. The transfected cells were either stimulated for 24 hours with leptin or were left untreated (NS, not stimulated). Luciferase measurements were performed in triplicate. Data are expressed as mean fold induction (leptin stimulated/NS) + s.d. (B) LR expression levels were measured on the same transfected cells by incubation for 2 hours with leptin-SEAP fusion protein with or without a 100-fold excess of unlabelled leptin. Mean bound SEAP activity + s.d. of triplicate measurements is plotted. (C) Western blot Fig. 4. Stability of the CIS and SOCS2 interactions with the LR. analysis of CISprey and SOCS2prey expression. Expression of the (A) HEK293T cells were transiently co-transfected with plasmids FLAG-tagged fusion prey proteins in the same transfected cells was encoding different pMET7-LR variants, the pMG2-CIS or pMG2- verified on lysates using anti-FLAG antibody. SOCS2 prey construct, pEF-FLAG-I/mCIS or pEF-FLAG- I/mSOCS2, or the appropriate amount of mock vector together with the pXP2d2-rPAP1-luci. The transfected cells were either stimulated transient, whereas the association of SOCS2 with Y1077 is for 24 hours with leptin or were left untreated (NS, not stimulated). more stable and therefore not easy to compete. It is quite Luciferase measurements were performed in triplicate. Data are surprising that SOCS2 can inhibit the MAPPIT signal of the expressed as mean fold induction (leptin stimulated/NS) + s.d. CISprey protein through Y985 since SOCS2 is not interacting (B) Western blot analysis of CISprey, SOCS2prey, CIS and SOCS2 with this position. Expression levels of the FLAG-tagged expression. Expression of the FLAG-tagged fusion proteins, CIS and proteins were confirmed by immunoblotting using an anti- SOCS2 was verified on lysates of transfected cells using anti-FLAG FLAG antibody (Fig. 4B). antibody.

Analysis of CIS and SOCS2 interactions with the LR replaced by 60 GGS repeats. GGS triplet repeats are often used using GGS-MAPPIT as hinge sequences for their known structural flexibility. By A new adaptation of the classic MAPPIT method, called GGS- using this GGS-MAPPIT strategy any background prey MAPPIT (Fig. 1C), was used to confirm the interaction of CIS association with the LR-F3 is prevented. The bait constructs and SOCS2 with the LR. In this configuration the cytosolic containing the LR motifs surrounding Y985 or Y1077 were domain of the LR, following the JAK2 interaction site, is transiently co-transfected with the prey construct and the rPAP

- 126 - 2218 Journal of Cell Science 119 (11)

luciferase reporter construct in HEK293T cells. Using GGS (Hekerman et al., 2005). Given the strong interaction of MAPPIT we were again able to detect the interaction of CIS SOCS2 at position Y1077 we examined whether SOCS2 can with both the Y985 and Y1077 motifs, whereas SOCS2 only interfere with STAT5 association at this position. The SH2 interacts with the Y1077 motif, but not with the pY985 motif domain of STAT5a was inserted in a prey construct and used (Fig. 5A). We tested this GGS-MAPPIT strategy further in in MAPPIT experiments using the Y1077 motif as bait in GGS- erythroleukaemic TF-1 cells and obtained similar results as MAPPIT. In HEK293T cells, co-expression of SOCS2 or a those found in HEK293T cells (Fig. 5B). A full-length SOCS2 mutant lacking the entire SOCS box completely FKBP12 bait was used to evaluate non-specific binding of the abolished the MAPPIT signal. Similarly, co-expression of CIS and SOCS2 preys. FACS analysis, using antibodies against SOCS2 ⌬box in TF-1 cells also abrogated the MAPPIT signal, the extracellular domain of the EpoR, allowed monitoring of thus excluding a role for elongin B/C recruitment in this the expression of the different GGS baits (Fig. 5C). suppressive effect (Fig. 6A,B). Similar data were obtained using the LR(FYF) as bait (data not shown). We conclude that SOCS2 interferes with STAT5a recruitment SOCS2 can compete with STAT5a association at the pY1077 We previously showed that STAT5 can be activated by the LR motif. upon recruitment to the LR Y1077 and Y1138 motifs SOCS2 interacts with the SOCS box of CIS Given the discrepancy between binding experiments at position A Y985, i.e. SOCS2 interferes with CIS binding without 9 8 Epo/NS 7 A 4 6 Epo/NS 3,5 5 4 3 3 2,5

fold induction 2 1 2 0 1,5

y y y y fold induction re re re p p Spre Sp 2 2 1 I I S S2prey C C C CS + O 7 SO SO 7 S 0,5 0 P12 + CISprey + + + B 5 2 8 77 1 0 P LR Y985 + C R Y1 Y9 B 0 R Y1 K F y 2 GGS GS L GGS FK S re G GS L G CS ⌬box GS LR G O G S 2 G SH2p + S LRY1077 a y C S 5 re O T S A 2p + GG T y SH B +S a re 7 p 7 T5 2 0 A T SH a +S 7 T5 20 SLRY1 7 A 0 T 18 Epo/NS GG 1 16 77+S 10 14 GGSLRY Y 12 R SL 10 G G 8 Journal of Cell Science 6

fold induction 4 B 4,5 2 Epo/NS 0 4

y ey e rey rey 3,5 prey p Spr 2 I S2p S CISprey C C 3 +CISpr + + 7 2 1 SOCS2 + SO + SOC 5 7 8 2,5 KBP 9 07 LR Y985 RY107 Y 1 BP12 + S SF Y SL G LR 2 GG G G LR G GGS GGS FK GGS induction fold 1,5

1

C 0,5 GGS LR Y985 GGS LR Y1077 GGS FKBP12 0 y e r box 1077 -p ⌬ a 2 RY S L AT5 C O S GGS +ST 7 y + 7 0 e 1 Y a-pr LR T5 S G TA G S + 77 10 Y R L S G Fig. 5. GGS-MAPPIT analysis of CIS and SOCS2 interactions with G the LR. (A,B) HEK293T cells (A) or TF-1 cells (B) were transiently co-transfected with plasmids encoding the chimeric bait constructs Fig. 6. SOCS2 interferes with the association of a STAT5a prey at with the different LR motifs or with the FKBP12 control bait, and Y1077. (A,B) HEK293T cells (A) or TF-1 cells (B) were transiently the pMG2-CIS, pMG2-SOCS2 prey constructs, combined with the co-transfected with the plasmid encoding the GGS bait construct pXP2d2-rPAP1-luci. The transfected cells were either stimulated for with the Y1077 LR motif, the pMG2-STAT5aSH2 prey construct, the 24 hours with Epo or were left untreated (NS, not stimulated). pMET7-FLAG-SOCS2 or pMET7-FLAG-SOCS2 ⌬box, or the Luciferase measurements were performed in triplicate. Data are appropriate amount of mock vector together with the pXP2d2- expressed as mean fold induction (Epo stimulated/NS) + s.e.m. rPAP1-luci. The transfected cells were either stimulated for 24 hours (C) FACS analysis shows the expression of the different chimeric with leptin or were left untreated (NS, not stimulated). Luciferase GGS bait receptors in TF-1 cells. The grey filled curves represent the measurements were performed in triplicate. Data are expressed as parental TF-1 cells; open lines, the transiently transfected TF-1 cells. mean fold induction (Epo stimulated/NS) + s.d.

- 127 - Leptin receptor and SOCS interactions 2219

interacting with this recruitment motif itself, we examined and cysteine 167, analogous to an elongin B/C recruitment- whether SOCS2 can directly associate with CIS. We first used deficient SOCS1 mutant reported before (Kamura et al., 1998). a MAPPIT configuration with CIS as bait. Here, SOCS2 We mutated both residues to glutamines to minimise structural clearly interacted specifically with full-length CIS (Fig. 7A). alterations. Elongin B/C association was analysed using a two- In Fig. 7B, we confirmed this interaction by co- step purification method, TAP2, based on the classic TAP immunoprecipitation. Next we looked at association of SOCS2 method (Puig et al., 2001). This sequential purification with the SOCS box of CIS in a MAPPIT experiment and also procedure involves a first protein A tag-based step, followed observed clear interaction (Fig. 7C). by TEV protease cleavage to remove the protein A part of the tag and followed by a FLAG-tag-based immunoprecipitation Elongin B/C recruitment is involved in SOCS2 step. Clearly, this SOCS2(LC-QQ) mutant no longer interacted interference with receptor-binding of CIS with elongin B or C (Fig. 8A). Furthermore, this SOCS2 We developed a mutant of SOCS2, SOCS2(LC-QQ), in which mutant as a prey protein still bound CIS in a MAPPIT elongin B/C recruitment is abrogated by mutating leucine 163 experiment (Fig. 8B). We next examined the interference of SOCS2 with CIS binding in more detail. At position Y985, the inhibitory effect by co-expression of SOCS2 was completely lost when using the SOCS2(LC-QQ) mutant. Recruitment of elongin B/C to the SOCS box of SOCS2 thus appeared essential for interference with CIS interaction at this position. By contrast, no difference was observed for the SOCS2(LC-QQ) mutant at the Y1077 position, clearly in line with a direct competition with CIS binding at this site (Fig. 8C).

Discussion MAPPIT allows the study of protein-protein interactions in the physiologically highly relevant context of intact human cells. Here we used several variations of the MAPPIT concept to study the interactions of two members of the SOCS protein family, CIS and SOCS2, with the murine LR long isoform. CIS and SOCS2 preys were shown to interact with specific tyrosine motifs, either within the full LR configuration or as isolated baits. Interactions were demonstrated in two different cell types: epithelial HEK293T cells as well as the haemopoietic TF-1 cell line.

Journal of Cell Science CIS binding was observed with the conserved mLR Y985 and Y1077 tyrosine-based motifs. By contrast, SOCS2 interacted only at the Y1077 position. In all cases, a Y to F mutation abrogated signalling, indicative of the phosphorylation- dependent nature of the interactions. We compared MAPPIT- based interaction analysis with a biochemical approach using

Fig. 7. SOCS2 interacts with CIS. (A) MAPPIT analysis. HEK293T cells were transiently co-transfected with plasmids encoding the chimeric EpoR-LR(F3) construct as a negative control or with the full-length (FL) CIS bait, and the pMG2-SOCS2 prey constructs, combined with the pXP2d2-rPAP1-luci reporter. The transfected cells were either stimulated for 24 hours with Epo or were left untreated (NS, not stimulated). Luciferase measurements were performed in triplicate. Data are expressed as mean fold induction (Epo stimulated/NS) + s.d. (B) Co-immunoprecipitation. HEK293T cells were transiently co-transfected with pMET7-Flag-SOCS2 and pMET7-Etag-CIS. Cell lysates were immunoprecipitated (IP) with anti-FLAG and subsequently immunoblotted (IB) with anti-E. (C) SOCS2 interacts with the SOCS box of CIS. HEK293T cells were transiently co-transfected with plasmids encoding the chimeric EpoR-LR(F3) construct as a negative control or with the CIS SOCS box bait, and the pMG2-SOCS2 prey construct or the appropriate amount of mock vector, combined with the pXP2d2-rPAP1-luci. The transfected cells were either stimulated for 24 hours with Epo or were left untreated (NS, not stimulated). Luciferase measurements were performed in triplicate. Data are expressed as mean fold induction (Epo stimulated/NS) + s.d.

- 128 - 2220 Journal of Cell Science 119 (11) Journal of Cell Science

Fig. 8. (A) Generation of a SOCS2 mutant deficient in elongin B/C binding. HEK293T cells were transiently transfected with the pMET7TAP2-SOCS2 and pMET7TAP2-SOCS2(LC-QQ) constructs. Cell lysates were purified using the TAP2 tag and loaded on a polyacrylamide gel and silverstained. From a parallel experiment, the indicated bands were identified as cullin 5, elongin B and elongin C by mass spectrometry. (B) The SOCS2(LC-QQ) mutant still binds CIS. HEK293T cells were transiently co-transfected with plasmids encoding the chimeric EpoR-LR(F3) construct as a negative control or with the CIS SOCS box bait, and the pMG2-SOCS2 or pMG2-SOCS2 (LC-QQ) prey constructs, combined with the pXP2d2-rPAP1-luci. The transfected cells were either stimulated for 24 hours with Epo or were left untreated (NS, not stimulated). Luciferase measurements were performed in triplicate. Data are expressed as mean fold induction (Epo stimulated/NS) + s.d. (C) Differential effects of the SOCS2(LC-QQ) mutant on CIS interaction with the LR recruitment motifs. HEK293T cells were transiently co-transfected with plasmids encoding different pMet7-LR variants, the pMG2-CIS prey construct, pMet7-FLAG-SOCS2 or pMet7-FLAG- SOCS2(LC-QQ), or the appropriate amount of mock vector together with the pXP2d2-rPAP1-luci. The transfected cells were either stimulated for 24 hours with leptin or were left untreated (NS, not stimulated). Luciferase measurements were performed in triplicate. Data are expressed as mean fold induction (leptin stimulated/NS) + s.d.

- 129 - Leptin receptor and SOCS interactions 2221

affinity chromatography with phosphorylated and non- Leptin resistance, which occurs in a majority of obese phosphorylated peptides matching the Y1077 or the Y985 individuals, may be situated at different levels, e.g. saturation motifs. The interaction between SOCS2 and the pY1077 motif of leptin transport through the blood-brain barrier or was readily demonstrated, in contrast to CIS and its matching aberrations in LR signalling in hypothalamic neurons (El- phosphopeptides. This is probably due to the more transient or Haschimi et al., 2000). LR Y1138S knock-in mice are severely weak nature of the latter interactions. In line with this proposal, obese and fail to activate STAT3, implying a dominant role for competition experiments showed that whereas CIS over- STAT3 in leptin-mediated regulation of the energy balance expression could clearly interfere with CISprey binding to (Bates et al., 2003). Aberrant negative feedback control of LR either motif, no cross-competition with the SOCS2prey signalling may contribute to leptin resistance and obesity, occurred. Conversely, SOCS2 could easily interfere with because augmented leptin sensitivity and resistance to diet- CISprey binding to pY1077. induced obesity was observed in neural-cell-specific SOCS3 Previous reports indicated that the tyrosine at position conditional-knockout mice or in SOCS3-haploinsufficient Y1077 of the receptor was not phosphorylated and was not mice (Howard et al., 2004; Mori et al., 2004). In contrast to involved in LR signalling (Banks et al., 2000; Li and Friedman, SOCS3, a negative regulatory role for CIS and SOCS2 on the 1999). However, several observations contradict this hypothalamic LR STAT3 pathway is questionable. Bjorbaek supposition. We reported earlier that SOCS3 can interact with and colleagues reported that JAK2 phosphorylation is the Y1077 domain, although in a rather weak manner, and that inhibited by SOCS3 upon leptin stimulation in COS cells but this interaction was dependent on tyrosine phosphorylation not by SOCS2 or CIS, which both lack a KIR domain at the (Eyckerman et al., 2000). More recently, Y1077 was also N-terminus (Bjorbaek et al., 1999). Similarly, we did not reported to induce STAT5 activation (Hekerman et al., 2005). observe any clear inhibitory effect on LR signalling through Consistent with a functional role, Y1077 is present in a highly STAT3 by either CIS or SOCS2 (data not shown). This is not conserved motif, with great similarity to the conserved Y985 unexpected because STAT3 recruitment occurs at the Y1138 domain (Eyckerman et al., 2000). Our findings now lend motif. Since expression of SOCS2 or CIS is also not up- further support for the important role of the pY1077 motif in regulated in the hypothalamus upon leptin administration in LR signalling with two more members of the SOCS protein mice, a role in LR STAT3 signalling is thus unlikely (Bjorbaek family interacting at this position, whereby SOCS2 can et al., 1998a). interfere with CIS and STAT5a prey recruitment. CIS and SOCS2 can function through competition with Very surprisingly, SOCS2 not only interfered with CIS-prey STAT binding at the receptor recruitment site. This interaction at position Y1077, but also at the Y985 motif mechanism, for example, underlies down-modulation of without binding this site itself. We provided an explanation for STAT5 activation by both CIS and SOCS2 upon growth this unexpected finding by showing that SOCS2 directly binds hormone receptor (GHR) activation (Greenhalgh et al., 2002a; to the SOCS box of CIS. Abrogation of the elongin B/C Ram and Waxman, 1999). Likewise, the physiological role for recruitment ability of SOCS2 had no influence on its CIS and SOCS2 on LR signalling through the Y985 and association with CIS, but its ability to eliminate CIS receptor Y1077 motifs may involve inhibition of recruitment of

Journal of Cell Science binding at position Y985 was completely lost, implying that downstream signalling moieties. This may be particularly ubiquitylation and proteasomal degradation of CIS is relevant in peripheral cell types, known to respond to leptin. involved. Very recently, it was reported that SOCS2 also Experiments on MLR (mixed-lymphocyte reaction), resulting interferes with SOCS3-dependent inhibition of IL-2 and IL-3 from the culture of T cells with major histocompatibility signalling (Tannahill et al., 2005). Together, these findings complex (MHC)-incompatible stimulator cells, indicated that point to an additional, new level of SOCS-mediated signalling leptin promotes proliferation of CD4+ T cells (helper T cells, control. Reminiscent of this, both mice lacking SOCS2 and Th) and induces a shifts to activation of Th1 cells, associated SOCS2 transgenic mice exhibit increased growth due to with elevated secretion of pro-inflammatory cytokines prolonged growth-hormone-dependent STAT5 activity including interleukin-2 (IL-2) and interferon-␥ (IFN-␥) (Lord (Greenhalgh et al., 2002b; Metcalf et al., 2000). This dual et al., 1998). Intriguingly, CIS transgenic mice show altered effect of SOCS2 was also observed in vitro because low helper T-cell development with a switch toward Th2 cell SOCS2 doses moderately inhibit GH signalling whereas response, accompanied by increased IL-4 levels (Matsumoto higher levels positively regulate signalling, probably through et al., 1999). CIS may thus be involved in the leptin-dependent interference with SOCS1 function (Favre et al., 1999; modulation of the Th1/Th2 balance. SOCS2 knock-out mice Greenhalgh et al., 2005). Our interaction analysis clearly showed a remarkable increase in size whereas growth implicates a complex biological role for SOCS2 and suggests retardation was observed in CIS transgenic mice. Both SOCS an explanation for the abovementioned duality: SOCS2 can proteins were identified as negative regulators of GHR interfere with cytokine signalling through direct interaction signalling, presumably through STAT5 (Matsumoto et al., with receptors, but can also enhance signalling by eliminating 1999; Metcalf et al., 2000). Considering the decreased linear other SOCS proteins through proteasomal degradation. This growth observed in db/db mice and humans with truncated LR latter effect may reflect a crucial physiological role of SOCS2 (Bates et al., 2003; Clement et al., 1998), SOCS2 and CIS may in restoring cellular responsiveness after cytokine activation. also exert their influence on growth through regulation of LR In line with this, SOCS2 is usually induced at later time points signalling. Since LR Y1138S knock-in mice are not reduced compared with CIS, SOCS1 and SOCS3 (Adams et al., 1998; in size (Bates et al., 2003) and since, in addition, no clear Pezet et al., 1999; Tannahill et al., 2005). Detailed quantitative effect of CIS or SOCS2 was observed on leptin-dependent analyses will be required to understand this balancing act in STAT3 signalling, this effect of SOCS2 and CIS probably full. occurs independently of STAT3. A good candidate is STAT5,

- 130 - 2222 Journal of Cell Science 119 (11)

since it is activated in different cell types upon leptin construct using EcoRI-XbaI and ligating it into the EcoRI-XbaI digested pMET7- stimulation in vitro through the Y1077 and Y1138 positions FLAG-SOCS3 expression vector which was described elsewhere (Eyckerman et al., 2000). SOCS2 ⌬box was amplified using primers 5Ј-TGCCTTTACTTCTAGGC- in the LR (Baumann et al., 1996; Hekerman et al., 2005). We CTG-3Ј and 5Ј-GCAGGTCTAGATTATGATGTATACAGAGGTTTG-3Ј from the here showed that SOCS2 can inhibit STAT5a prey association templates pMET7-FLAG-SOCS2 cloned in the NotI-XbaI opened pMET7-FLAG- at the LR Y1077 position. SOCS2 to create pMET7-FLAG-SOCS2 ⌬box. The pMET7-FLAG-SOCS2(LC- In conclusion, the MAPPIT approach was shown to be a QQ) mutant was created by site-directed mutagenesis of the pMET7-FLAG-SOCS2 construct using primers 5Ј-GTATACATCAGCACCCACTCAGCAGCATTTCCA- sensitive and flexible system for analysing interactions ACGACTCGCCATTAAC-3Ј and 5Ј-GTTAATGGCGAGTCGTTGGAAATGCTG- between proteins in a cellular context. We identified two SOCS CTGAGTGGGTGCTGATGTATAC-3Ј. proteins, CIS and SOCS2, as new interaction partners of the Generation of the chimeric receptors containing the extracellular part of the EpoR and the transmembrane and intracellular parts of the leptin receptor, such as EpoR- LR, and identified a novel regulatory role for SOCS2. Full LR(F3), were described elsewhere (Eyckerman et al., 2001). A full-length CIS bait understanding of the biological implications of cross- construct was generated by digesting the pCEL(2L)-Y480 bait construct with SstI regulation between SOCS proteins on the different cytokine and NotI and swapping the EpoR Y402 motif with a PCR product containing full- Ј receptor systems will require detailed, quantitative analysis of length CIS and the cloning sites SstI and NotI (primers 5 -GCGCGAGCTC- AATGGTCCTCTGCGTACAGGG-3Ј and 5Ј-GCTCGCGGCCGCTCAGAGTTG- all members of this protein family. GAAGGGGTACTGTCGG-3Ј). The CIS SOCS box bait was made using the same strategy and the PCR amplification of the CIS SOCS box was done with primers Materials and Methods 5Ј GCGAGAGCTCCGGATCCGCCCGCAGCTTACAACATC and 5Ј CGCTG- CGGCCGCTTAGAGTTGGAAGGGGTACTG. The SOCS2 (LC-QQ) prey was Constructs generated by mutating L163 and C167 of the Wild Type SOCS2 prey using primers Generation of the mutant mouse LR(YYF), LR(FYF), LR(YFF), LR(F3) in the 5Ј-GTATACATCAGCACCCACTCAGCAGCATTTCCAACGACTCGCCATTAAC- pMET7 expression vector was described elsewhere (Eyckerman et al., 1999). A 3Ј and 5Ј-GTTAATGGCGAGTCGTTGGAAATGCTGCTGAGTGGGTGCTG- pSEL-hEpoR-Y480 bait vector was derived from the described pSEL-hEpoR-Y402 ATGTATAC-3Ј. pMG2-STAT5aSH2 was created by amplifying the SH2 domain of bait (Eyckerman et al., 2001). In this pSEL-hEpoR-Y480 bait construct most of the STAT5a using primers 5Ј-GCGAGAATTCTCCGGACCCCACTGGAATGATGG- intracellular part of the LR was replaced by a flexible GGS linker. An unique N GGC-3Ј and 5Ј-CGCTTCTAGATTAACTCGAGGAGAAGACCTCATCCTTGG-3Ј EcoRI restriction site was introduced immediately following the JAK2 binding site and EcoRI-XbaI cloning in the pMG2 vector. through site-directed mutagenesis (Stratagene) using the primer pair 5Ј-GCTT- To generate the pMET7TAP2 construct we used the primers 5Ј-GCGAG- GGAAAAATAAAGATGAATTCGTCCCAGCAGCTATGGTC-3Ј and 5Ј-GACC- GGCCCGCCACCATGGCCCAGCACGACGAGATCTC-3Ј and 5Ј-CGCTCTCG- ATAGCTGCTGGGACGAATTCATCTTTATTTTTCCAAGC-3Ј. Phosphorylated AGGCCCTGGAAGTACAGGTTCTCGCTGGCGGTGGTGGGGATGTCGCTGT- oligonucleotides encoding two GGS repeats (5Ј-TCTGGTGGCAGTGGAGGG-3Ј TGGCGTCCACGCTG-3Ј to amplify the proteinA domain from the pMA-SpaI and 5Ј-AGACCCTCCACTGCCACC-3Ј) were annealed and head to tail ligated. construct obtained from the BCCM/LMBP plasmid collection and to add a TEV Ligation was stopped by addition of two other annealed oligonucleotide couples: cleavage site and we cloned the PCR product in the pMET7 vector using ApaI-XhoI. 5Ј-AATTCGGAGGGAGTGGTGGC-3Ј and 5Ј-AGAGCCACCACTCCCTCCG-3Ј; The FLAGtag was introduced using primers 5Ј-GCGAGGGCCCGCCACCAT- 5Ј-TCTGGAGGGAGTGGTGGGAGCT-3Ј and 5Ј-CCCACCACTCCCTCC-3Ј. GGCCCAGCACGACGAGATCTC-3Ј and 5Ј-GCGAGAATTCCCCGCTGCCCT- Annealing of these oligonucleotide couples generated respectively an EcoRI and a TGTCATCGTCGTCCTTGTAGTCCTGGCGCGCGCCCTGGAAGTACAGGTTC- SacII (both underlined) sticky end. The final product was ligated in EcoRI-SacII 3Ј and cloned in the same vector using ApaI-EcoRI. opened pSEL-hEpoR-Y480 vector. Sequence analysis showed that using this pMET7TAP2-SOCS2 was constructed by cutting SOCS2 from the pMG2-SOCS2 procedure 20 GGS repeats were introduced in the bait construct. The linker was construct using EcoRI-NotI and ligating it in the pMET7TAP2 construct. further amplified using oligonucletides 5Ј-CTTCTTCTGGAGCCTGAACC-3Ј and This construct was then used to create the pMET7TAP2-SOCS2(LC-QQ) by site- 5Ј-CGCCGCCAATTGCGAACTCCCACCACTCCC-3Ј. The product was digested directed mutagenesis using the primers 5Ј-GTATACATCAGCACCCACTCAGC- with EcoRI-MfeI and ligated in the EcoRI digested pSEL-20GGS-hEpoR-Y480 AGCATTTCCAACGACTCGCCATTAAC-3Ј and 5Ј-GTTAATGGCGAGTCGTT- vector yielding the pSEL-40GGS-hEpoR-Y480 vector. This ligation step was GGAAATGCTGCTGAGTGGGTGCTGATGTATAC-3Ј. All constructs were repeated once more to generate pSEL-60GGS-hEpoR-Y480 vector. The Journal of Cell Science verified by DNA sequence analysis. pSEL(+2L)60GGS-Y480 construct was generated by site-directed mutagenesis on the pSEL-60GGS-hEpoR-Y480 vector using primers 5Ј-CCCATAATTATTTCC- AGCTGTCTCCTCGTCCTACTGCTCGGAAC-3Ј and 5Ј-GTTCCGAGCAGTAG- Cell culture, transfection and reporter assays GACGAGGAGACAGCTGGAAATAATTATGGG-3Ј and Y480 was removed by Culture conditions, transfection procedures and luciferase assays for HEK293T cells SacI-NotI. The mLR Y985 motif was amplified with forward primer 5Ј- were as previously described (Eyckerman et al., 2000). For a typical luciferase GCCGAGCTCATGGAAAAATAAAGATGAG-3Ј containing a SacI site and experiment, HEK293T cells were seeded in six-well plates 24 hours before reverse primer 5Ј-CGGGCGGCCGCTCAACAGACAGACTTCTCCCTGTG-3Ј overnight transfection with the desired constructs together with the luciferase containing a NotI site and a stop codon, allowing in-frame coupling to the hEpoR- reporter gene. Two days after transfection cells were left untreated (not stimulated 60GGS chimeric receptor. The same strategy was used for the mLR Y1077 motif, NS) or were stimulated with 100 ng/ml leptin overnight. The luciferase activity of using primers 5Ј-GCCGAGCTCAGCAACTCTGGTCAGCAAC-3Ј and 5Ј-GGG- the transfected cells were measured by chemiluminescence. The factor-dependent CGGCCGCTCAAGGTACAAAGTTCTCACC-3Ј. The final constructs were called TF-1 erythroleukaemia cell line was grown in RPMI medium supplemented with 10% foetal calf serum and 1 ng/ml GM-CSF. After electroporation (300 V, 1500 pSEL(+2L)60GGS-mLR-Y985 and pSEL(+2L)60GGS-mLR Y1077, respectively. ␮ For the pSEL(+2L)60GGS-FKBP12 construct, FKPB12 was cut from the F), cells were starved (removal of GM-CSF) for 24 hours and were subsequently pSELFFY-FKBP12 construct described earlier (Eyckerman et al., 2005) using SacI stimulated with 5 ng/ml hEpo overnight. After 24 hours, luciferase activity was and NotI, and cloned in the pSEL(+2L)60GGS vector. measured as described before. The pXP2d2-rPAPI-luciferase reporter, originating from the rPAPI (rat pancreatitis-associated protein I) promoter, is used as previously described Leptin binding assay (Eyckerman et al., 2001). Expression plasmid vectors pEF-FLAG-I/mSOCS2 and LR expression on the surface of HEK293T cells was measured using a binding assay pEF-FLAG-I/mCIS were a gift from R. Starr (The Walter and Eliza Hall Institute with a mouse leptin-secreted alkaline phosphatase (SEAP) chimeric protein of Medical Research, Parkville, Australia). Generation of the prey constructs pMG2- (Tartaglia et al., 1995). 48 hours after transfection, cells were incubated for 2 hours CIS and pMG2-SOCS2 both containing part of the gp130 chain (aa 905-918) in with a 1:50 dilution of conditioned Cos1 medium containing the chimeric protein duplicate was described elsewhere (Montoye et al., 2005). with or without an excess of leptin. After two washing steps, cells were lysed in a The pMET7-FLAG-CIS construct was created by a three-point ligation. The N- buffer (1% Triton X-100, 20 mM Tris-HCl pH 7.4) and alkaline phosphatase activity terminal FLAG-tag of CIS was cut from the pEF-FLAG-I/mCIS construct using was measured by chemiluminescence, using CSPD substrate (PhosphaLight, EcoRI-PvuII and the C-terminal part of CIS was cut from the pMG1-CIS construct Tropix) according to the protocol provided by the manufacturer. using KpnI-PvuII as described elsewhere (Eyckerman et al., 2001). Both parts were ligated in the pMet7 vector digested with EcoRI-PvuII. To create the pMET7-Etag- FACS analysis CIS construct, CIS was amplified from the pMET7-FLAG-CIS using primers The expression of the chimeric hEpoR-mLR GGS baits was monitored using goat 5Ј-CGTCCGCGGCCGCGGTCCTCTGCGTACAGGGATC-3Ј and 5Ј-GCTGGCT- anti-human EpoR polyclonal IgG (R&D Systems) at 2 ␮g/ml and Alexa Fluor 488- CGAGTCAGAGTTGGAAGGGGTACTGTC-3Ј and was ligated in the NotI-XhoI conjugated donkey anti-goat IgG (Molecular Probes) at 4 ␮g/ml. Fluorescence- digested pCAGGSE-mMyD88 construct, which was a gift from Rudy Beyaert activated cell sorting (FACS) was performed on a FACSCalibur (Becton Dickinson). (Ghent University, Ghent, Belgium). Etag-CIS was then digested with EcoRI-XhoI and ligated in the pMET7 vector. Western blot analysis pMET7-FLAG-SOCS2 was created by cutting SOCS2 from the pMG2-SOCS2 Expression of the gp130-fusion proteins, CIS and SOCS2, all flag-tagged, were

- 131 - Leptin receptor and SOCS interactions 2223

verified by western blot analysis. Transfected HEK293T or TF-1 cells were lysed Flanders Institute of Science and Technology (GBOU 010090 grant), in RIPA buffer: 200 mM NaCl, 50 mM Tris-HCl pH 8, 0.05% SDS, 2 mM EDTA, from The Fund for Scientific Research – Flanders (FWO-V Grant 1% NP40, 0.5% DOC, Complete™ Protease Inhibitor Cocktail (Roche). 4ϫ loading number 1.5.446.98 to D.L., L.Z. and S.E.), from Ghent University ␤ buffer (125 mM Tris-HCl pH 6.8, 6% SDS, 20% glycerol, 0.02% BFB, 10% - (GOA 12051401) and from the Deutsche Forschungsgemeinschaft mercaptoethanol) was added to the lysates which were then loaded on a 10% polyacrylamide gel and blotted overnight. Blotting efficiency was checked using (SFB 542 to W.B.). PonceauS staining (Sigma). Flag-tagged proteins were revealed using monoclonal anti-Flag antibody M2 (Sigma) and anti-mouse-HRP (horseradish peroxidase) References (Amersham Biosciences). Adams, T. E., Hansen, J. A., Starr, R., Nicola, N. A., Hilton, D. J. and Billestrup, N. (1998). Growth hormone preferentially induces the rapid, transient expression of (Phospho)peptide affinity chromatography SOCS-3, a novel inhibitor of cytokine receptor signaling. J. Biol. Chem. 273, 1285- Approximately 35ϫ106 HEK293T cells were transfected with either pEF-FLAG- 1287. 1/mSOCS2 or pEF-FLAG-1/mCIS and were lysed in lysis buffer (20 mM HEPES Banks, A. S., Davis, S. M., Bates, S. H. and Myers, M. G., Jr (2000). Activation of downstream signals by the long form of the leptin receptor. J. Biol. Chem. 275, 14563- pH 7, 1 mM MgCl2, 10 mM KCl, 0.5 mM DTT, 150 mM NaCl, 0.5% NP40, 20% glycerol, 1 mM NaVO , Complete™ Protease Inhibitor Cocktail). The lysates were 14572. 4 Bates, S. H., Stearns, W. H., Dundon, T. A., Schubert, M., Tso, A. W., Wang, Y., centrifuged for 5 minutes at 10,000 g and loaded on a pre-column with Sepharose Banks, A. S., Lavery, H. J., Haq, A. K., Maratos-Flier, E. et al. (2003). STAT3 4B beads and streptavidin-agarose to prevent nonspecific interactions. Pre-cleared signalling is required for leptin regulation of energy balance but not reproduction. lysates were then incubated for 2 hours at 4°C with the (phospho)-tyrosine peptides Nature 421, 856-859. as indicated coupled to streptavidin-agarose beads through their biotin group. The Baumann, H., Morella, K. K., White, D. W., Dembski, M., Bailon, P. S., Kim, H., Lai, beads were then washed twice with lysis buffer and resuspended in 2ϫ loading C. F. and Tartaglia, L. A. (1996). The full-length leptin receptor has signaling buffer (62.5 mM Tris-HCl pH 6.8, 3% SDS, 10% glycerol, 0.01% BFB, 5% ␤- capabilities of interleukin 6-type cytokine receptors. Proc. Natl. Acad. Sci. USA 93, mercaptoethanol). Specific protein binding was revealed by SDS-PAGE and 8374-8378. immunoblotting using the anti-flag antibody and anti-mouse-HRP. The sequences Bjorbaek, C., Elmquist, J. K., Frantz, J. D., Shoelson, S. E. and Flier, J. S. (1998a). of the used peptides were biotin-QRQPSVK(P)Y985ATLVSNDK and biotin- Identification of SOCS-3 as a potential mediator of central leptin resistance. Mol. Cell NHREKSVC(P)Y1077LGVTSVNR. Synthesis and purification of the biotinylated 1, 619-625. (phospho)tyrosine peptides and coupling to streptavidin-agarose beads was Bjorbaek, C., Elmquist, J. K., Michl, P., Ahima, R. S., van Bueren, A., Mccall, A. L. described before (Eyckerman et al., 2000). and Flier, J. S. (1998b). Expression of leptin receptor isoforms in rat brain microvessels. Endocrinology 139, 3485-3491. Bjorbaek, C., El Haschimi, K., Frantz, J. D. and Flier, J. S. (1999). The role of SOCS- Co-immunoprecipitation 3 in leptin signaling and leptin resistance. J. Biol. Chem. 274, 30059-30065. ϫ 6 Approximately 2 10 HEK293T cells were transfected with pMet7-Flag-SOCS2 Bjorbaek, C., Lavery, H. J., Bates, S. H., Olson, R. K., Davis, S. M., Flier, J. S. and and pMet7-Etag-CIS. Cleared lysates (modified RIPA lysis buffer) were incubated Myers, M. G., Jr (2000). SOCS3 mediates feedback inhibition of the leptin receptor with 4 ␮g/ml anti-FLAG mouse monoclonal antibody (Sigma) and protein-G- via Tyr985. J. Biol. Chem. 275, 40649-40657. Sepharose (Amersham Biosciences). After immunoprecipitation, SDS-PAGE and Bjorbaek, C., Buchholz, R. M., Davis, S. M., Bates, S. H., Pierroz, D. D., Gu, H., Neel, western blotting, interactions were detected using anti-E-Tag antibody (Amersham B. G., Myers, M. G., Jr and Flier, J. S. (2001). Divergent roles of SHP-2 in ERK Biosciences). activation by leptin receptors. J. Biol. Chem. 276, 4747-4755. Boado, R. J., Golden, P. L., Levin, N. and Pardridge, W. M. (1998). Up-regulation of TAP2 purification and mass spectrometry blood-brain barrier short-form leptin receptor gene products in rats fed a high fat diet. HEK293T cells were transfected with the appropriate constructs and lysed in cell J. Neurochem. 71, 1761-1764. lysis buffer (50 mM Tris-HCl pH 8, 10% glycerol, 1% NP40, 150 mM NaCl, 5 mM Clement, K., Vaisse, C., Lahlou, N., Cabrol, S., Pelloux, V., Cassuto, D., Gourmelen, M., Dina, C., Chambaz, J., Lacorte, J. M. et al. (1998). A mutation in the human NaF, 5 ␮M ZnCl , 1 mM Na VO , 10 mM EGTA, Complete™ Protease Inhibitor 2 3 4 leptin receptor gene causes obesity and pituitary dysfunction. Nature 392, 398-401. Cocktail). The insoluble fraction was centrifuged and the supernatant was incubated Cohen, B., Novick, D. and Rubinstein, M. (1996). Modulation of insulin activities by with IgG Sepharose (Amersham Biosciences) overnight. The beads were washed leptin. Science 274, 1185-1188. three times with washing buffer (20 mM Tris-HCl pH 7.5, 5% glycerol, 0.1% NP40, Duan, C., Li, M. and Rui, L. (2004). SH2-B promotes insulin receptor substrate 1

Journal of Cell Science 150 mM NaCl) and twice with TEV (Tobacco Etch Virus) protease cleavage buffer (IRS1)- and IRS2-mediated activation of the phosphatidylinositol 3-kinase pathway in 1 (10 mM Tris-HCl pH 8, 150 mM NaCl, 0.1% NP40, 0.5 mM EDTA) and were response to leptin. J. Biol. Chem. 279, 43684-43691. then incubated with TEV protease in TEV protease cleavage buffer 1 for 2 to 4 Dunn, S. L., Bjornholm, M., Bates, S. H., Chen, Z. B., Seifert, M. and Myers, M. hours. The beads were then centrifuged and the supernatant was incubated with anti- G. (2005). Feedback inhibition of leptin receptor/Jak2 signaling via Tyr(1138) of the FLAG agarose (Sigma) in TEV protease cleavage buffer 2 (10 mM Tris-HCl pH 8, leptin receptor and suppressor of cytokine signaling 3. Mol. Endocrinol. 19, 925- 150 mM NaCl, 0.1% NP40) for 2 to 4 hours. The anti-FLAG agarose beads were 938. washed three times with washing buffer and incubated with FLAG peptide for 10 El-Haschimi, K., Pierroz, D. D., Hileman, S. M., Bjorbaek, C. and Flier, J. S. (2000). minutes. The beads were spun down and 4ϫ loading buffer was added to the Two defects contribute to hypothalamic leptin resistance in mice with diet-induced supernatants before loading on a polyacrylamide gel. Proteins were either visualised obesity. J. Clin. Invest. 105, 1827-1832. Eyckerman, S., Waelput, W., Verhee, A., Broekaert, D., Vandekerckhove, J. and by silver staining, or for mass spectrometry analysis with Sypro Ruby protein gel Tavernier, J. (1999). Analysis of Tyr to Phe and fa/fa leptin receptor mutations in the stain according to the manufacturer’s instructions (Molecular Probes). Proteins of PC12 cell line. Eur. Cytokine Netw. 10, 549-556. interest were excised and in-gel digested with trypsin as described. The resulting Eyckerman, S., Broekaert, D., Verhee, A., Vandekerckhove, J. and Tavernier, J. ␮ peptide mixture was dried, re-dissolved in 20 l of 0.1% formic acid in 2/98 (v/v) (2000). Identification of the Y985 and Y1077 motifs as SOCS3 recruitment sites in the acetonitrile/water and half of it was applied for nano-LC-MS/MS analysis on an murine leptin receptor. FEBS Lett. 486, 33-37. Ultimate (Dionex, Amsterdam, The Netherlands) in-line connected to an Esquire Eyckerman, S., Verhee, A., der Heyden, J. V., Lemmens, I., Ostade, X. V., HCT ion trap (Bruker Daltonics, Bremen, Germany). The sample was first trapped Vandekerckhove, J. and Tavernier, J. (2001). Design and application of a cytokine- on a trapping column (PepMapTM C18 column, 0.3 mm ID ϫ5 mm, Dionex) and receptor-based interaction trap. Nat. Cell Biol. 3, 1114-1119. after back-flushing, the sample was loaded on a 75 ␮m ID ϫ150 mm reverse-phase Eyckerman, S., Lemmens, I., Cateeuw, D., Verhee, A., Vandekerckhove, J., Lievens, column (PepMapTM C18, Dionex). The peptides were eluted with a linear solvent S. and Tavernier, J. (2005). Reverse MAPPIT: screening for protein-protein gradient over 50 minutes of 0.1% formic acid in acetonitrile/water (7/3, v/v). Using interaction modifiers in mammalian cells. Nat. Methods 2, 427-433. data-dependent acquisition, only multiple charged ions with intensities above Favre, H., Benhamou, A., Finidori, J., Kelly, P. A. and Edery, M. (1999). Dual effects threshold 100,000 were selected for fragmentation. For MS/MS analysis, an MS/MS of suppressor of cytokine signaling (SOCS-2) on growth hormone signal transduction. FEBS Lett. 453, 63-66. fragmentation amplitude of 0.7 V and a scan time of 40 milliseconds was used. The Ghilardi, N., Ziegler, S., Wiestner, A., Stoffel, R., Heim, M. H. and Skoda, R. C. fragmentation spectra were converted to Mascot generic files (mgf) using the (1996). Defective STAT signaling by the leptin receptor in diabetic mice. Proc. Natl. Automation Engine software (version 3.2, Bruker) and searched using the MASCOT Acad. Sci. USA 93, 6231-6235. database search engine (http://www.matrixscience.com) against the SwissProt and Greenhalgh, C. J., Bertolino, P., Asa, S. L., Metcalf, D., Corbin, J. E., Adams, T. E., the NCBInr Database (taxonomy mammalia). Only spectra that exceeded Mascot’s Davey, H. W., Nicola, N. A., Hilton, D. J. and Alexander, W. S. (2002a). Growth threshold score for identify (set at the 95% confidence level) were retained for enhancement in suppressor of cytokine signaling 2 (SOCS-2)-deficient mice is further manual validation. dependent on signal transducer and activator of transcription 5b (STAT5b). Mol. Endocrinol. 16, 1394-1406. We greatly acknowledge the technical support from Delphine Greenhalgh, C. J., Metcalf, D., Thaus, A. L., Corbin, J. E., Uren, R., Morgan, P. O., Defeau for construction of the GGS baits, from Marc Goethals for Fabri, L. J., Zhang, J. G., Martin, H. M., Willson, T. A. et al. (2002b). Biological evidence that SOCS-2 can act either as an enhancer or suppressor of growth hormone peptide synthesis and from An Staes and Evy Timmerman for mass signaling. J. Biol. Chem. 277, 40181-40184. spectrometry analysis. This work was supported by grants from the Greenhalgh, C. J., Rico-Bautista, E., Lorentzon, M., Thaus, A. L., Morgan, P. O.,

- 132 - 2224 Journal of Cell Science 119 (11)

Willson, T. A., Zervoudakis, P., Metcalf, D., Street, I., Nicola, N. A. et al. (2005). intake by responding to hormonal and nutrient signals in the hypothalamus. Nature SOCS2 negatively regulates growth hormone action in vitro and in vivo. J. Clin. Invest. 428, 569-574. 115, 397-406. Montoye, T., Lemmens, I., Catteeuw, D., Eyckerman, S. and Tavernier, J. (2005). A Hekerman, P., Zeidler, J., Bamberg-Lemper, S., Knobelspies, H., Lavens, D., systematic scan of interactions with tyrosine motifs in the erythropoietin receptor using Tavernier, J., Joost, H. G. and Becker, W. (2005). Pleiotropy of leptin receptor a mammalian 2-hybrid approach. Blood 105, 4264-4271. signalling is defined by distinct roles of the intracellular tyrosines. FEBS J. 272, 109- Mori, H., Hanada, R., Hanada, T., Aki, D., Mashima, R., Nishinakamura, H., Torisu, 119. T., Chien, K. R., Yasukawa, H. and Yoshimura, A. (2004). Socs3 deficiency in the Howard, J. K., Cave, B. J., Oksanen, L. J., Tzameli, I., Bjorbaek, C. and Flier, J. S. brain elevates leptin sensitivity and confers resistance to diet-induced obesity. Nat. (2004). Enhanced leptin sensitivity and attenuation of diet-induced obesity in mice with Med. 10, 739-743. haploinsufficiency of Socs3. Nat. Med. 10, 734-738. Niswender, K. D., Morton, G. J., Stearns, W. H., Rhodes, C. J., Myers, M. G., Jr and Kamura, T., Sato, S., Haque, D., Liu, L., Kaelin, W. G., Jr, Conaway, R. C. and Schwartz, M. W. (2001). Intracellular signalling. Key enzyme in leptin-induced Conaway, J. W. (1998). The Elongin BC complex interacts with the conserved SOCS- anorexia. Nature 413, 794-795. box motif present in members of the SOCS, ras, WD-40 repeat, and ankyrin repeat Pezet, A., Favre, H., Kelly, P. A. and Edery, M. (1999). Inhibition and restoration of families. Genes Dev. 12, 3872-3881. prolactin signal transduction by suppressors of cytokine signaling. J. Biol. Chem. 274, Kaszubska, W., Falls, H. D., Schaefer, V. G., Haasch, D., Frost, L., Hessler, P., 24497-24502. Kroeger, P. E., White, D. W., Jirousek, M. R. and Trevillyan, J. M. (2002). Protein Puig, O., Caspary, F., Rigaut, G., Rutz, B., Bouveret, E., Bragado-Nilsson, E., Wilm, tyrosine phosphatase 1B negatively regulates leptin signaling in a hypothalamic cell M. and Seraphin, B. (2001). The tandem affinity purification (TAP) method: a general line. Mol. Cell Endocrinol. 195, 109-118. procedure of protein complex purification. Methods 24, 218-229. Kile, B. T., Schulman, B. A., Alexander, W. S., Nicola, N. A., Martin, H. M. and Ram, P. A. and Waxman, D. J. (1999). SOCS/CIS protein inhibition of growth hormone- Hilton, D. J. (2002). The SOCS box: a tale of destruction and degradation. Trends stimulated STAT5 signaling by multiple mechanisms. J. Biol. Chem. 274, 35553- Biochem. Sci. 27, 235-241. 35561. Kim, Y. B., Uotani, S., Pierroz, D. D., Flier, J. S. and Kahn, B. B. (2000). In vivo Ren, D., Li, M., Duan, C. and Rui, L. (2005). Identification of SH2-B as a key administration of leptin activates signal transduction directly in insulin-sensitive regulator of leptin sensitivity, energy balance, and body weight in mice. Cell Metab. tissues: overlapping but distinct pathways from insulin. Endocrinology 141, 2328- 2, 95-104. 2339. Starr, R., Willson, T. A., Viney, E. M., Murray, L. J., Rayner, J. R., Jenkins, B. J., Kubo, M., Hanada, T. and Yoshimura, A. (2003). Suppressors of cytokine signaling Gonda, T. J., Alexander, W. S., Metcalf, D., Nicola, N. A. et al. (1997). A family of and immunity. Nat. Immunol. 4, 1169-1176. cytokine-inducible inhibitors of signalling. Nature 387, 917-921. Li, C. and Friedman, J. M. (1999). Leptin receptor activation of SH2 domain containing Tannahill, G. M., Elliott, J., Barry, A. C., Hibbert, L., Cacalano, N. A. and Johnston, protein tyrosine phosphatase 2 modulates Ob receptor signal transduction. Proc. Natl. J. A. (2005). SOCS2 can enhance interleukin-2 (IL-2) and IL-3 signaling by Acad. Sci. USA 96, 9677-9682. accelerating SOCS3 degradation. Mol. Cell. Biol. 25, 9115-9126. Lord, G. M., Matarese, G., Howard, L. K., Baker, R. J., Bloom, S. R. and Lechler, Tartaglia, L. A., Dembski, M., Weng, X., Deng, N., Culpepper, J., Devos, R., R. I. (1998). Leptin modulates the T-cell immune response and reverses starvation- Richards, G. J., Campfield, L. A., Clark, F. T., Deeds, J. et al. (1995). Identification induced immunosuppression. Nature 394, 897-901. and expression cloning of a leptin receptor, OB-R. Cell 83, 1263-1271. Matsumoto, A., Seki, Y., Kubo, M., Ohtsuka, S., Suzuki, A., Hayashi, I., Tsuji, K., Vaisse, C., Halaas, J. L., Horvath, C. M., Darnell, J. E., Jr, Stoffel, M. and Friedman, Nakahata, T., Okabe, M., Yamada, S. et al. (1999). Suppression of STAT5 functions J. M. (1996). Leptin activation of Stat3 in the hypothalamus of wild-type and ob/ob in liver, mammary glands, and T cells in cytokine-inducible SH2-containing protein 1 mice but not db/db mice. Nat. Genet. 14, 95-97. transgenic mice. Mol. Cell. Biol. 19, 6396-6407. Zabeau, L., Lavens, D., Peelman, F., Eyckerman, S., Vandekerckhove, J. and Metcalf, D., Greenhalgh, C. J., Viney, E., Willson, T. A., Starr, R., Nicola, N. A., Tavernier, J. (2003). The ins and outs of leptin receptor activation. FEBS Lett. 546, Hilton, D. J. and Alexander, W. S. (2000). Gigantism in mice lacking suppressor of 45-50. cytokine signalling-2. Nature 405, 1069-1073. Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L. and Friedman, J. M. Minokoshi, Y., Alquier, T., Furukawa, N., Kim, Y. B., Lee, A., Xue, B., Mu, J., (1994). Positional cloning of the mouse obese gene and its human homologue. Nature Foufelle, F., Ferre, P., Birnbaum, M. J. et al. (2004). AMP-kinase regulates food 372, 425-432. Journal of Cell Science

- 133 -

- 134 - CHAPTER 7: Leptin signalling in haematopoietic cells

I. Introduction

Leptin research was initially focused on its effects on hypothalamic weight regulation. During the last years however, leptin has been increasingly recognized as a cytokine-like hormone with pleiotropic actions on different physiological processes and in many peripheral tissues. Conceivably, leptin may function as a link between energy homeostasis and these physiological processes, since adequate energy stores are required to maintain certain energy-demanding processes. At present, the role of leptin in haematopoiesis is still a subject of much research and discussion. The functional long isoform of the LR is expressed in haematopoietic stem cells and in bone marrow stromal cells (Bennett et al., 1996; Cioffi et al., 1996; Konopleva et al., 1999). Involvement of leptin in modulation of haematopoiesis was demonstrated by colony formation studies where leptin stimulated the proliferation of stem cells and increased the numbers of lymphoid, erythroid and myeloid colonies (Bennett et al., 1996). Both ob/ob and db/db mice show a deficit in lymphopoietic progenitors and have defective erythrocyte production in the spleen, suggesting a role for leptin in the proliferation and expansion of haematopoietic stem cells and lymphoid progenitors (Bennett et al., 1996; Fantuzzi and Faggioni, 2000; Howard et al., 1999). Studies on signalling events induced by leptin in haematopoietic progenitor cells are very limited. Induction of the MAPK and PI3K pathways by leptin has been shown in peripheral blood mononuclear cells (Martin-Romero et al., 2000) and leptin was reported to prevent apoptosis of leukemia cells through STAT3 and MAPK activation (Tabe et al., 2004).

In order to gain more insight in the function of leptin as a modulator of haematopoiesis, we analysed leptin-mediated signalling events in haematopoietic cell lines using the MAPPIT technology. In preliminary experiments, no clear signals could be obtained with the classical STAT3-based MAPPIT set-up in several haematopoietic cell lines including erythroleukemic TF1, promyelocytic FDC-P1 and Chapter 7: Leptin signalling in haematopoietic cells

- 135 - prolymphocytic Ba/F3 cells. Since haematopoietic signalling depends predominantly on STAT5, we designed a variant of the MAPPIT method relying on functional complementation of STAT5 signalling. A novel prey construct was generated in which the gp130 domain is replaced by a STAT5 interaction sites-containing part of the βc-receptor. We used this novel βc-adaptation of the MAPPIT technology to examine leptin signalling in the TF1 and Ba/F3 haematopoietic cell lines. Several reported as well as novel interactions with the LR were identified. Our findings provide a basis for more detailed functional analysis of leptin signalling in haematopoiesis. Furthermore, MAPPIT proves to be a flexible method that can be adapted to other cell types like here for haematopoietic cell lines.

II. Article: Analysis of leptin signalling in haematopoietic cells using an adapted MAPPIT strategy. Published in FEBS letters, 2006.

III. References

Bennett, B. D., Solar, G. P., Yuan, J. Q., Mathias, J., Thomas, G. R., and Matthews, W. (1996). A role for leptin and its cognate receptor in hematopoiesis. Curr Biol 6, 1170-1180. Cioffi, J. A., Shafer, A. W., Zupancic, T. J., Smith-Gbur, J., Mikhail, A., Platika, D., and Snodgrass, H. R. (1996). Novel B219/OB receptor isoforms: possible role of leptin in hematopoiesis and reproduction. Nat Med 2, 585-589. Fantuzzi, G., and Faggioni, R. (2000). Leptin in the regulation of immunity, inflammation, and hematopoiesis. J Leukoc Biol 68, 437-446. Howard, J. K., Lord, G. M., Matarese, G., Vendetti, S., Ghatei, M. A., Ritter, M. A., Lechler, R. I., and Bloom, S. R. (1999). Leptin protects mice from starvation-induced lymphoid atrophy and increases thymic cellularity in ob/ob mice. J Clin Invest 104, 1051-1059. Konopleva, M., Mikhail, A., Estrov, Z., Zhao, S., Harris, D., Sanchez-Williams, G., Kornblau, S. M., Dong, J., Kliche, K. O., Jiang, S., et al. (1999). Expression and function of leptin receptor isoforms in myeloid leukemia and myelodysplastic syndromes: proliferative and anti-apoptotic activities. Blood 93, 1668-1676. Martin-Romero, C., Santos-Alvarez, J., Goberna, R., and Sanchez-Margalet, V. (2000). Human leptin enhances activation and proliferation of human circulating T lymphocytes. Cell Immunol 199, 15- 24. Tabe, Y., Konopleva, M., Munsell, M. F., Marini, F. C., Zompetta, C., McQueen, T., Tsao, T., Zhao, S., Pierce, S., Igari, J., et al. (2004). PML-RARalpha is associated with leptin-receptor induction: the role of mesenchymal stem cell-derived adipocytes in APL cell survival. Blood 103, 1815- 1822.

Chapter 7: Leptin signalling in haematopoietic cells

- 136 - FEBS Letters 580 (2006) 3301–3307

Analysis of leptin signalling in hematopoietic cells using an adapted MAPPIT strategy

T. Montoye, J. Piessevaux, D. Lavens, J. Wauman, D. Catteeuw, J. Vandekerckhove, I. Lemmens, J. Tavernier* Flanders Interuniversity Institute for Biotechnology, Department of Medical Protein Research, Faculty of Medicine and Health Sciences, Ghent University, A. Baertsoenkaai 3, B-9000 Ghent, Belgium

Received 8 March 2006; revised 10 April 2006; accepted 19 April 2006

Available online 8 May 2006

Edited by Robert Barouki

only the LRlo can activate the JAK-STAT signalling pathway Abstract The adipocyte-secreted hormone leptin participates in the regulation of hematopoiesis and enhances proliferation of [7]. This LRlo form has three conserved tyrosine (Y) motifs in hematopoietic cells. We used an adaptation of the MAPPIT the intracellular domain, being Y985, Y1077 and Y1138 in the mammalian two-hybrid method to study leptin signalling in a mouse LR. These sites become phosphorylated upon leptin hematopoietic setting. We confirmed the known interactions of treatment and are used as docking sites for several signalling suppressor of cytokine signalling 3 (SOCS3) and STAT5 with or inhibitory molecules. Examples include recruitment of the Y985 and Y1077 motifs of the leptin receptor, respectively. STAT3 (signalling transducer and activator of transcription) We also provide evidence for novel interactions at the Y1077 mo- via the Y1138 motif of the LR, STAT5 via the Y1077 and tif, including phospholipase C gamma and several members of Y1138 motif of the LR [8] and binding of the SH2-containing the SOCS protein family, further underscoring the important phosphatase SHP-2 on the Y985 motif leading to activation of role of the Y1077 motif in leptin signalling. the Ras-MAPK pathway [9]. In addition, several members of 2006 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. the SOCS (suppressor of cytokine signalling) protein family can interact with the LR. SOCS3 associates predominantly Keywords: MAPPIT; Leptin receptor; Signal transduction with the pY985 motif [10,11] and was identified as a potent inhibitor of LR signalling. SOCS2 interacts with Y1077 and cytokine inducible SH2 containing protein (CIS) with both Y985 and Y1077 motifs (Lavens et al., in press). In this report, we used the human premyeloid TF1 and the murine Ba/F3 pro-B cell lines as models to study protein interac- 1. Introduction tions with the LR in a hematopoietic environment. To this end, we adapted the MAPPIT (mammalian protein–protein interac- Leptins’ role has been studied most extensively in the central tion trap) method [12] to operate in hematopoietic cell types. nervous system, where it regulates food intake and energy bal- ance. Recent research revealed a wider spectrum of biological actions of this adipokine in other vital processes. Leptin-defi- cient (ob/ob) and leptin-receptor (LR)-deficient (db/db) mice 2. Materials and methods develop a complex syndrome characterized not only by obesity but also abnormal reproduction, hormonal imbalances and 2.1. Constructs Generation of the mutant mouse LR(YYF) in the pMET7 dysregulation of the hematopoietic and immune system [1]. Al- expression vector was described elsewhere [13]. Construction of the tered amounts of lymphopoietic progenitors, circulating lym- pSEL-60GGS-mLR-Y985 and pSEL-60GGS-mLR-Y1077 baits was phocytes, and leukocytes are observed in ob/ob and db/db described in Lavens et al. (in press). A fragment of the intracellular mice, and correlation studies between plasma leptin concentra- part of the hbc receptor, containing 4 tyrosine motifs, was amplified by PCR on the pSV532-hbc plasmid using primer 1 and primer 2 tion and leukocyte counts in humans led to the notion that lep- (see Table 1). The PCR fragment was digested with ApoI and was li- tin participates in the regulation of hematopoiesis [2–4]. In line gated into the pMG2-SVT plasmid [12] which was digested with EcoRI with this, expression of the signalling-competent leptin receptor leading to replacement of the gp130 part of the pMG2-construct. This long isoform (LRlo) is observed in fetal liver, bone marrow, prey-construct was called pMbc-SVT. This construct was further di- CD34+ progenitor cells as well as in several hematopoietic cell gested with EcoRI and NotI, allowing exchange of the SVT part by a full-length rat SOCS3 F25A PCR fragment (primers 3 and 4). The lines, such as TF1 and MO7E [5,6]. KIR domain of SOCS3 was rendered inactive by a F25A mutation that The LR, a member of the class I cytokine receptor family, is was introduced using primers 5 and 6. All other members of the SOCS expressed as multiple alternatively spliced isoforms, of which family were cloned as pMbc-prey fusion proteins. Murine CIS and SOCS2 were already cloned as pMG2-preys [14], and were transferred as EcoRI–XbaI fragments. Murine SOCS1 was amplified by PCR *Corresponding author. Fax: +32 9 2649492. using primers 7 and 8 and was ligated into EcoRI–NotI opened pMbc E-mail address: [email protected] (J. Tavernier). vector. Inactivation of the KIR domain of SOCS1 was done with prim- ers 9 and 10 leading to a F59A mutation. The pMbc-mSOCS4 con- Abbreviations: LR, leptin receptor; SOCS, suppressor of cytokine si- struct was obtained by PCR on cDNA prepared from mouse thymus gnalling; CIS, cytokine inducible SH2 containing protein; STAT, sig- (gift from Dr. Peter Brouckaert) with primers 11 and 12 and insertion nal transducer and activator of transcription; PLCc, phospholipase C in the EcoRI–NotI opened pMbc vector. The pMbc-mSOCS5 and gamma -mSOCS6 prey constructs were generated by amplification from the

0014-5793/$32.00 2006 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2006.04.094 - 137 - 3302 T. Montoye et al. / FEBS Letters 580 (2006) 3301–3307

Table 1 Overview of primers used in this study Primer 1 Forward 50-CGCAAATTTTCCCACACACCTGAGAAACA Primer 2 Reverse 50-CGCGAATTCAGGATTGTTCCTTGGTGACC Primer 3 Forward 50-GCGAGATCTCAGAATTCGTCACCCACAGCAAGTTTCC Primer 4 Reverse 50-GGTGCGGCCGCTCCACCGGTCGACGAAAGTGGAGCATCATACTGG Primer 5 Forward 50-CGCCTCAAGACCGCTAGCTCCAAGAGC Primer 6 Reverse 50-GCTCTTGGAGCTAGCGGTCTTGAGGCG Primer 7 Forward 50-CCAGCGAATTCATGGCGCGCCAGGACTACAAGGAC Primer 8 Reverse 50-GCTTGCGGCCGCTTAGATCTGGAAGGGGAAGGA Primer 9 Forward 50-CACTTCCGCACCGCGCGCTCCCACTCC Primer 10 Reverse 50-GGAGTGGGAGCGCGCGGTGCGGAAGTG Primer 11 Forward 50-GCGGAATTCGCTGAAAACAATAGT Primer 12 Reverse 50-CGCGCGGCCGCTCACTGCTGCTCTGGCA Primer 13 Forward 50-GCGGAATTCGATAAAGTGGGGAAAATGTG Primer 14 Reverse 50-CGCGCGGCCGCTTACTTTGCTTTGACTG Primer 15 Forward 50-GCGGAATTCAAGAAAATCAGTCTG Primer 16 Reverse 50-CGCGCGGCCGCTCAGTAGTGCTTCTCC Primer 17 Forward 50-GCGGAATTCGTGTTCCGCAACGTG Primer 18 Reverse 50-CGCTCTAGAGACTACGTGGAAGGCTCCA

RZPD clones IRAV p968 D11111D6 (mSOCS5) and IRAV p968 wherein the gp130 moiety is swapped for a part of the bc- E0635 D6 (mSOCS6) using, respectively, primers 13 and 14, and 15 receptor, containing several STAT5 interaction sites. In the and 16, again allowing insertion in the EcoRI–NotI opened pMbc vec- MAPPIT bait constructs, we replaced the cytosolic domain tor. A splice variant lacking exon 4 of murine SOCS7 (Dr. Martens N, personal communication) was amplified by PCR with primers 17 and 18 of the LR following the JAK2 interaction site, by a large array on cDNA of mouse hypothalamic N-38 cells (gift from Dr. Belsham) of Gly-Gly-Ser (GGS) repeats (Fig. 1B) in order to prevent any and inserted in the EcoRI–XbaI opened pMbc vector. pMbc-prey vec- background prey association with the LR-F3 (Lavens et al., in tors carrying hPLCc(2· SH2) and hSTAT5a(F694) were obtained by press). Interaction of co-transfected GGS-bait and bc-prey will EcoRI–XbaI insert swaps from the parental pMG2-based vectors [14]. The hPLCc(2· SH2) insert was also cloned in the pMET7-expres- lead in this setting to activation of the STAT5-dependent sion vector [13] by exchanging EcoRI–XbaI digested inserts. SPI2.1-luciferase reporter. The MAPPIT technique also allows the analysis of interactions with the LR itself. A mutant 2.2. Cell lines, electroporation conditions, reporter assays, expression LR(YYF) [13] was used to avoid possible background by acti- analysis and phospho-peptide affinity chromatography vation of STAT3 and 5 via Y1138 (Fig. 1C). Binding of Culture conditions for Hek293T cells were as described [11]. The STAT5 to the Y1077 motif [18], did not interfere with the TF1-M1-16 cell line is a hIL5-responsive derivative of TF1 cells [15] read-out in the hematopoietic cell systems used. [16]. Cells were grown in RPMI medium supplemented with 10% fetal calf serum and 1 ng/ml hIL5. Ba/F3 cells were grown in RPMI medium We initially tested the concept using a SOCS3(F25A)-prey. supplemented with 10% fetal calf serum and 1 ng/ml mIL3 (Biogen). SOCS3 strongly binds to the LR pY985-motif and negatively Transfections of both cell lines were done by electroporation (300 V, regulates LR signalling [18]. To suppress its inhibitory effect 1500 lF). Cells were simultaneously starved (removal of serum and on JAK2 activation, we inactivated the Kinase Inhibitory Re- hIL5 or mIL3) for 24 h and stimulated with 5 ng/ml hEpo or 100 ng/ gion (KIR domain) in the SOCS3 prey by introducing a F25A ml leptin. Activation of the pGL2-SPI2.1-luciferase reporter (gift by Dr. Walter Becker [17]) was measured as described before [14]. All mutation. SV40 large T protein (SVT) was used as negative MAPPIT data in this manuscript are expressed as fold induction (stim- prey control. As shown in Fig. 2, clear, specific signals were ulated/non-stimulated or NS) and are representative of at least three obtained in both Ba/F3 and TF1-M1-16 cells with either the independent experiments. LR(YYF) lacking the Y1138 STAT recruitment motif or with Expression analysis of the FLAG-tagged bc-fusion proteins was done by Western blot analysis with anti-FLAG mouse monoclonal antibody a GGS-bait construct containing only the LR Y985 motif. A (Sigma), using lysates of electroporated cells. Expression of the GGS slight activation was observed in case of the negative control baits was verified using goat anti-human EpoR polyclonal IgG (R&D in Ba/F3 cells, when stimulated with leptin and in TF1-M1- Systems) at 2 lg/ml and Alexa 488-conjugated donkey anti-goat IgG 16 cells when stimulated with Epo. This is probably due to (Molecular Probes) at 4 lg/ml. Fluorescence-activated cell sorting the presence of the endogenous LR or EpoR on Ba/F3 and (FACS) was performed on a FACSCalibur (Becton Dickinson). Phospho-peptide affinity chromatography experiments were per- TF1-M1-16 cells, respectively. The data shown in Figs. 2 and formed using the biotin-QRQPSVK(P)Y985ATLVSNDK and biotin- 3A are corrected for this low background. In these, and the NHREKSVC(P)Y1077LGVTSVNR peptides and lysates from Hek293T experiments described below, expression of the FLAG-tagged cells transfected with the pMET7-PLCc(2· SH2) expression plasmid as bc-preys in TF1-M1-16 or Hek293-T cells was revealed by described in Lavens et al. (in press). immunoblotting using an anti-FLAG antibody (data not shown). Expression analysis of the GGS baits in TF1-M1-16 cells was performed using FACS analysis with antibodies 3. Results against the extracellular domain of the EpoR as described before [18] (data not shown). 3.1. bc-MAPPIT: design and proof of principle The MAPPIT concept is based on JAK-STAT signalling and is shown in Fig. 1. We here designed a variant of the MAPPIT 3.2. Interaction of signalling molecules with the LR method that enables us to detect protein interactions in hema- Since the LR can trigger several signalling pathways, we next topoietic cells. Since cytokines predominantly activate STAT5 checked interaction of distinct signalling molecules with the in hematopoietic cells, we designed novel prey constructs, LR(YYF) in both Ba/F3 and TF1-M1-16 cells. The bc-preys

- 138 - T. Montoye et al. / FEBS Letters 580 (2006) 3301–3307 3303

Fig. 1. (A) MAPPIT principle: A bait protein is C-terminally linked to a chimeric receptor consisting of the extracellular part of the EpoR and the transmembrane and intracellular parts of a STAT3 recruitment-deficient LRF3, while the prey protein is fused to functional STAT3 recruitment sites of gp130. Co-expression of interacting bait and prey can lead to functional complementation of STAT3 activity that can be measured with a STAT3- responsive luciferase reporter. (B) GGS-MAPPIT: A bait protein is attached C-terminally to a variant of the chimeric EpoR-LR receptor. The cytosolic domain of the LR following the JAK2 association domain is replaced by a GGS-array, preventing any background activation due to prey association with the LR-F3. In this paper we use a bc-receptor based prey construct (inset). The bc receptor contains six tyrosine motifs in its cytoplasmatic tail of which three are known STAT5 recruitment sites. A prey in the bc-MAPPIT concept is fused to a part of the bc receptor containing all three STAT5 recruitment sites. (C) LR MAPPIT: Here, the LR itself functions as bait protein. Due to the Y1138F mutation, no detectable STAT recruitment occurs in our hematopoietic cell types. Upon stimulation, the two membrane proximal tyrosines become phosphorylated by JAK2. Interaction of the bc-based prey protein with the LR allows efficient STAT5 activation and subsequent reporter induction. used in this study were full-length STAT5a and part of PLCc Strong luciferase signals were detected with the PLCc-prey, encompassing its two SH2-domains. The STAT5a prey was and a weaker interaction was seen with the STAT5a-prey made signalling-deficient by introducing an Y694F mutation. (Fig. 3A). Analysis using the GGS-LR Y985 and GGS-LR

- 139 - 3304 T. Montoye et al. / FEBS Letters 580 (2006) 3301–3307

Fig. 2. bc-MAPPIT: proof of principle. (Bars 1–4) Ba/F3 cells were transiently electroporated with plasmids encoding the non-specific prey bc-SVT used as negative control, and the specific prey bc-SOCS3F25A with, respectively, the LR(YYF) mutant (Bars 1 and 2) or the EpoR-LR-60xGGS- Y985 bait (Bars 3 and 4), combined with the pGL2-SPI2.1-luciferase reporter. After 48 h of electroporation, the cells were either stimulated overnight with leptin/Epo as indicated or were left untreated. Data are expressed as fold induction (stimulated/NS). (Bars 5–8) Similar experimental set-up as above, but performed in TF1-M1-16 cells. The values obtained with the bc-SVT prey in Ba/F3 cells, when stimulated with leptin and in TF1-M1-16 cells when stimulated with Epo were, respectively, 5- and 2-fold, possibly due to endogenous expression of the LR and EpoR. The values shown are normalized for this background.

Y1077 baits revealed that both preys only interact with the in hematopoietic cells are limited. Leptin can prevent apopto- Y1077 motif (Fig. 3B). We confirmed the PLCc dataset with sis of leukaemia cells through STAT3 and mitogen-activated (phospho)peptide affinity chromatography using lysates from protein kinase (MAPK) phosphorylation [19] and activation Hek293T cells containing a FLAG-tagged PLCc-derived poly- of the MAPK and PI3-K pathways by leptin has been shown peptide encompassing both SH2 domains. Clear binding was in peripheral blood mononuclear cells [20]. Here, we adapted observed with the pY1077 phospho-peptide, with only minor the MAPPIT mammalian two-hybrid method to a hematopoi- binding to the pY985 motif. No detectable binding was ob- etic setting and studied protein interactions with the LR in served with the non-phosphorylated peptides (Fig. 4B). TF1-M1-16 and Ba/F3 cells. The basic MAPPIT set-up using STAT3 did not function in these cell lines, presumably due 3.3. Interaction map of SOCS proteins with the LR to low amounts of endogenous STAT3. We therefore swapped To determine their interaction with the LR, all members of the gp130 moiety in the prey constructs for part of the cyto- the SOCS family were cloned as bc-preys and were tested for solic domain of bc capable of recruiting and activating STAT5, interaction with LR(YYF) in Ba/F3 or TF1-M1-16 cells which is highly expressed in hematopoietic cell types. Our (Fig. 4A and B). The inhibitory effect by SOCS1 was sup- experiments illustrate the flexibility of the MAPPIT strategy, pressed by a F59A mutation in its KIR domain, similar to which can be adapted to operate in different types of human SOCS3 (see above). In Ba/F3 cells, clear induction of lucifer- cells by simple adjustment to different reporter systems. ase activity indicated that CIS, SOCS2 and SOCS3 interact The murine LR cytoplasmic tail contains three conserved with the LR(YYF), consistent previous reports [11] (Lavens tyrosine motifs at positions Y985, Y1077 and Y1138. With et al., in press). In addition, reproducible induction of lucifer- the bc-MAPPIT approach we confirmed the interaction of ase activity was also seen with SOCS6 and SOCS7. Similar re- SOCS3 with the LR Y985 motif in hematopoietic cells, whilst sults were obtained in TF1-M1-16 cells. No signal was only a very weak effect was seen with Y1077, consistent with obtained in the case of the bc-SOCS1 F59A, SOCS4 and the weak interaction with this motif (Figs. 2 and 4C) (10). SOCS5 preys. The role of the Y1077 motif in leptin signalling is still some- A detailed binding analysis of SOCS preys showed that what controversial since its tyrosine phosphorylation is diffi- SOCS3 interacted with the Y985 motif, while SOCS2 and -6 cult to demonstrate. However, the Y1077 motif was shown bind to the Y1077 motif. CIS and SOCS7 can interact with to interact with SOCS3 and STAT5 in a phosphorylation- both motifs (Fig. 4C). These bc-preys bind specifically with dependent modus [8,11]. Here, we provide further evidence the tyrosine motifs of the LR, since no interaction could be for an important role of the Y1077 motif in leptin signalling found with an irrelevant GGS-FKBP12 bait and replacement with several additional signalling proteins interacting at this of preys by a wild-type SOCS protein (SOCS7) did not lead site. Although there is evidence suggesting involvement of to luciferase activity (data not shown). the phospholipase C–phosphokinase C (PLC–PKC) pathway in leptin signalling [21–23], no proof for interaction of PLC proteins with the LR was obtained so far. We here show that 4. Discussion PLCc can interact via its SH2 domains with the LR(YYF) and more detailed analysis using both bc-MAPPIT and peptide Although a role of leptin in hematopoiesis is now well doc- affinity chromatography revealed that PLCc interacts with umented, studies on the intracellular pathways used by the LR the phosphorylated Y1077 motif.

- 140 - T. Montoye et al. / FEBS Letters 580 (2006) 3301–3307 3305

Fig. 3. Interaction of STAT5 and PLCc with the LR. (A) Ba/F3 (Bars 1–3) or TF1-M1-16 cells (Bars 4–6) were transiently electroporated with plasmids encoding pMet7-LR(YYF) and a bc-prey as indicated or an empty vector, combined with the pGL2-SPI2.1-luciferase reporter. Experimental set-up was as in Fig. 2. The values were normalized for background as mentioned in Fig. 2. (B) Ba/F3 were transiently electroporated with plasmids encoding the pSEL60GGS-LR Y985 or pSEL-60GGS-LR Y1077 bait and a bc-prey as indicated or an empty vector, combined with the pGL2-SPI2.1-luciferase reporter. Experimental set-up was as in Fig. 2. (C) The FLAG-tagged PLCc(2· SH2) protein was expressed in Hek293T cells and total cell lysates were incubated with biotinylated peptides encompassing the LR (phosphorylated) Y1077 or Y985 motifs. Immunoblotting with anti-FLAG antibody revealed specific interaction of PLCc with the phosphorylated Y1077 motif.

Since SOCS3 and SOCS7 were reported to inhibit leptin sig- tected, which is somewhat surprising since SOCS1 is known nalling in different ways [24], we performed a MAPPIT scan to to bind JAK2 [25] and can inhibit leptin signalling in cell-based monitor the binding capacity of all SOCS proteins with the LR. assays (Piessevaux et al., submitted for publication). Possibly, We were able to detect binding of SOCS3 as expected, but also certain preys that directly interact with JAK2 may be subject of CIS, SOCS2, SOCS6 and SOCS7. SOCS4- and SOCS5-preys to a topological restraint whereby phosphorylation of the prey do not induce reporter activity, indicating that no interaction tyrosines by the JAK is sterically impossible. Interestingly, the occurs, although direct inhibition of STAT5 activation cannot closely related SOCS proteins CIS and SOCS2 both bind to the be completely ruled out. Also, no interaction of SOCS1 is de- Y1077 motif, but only CIS appears to interact with the Y985

- 141 - 3306 T. Montoye et al. / FEBS Letters 580 (2006) 3301–3307

Fig. 4. Interaction of SOCS proteins with the LR. (A, B) Ba/F3 (Panel A) or TF1-M1-16 cells (Panel B) were transiently electroporated with plasmids encoding pMet7-LR(YYF) and a bc-SOCS prey or an empty vector, combined with the pGL2-SPI2.1-luciferase reporter. Experimental set- up was as in Fig. 2. (C) Ba/F3 cells were transiently electroporated with plasmids encoding the pSEL60GGS-LR Y985 or pSEL-60GGS-LR Y1077 bait and a bc-SOCS prey as indicated or an empty vector, combined with the pGL2-SPI2.1-luciferase reporter. Experimental set-up was as in Fig. 2.

motif. Similar data were obtained in non-haematopoietic cell that besides the well-established inhibitory effect of SOCS3 types (Lavens et al., in press). Similarly, SOCS7 can interact on hypothalamic leptin signalling, other SOCS proteins can with both the Y985 and the Y1077 motifs, whilst SOCS6 only bind to the LR and possibly may modulate leptin signalling binds Y1077. Inhibition or binding of SOCS6 on the LR has in other, e.g., peripheral cell types. not been reported so far, although both can be expressed in Together, our findings illustrate that the MAPPIT strategy hematopoietic cells [26]. Inhibition of leptin signalling by can easily be adapted to hematopoietic cell types. Our findings SOCS7 has been shown through binding and inhibition of identify several novel interactions with the LR and provide a STAT3 by SOCS7 [24]. However, binding of SOCS7 on the rationale for more detailed functional analysis of leptin signal- LR itself was not demonstrated before. Our findings suggest ling in hematopoiesis.

- 142 - T. Montoye et al. / FEBS Letters 580 (2006) 3301–3307 3307

Acknowledgements: We acknowledge Marc Goethals for peptide syn- and application of a cytokine-receptor-based interaction trap. thesis. This work was supported by grants from the Flanders Institute Nat. Cell Biol. 3, 1114–1119. of Science and Technology (GBOU 010090 grant), from The Fund for [13] Eyckerman, S., Waelput, W., Verhee, A., Broekaert, D., Van- Scientific Research – Flanders (FWO-V Grant No. 1.5.446.98, and to dekerckhove, J. and Tavernier, J. (1999) Analysis of Tyr to Phe J.P., D.L., J.W. and I.L.) and from Ghent University (GOA and fa/fa leptin receptor mutations in the PC12 cell line. Eur. 01G00606.). Cytokine Netw. 10, 549–556. [14] Montoye, T., Lemmens, I., Catteeuw, D., Eyckerman, S. and Tavernier, J. (2005) A systematic scan of interactions with tyrosine motifs in the erythropoietin receptor using a mammalian References 2-hybrid approach. Blood 105, 4264–4271. [15] Kitamura, T. et al. (1989) Establishment and characterization of [1] Fantuzzi, G. and Faggioni, R. (2000) Leptin in the regulation of a unique human cell line that proliferates dependently on GM- immunity, inflammation, and hematopoiesis. J. Leukoc. Biol. 68, CSF, IL-3, or erythropoietin. J. Cell Physiol. 140, 323– 437–446. 334. [2] Bennett, B.D., Solar, G.P., Yuan, J.Q., Mathias, J., Thomas, [16] Tavernier, J. et al. (2000) Interleukin 5 regulates the isoform G.R. and Matthews, W. (1996) A role for leptin and its cognate expression of its own receptor alpha-subunit. Blood 95, 1600– receptor in hematopoiesis. Curr. Biol. 6, 1170–1180. 1607. [3] Hirose, H., Saito, I., Kawai, T., Nakamura, K., Maruyama, H. [17] Wood, T.J., Sliva, D., Lobie, P.E., Goullieux, F., Mui, A.L., and Saruta, T. (1998) Serum leptin level: possible association with Groner, B., Norstedt, G. and Haldosen, L.A. (1997) Specificity of haematopoiesis in adolescents, independent of body mass index transcription enhancement via the STAT responsive element in and serum insulin. Clin. Sci. (Lond.) 94, 633–636. the serine protease inhibitor 2.1 promoter. Mol. Cell. Endocrinol. [4] Faggioni, R., Jones-Carson, J., Reed, D.A., Dinarello, C.A., 130, 69–81. Feingold, K.R., Grunfeld, C. and Fantuzzi, G. (2000) Leptin- [18] Bjorbaek, C., El-Haschimi, K., Frantz, J.D. and Flier, J.S. (1999) deficient (ob/ob) mice are protected from T cell-mediated hepa- The role of SOCS-3 in leptin signaling and leptin resistance. J. totoxicity: role of tumor necrosis factor alpha and IL-18. Proc. Biol. Chem. 274, 30059–30065. Natl. Acad. Sci. USA 97, 2367–2372. [19] Tabe, Y. et al. (2004) PML-RARalpha is associated with leptin- [5] Cioffi, J.A., Shafer, A.W., Zupancic, T.J., Smith-Gbur, J., receptor induction: the role of mesenchymal stem cell-derived Mikhail, A., Platika, D. and Snodgrass, H.R. (1996) Novel adipocytes in APL cell survival. Blood 103, 1815–1822. B219/OB receptor isoforms: possible role of leptin in hematopoi- [20] Martin-Romero, C. and Sanchez-Margalet, V. (2001) Human esis and reproduction. Nat. Med. 2, 585–589. leptin activates PI3K and MAPK pathways in human peripheral [6] Konopleva, M. et al. (1999) Expression and function of leptin blood mononuclear cells: possible role of Sam68. Cell Immunol. receptor isoforms in myeloid leukemia and myelodysplastic 212, 83–91. syndromes: proliferative and anti-apoptotic activities. Blood 93, [21] Takekoshi, K., Ishii, K., Kawakami, Y., Isobe, K., Nanmoku, T. 1668–1676. and Nakai, T. (2001) Ca(2+) mobilization, tyrosine hydroxylase [7] Bjorbaek, C., Uotani, S., da Silva, B. and Flier, J.S. (1997) activity, and signaling mechanisms in cultured porcine adrenal Divergent signaling capacities of the long and short isoforms of medullary chromaffin cells: effects of leptin. Endocrinology 142, the leptin receptor. J. Biol. Chem. 272, 32686–32695. 290–298. [8] Hekerman, P., Zeidler, J., Bamberg-Lemper, S., Knobelspies, H., [22] Sweeney, G. (2002) Leptin signalling. Cell Signal. 14, 655–663. Lavens, D., Tavernier, J., Joost, H.G. and Becker, W. (2005) [23] Corsonello, A., Malara, A., De Domenico, D., Perticone, F., Pleiotropy of leptin receptor signalling is defined by distinct roles Valenti, A., Buemi, M., Ientile, R. and Corica, F. (2004) of the intracellular tyrosines. FEBS J 272, 109–119. Identifying pathways involved in leptin-dependent aggregation [9] Bjorbaek, C. et al. (2001) Divergent roles of SHP-2 in ERK of human platelets. Int. J. Obes. Rel. Metab. Disord. 28, activation by leptin receptors. J. Biol. Chem. 276, 4747–4755. 979–984. [10] Bjorbak, C., Lavery, H.J., Bates, S.H., Olson, R.K., Davis, S.M., [24] Martens, N., Uzan, G., Wery, M., Hooghe, R., Hooghe-Peters, Flier, J.S. and Myers Jr., M.G. (2000) SOCS3 mediates feedback E.L. and Gertler, A. (2005) Suppressor of cytokine signaling 7 inhibition of the leptin receptor via Tyr985. J. Biol. Chem. 275, inhibits prolactin, growth hormone, and leptin signaling by 40649–40657. interacting with STAT5 or STAT3 and attenuating their nuclear [11] Eyckerman, S., Broekaert, D., Verhee, A., Vandekerckhove, J. translocation. J. Biol. Chem. 280, 13817–13823. and Tavernier, J. (2000) Identification of the Y985 and Y1077 [25] Ilangumaran, S. and Rottapel, R. (2003) Regulation of cytokine motifs as SOCS3 recruitment sites in the murine leptin receptor. receptor signaling by SOCS1. Immunol. Rev. 192, 196–211. FEBS Lett. 486, 33–37. [26] Krebs, D.L. et al. (2002) SOCS-6 binds to insulin receptor [12] Eyckerman, S., Verhee, A., der Heyden, J.V., Lemmens, I., substrate 4, and mice lacking the SOCS-6 gene exhibit mild Ostade, X.V., Vandekerckhove, J. and Tavernier, J. (2001) Design growth retardation. Mol. Cell. Biol. 22, 4567–4578.

- 143 -

- 144 - CHAPTER 8: Modulation of leptin receptor signalling.

I. Review: Negative regulation of leptin receptor signalling Published in European Cytokine Network, 2006

Chapter 8: Modulation of leptin receptor signalling

- 145 - Eur. Cytokine Netw., Vol. 17 n° 3, September 2006, 211-9 211

Review: negative regulation of leptin receptor signalling

Delphine Lavens, Julie Piessevaux, Jan Tavernier

Department of Medical Protein Research, Faculty of Medicine and Health Sciences, Flanders Interuniversity Institute for Biotechnology, VIB09, Ghent University, A. Baertsoenkaai 3, B-9000 Ghent Tel.: (+00 32) 9 264 93 02; fax: (+00 32) 9 264 94 92

Correspondence : J. Tavernier Accepted for publication September 8, 2006

ABSTRACT. Leptin was discovered as an adipostat, regulating body weight by balancing food intake and energy expenditure. Recently, leptin emerged as a pleiotropic cytokine. It plays a substantial role in a wide spectrum of other functions including immune regulation, bone formation and fertility. Leptin signalling is under tight control. Aberrations of this stringent control system may be implicated in a variety of pathologies. Here, we review the various mechanisms that control cellular leptin receptor signalling.

Keywords: leptin receptor signalling, negative regulation, SHP-2, PTP1B, SOCS proteins

Leptin plays a major role in the regulation of energy the LR [9]. Canonical leptin signalling occurs through the homeostasis and food intake. It is mainly produced in JAK-STAT pathway. Ligand binding results in LR cluster- white adipose tissue and, to a lesser degree, in the stomach ing, bringing the associated JAKs (janus kinase) into close and in some other tissues [1, 2]. Leptin is released into the proximity. This allows them to activate each other by circulation and is translocated through the blood-brain- cross-phosphorylating tyrosines in their activation loop. barrier (BBB) to target the leptin receptor (LR) in the These activated JAK kinases then phosphorylate tyrosines hypothalamus. Functioning as an adipostat, it signals the in the cytoplasmic tail of the receptor and on the JAKs, state of body fat reserves to the brain. Aberrations in leptin forming docking sites for signalling proteins. Amongst signalling are often associated with obesity, but only a these, the STATs (signal transducers and activators of minority of obese individuals show a deficiency in leptin or transcription) associate with the phosphotyrosines in the its receptor. Instead, most cases of human obesity show a receptor via their SH2 domain and become activated by state of relative leptin resistance, as reflected in high serum JAK2 mediated tyrosine phosphorylation. The activated leptin levels [3, 4]. This resistance may be situated at STATs then dissociate from the receptor and translocate to the nucleus as dimers to induce specific target genes. different levels in the leptin pathway, including saturation of transport through the blood-brain barrier, aberrations in JAK2 is constitutively associated with the membrane LR signal transduction or downstream effects on neural proximal box1 in the cytoplasmatic tail of the LR [10, 11]. networks in the hypothalamus [5, 6]. The intracellular part of the receptor also carries three conserved tyrosines at positions Y985, Y1077 and Y1138 Leptin is a pleiotropic cytokine. Apart from its role in (murine numbering). The membrane distal tyrosine is em- energy homeostasis, it is also implicated in a range of bedded in aYXXQ motif and is responsible for the recruit- other, often peripheral processes, including immune re- ment of STAT3 [12, 13]. STAT3 activation was demon- sponse, bone formation, angiogenesis and reproduction. strated after leptin stimulation in the hypothalamus of mice Recent findings suggest that leptin is involved in a variety [14]. Knock-in mice containing an Y1138S mutation are of pathological processes, including cardiovascular and incapable of STAT3 activation and reveal a severely obese autoimmune diseases [7, 8]. phenotype. They do not show the infertility and reduced Given leptin’s wide range of important functions, its ac- size that is seen in db/db mice that are truncated in the long tivities must be under stringent control. In this review we LR, indicative of the involvement of other signal transduc- discuss the molecular mechanisms that are responsible for ers [15]. Leptin-induced activation of STAT1 and the modulation of signal transduction via the LR. A sche- STAT5B, in addition to STAT3, was shown in COS cells matic representation of LR signalling and modulation is and in HIT-T15 cells [16, 17]. In the latter cell line, STAT1 shown in figure 1. was activated via Y1138 while STAT5B activation oc- curred via both Y1138 and Y1077 [17]. Next to JAK-STAT signalling, leptin also activates other JAK-STAT SIGNALLING pathways. A number of adaptor molecules can associate with the receptor and link to several signalling pathways, At least 5 different LR isoforms exist, but the main player including the mitogen-activated protein kinase (MAPK) doi: 10.1684/ecn.2006.0040 responsible for signal transduction is the long isoform of pathway (see below) and the phosphoinositol 3-kinase

- 146 - 212 D. Lavens, et al.

L LR

PTP1B P JAK JAK Box1 Box1 PI3K-pathway P SOCS1

Grb2 P P Y985 P SOCS3 Shp2 MAPK-pathway P CIS P STAT5 P Y1077 Y1077

P Y1138 Y1138 P SOCS2 STAT3

Figure 1 Schematic representation of LR signalling and negative regulation. For abbreviations, refer to the main text.

(PI3K) pathway. In the latter, the JAK2-interacting protein, the transmembrane domain [22]. Whether external stimuli SH2-B, mediates binding of IRS (insulin receptor sub- modulate this LR localisation throughout the cell and in strate) proteins that function as adaptors for PI3K [18, 19]. this way regulate leptin sensitivity remains to be deter- PI3K transforms phosphatidylinositol4,5-biphosphate mined. 125 (PIP2) into phosphatidylinositol3,4,5-triphosphate (PIP3) I-labeled leptin uptake experiments demonstrated that eventually resulting in reduced levels of cAMP. It was also LRs are also internalized upon ligand binding via clathrin- demonstrated that leptin has an inhibitory role on hypotha- mediated endocytosis leading to leptin degradation in the lamic AMPK (AMP-activated protein kinase) activity lysosomes [21, 23]. An internalisation signal was identi- which contributes to body weight regulation [20]. fied in the intracellular part of the receptor in immediate proximity to the membrane [23]. Compared with other LR splice variants, the long LR isoform seemed to be depleted MODULATION OF FUNCTIONAL RECEPTOR relatively quickly from the cell surface upon leptin expo- EXPRESSION sure, suggesting it is most sensitive to leptin-induced down-regulation while its limited recycling to the cell Obviously, receptor internalisation is an effective mecha- membrane was slow [21-24]. This favoured down- nism for rapidly turning off cytokine signalling. Upon modulation of LR signalling may be implicated in leptin ligand binding, cytokine receptors can be internalized via resistance [25, 26]. the clathrin-coated pit pathway into early endosomes. Recently, it was demonstrated that both the long LR and Trafficking dynamics of the LR with receptor internalisa- the short LR, a membrane-anchored isoform with a short tion and subsequent degradation or recycling back to the cytoplasmic tail, become ubiquitinated. Unlike for the cell surface clearly are involved in the regulation of leptin long LR, this ubiquitination is essential for clathrin- signalling. In steady-state conditions, no more than 25% of mediated endocytosis of the short LR [27]. Many aspects the LR is located at the cell surface, whilst the majority of of the mechanisms underlying LR cell surface expression the LR are found in intracellular pools [21]. This distribu- and internalisation remain to be elucidated. It is likely that tion of the LR may be explained by its tendency to consti- additional proteins involved in ubiquitination of the (acti- tutive endocytosis resulting in short-lived membrane ex- vated) LR complex remain to be identified. pression. In addition, some of the newly-synthesized LRs A soluble form of the LR associates with circulating leptin are retained intracellularly based on a retention signal in [28]. Secreted cytokine receptors can protect their ligands

- 147 - Review: negative regulation of leptin receptor signalling 213 from either degradation or clearance and thus significantly forebrain-specific SHP-2-deficient mice revealed that extend their half-life or they can act as antagonists, captur- SHP-2 moderately down-modulates JAK2 and STAT3 ac- ing their ligand and thus preventing signalling by their tivation in vivo [50]. Although SHP-2 has a modest role in membrane-spanning counterparts. In mice, the soluble LR terminating leptin signal transduction, its dominant induc- is generated by alternative mRNA splicing. In contrast, no tion of the ERK pathway makes it overall an enhancer of such mRNA splice variant has been discovered in humans; leptin signalling, whereby it may function as a switch a secreted human LR is generated by ectodomain shedding towards MAPK signalling. of membrane-anchored LRs including the signalling long Protein tyrosine phosphatase 1B (PTP1B) is a crucial form, by a hitherto unknown protease [29-31]. Although protein tyrosine phosphatase implicated in the negative the soluble LR appears important for keeping leptin avail- regulation of leptin receptor signalling. PTP1B deficiency able in circulation, it is at the same time, capable of results in hypersensitivity to insulin and leptin in mice, and competing with the long LR isoform for leptin binding and leads to protection from high fat diet obesity [51]. PTP1B may suppress leptin action in that way [32-35]. This could harbours two phosphotyrosine binding pockets in its cata- indicate that the secreted LR plays an important role in lytic domain that determine its intrinsic specificity. A con- determining leptin levels available for signal transduction. sensus substrate recognition motif was found in the kinase It is of note that the relative concentrations of the soluble activation loop of the insulin receptor and in JAK2 [52-54]. LR and free leptin are similar, while in obese individuals Both in vivo and in vitro data demonstrate that PTP1B concentrations of free leptin exceed by far the concentra- targets LR signalling predominantly by dephosphorylating tions of secreted LR [36]. JAK2 [55-58]. PTP1B is a negative mediator of both the JAK-STAT and MAPK pathway in leptin receptor signal- ling. PTP1B-mediated hypophosphorylation of JAK2 in a PHOSPHATASES mouse hypothalamic neuronal cell line abrogated the leptin-dependent induction of the STAT3 and MAPK in- SH2 domain-containing phosphatase-2 (SHP-2) is a con- ducible SOCS3 and c-fos genes, respectively [56]. Re- stitutively expressed protein tyrosine phosphatase known cently, leptin induced PTP1B was observed in liver, raising to be involved in the dephosphorylation of the JAKs. It the possibility that PTP1B may also function in a negative carries two tandem SH2 domains followed by a tyrosine feedback loop [59]. Diet-induced obesity is associated phosphatase catalytic domain and associates directly with with increased hepatic PTP1B levels. Aberrant PTP1B the LR at position Y985 [37]. The exact role of SHP-2 in activity is implicated in leptin resistance and PTP1B is LR signalling has been a long standing matter of debate. currently being investigated as a drug target in obesity Despite its initial identification as an inhibitor of LR sig- [60-63]. nalling (see below), it also appeared as a strong activator of PTP1B is localized predominantly on the ER (endoplas- the MAPK pathway. ERK activation occurs predominantly mic reticulum) via its C-terminal hydrophobic targeting via SHP-2 recruitment at tyrosine Y985 via its C-terminal sequence [64]. How PTP1B acts on its substrates remains SH2 domain. SHP-2 is phosphorylated by JAK2 and forms unclear. It was demonstrated that the platelet-derived a docking site for the adaptor protein growth factor recep- growth factor (PDGF) receptor becomes dephosphoryl- tor binding 2 (Grb2) leading to the activation of the ERK ized by PTP1B at the ER after internalization [65]. Re- signalling cascade [12]. Alternatively, ERK is also directly cently, direct interaction of PTP1B with the insulin recep- activated by JAK2, but still requires the intervention of tor was observed in a perinuclear endosome compartment SHP-2 [38]. Leptin-triggered activation of MAPK was [66]. On the other hand, it has been demonstrated that observed both peripherally and centrally. Recently, regu- internalisation of the insulin receptor is not essential for lation of calcium fluxes involving MAPK activity was interaction with PTP1B and subsequent dephosphoryla- shown in lateral hypothalamic neurons upon leptin stimu- tion [67]. In line with this, proteolytic cleavage of PTP1B lation [39]. Also, NO (nitric oxide) production induced by can lead to the relocalization of the catalytic domain of leptin via MAPK activation was observed in white adipo- PTP1B to the cytosol [68]. cytes [40]. Moreover, leptin induced MAPK is involved in The ubiquitously expressed phosphatase and tensin homo- full activation of the DNA binding of STAT3 by mediating logue deleted on chromosome ten (PTEN) is a tumour serine phosphorylation at position S727 of STAT3 [41]. suppressor protein and its mutation is linked with several On the other hand, many reports have also attributed an human cancer types [69]. It belongs to the family of protein inhibitory role to the SHP-2 phosphatase in LR signalling. tyrosine phosphatases but also possesses lipid phosphatase Mutation of the Y986 position in the human LR led to activity. PTEN suppresses the PI3K pathway by hydrolyz- augmented STAT3 signalling, and inhibitory properties ing the secondary messenger PIP3 back to PIP2. [70]. It associated with this position were ascribed to the negative was demonstrated that hypothalamic PI3K is involved in regulatory function of SHP-2 [42]. However, suppressor of leptin-induced reduction in food intake [19]. Surprisingly, cytokine signalling 3 (SOCS3), identified as a strong in- specific disruption of PTEN restricted to the hypothalamic hibitor of LR signalling (see below), was found to interact neurons expressing the anorexigenic proopiomelanocortin with the corresponding Y985 position in the murine LR (POMC) neuropeptide results in an obese phenotype asso- [43-45]. SOCS3 is part of the SOCS family and its inhibi- ciated with leptin resistance [71]. tory mechanism is discussed below. SHP-2 and SOCS3 have very similar binding specificities, and overlapping binding sites were also observed for the gp130 chain SUPPRESSORS OF CYTOKINE SIGNALLING [46-49]. Thus, the negative regulation associated with the membrane proximal tyrosine position is partly attributed The family of SOCS proteins consists of 8 members: to SOCS3. However, SHP-2-mediated dephosphorylation cytokine inducible SH2 protein (CIS) and SOCS1 through of JAK2 was demonstrated in vitro [37]. Recently, SOCS7. SOCS proteins have a characteristic domain

- 148 - 214 D. Lavens, et al. structure which is represented in figure 2. They carry a leptin signalling and suggest a prominent role in leptin central SH2 domain, an N-terminal preSH2 domain with resistance. an ESS (extended SH2 subdomain) region and in some Only SOCS1 and 3 carry a KIR domain in their N-terminal cases a kinase inhibitory region (KIR) domain and a region involved in direct inhibition of the JAK kinase C-terminal SOCS-box [72]. The N-terminal domain varies activity. They both inhibit leptin receptor signalling, using in length and composition while the SH2 domain and the a slightly different mechanism. SOCS1 directly interacts SOCS-box are more conserved. They also carry one or two with the kinase domain of JAK2 by targeting the phospho- conserved tyrosines in the C-terminus of their SOCS-box. tyrosine at position Y1007 in the activation loop of JAK2 SOCS proteins can interfere with cytokine signalling at [81, 82]. The KIR domain is essential for the inhibitory different levels. They can interact with phosphotyrosine function of the SOCS protein [82]. It associates with the motifs in activated cytokine receptor complexes by means catalytic groove of JAK2 and is suggested to act as a of their SH2 domain, thereby hindering association of pseudosubstrate which mimics the activation loop that signalling molecules. The SOCS-box of SOCS proteins is regulates access to the catalytic groove [81, 82]. It may identified as a key mediator in targeting associated proteins obstruct the ATP binding pocket and hinder accessibility for proteasomal degradation. It associates with elonginB/C for substrates [81, 82]. Unlike SOCS1, SOCS3 has only via its BC-box and takes part in a multi-protein complex weak affinity for JAK2. It is thought to inhibit the kinase that acts as an E3 ligase known to link ubiquitin to the activity through its KIR domain after binding via its SH2 substrate. Finally, the kinase activity of the JAKs can be domain with phosphotyrosine motifs in the receptor in abolished through the KIR domain. close proximity to the JAKs [83]. Indeed, SOCS3 associ- SOCS proteins are typically part of a negative feedback ates with the LR at the membrane proximal tyrosine Y985 loop. They are induced upon cytokine stimulation and domain [44, 84]. It also weakly binds the highly similar attenuate signalling by various cytokine receptors, allow- Y1077 interaction site, with an accessory effect on LR ing possible cross-regulation among cytokine systems. signalling inhibition [84]. Leptin induces SOCS3 expression in a rapid and transient Using the MAPPIT technique, a two-hybrid method based manner while CIS expression accumulates over a longer on cytokine signalling, we recently demonstrated the inter- period of time [43, 73, 74]. A role for leptin has also been action of CIS and SOCS2, two other members of the SOCS implicated in the expression of SOCS1 and, to a lesser protein family, with the LR [45, 74]. We showed that CIS extent of SOCS2 [74, 75]. interacts with the two membrane proximal tyrosine motifs SOCS3 was identified as a potent inhibitor of LR signal- at positions Y985 and Y1077, while SOCS2 only associ- ling [43]. Its STAT3-mediated expression is induced in the ated with the latter of the two. Phosphotyrosine specific hypothalamus and liver after peripheral leptin administra- interaction of SOCS2 with the LR Y1077 motif was con- tion in leptin-deficient ob/ob mice [12, 43, 76]. SOCS3 is a firmed by peptide affinity chromatography (PAC). Using functional marker for identification of leptin-sensitive neu- this method, we also demonstrated that SOCS2 binds rons in the hypothalamus [77]. In these hypothalamic specifically to the phosphotyrosine Y1138 peptide. An neurons of the leptin-resistant lethal yellow (Ay/a) mouse overview of LR/SOCS interactions is given in table 1. model, elevated levels of SOCS3 were found [43]. Unlike Interactions with the LR Y1138 motif and those involving SOCS3-deficient mice that die in utero, SOCS3 haploin- SOCS1 were only analysed using PAC since in these cases sufficient or neural-cell specific-deficient mice are viable interference occurs with the MAPPIT read-out. Of note, and show augmented leptin sensitivity in the hypothala- MAPPIT proved to be a highly sensitive technique that can mus and a remarkable attenuation of diet-induced obesity detect weak or transient (but functionally relevant) inter- [78, 79]. It was demonstrated that SOCS3 action is in- actions that could not be detected by PAC. volved in rendering the LR refractory to reactivation after CIS and SOCS2 are known inhibitors of STAT5 activation. chronic leptin stimulation [80]. These observations show Although negative regulation of a leptin-induced STAT3 SOCS3 up as a key mediator of negative regulation of binding reporter gene by CIS was suggested, we did not

CIS

SOCS1

SOCS2

SOCS3

SOCS4

SOCS5

SOCS6

SOCS7 Pre SH2 SH2 SOCS box

Figure 2 Schematic overview of SOCS protein structure. The KIR domain is indicated with a black box, the C-terminal, conserved tyrosines are represented by a black line.

- 149 - Review: negative regulation of leptin receptor signalling 215

Table 1 Binding of the SOCS proteins, CIS and SOCS1 through SOCS3, with the tyrosines of the LR based on peptide affinity chromatography (PAC) with corresponding phosphorylated and non-phosphorylated tyrosine motifs and based on mammalian protein-protein interaction trap (MAPPIT) [74, 84, 100]

PY985 PY1077 PY1138 MAPPIT PAC MAPPIT PAC PAC CIS + - + - - SOCS1 - - - SOCS2 - - + + + SOCS3 + + - /+ + -

observe any inhibitory effect on STAT3-mediated LR sig- C-terminus of its SOCS-box is also involved in substrate nalling by either CIS or SOCS2 [73, 74]. Instead, we recognition [91, 92]. suggest an inhibitory role in leptin-induced STAT5 signal- Recently, it has become clear that regulation by certain ling through interference with STAT5a recruitment to the SOCS proteins can be more complex than a mere negative Y1077 tyrosine motif in a MAPPIT based experiment [74]. feedback loop. It has been demonstrated that, apart from its Supporting this notion, SOCS2 binding completely over- negative regulatory effects, SOCS2 can also have positive laps with STAT5 association at the LR. CIS and SOCS2 effects on cytokine signalling, as was clearly observed in may be implicated in preventing recruitment of down- vivo and in vitro for GHR signalling [93, 94]. SOCS2 stream signalling moieties to the LR. Both SOCS2 knock- interference with other SOCS proteins has been observed outs and CIS transgenes show growth abnormalities, the in several cytokine receptor systems including LR signal- former being larger and the latter smaller than normal [85, ling [74, 93, 95, 96, 97]. We recently demonstrated that 86]. Although both SOCS proteins are negative regulators SOCS2 interferes with the association of CIS to the mem- of GH signalling, growth retardation in people with a brane proximal tyrosine of the LR, although no direct truncated LR as well as in LR null db/db mice suggests binding of SOCS2 with this tyrosine position was demon- these SOCS proteins may additionally influence growth strated [74]. In addition, SOCS2 can impair the inhibitory via the LR [15, 87]. Leptin has been identified as a pro- effect of SOCS1 or SOCS3 on leptin-induced signalling. inflammatory cytokine [88]. It is implicated in the patho- This effect strictly relied on the presence of the SOCS-box genesis of several autoimmune diseases including rheuma- of both SOCS-proteins, since deletion of the SOCS-box of toid arthritis, multiple sclerosis and inflammatory bowel either SOCS2 or SOCS1 and SOCS3 abolished complete disease [7, 8]. A role for leptin was described in T-cell SOCS2 interference [97]. SOCS2 is demonstrated to asso- proliferation and switching towards a Th1 response [89]. ciate with all members of the SOCS protein family [74, 96, CIS transgenic mice exhibit a shift to activation of Th2 97]. Abolishing the elonginB/C recruitment potential of cells [85], an effect that may, in part, be explained by its effect on leptin signalling in T-cells. More detailed analy- SOCS2 has no effect on its SOCS interaction capacity but sis in cell-type specific expression and function will be leads to complete loss of its functional interfering charac- needed to elucidate the specific roles of SOCS proteins in teristics [74, 97]. SOCS2 influences the stability of target leptin signalling. Possibly, different physiological func- SOCS proteins and this effect is sensitive to proteasome tions of leptin may be under the control of different SOCS inhibitors and clearly relies on the presence of its BC-box proteins. [96, 97]. Together, these data strongly suggest that SOCS2 More detailed examination of the binding modalities of can target SOCS proteins for degradation and regulate SOCS proteins with the LR reveals that the SOCS-box of SOCS protein turnover. In addition, we demonstrated that CIS is implicated in the association with the LR (Lavens et SOCS6 and SOCS7 are also capable of interacting with the al., in press). The conserved C-terminal tyrosine at posi- SOCS protein family members. Similar potentiating ef- tionY253 is essential for binding to both membrane proxi- fects as with SOCS2 are observed for SOCS6 in LR mal tyrosines. The same phenomenon is also observed for signalling as well as other cytokine receptor systems [97]. interaction with other cytokine receptors such as the EpoR This cross-regulatory effect of SOCS proteins may be of but not for association with the unrelated MyD88 protein, great importance in restoring cellular sensitivity after cy- an adaptor protein involved in toll-like receptor (TLR) tokine stimulation. Indeed, it has been reported that the signalling [74, 90]. In contrast, the corresponding expression of SOCS2 is in many cases more prolonged C-terminal tyrosine or even the entire SOCS-box of the than that seen for other SOCS proteins [96-100]. highly related SOCS2 protein are not essential for interac- Using the MAPPIT methodology, we recently demon- tion with the LR, and deletion of the SOCS-box also, strated that SOCS6 and SOCS7 also interact with the LR. hardly influenced the inhibitory capacity of SOCS1 or Both associate with the Y1077 motif whilst only SOCS7 SOCS3 on LR signalling [74]. This indispensable role of interacts with the more membrane proximal tyrosine the SOCS-box for binding with the LR (and likely other [101]. It was reported that SOCS7 is implicated in LR cytokine receptors as well), is probably an exclusive char- signalling termination. It can inhibit STAT3 activation acteristic of CIS. The exact functional role of the which we speculate may involve LR association, but it can C-terminus of CIS is still unclear. This observation is very also interact with activated STAT3 molecules to prevent reminiscent of the Von Hippel-Lindau protein whereby the them from translocating to the nucleus [102].

- 150 - 216 D. Lavens, et al.

CONCLUSION 11. Kloek C, Haq AK, Dunn SL, Lavery HJ, Banks AS, Myers Jr. MG. Regulation of Jak kinases by intracellular leptin receptor se- quences. J Biol Chem 2002; 277: 41547. Leptin is involved in a variety of crucial processes includ- ing adipocyte metabolism and immune responses, and 12. Banks AS, Davis SM, Bates SH, Myers Jr. MG. Activation of aberrant leptin signalling has been implicated in several downstream signals by the long form of the leptin receptor. J Biol pathophysiological processes. Tight control mechanisms Chem 2000; 275: 14563. exist that regulate leptin receptor signal transduction. To- 13. Haan S, Hemmann U, Hassiepen U, Schaper F, Schneider- day, SOCS3 and PTP1B are the two molecules that are Mergener J, Wollmer A, Heinrich PC, Grotzinger J. Characteriza- most associated with modulation of LR signalling. How- tion and binding specificity of the monomeric STAT3-SH2domain. ever, the involvement of other mechanisms and molecules, J Biol Chem 1999; 274: 1342. especially other SOCS proteins is emerging. It is likely that the different inhibitory molecules may be implicated in the 14. Vaisse C, Halaas JL, Horvath CM, Darnell Jr. JE, Stoffel M, Friedman JM. Leptin activation of Stat3 in the hypothalamus of regulation of leptin functions in different cell types. Fur- wild-type and ob/ob mice but not db/db mice. Nat Genet 1996; 14: ther investigation will be needed to clarify the complex 95. regulatory mechanisms that control leptin receptor signal- ling in many vital processes. 15. Bates SH, Stearns WH, Dundon TA, Schubert M, Tso AW, Wang Y, Banks AS, Lavery HJ, Haq AK, Maratos-Flier E, Neel BG, Schwartz MW, Myers Jr. MG. STAT3 signalling is re- Acknowledgements. We greatly acknowledge Prof. Joël Vande- quired for leptin regulation of energy balance but not reproduction. kerckhove for continued support. This work was supported by Nature 2003; 421: 856. grants from the Flanders Institute of Science and Technology (GBOU 010090 grant), from The Fund for Scientific Research – 16. Baumann H, Morella KK, White DW, Dembski M, Bailon PS, Flanders (FWO-V Grant N° 1.5.446.98) and from Ghent Uni- Kim H, Lai CF, Tartaglia LA. The full-length leptin receptor has versity (GOA 12051401). signaling capabilities of interleukin 6-type cytokine receptors. Proc Natl Acad Sci USA 1996; 93: 8374.

17. Hekerman P, Zeidler J, Bamberg-Lemper S, Knobelspies H, Lavens D, Tavernier J, Joost HG, Becker W. Pleiotropy of leptin REFERENCES receptor signalling is defined by distinct roles of the intracellular tyrosines. FEBS J 2005; 272: 109. 1. Bado A, Levasseur S, Attoub S, Kermorgant S, Laigneau JP, Bortoluzzi MN, Moizo L, Lehy T, Guerre-Millo M, Marchand- 18. Duan C, Li M, Rui L. SH2-B promotes insulin receptor substrate 1 Brustel Y, Lewin MJ. The stomach is a source of leptin. Nature (IRS1)- and IRS2-mediated activation of the phosphatidylinositol 1998; 394: 790. 3-kinase pathway in response to leptin. J Biol Chem 2004; 279: 43684. 2. Zhang Y, Proenca R, Maffei M, Barone M, Leopold L, Friedman JM. Positional cloning of the mouse obese gene and its 19. Niswender KD, Morton GJ, Stearns WH, Rhodes CJ, Myers Jr. human homologue. Nature 1994; 372: 425. MG, Schwartz MW. Intracellular signalling. Key enzyme in leptin- induced anorexia. Nature 2001; 413: 794. 3. Maffei M, Halaas J, Ravussin E, Pratley RE, Lee GH, Zhang Y, Fei H, Kim S, Lallone R, Ranganathan S. Leptin levels in human 20. Minokoshi Y, Alquier T, Furukawa N, Kim YB, Lee A, Xue B, and rodent. measurement of plasma leptin and ob RNA in obese Mu J, Foufelle F, Ferre P, Birnbaum MJ, Stuck BJ, Kahn BB. and weight-reduced subjects. Nat Med 1995; 1: 1155. AMP-kinase regulates food intake by responding to hormonal and nutrient signals in the hypothalamus. Nature 2004; 428: 569. 4. Considine RV, Sinha MK, Heiman ML, Kriauciunas A, Stephens TW, Nyce MR, Ohannesian JP, Marco CC, McKee LJ, 21. Barr VA, Lane K, Taylor SI. Subcellular localization and internal- Bauer TL. Serum immunoreactive-leptin concentrations in ization of the four human leptin receptor isoforms. JBiolChem normal-weight and obese humans. NEnglJMed1996; 334: 292. 1999; 274: 21416.

5. El Haschimi K, Pierroz DD, Hileman SM, Bjorbaek C, Flier JS. 22. Belouzard S, Delcroix D, Rouille Y. Low levels of expression of Two defects contribute to hypothalamic leptin resistance in mice leptin receptor at the cell surface result from constitutive endocy- with diet-induced obesity. J Clin Invest 2000; 105: 1827. tosis and intracellular retention in the biosynthetic pathway. J Biol Chem 2004; 279: 28499. 6. Munzberg H, Myers Jr. MG. Molecular and anatomical determi- 23. Uotani S, Bjorbaek C, Tornoe J, Flier JS. Functional properties of nants of central leptin resistance. Nat Neurosci 2005; 8: 566. leptin receptor isoforms. internalization and degradation of leptin Diabetes 7. Peelman F, Waelput W, Iserentant H, Lavens D, Eyckerman S, and ligand-induced receptor downregulation. 1999; 48: Zabeau L, Tavernier J. Leptin. linking adipocyte metabolism with 279. Prog Lipid Res cardiovascular and autoimmune diseases. 2004; 43: 24. Lundin A, Rondahl H, Walum E, Wilcke M. Expression and intra- 283. cellular localization of leptin receptor long isoform-GFP chimera. Biochim Biophys Acta 2000; 1499: 130. 8. Matarese G, Moschos S, Mantzoros CS. Leptin in immunology. J Immunol 2005; 174: 3137. 25. Fruhbeck G. Intracellular signalling pathways activated by leptin. Biochem J 2006; 393: 7. 9. Ghilardi N, Ziegler S, Wiestner A, Stoffel R, Heim MH, Skoda RC. Defective STAT signaling by the leptin receptor in 26. Sweeney G. Leptin signalling. Cell Signal 2002; 14: 655. diabetic mice. Proc Natl Acad Sci USA 1996; 93: 6231. 27. Belouzard S, Rouille Y. Ubiquitylation of leptin receptor OB-Ra 10. Bahrenberg G, Behrmann I, Barthel A, Hekerman P, Heinrich PC, regulates its clathrin-mediated endocytosis. EMBO J 2006; 25: Joost HG, Becker W. Identification of the critical sequence ele- 932. ments in the cytoplasmic domain of leptin receptor isoforms re- quired for Janus kinase/signal transducer and activator of transcrip- 28. Li C, Ioffe E, Fidahusein N, Connolly E, Friedman JM. Absence tion activation by receptor heterodimers. Mol Endocrinol 2002; 16: of soluble leptin receptor in plasma from dbPas/dbPas and other 859. db/db mice. J Biol Chem 1998; 273: 10078.

- 151 - Review: negative regulation of leptin receptor signalling 217

29. Lee GH, Proenca R, Montez JM, Carroll KM, Darvishzadeh JG, 47. Fairlie WD, De Souza D, Nicola NA, Baca M. Negative regulation Lee JI, Friedman JM. Abnormal splicing of the leptin receptor in of gp130 signalling mediated through tyrosine-757 is not depen- diabetic mice. Nature 1996; 379: 632. dent on the recruitment of SHP2. Biochem J 2003; 372: 495.

30. Ge H, Huang L, Pourbahrami T, Li C. Generation of soluble leptin 48. Nicholson SE, De Souza D, Fabri LJ, Corbin J, Willson TA, receptor by ectodomain shedding of membrane-spanning receptors Zhang JG, Silva A, Asimakis M, Farley A, Nash AD, Metcalf D, in vitro and in vivo. J Biol Chem 2002; 277: 45898. Hilton DJ, Nicola NA, Baca M. Suppressor of cytokine signaling-3 preferentially binds to the SHP-2-binding site on the 31. Maamra M, Bidlingmaier M, Postel-Vinay MC, Wu Z, Strasburger shared cytokine receptor subunit gp130. Proc Natl Acad Sci USA CJ, Ross RJ. Generation of human soluble leptin receptor by pro- 2000; 97: 6493. teolytic cleavage of membrane-anchored receptors. Endocrinology 2001; 142: 4389. 49. Schmitz J, Weissenbach M, Haan S, Heinrich PC, Schaper F. SOCS3 exerts its inhibitory function on interleukin-6 signal trans- 32. Liu C, Liu XJ, Barry G, Ling N, Maki RA, De Souza EB. Expres- duction through the SHP2 recruitment site of gp130. JBiolChem sion and characterization of a putative high affinity human soluble 2000; 275: 12848. leptin receptor. Endocrinology 1997; 138: 3548. 50. Zhang EE, Chapeau E, Hagihara K, Feng GS. Neuronal Shp2 ty- 33. Huang LJ, Constantinescu SN, Lodish HF. The N-terminal domain rosine phosphatase controls energy balance and metabolism. Proc of Janus kinase 2 is required for Golgi processing and cell surface Natl Acad Sci USA 2004; 101: 16064. expression of erythropoietin receptor. Mol Cell 2001; 8: 1327. 51. Elchebly M, Payette P, Michaliszyn E, Cromlish W, Collins S, 34. Zastrow O, Seidel B, Kiess W, Thiery J, Keller E, Bottner A, Loy AL, Normandin D, Cheng A, Himms-Hagen J, Chan CC, Ra- Kratzsch J. The soluble leptin receptor is crucial for leptin action. machandran C, Gresser MJ, Tremblay ML, Kennedy BP. In- evidence from clinical and experimental data. Int J Obes Relat creased insulin sensitivity and obesity resistance in mice lacking Metab Disord 2003; 27: 1472. the protein tyrosine phosphatase-1B gene. Science 1999; 283: 1544. 35. Yang G, Ge H, Boucher A,Yu X, Li C. Modulation of direct leptin signaling by soluble leptin receptor. Mol Endocrinol 2004; 18: 52. Myers MP, Andersen JN, Cheng A, Tremblay ML, Horvath CM, 1354. Parisien JP, Salmeen A, Barford D, Tonks NK. TYK2 and JAK2 36. van Dielen FM, van ’, V, Buurman WA, Greve JW. Leptin and are substrates of protein-tyrosine phosphatase 1B. JBiolChem soluble leptin receptor levels in obese and weight-losing individu- 2001; 276: 47771. J Clin Endocrinol Metab als. 2002; 87: 1708. 53. Salmeen A, Andersen JN, Myers MP, Tonks NK, Barford D. Mo- 37. Li C, Friedman JM. Leptin receptor activation of SH2 domain lecular basis for the dephosphorylation of the activation segment of containing protein tyrosine phosphatase 2 modulates Ob receptor the insulin receptor by protein tyrosine phosphatase 1B. Mol Cell signal transduction. Proc Natl Acad Sci USA 1999; 96: 9677. 2000; 6: 1401.

38. Bjorbaek C, Buchholz RM, Davis SM, Bates SH, Pierroz DD, 54. Walchli S, Espanel X, Harrenga A, Rossi M, Cesareni G, Van Gu H, Neel BG, Myers Jr. MG, Flier JS. Divergent roles of SHP-2 Huijsduijnen RH. Probing protein-tyrosine phosphatase substrate in ERK activation by leptin receptors. J Biol Chem 2001; 276: specificity using a phosphotyrosine-containing phage library. 4747. J Biol Chem 2004; 279: 311.

39. Jo YH, Chen YJ, Chua Jr. SC, Talmage DA, Role LW. Integration 55. Cheng A, Uetani N, Simoncic PD, Chaubey VP, Lee-Loy A, of endocannabinoid and leptin signaling in an appetite-related McGlade CJ, Kennedy BP, Tremblay ML. Attenuation of leptin neural circuit. Neuron 2005; 48: 1055. action and regulation of obesity by protein tyrosine phosphatase 1B. Dev Cell 2002; 2: 497. 40. Mehebik N, Jaubert AM, Sabourault D, Giudicelli Y, Ribiere C. Leptin-induced nitric oxide production in white adipocytes is me- 56. Kaszubska W, Falls HD, Schaefer VG, Haasch D, Frost L, diated through PKA and MAP kinase activation. Am J Physiol Cell Hessler P, Kroeger PE, White DW, Jirousek MR, Trevillyan JM. Physiol 2005; 289: C379. Protein tyrosine phosphatase 1B negatively regulates leptin signal- ing in a hypothalamic cell line. Mol Cell Endocrinol 2002; 195: 41. O’Rourke L, Shepherd PR. Biphasic regulation of extracellular- 109. signal-regulated protein kinase by leptin in macrophages. role in regulating STAT3 Ser727 phosphorylation and DNA binding. Bio- 57. Lund IK, Hansen JA, Andersen HS, Moller NP, Billestrup N. chem J 2002; 364: 875. Mechanism of protein tyrosine phosphatase 1B-mediated inhibi- tion of leptin signalling. J Mol Endocrinol 2005; 34: 339. 42. Carpenter LR, Farruggella TJ, Symes A, Karow ML,Yancopoulos GD, Stahl N. Enhancing leptin response by preventing SH2- 58. Zabolotny JM, Bence-Hanulec KK, Stricker-Krongrad A, Haj F, containing phosphatase 2 interaction with Ob receptor. Proc Natl Wang Y, Minokoshi Y, Kim YB, Elmquist JK, Tartaglia LA, Kah- Acad Sci USA 1998; 95: 6061. n BB, Neel BG. PTP1B regulates leptin signal transduction in vivo. Dev Cell 2002; 2: 489. 43. Bjorbaek C, Elmquist JK, Frantz JD, Shoelson SE, Flier JS. Iden- tification of SOCS-3 as a potential mediator of central leptin 59. Lam NT, Lewis JT, Cheung AT, Luk CT, Tse J, Wang J, Bryer- resistance. Mol Cell 1998; 1: 619. Ash M, Kolls JK, Kieffer TJ. Leptin increases hepatic insulin sen- sitivity and protein tyrosine phosphatase 1B expression. Mol Endo- 44. Bjorbak C, Lavery HJ, Bates SH, Olson RK, Davis SM, Flier JS, crinol 2004; 18: 1333. Myers Jr. MG. SOCS3 mediates feedback inhibition of the leptin receptor via Tyr985. J Biol Chem 2000; 275: 40649. 60. Hooft VH, Walchli S, Ibberson M, Harrenga A. Protein tyrosine phosphatases as drug targets. PTP1B and beyond. Expert Opin 45. Eyckerman S, Verhee A, der Heyden JV, Lemmens I, Ostade XV, Ther Targets 2002; 6: 637. Vandekerckhove J, Tavernier J. Design and application of a cytokine-receptor-based interaction trap. Nat Cell Biol 2001; 3: 61. Lam NT, Covey SD, Lewis JT, Oosman S, Webber T, Hsu EC, 1114. Cheung AT, Kieffer TJ. Leptin resistance following over- expression of protein tyrosine phosphatase 1B in liver. J Mol 46. De Souza D, Fabri LJ, Nash A, Hilton DJ, Nicola NA, Baca M. Endocrinol 2006; 36: 163. SH2 domains from suppressor of cytokine signaling-3 and protein tyrosine phosphatase SHP-2 have similar binding specificities. 62. Taylor SD. Inhibitors of protein tyrosine phosphatase 1B (PTP1B). Biochemistry 2002; 41: 9229. Curr Top Med Chem 2003; 3: 759.

- 152 - 218 D. Lavens, et al.

63. Tonks NK. PTP1B. from the sidelines to the front lines! FEBS Lett 79. Mori H, Hanada R, Hanada T, Aki D, Mashima R, Nishinakamura 2003; 546: 140. H, Torisu T, Chien KR, Yasukawa H, Yoshimura A. Socs3 defi- ciency in the brain elevates leptin sensitivity and confers resistance 64. Frangioni JV, Beahm PH, Shifrin V, Jost CA, Neel BG. The non- to diet-induced obesity. Nat Med 2004; 10: 739. transmembrane tyrosine phosphatase PTP-1B localizes to the en- doplasmic reticulum via its 35 amino acid C-terminal sequence. 80. Dunn SL, Bjornholm M, Bates SH, Chen ZB, Seifert M, Cell 1992; 68: 545. Myers MG. Feedback inhibition of leptin receptor/Jak2 signaling via Tyr(1138) of the leptin receptor and suppressor of cytokine 65. Haj FG, Verveer PJ, Squire A, Neel BG, Bastiaens PI. Imaging signaling 3. Mol Endocrinol 2005; 19: 925. sites of receptor dephosphorylation by PTP1B on the surface of the endoplasmic reticulum. Science 2002; 295: 1708. 81. Giordanetto F, Kroemer RT. A three-dimensional model of Sup- pressor Of Cytokine Signalling 1 (SOCS-1). Protein Eng 2003; 16: 66. Romsicki Y, Reece M, Gauthier JY, Asante-Appiah E, 115. Kennedy BP. Protein tyrosine phosphatase-1B dephosphorylation of the insulin receptor occurs in a perinuclear endosome compart- 82. Yasukawa H, Misawa H, Sakamoto H, Masuhara M, Sasaki A, ment in human embryonic kidney 293 cells. J Biol Chem 2004; Wakioka T, Ohtsuka S, Imaizumi T, Matsuda T, Ihle JN, 279: 12868. YoshimuraA. The JAK-binding protein JAB inhibits Janus tyrosine kinase activity through binding in the activation loop. EMBO J 67. Shi K, Egawa K, Maegawa H, Nakamura T, Ugi S, Nishio Y, 1999; 18: 1309. Kashiwagi A. Protein-tyrosine phosphatase 1B associates with in- sulin receptor and negatively regulates insulin signaling without receptor internalization. J Biochem (Tokyo) 2004; 136: 89. 83. Suzuki R, Sakamoto H, Yasukawa H, Masuhara M, Wakioka T, Sasaki A, Yuge K, Komiya S, Inoue A, Yoshimura A. CIS3 and JAB have different regulatory roles in interleukin-6 mediated dif- 68. Frangioni JV, Oda A, Smith M, Salzman EW, Neel BG. Calpain- ferentiation and STAT3 activation in M1 leukemia cells. Oncogene catalyzed cleavage and subcellular relocation of protein phospho- 1998; 17: 2271. tyrosine phosphatase 1B (PTP-1B) in human platelets. EMBO J 1993; 12: 4843. 84. Eyckerman S, Broekaert D, Verhee A, Vandekerckhove J, 69. Leslie NR, Downes CP. PTEN function. how normal cells control Tavernier J. Identification of theY985 andY1077 motifs as SOCS3 it and tumour cells lose it. Biochem J 2004; 382: 1. recruitment sites in the murine leptin receptor. FEBS Lett 2000; 486: 33. 70. Leslie NR, Downes CP. PTEN. The down side of PI 3-kinase signalling. Cell Signal 2002; 14: 285. 85. Matsumoto A, Seki Y, Kubo M, Ohtsuka S, Suzuki A, Hayashi I, Tsuji K, Nakahata T, Okabe M,Yamada S,Yoshimura A. Suppres- 71. Plum L, Ma X, Hampel B, Balthasar N, Coppari R, Munzberg H, sion of STAT5 functions in liver, mammary glands, and T cells in Shanabrough M, Burdakov D, Rother E, Janoschek R, Alber J, cytokine-inducible SH2-containing protein 1 transgenic mice. Mol Belgardt BF, Koch L, Seibler J, Schwenk F, Fekete C, Suzuki A, Cell Biol 1999; 19: 6396. Mak TW, Krone W, Horvath TL, Ashcroft FM, Bruning JC. En- hanced PIP(3) signaling in POMC neurons causes K(ATP) channel 86. Metcalf D, Greenhalgh CJ, Viney E, Willson TA, Starr R, activation and leads to diet-sensitive obesity. J Clin Invest 2006; Nicola NA, Hilton DJ, Alexander WS. Gigantism in mice lacking 116: 1886. suppressor of cytokine signalling-2. Nature 2000; 405: 1069.

72. Starr R, Willson TA, Viney EM, Murray LJ, Rayner JR, Jenkins 87. Clement K, Vaisse C, Lahlou N, Cabrol S, Pelloux V, Cassuto D, BJ, Gonda TJ, Alexander WS, Metcalf D, Nicola NA, Hilton DJ. Gourmelen M, Dina C, Chambaz J, Lacorte JM, Basdevant A, A family of cytokine-inducible inhibitors of signalling. Nature Bougneres P, Lebouc Y, Froguel P, Guy-Grand B. A mutation in 1997; 387: 917. the human leptin receptor gene causes obesity and pituitary dys- function. Nature 1998; 392: 398. 73. Emilsson V, Arch JR, de Groot RP, Lister CA, Cawthorne MA. Leptin treatment increases suppressors of cytokine signaling in 88. Fantuzzi G, Faggioni R. Leptin in the regulation of immunity, central and peripheral tissues. FEBS Lett 1999; 455: 170. inflammation, and hematopoiesis. J Leukoc Biol 2000; 68: 437.

74. Lavens D, Montoye T, Piessevaux J, Zabeau L, Vandekerckhove J, 89. Lord GM, Matarese G, Howard LK, Baker RJ, Bloom SR, Gevaert K, Becker W, Eyckerman S, Tavernier J. A complex inter- Lechler RI. Leptin modulates the T-cell immune response and action pattern of CIS and SOCS2 with the leptin receptor. J Cell Sci reverses starvation-induced immunosuppression. Nature 1998; 2006; 119: 2214. 394: 897. 75. Motta M, Accornero P, Baratta M. Leptin and prolactin modulate the expression of SOCS-1 in association with interleukin-6 and 90. Ketteler R, Moghraby CS, Hsiao JG, Sandra O, Lodish HF, tumor necrosis factor-alpha in mammary cells. a role in differenti- Klingmuller U. The cytokine-inducible Scr homology domain- ated secretory epithelium. Regul Pept 2004; 121: 163. containing protein negatively regulates signaling by promoting apoptosis in erythroid progenitor cells. J Biol Chem 2003; 278: 2654. 76. Waelput W, Verhee A, Broekaert D, Eyckerman S, Vandekerckhove J, Beattie JH, Tavernier J. Identification and expression analysis of leptin-regulated immediate early response and late target genes. 91. Hon WC, Wilson MI, Harlos K, Claridge TD, Schofield CJ, Biochem J 2000; 348(Pt 1): 55. Pugh CW, Maxwell PH, Ratcliffe PJ, Stuart DI, Jones EY. Struc- tural basis for the recognition of hydroxyproline in HIF-1 alpha by 77. Elias CF, Aschkenasi C, Lee C, Kelly J, Ahima RS, Bjorbaek C, pVHL. Nature 2002; 417: 975. Flier JS, Saper CB, Elmquist JK. Leptin differentially regulates NPY and POMC neurons projecting to the lateral hypothalamic 92. Lewis MD, Roberts BJ. Role of the C-terminal alpha-helical do- area. Neuron 1999; 23: 775. main of the von Hippel-Lindau protein in its E3 ubiquitin ligase activity. Oncogene 2004; 23: 2315. 78. Howard JK, Cave BJ, Oksanen LJ, Tzameli I, Bjorbaek C, Flier JS. Enhanced leptin sensitivity and attenuation of diet- 93. Favre H, Benhamou A, Finidori J, Kelly PA, Edery M. Dual ef- induced obesity in mice with haploinsufficiency of Socs3. Nat Med fects of suppressor of cytokine signaling (SOCS-2) on growth 2004; 10: 734. hormone signal transduction. FEBS Lett 1999; 453: 63.

- 153 - Review: negative regulation of leptin receptor signalling 219

94. Greenhalgh CJ, Metcalf D, Thaus AL, Corbin JE, Uren R, 99. Brender C, Nielsen M, Ropke C, Nissen MH, Svejgaard A, Morgan PO, Fabri LJ, Zhang JG, Martin HM, Willson TA, Billestrup N, Geisler C, Odum N. Interferon-alpha induces tran- Billestrup N, Nicola NA, Baca M, Alexander WS, Hilton DJ. Bio- sient suppressors of cytokine signalling expression in human T logical evidence that SOCS-2 can act either as an enhancer or cells. Exp Clin Immunogenet 2001; 18: 80. suppressor of growth hormone signaling. J Biol Chem 2002; 277: 40181. 100. Pezet A, Favre H, Kelly PA, Edery M. Inhibition and restoration of 95. Dif F, Saunier E, Demeneix B, Kelly PA, Edery M. Cytokine- prolactin signal transduction by suppressors of cytokine signaling. inducible SH2-containing protein suppresses PRL signaling by J Biol Chem 1999; 274: 24497. binding the PRL receptor. Endocrinology 2001; 142: 5286. 96. Tannahill GM, Elliott J, Barry AC, Hibbert L, Cacalano NA, Johnston JA. SOCS2 Can Enhance Interleukin-2 (IL-2) and IL-3 101. Montoye T, Piessevaux J, Lavens D, Wauman J, Catteeuw D, Signaling by Accelerating SOCS3 Degradation. Mol Cell Biol Vandekerckhove J, Lemmens I, Tavernier J. Analysis of leptin sig- 2005; 25: 9115. nalling in hematopoietic cells using an adapted MAPPIT strategy. FEBS Lett 2006; 580: 3301. 97. Piessevaux J, Lavens D, Montoye T, et al. Functional cross- modulation between SOCS proteins can stimulate cytokine signal- ling. J Biol Chem 2006; 281: 32953. 102. Martens N, Uzan G, Wery M, Hooghe R, Hooghe-Peters EL, Gertler A. Suppressor of cytokine signaling 7 inhibits prolactin, 98. Adams TE, Hansen JA, Starr R, Nicola NA, Hilton DJ, growth hormone, and leptin signaling by interacting with STAT5 or Billestrup N. Growth hormone preferentially induces the rapid, STAT3 and attenuating their nuclear translocation. J Biol Chem transient expression of SOCS-3, a novel inhibitor of cytokine receptor signaling. J Biol Chem 1998; 273: 1285. 2005; 280: 13817.

- 154 -

Part III : The many faces of the SOCS box

- 155 -

- 156 - CHAPTER 9: Enhanced cytokine signalling by SOCS box- dependent cross-regulation between SOCS proteins.

I. Introduction

Increasing evidence indicates that SOCS molecules not only act as inhibitors of cytokine responses but also play an essential role in determining cell fate by exerting broader regulatory mechanisms. SOCS proteins were for example shown to exert a stimulating effect on signal transduction of the RAS/MAPK pathway. In this respect, CIS increases ERK- and JNK-mediated MAPK signalling in activated T cells (Li et al., 2000). Tyrosine phosphorylation of the SOCS box of SOCS3 allows interaction with the Ras inhibitor p120RasGAP, resulting in sustained ERK activation (Cacalano et al., 2001). SOCS2 expression enhances ERK (and STAT) phoshorylation following cytokine treatment (Johnston, 2004). Also the Drosophila SOCS44A protein can have a stimulatory action on the EGFR/MAPK pathway (Rawlings et al., 2004). Additionally, positive effects were reported for SOCS2 and SOCS6 in other signalling cascades. SOCS6 increases AKT activation upon insulin stimulation possibly by interacting with the p85 monomer which is an attenuator of PI-3K dependent pathways. Accordingly, an improvement in glucose metabolism was observed in SOCS6 transgenic mice (Li et al., 2004). In vitro data demonstrated a dual effect of SOCS2 on GH responses with low concentrations having a suppressive effect while signalling is restored and even enhanced at higher concentrations (Favre et al., 1999). This paradoxal effect of SOCS2 is supported by in vivo data since deficiency and overexpression of SOCS2 in mice causes a similar phenotype characterized by enhanced growth (Greenhalgh et al., 2002; Metcalf et al., 2000).

In this paper we examined the molecular mechanisms underlying the positive effect of SOCS2 on cytokine signalling and show that SOCS2 can interfere with the inhibitory functions of SOCS1 and SOCS3 in GH, type I IFN and leptin signalling.

Chapter 9: Enhanced cytokine signalling by cross-regulation between SOCS proteins

- 157 - The modalities of this interfering effect were studied in greater detail. Using MAPPIT we found that SOCS2 (and SOCS6 and -7) can bind with all members of the SOCS protein family and the SOCS box of the targeted SOCS appears to be implicated. In analogy to the SOCS2 interference with CIS interaction at the LR described in chapter 6, this regulatory capacity of SOCS2 depends on Elongin B/C recruitment to its SOCS box. We observed SOCS2 mediated degradation of SOCS1 but not by its Elongin B/C recruitment-deficient mutant, suggesting that SOCS2 targets other SOCS proteins for proteasomal degradation. The cross-regulatory mechanism between SOCS molecules may be important for the restoration of cellular responsiveness for subsequent stimulation by eliminating excess SOCS levels.

II. Article: Functional cross-modulation between SOCS proteins can stimulate cytokine signalling. Published in Journal of Biological Chemistry, 2006

III. References

Cacalano, N. A., Sanden, D., and Johnston, J. A. (2001). Tyrosine-phosphorylated SOCS-3 inhibits STAT activation but binds to p120 RasGAP and activates Ras. Nat Cell Biol 3, 460-465. Favre, H., Benhamou, A., Finidori, J., Kelly, P. A., and Edery, M. (1999). Dual effects of suppressor of cytokine signaling (SOCS-2) on growth hormone signal transduction. FEBS Lett 453, 63-66. Greenhalgh, C. J., Metcalf, D., Thaus, A. L., Corbin, J. E., Uren, R., Morgan, P. O., Fabri, L. J., Zhang, J. G., Martin, H. M., Willson, T. A., et al. (2002). Biological evidence that SOCS-2 can act either as an enhancer or suppressor of growth hormone signaling. J Biol Chem 277, 40181-40184. Johnston, J. A. (2004). Are SOCS suppressors, regulators, and degraders? J Leukoc Biol 75, 743- 748. Li, L., Gronning, L. M., Anderson, P. O., Li, S., Edvardsen, K., Johnston, J., Kioussis, D., Shepherd, P. R., and Wang, P. (2004). Insulin induces SOCS-6 expression and its binding to the p85 monomer of phosphoinositide 3-kinase, resulting in improvement in glucose metabolism. J Biol Chem 279, 34107-34114. Li, S., Chen, S., Xu, X., Sundstedt, A., Paulsson, K. M., Anderson, P., Karlsson, S., Sjogren, H. O., and Wang, P. (2000). Cytokine-induced Src homology 2 protein (CIS) promotes T cell receptor-mediated proliferation and prolongs survival of activated T cells. J Exp Med 191, 985- 994. Metcalf, D., Greenhalgh, C. J., Viney, E., Willson, T. A., Starr, R., Nicola, N. A., Hilton, D. J., and Alexander, W. S. (2000). Gigantism in mice lacking suppressor of cytokine signalling-2. Nature 405, 1069-1073. Rawlings, J. S., Rennebeck, G., Harrison, S. M., Xi, R., and Harrison, D. A. (2004). Two Drosophila suppressors of cytokine signaling (SOCS) differentially regulate JAK and EGFR pathway activities. BMC Cell Biol 5, 38.

Chapter 9: Enhanced cytokine signalling by cross-regulation between SOCS proteins

- 158 - THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 281, NO. 44, pp. 32953–32966, November 3, 2006 © 2006 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.

Functional Cross-modulation between SOCS Proteins Can Stimulate Cytokine Signaling* Received for publication, January 25, 2006, and in revised form, August 31, 2006 Published, JBC Papers in Press, September 6, 2006, DOI 10.1074/jbc.M600776200 Julie Piessevaux‡1, Delphine Lavens‡1, Tony Montoye‡, Joris Wauman‡, Dominiek Catteeuw‡, Joe¨l Vandekerckhove‡, Denise Belsham§, Frank Peelman‡, and Jan Tavernier‡2 From the ‡Flanders Interuniversity Institute for Biotechnology, Department of Medical Protein Research, Faculty of Medicine and Health Sciences, Ghent University, Baertsoenkaai 3, B-9000 Ghent, Belgium and the §Department of Physiology, University of Toronto, Ontario M5S 1A8, Canada

SOCS (suppressors of cytokine signaling) proteins are nega- levels and involves receptor down-regulation, protein-tyrosine tive regulators of cytokine signaling that function primarily at phosphatases, protein inhibitors of activated STATs, and mem- the receptor level. Remarkably, in vitro and in vivo observations bers of the SOCS (suppressors of cytokine signaling) protein Downloaded from revealed both inhibitory and stimulatory effects of SOCS2 on family. growth hormone signaling, suggesting an additional regulatory The SOCS family consists of eight different members level. In this study, we examined the possibility of direct cross- (SOCS1–7 and CIS (cytokine-inducible SH2 domain-contain- modulation between SOCS proteins and found that SOCS2 ing protein)) characterized by conserved structural features. All could interfere with the inhibitory actions of other SOCS pro-

SOCS proteins consist of a central SH2 domain flanked by a www.jbc.org teins in growth hormone, interferon, and leptin signaling. This variable N-terminal region and a conserved C-terminal SOCS SOCS2 effect was SOCS box-dependent, required recruitment box (1, 2). The SH2 domain can inhibit STAT activation by of the elongin BC complex, and coincided with degradation of direct competition for the phosphorylated receptor recruit- target SOCS proteins. Detailed mammalian protein-protein ment sites (3–8). SOCS1 and SOCS3 carry an additional kinase at BIOMEDISCHE BIBLIOTHEEK on February 12, 2008 interaction trap (MAPPIT) analysis indicated that SOCS2 can inhibitory region (KIR) in their N-terminal domains that acts as interact with all members of the SOCS family. SOCS2 may thus a pseudosubstrate for the JAK kinase, thereby blocking signal- function as a molecular bridge between a ubiquitin-protein ing (5). The SOCS box was shown to act as an interaction isopeptide ligase complex and SOCS proteins, targeting them domain for the elongin BC complex (9, 10), which, in turn, is a for proteasomal turnover. We furthermore extended these component of an ubiquitin-protein isopeptide ligase (E3) com- observations to SOCS6 and SOCS7. Our findings point to a plex (11). This way, the SOCS box can control protein turnover unique regulatory role for SOCS2, SOCS6, and SOCS7 within by marking target proteins for proteasomal degradation (12). the SOCS family and provide an explanation for the unexpected However, the significance of the interaction between SOCS phenotypes observed in SOCS2 and SOCS6 transgenic mice. proteins and the elongin BC complex is not totally clarified, as some reports propose that elongin association targets SOCS molecules for proteasomal degradation (10, 12–15), whereas Cytokine signaling is typically a transient event, implying other data suggest that elongin BC binding stabilizes SOCS pro- rapid and finely tuned attenuation. Receptor binding leads to tein expression (9, 16, 17). rapid activation of receptor-associated members of the JAK3 Deletion studies of SOCS genes in mice have underscored family. Subsequent phosphorylation of tyrosine residues in the their importance in specific restricted cytokine signaling path- receptor tails enables recruitment of downstream signaling ways, e.g. SOCS1-deficient mice suffer from deregulated inter- molecules whereby STATs play a prominent role. Activated feron (IFN)-␥ signaling characterized by malfunctioning of the STATs translocate to the nucleus, where they control cytokine- immune system at several levels (18–20), and SOCS3 haplo- regulated gene transcription. Negative control occurs at many insufficient mice or mice with a specific deletion of SOCS3 in hypothalamic neurons show augmented central leptin sensitiv- ity (21, 22), suggesting a key role for SOCS3 in leptin resistance. * This work was supported by Flanders Institute of Science and Technology Grant GBOU 010090, Fund for Scientific Research-Flanders Grant FWO-V A special case concerns SOCS2, which can have opposing 1.5.446.98 (to J. P. and D. L.), and Ghent University Grant GOA 12051401. effects on growth hormone (GH) signaling: SOCS2 knock-out The costs of publication of this article were defrayed in part by the pay- mice exhibit an overgrowth phenotype because of prolonged ment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indi- GH-dependent STAT5 activity (23, 24), and paradoxically, cate this fact. overexpression of SOCS2 in a transgenic mouse model also 1 Both authors contributed equally to this work. leads to gigantism (25). This dual effect of SOCS2 is also 2 To whom correspondence should be addressed. Tel.: 32-9-264-9302; Fax: observed in vitro, where low SOCS2 doses moderately inhibit 32-9-264-9492; E-mail: [email protected]. 3 The abbreviations used are: JAK, Janus kinase; STATs, signal transducers and GH signaling, and higher levels positively regulate signaling activators of transcription; SH2, Src homology 2; E3, ubiquitin-protein (25–27). A similar phenomenon is observed for the effect of isopeptide ligase; IFN, interferon; GH, growth hormone; PRL, prolactin; SOCS2 on prolactin (PRL) (28) and interleukin-3 (29) signaling. GHR, growth hormone receptor; LR, leptin receptor; EpoR, erythropoietin receptor; SEAP, secreted alkaline phosphatase; MAPPIT, mammalian pro- The role of SOCS2 in regulating cytokine-induced signals is tein-protein interaction trap. obviously complex because increasing SOCS2 levels can over-

NOVEMBER 3, 2006•VOLUME 281•NUMBER 44 JOURNAL OF BIOLOGICAL CHEMISTRY 32953 - 159 - SOCS Cross-regulation come the negative effect of SOCS1 on GH receptor (GHR) and ery. N38 cells were transfected using Lipofectamine 2000 PRL signaling and can partially restore the SOCS3 down-regu- (Invitrogen) following the manufacturer’s guidelines. One day lated PRL function (26, 28, 30). Of note, SOCS6 overexpression after transfection, cells were washed with phosphate-buffed also confers an enhanced phenotype because SOCS6 transgenic saline without calcium, magnesium, and sodium bicarbonate mice display increased insulin sensitivity and enhanced glucose and cultured until used. Recombinant mouse leptin and human metabolism (31). erythropoietin were purchased from R&D Systems. Human GH GH, PRL, IFN, and others induce SOCS2 expression (27, 28, was purchased from ImmunoTools, and human IFN-␤ was 32). Unlike SOCS1 and SOCS3 expression, which is typically generated in the laboratory. induced in a rapid and transient manner, SOCS2 expression Luciferase and Secreted Alkaline Phosphatase (SEAP) Assays— usually occurs later after cytokine stimulation and is more pro- For a typical luciferase experiment, HEK293-T or N38 cells longed (28, 32). Consequently, it is tempting to speculate that were transfected with the desired constructs together with a SOCS2 may be involved in restoring cellular sensitivity by over- luciferase reporter gene. For STAT5-dependent luciferase coming the inhibitory effect of other SOCS proteins. However, assays, we used a STAT5-responsive ␤-casein-derived lucifer- to date, no report concerning the precise molecular mechanism of ase reporter plasmid (38). For STAT3-dependent luciferase action of SOCS2 in signal enhancement of GH response has been experiments, we used the pXP2d2-rPAP1-luciferase reporter, published. originating from the rat pancreatitis-associated protein 1 pro- Downloaded from This study was conducted to clarify the stimulatory effect of moter, as described previously (36). 24 h after transfection, cells SOCS2 observed in GH signaling. We demonstrate that SOCS2 were left untreated or were stimulated with ligand. After can interfere with the negative regulatory effects of SOCS1 and another 24 h, luciferase activity from triplicate samples was SOCS3 via direct interaction. This effect requires the C-termi- measured by chemiluminescence in a TopCount luminometer

nal SOCS box of the targeted SOCS protein as well as the elon- (Canberra Packard). For IFN-stimulated gene factor 3-depend- www.jbc.org gin BC-binding motif in the SOCS2 SOCS box, supporting pro- ent SEAP assays, we used the 6-16 SEAP reporter construct, teasomal degradation of the targeted SOCS proteins. We also which was constructed as described previously (39). The show that this inter-SOCS cross-modulation can be extended amount of SEAP was determined with a Phospha-Light kit to other cytokine receptor systems and to other members of the (Tropix, Inc., Bedford, MA) using disodium 3-(4-meth- at BIOMEDISCHE BIBLIOTHEEK on February 12, 2008 SOCS protein family. oxyspiro-(1,2-dioxetane-3,2Ј-(5Ј-chloro)tricycloneo[3.3.1.1]de- can)-4-yl)phenyl phosphate as the luminogen substrate. Assays EXPERIMENTAL PROCEDURES were performed in a 96-well microtiter plate following the Constructs—All constructs used in this study were generated manufacturer’s guidelines. Cells were lysed in 1% Triton X-100 by standard PCR- or restriction-based cloning procedures and and 20 mM Tris (pH 7.4), and alkaline phosphatase activity in are represented in Table 1. The pEF-FLAG-I/mSOCS1, pEF- triplicate samples was measured by chemiluminescence in the FLAG-I/mCIS, and pEF-FLAG-I/mSOCS2 constructs were kindly TopCount luminometer. provided by Dr. R. Starr. pMET7-mLR (mouse leptin receptor Western Blot Analysis and Co-immunoprecipitation—Trans- (LR) long form) was a gift from Dr. L. Tartaglia, and the pcb6- fected HEK293-T or N38 cells were lysed in modified radioim- rbGHR vector was a gift from Dr. G. Strous. The mouse thymus mune precipitation assay buffer (200 mM NaCl, 50 mM Tris- cDNA was kindly provided by Dr. P. Brouckaert. The pMET7- HCl (pH 8), 0.05% SDS, 2 mM EDTA, 1% Nonidet P-40, 0.5% ␤ FLAG rat SOCS3 expression vector was described elsewhere deoxycholic acid, 1 mM Na3VO4,1mM NaF, 20 mM -glycero- (33). The pMET7-FLAG-CIS, pMET7-Etag-CIS, and pMET7- phosphate, and CompleteTM protease inhibitor mixture (Roche FLAG rat SOCS2 expression vectors have been described pre- Applied Science)). 5ϫ loading buffer (156 mM Tris-HCl (pH viously (34). Generation of the chimeric bait receptors contain- 6.8), 2% SDS, 25% glycerol, 0.01% bromphenol blue sodium salt, ing the extracellular part of the erythropoietin receptor (EpoR) and 5% ␤-mercaptoethanol) was added to the cell lysates, which and the transmembrane and intracellular parts of the LR, such were then resolved by SDS-PAGE and transferred to nitrocel- as pCEL, was described elsewhere (35, 36). Generation of the lulose membranes (Amersham Biosciences). Blotting efficiency prey constructs pMG2-CIS and pMG2-SOCS2, both contain- was checked by Ponceau S staining (Sigma). Blocking, washing, ing part of the gp130 chain (amino acids 905–918) in duplicate, and incubation with antibodies were carried out in Tris-buff- was as described (37). The EpoR Tyr402 bait and pMET7-SVT ered saline supplemented with 5% dried skimmed milk and (SV40 large T antigen) expression vectors were obtained as 0.1% Tween 20. FLAG-tagged (corresponding to the peptide described previously (36). tag DYKDDDDK) and E-tagged (corresponding to the peptide Cell Culture, Transfection Procedures, and Reagents—HEK293- tag GAPVPYPDPLEPR) proteins were revealed using anti-

T, 3T3-F442A, and N38 cells were cultured in a 10% CO2 FLAG monoclonal antibody M2 (Sigma) and anti-E tag mono- humidified atmosphere at 37 °C and grown in Dulbecco’s mod- clonal antibody (Amersham Biosciences), respectively. Rabbit ified Eagle’s medium (Invitrogen) with 10% fetal calf serum anti-SOCS2 polyclonal antibody was a gift from Dr. J. Johnston, (Cambrex Corp.). For transfection experiments, cells were and anti-mouse ␤-actin antibody was supplied by Sigma. freshly seeded in 6-well plates. HEK293-T cells were trans- Immunoblots were then revealed by incubation with horserad- fected overnight with ϳ2.5 ␮g of plasmid DNA using a standard ish peroxidase-conjugated anti-mouse or anti-rabbit secondary calcium phosphate precipitation procedure. The pMET7-SVT antibodies (Amersham Biosciences) and SuperSignal West Pico construct was used to normalize for the amount of transfected chemiluminescent substrate (Pierce). For co-immunoprecipi- DNA and load of the transcriptional and translational machin- tation experiments, ϳ2 ϫ 106 HEK293-T cells were transfected

32954 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281•NUMBER 44•NOVEMBER 3, 2006 - 160 - OEBR3 2006• 3, NOVEMBER

TABLE 1 Overview of the constructs used in this study Construct Template Cloning vector Cloning sites Oligonucleotides

OUE21NME 44 281•NUMBER VOLUME pMET7-rbGHR-FLAG pcb6-rbGHR pMET7 EcoRV-XhoI 5Ј-CCGGATATCACCATGGATCTCTGGCAGCTGC, 5Ј-CCGCTCGAGTTACTTATCGTC GTCATCCTTGTAATCTGGCAAGATTTTGTTCAGTTG pMET7-FLAG-SOCS3⌬box pMET7-FLAG-rSOCS3 pMET7 EcoRI-XbaI 5Ј-GCGAGATCTCAGAATTCGTCACCCACAGCAAGTTTCC, 5Ј-CGCTTCTAGATTAGT TGGAGGAGAGAGGTCGG pMET7-FLAG-SOCS1 pEF-FLAG-I/mSOCS1 pMET7 EcoRI-XbaI 5Ј-CCAGCGAATTCATGGCGCGCCAGGACTACAAGGAC, 5Ј-GGTCGTCTAGATCAGAT CTGGAAGGGGAAGGAAC pMET7-FLAG-SOCS1⌬box pEF-FLAG-I/mSOCS1 pMET7 EcoRI-XbaI 5Ј-CCAGCGAATTCATGGCGCGCCAGGACTACAAGGAC, 5Ј-GGTCGTCTAGATCAGCG GCGCTGGCGCAGCGGGGCCCCCAAC pMET7-Etag-SOCS1 pEF-FLAG-I/mSOCS1 pMET7-Etag-CISa SacII-XbaI 5Ј-CGTCCCGCGGTAGCACGCAACCAGGTGGCAG, 5Ј-GGTCGTCTAGATCAGATCTGG AAGGGGAAGGAAC pMET7-Etag-SOCS1⌬box pEF-FLAG-I/mSOCS1 pMET7 SacII-XbaI 5Ј-CGTCCCGCGGGAACCCTGCGGTGCCTGGAGCCCTC, 5Ј-GGTCGTCTAGATCAGCG GCGCTGGCGCAGCGGGGCCCCCAAC pMET7-Etag-SOCS2 pMET7-FLAG-SOCS2 pMET7-Etag-CIS Not-XbaI 5Ј-CGTCGCGGCCGCGGTAACCCTGCGGTGCCTGGAGCCCTC, 5Ј-GCAGGTCTAGATT ATACCTGGAATTTATATTC pMET7-FLAG-SOCS2⌬box pMET7-FLAG-SOCS2 pMET7 NotI-XbaI 5Ј-TGCCTTTACTTCTAGGCCTG, 5Ј-GCAGGTCTAGATTATGATGTATACAGAGGTTTG pMET7-Etag-SOCS2⌬box pMET7-Etag-SOCS2 pMET7 NotI-XbaI 5Ј-TGCCTTTACTTCTAGGCCTG, 5Ј-GCAGGTCTAGATTATGATGTATACAGAGGTTTG pMET7-FLAG-SOCS6 pMG2-mSOCS6 pMET7 EcoRI-KpnI pMET7-FLAG-SOCS2 (LC-QQ) pMET7-FLAG-SOCS2 Mutagenesis 5Ј-GTATACATCAGCACCCACTCAGCAGCATTTCCAACGACTCGCCATTAAC, 5Ј-GTT AATGGCGAGTCGTTGGAAATGCTGCTGAGTGGGTGCTGATGTATAC 5Ј-GTATACATCAGCACCCACTCAGCAGCATTTCCAACGACTCGCCATTAAC, 5Ј-GTT -161 - pMET7-Etag-SOCS2 (LC-QQ) pMET7-Etag-SOCS2 Mutagenesis AATGGCGAGTCGTTGGAAATGCTGCTGAGTGGGTGCTGATGTATAC pMET7-FLAG-SOCS2 (LC-PF) pMET7-FLAG-SOCS2 Mutagenesis 5Ј-GTATACATCAGCACCCACTCCGCAGCATTTCTTTCGACTCGCCATTAAC, 5Ј-GTT AATGGCGAGTCGAAAGAAATGCTGCGGAGTGGGTGCTGATGTATAC pMET7-Etag-SOCS2 (LC-PF) pMET7-Etag-SOCS2 Mutagenesis 5Ј-GTATACATCAGCACCCACTCCGCAGCATTTCTTTCGACTCGCCATTAAC, 5Ј-GTT AATGGCGAGTCGAAAGAAATGCTGCGGAGTGGGTGCTGATGTATAC pMET7-FLAG-SOCS6 (LC-QQ) pMET7-FLAG-SOCS6 Mutagenesis 5Ј-TGCAGGTGCGCTCGCAACAGTACCTGCAACGCTTTGTTATCCGT, 5Ј-ACGGATAA CAAAGCGTTGCAGGTACTGTTGCGAGCGCACCTGCA CIS SOCS box baitb pEF-FLAG-I/mCIS pCEL SstI-NotI 5Ј-GCGAGAGCTCCGGATCCGCCCGCAGCTTACAACATC, 5Ј-CGCTGCGGCCGCTTAG AGTTGGAAGGGGTACTG SOCS1 SOCS box bait pEF-FLAG-I/mSOCS1 pCEL SstI-NotI 5Ј-GCGAGAGCTCAGTCCGGCCGCTGCAGGAGC, 5Ј-GCTTGCGGCCGCTTAGATCTGG AAGGGGAAGGA SOCS2 SOCS box bait pEF-FLAG-I/mSOCS2 pCEL SstI-NotI 5Ј-GCGAGAGCTCCGCACCATCTCTGCAGCATC, 5Ј-GCTGCGGCCGCTTATACCTGGA ATTTATATTCTTCC SOCS3 SOCS box bait pMET7-FLAG-SOCS3 pCEL SstI-NotI 5Ј-CGAGAGCTCCGTGGCTACCCTCCAGCATC, 5Ј-CGCTGCGGCCGCTTAAAGTGGAG

ORA FBOOIA CHEMISTRY BIOLOGICAL OF JOURNAL CATCATAC SOCS4 SOCS box bait Mouse thymus cDNA pCEL SsI-NotI 5Ј-GCGGAGCTCCCCCTTTTCCTTGCAGCAT, 5Ј-CGCGCGGCCGCTCACTGCTGCTCT GGCA SOCS5 SOCS box bait RZPD clone IRAV pCEL SsI-NotI 5Ј-GCGGAGCTCCCCTTTCAGCCTGCAG, 5Ј-CGCGCGGCCGCTTACTTTGCTTTGACTG p968 D11111D6 SOCS6 SOCS box bait RZPD clone IRAV pCEL SsI-NotI 5Ј-GCGGAGCTCGGTGCGCTCGCTGCA, 5Ј-CGCGCGGCCGCTCAGTAGTGCTTCTCC p968 E0635 D6

SOCS7 SOCS box bait N38 cell cDNA pCEL SsI-NotI 5Ј-GCGGAGCTCTGTCAAGTCCCTCCAGC, 5Ј-CGCTCTAGACTACGTGGAAGGCTCCA Cross-regulation SOCS Elongin B bait N38 cell cDNA pCEL BamHI-NotI 5Ј-CGCGGATCCGACGTGTTTCTCATGATCC-3Ј,5Ј-CGCTGATCATCACTGCACAGC TTGTTC-3Ј SOCS2 (LC-QQ) prey pMG2-SOCS2 Mutagenesis 5Ј-GTATACATCAGCACCCACTCAGCAGCATTTCCAACGACTCGCCATTAAC, 5Ј-GTT AATGGCGAGTCGTTGGAAATGCTGCTGAGTGGGTGCTGATGTATAC SOCS6 prey RZPD clone IRAV p968 pMG2 EcoRI-NotI 5Ј-GCGGAATTCAAGAAAATCAGTCTG, 5Ј-CGCGCGGCCGCTCAGTAGTGCTTCTCC E0635D6 SOCS7 preyc N38 cell cDNA pMG2 EcoRI-XbaI 5Ј-GCGGAATTCGTGTTCCGCAACGTG, 5Ј-CGCTCTAGACTACGTGGAAGGCTCCA a Mutagenesis was used to eliminate an overlapping open reading frame. b The BamHI site in the C terminus of the LR was eliminated by mutagenesis.

c

32955 SOCS7 was cloned in pZeroBlunt, cut with XbaI, blunted, and subsequently partially digested with SacI. This allowed ligation in the pCEL vector, which was digested with NotI, blunted, and then partially digested with SacI.

at BIOMEDISCHE BIBLIOTHEEK on February 12, 2008 2008 12, February on BIBLIOTHEEK BIOMEDISCHE at www.jbc.org from Downloaded SOCS Cross-regulation

with FLAG- or E-tagged pMET7- SOCS expression vectors. Cleared lysates (modified radioimmune precipitation assay lysis buffer) were incubated with 4.0 ␮g/ml mouse anti-FLAG or anti-E tag monoclonal antibody and protein G-Sepharose (Amersham Biosciences). After immunoprecipitation, SDS-PAGE, and Western blotting, interactions were detected using anti-FLAG or anti-E tag antibody as described above. RESULTS Essential Role for the SOCS2 Downloaded from SOCS Box in Antagonizing SOCS1 and SOCS3 Inhibition of Cytokine Signaling—SOCS2 exerts a dual action on GH and PRL signaling and

impairs the inhibitory effect of other www.jbc.org SOCS proteins (26, 30). To gain more detailed insight in the under- lying mechanism, we first analyzed the role of the different SOCS at BIOMEDISCHE BIBLIOTHEEK on February 12, 2008 protein subdomains. The effect of constitutive expression of SOCS proteins on GH signaling was inves- tigated in HEK293-T cells using the STAT5-responsive ␤-casein- derived luciferase reporter. Fig. 1A shows dose-response curves dem- onstrating complete inhibition of GH signaling by SOCS1 and SOCS3. GH-inducible activity was fully inhibited by low concentrations of either SOCS1 or SOCS3, i.e. con- centrations below the level of antibody detection as judged by Western blot analysis of the FLAG-tagged SOCS constructs using anti-FLAG antibody. After removal of the SOCS boxes of FIGURE 1. Essential role for the SOCS box in interference of SOCS2 with SOCS1 and SOCS3 inhibition of GH signaling. HEK293-T cells were transfected with a rabbit GHR expression vector (40 ng) and a ␤-casein- SOCS1 (SOCS1⌬box) and SOCS3 derived luciferase reporter gene (200 ng). 24 h after transfection, the cells were deprived of serum and then (SOCS3⌬box), inhibition was treated with human GH (200 ng/ml) for 15 h before the luciferase activity from the ␤-casein reporter gene was measured. Luciferase measurements were performed in triplicate. -Fold induction represents the ratio of lucif- slightly reduced but not abolished in erase activity determined in the presence or absence of ligand. A, SOCS1, SOCS3, or their SOCS box deletion this assay system. Coexpression of mutant plasmids (SOCS1⌬box (S1⌬box) and SOCS3⌬box (S3⌬box)) were cotransfected at a range of concen- SOCS2 completely suppressed the trations to analyze the inhibitory effect on GH signaling. A sample of lysate from each group was Western- blotted and probed with anti-FLAG antibody. B, SOCS1 (10 ng) or SOCS1⌬box (60 ng) was cotransfected SOCS1- and SOCS3-dependent with SOCS2 or SOCS2⌬box (S2⌬box) at increasing concentrations. Expression of the E-tagged SOCS2 and inhibition of GH signaling (Fig. 1, B ⌬ SOCS2 box proteins in the same transfected cells was verified on lysates using anti-E tag antibody. C, SOCS3 and C), whereby SOCS1 inhibition (100 ng) or SOCS3⌬box (100 ng) was cotransfected with SOCS2 or SOCS2⌬box at increasing concentrations. Expression of the E-tagged SOCS2 and SOCS2⌬box proteins in the same transfected cells was verified on appeared to be more sensitive to the lysates using anti-E tag antibody. D, shown is a comparison of the ectopic and endogenous expression levels of counteracting effect of SOCS2 com- mouse SOCS2 in HEK293-T and 3T3-F442A cells, respectively. SOCS1 (10 ng) was cotransfected with SOCS2 at increasing concentrations in HEK293-T cells. Expression of the E-tagged SOCS2 proteins in the same trans- pared with SOCS3. Of note, the fected cells and of endogenous SOCS2 in the 3T3-F442A cells was verified on lysates using anti-SOCS2 anti- amounts of SOCS1 used in this body. 3T3-F442A cells were incubated in serum-free medium prior to stimulation with GH (200 ng/ml) for the experiment could not be visualized indicated times. The levels of loaded protein were normalized by determining the protein concentrations with the Bradford method, and this was verified by Ponceau S staining. As an additional control, the blots were by Western blot analysis, indicating stripped and probed with anti-␤-actin antibody to check for equal loading of lysates of the same cell type. that the working concentrations

32956 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281•NUMBER 44•NOVEMBER 3, 2006 - 162 - SOCS Cross-regulation

endogenous level of SOCS2 in the GH-responsive mouse 3T3-F442A preadipocyte cell line (Fig. 1D). This suppressive effect on SOCS molecules was specific for SOCS2, as coexpression of CIS did not interfere with SOCS1- or SOCS3- mediated inhibition (data not shown). Strikingly, this effect of SOCS2 depended strictly on the presence of its SOCS box. Of note, the deletion of the SOCS box led to enhanced expression in the case of SOCS2. This effect was also observed, albeit to a lesser extent, with SOCS1, but was not observed Downloaded from for SOCS3. We next evaluated whether we could extrapolate this SOCS2 regu- lation to other receptor systems.

SOCS1 and SOCS3 have been www.jbc.org implicated as potent inhibitors of IFN type I receptor signaling (40, 41); however, the role of SOCS2 is less well elucidated. We monitored at BIOMEDISCHE BIBLIOTHEEK on February 12, 2008 IFN-␤ signaling in HEK293-T cells using the IFN-sensitive 6-16 SEAP type I reporter gene and evaluated the effect of expression of various combinations of (mutant) SOCS proteins as described above. We found that expression of SOCS2 at increasing concentrations resulted in a clear dual effect on IFN signal- ing (Fig. 2A): at low concentrations, SOCS2 suppressed IFN signaling, but at higher concentrations, SOCS2 led to complete restoration and even enhancement of the responsiveness of the 6-16 reporter to IFN-␤, suggesting a negative effect of SOCS2 on endogenous SOCS proteins. Quite similar to FIGURE 2. Essential role for the SOCS box in interference of SOCS2 with SOCS1 and SOCS3 inhibition of what we observed with GH, expres- IFN signaling. SEAP activity was assayed in HEK293-T cells transfected without SOCS or with SOCS1–3 expres- sion of SOCS1, SOCS3, or their sion vectors and the IFN-responsive 6-16 SEAP reporter (200 ng) at several ratios. After 24 h, transfected cells were stimulated with human IFN-␤ (100 pM); and after 48 h, the SEAP activity in the 6-16 reporter gene was mutants lacking the SOCS box measured. SEAP measurements were performed in triplicate. -Fold induction represents the ratio of SEAP inhibited IFN-␤ signaling (Fig. 2B). activity determined in the presence or absence of ligand. A, SOCS2 can act as a dual effector of INF type I signaling as assessed by transfection with SOCS2 at a range of concentrations or with empty vector in an Again, analogous to the observa- appropriate amount in HEK293-T cells. Expression of the E-tagged SOCS2 protein in the same transfected cells tions made for GH, SOCS1- and was verified on lysates using anti-E tag antibody. B, SOCS1, SOCS3, or their SOCS box deletion mutant plasmids SOCS3-mediated inhibition of were transfected at a range of concentrations to analyze the inhibitory effect on interferon type I signaling. ␤ C, SOCS1 (10 ng) or SOCS1⌬box (S1⌬box; 60 ng) was cotransfected with SOCS2 or SOCS2⌬box (S2⌬box)at IFN- signaling was completely increasing concentrations. D, SOCS3 (20 ng) or SOCS3⌬box (S3⌬box; 100 ng) was cotransfected with SOCS2 or neutralized by coexpression of ⌬ SOCS2 box at increasing concentrations. SOCS2, and the SOCS boxes of SOCS1 or SOCS3 and of SOCS2 were approaching the physiological concentrations of this were strictly required for the full effect (Fig. 2, C and D). SOCS protein. The SOCS2 amounts were also not supra- We finally extended these analyses of SOCS modulation also physiological, as the SOCS2 concentration at which a cross- to LR signaling. Again, quite similar to the previous observa- regulatory effect was observed was comparable with the tions, expression of SOCS1, SOCS3, or their SOCS box deletion

NOVEMBER 3, 2006•VOLUME 281•NUMBER 44 JOURNAL OF BIOLOGICAL CHEMISTRY 32957 - 163 - SOCS Cross-regulation

the STAT3-dependent luciferase response (Fig. 3C), which can be explained by a negative effect of SOCS2 on the endogenous SOCS proteins. This effect was again lost with a SOCS2 mutant lacking the SOCS box. Together, these findings show that the cross-modulatory effect of SOCS2 on other SOCS pro- teins is not limited to the GH system and likely involves similar underly- ing mechanisms. Recruitment of the Elongin BC Complex by SOCS2 Is Essential for Interference with Other SOCS Pro- teins—Sequence alignments of SOCS Downloaded from box-containing proteins reveal a sin- gle conserved region with the consen- sus sequence (T/S)(L/M)XXX(C/S)- XXX(V/L/I) that defines an elongin

BC complex-binding site or “BC www.jbc.org box” (9, 10, 43). We generated a SOCS2 mutant, SOCS2(LC-PF), containing point mutations in the BC box of SOCS2 that abrogate at BIOMEDISCHE BIBLIOTHEEK on February 12, 2008 elongin BC recruitment (9). In another SOCS2 derivative, SOCS2- (LC-QQ), both residues were mutated to glutamine to minimize structural alterations of the protein. As shown in Fig. 4, this SOCS2(LC- QQ) mutant completely lost its FIGURE 3. SOCS2 displays a SOCS box-dependent stimulatory effect on leptin signaling in N38 cells. capacity to interfere with SOCS1 Mouse N38 hypothalamic cells were transiently cotransfected with a mouse LR expression vector (250 ng) and and SOCS3 antagonism in GH and the pXP2d2-rPAP1-luciferase reporter (1 ␮g). The transfected cells were either left untreated or stimulated for 24 h with leptin (100 ng/ml). Luciferase measurements were performed in triplicate. Data are expressed as the IFN signaling in HEK293-T cells leptin-stimulated/non-stimulated ratio. A, SOCS1, SOCS3, or their SOCS box deletion mutant plasmids were and with leptin signaling in N38 cotransfected at a range of concentrations to analyze the inhibitory effect on leptin signaling. B, SOCS1 (30 ng) cells. Similar findings were made or SOCS1⌬box (S1⌬box; 100 ng) was cotransfected with SOCS2 or SOCS2⌬box (S2⌬box) at increasing concen- trations. C, SOCS2 or the SOCS2⌬box mutant plasmid was transfected at a range of concentrations to analyze with the SOCS2(LC-PF) mutant the stimulatory effect on leptin signaling. (data not shown). This indicates that functional recruitment of the mutants blocked induction of leptin-mediated activation of a elongin BC complex is a prerequisite for the negative regulation STAT3-responsive rat pancreatitis-associated protein 1 pro- by SOCS2 of other SOCS proteins. moter-luciferase reporter in HEK293-T cells (data not shown). SOCS2 Interacts with Other Members of the SOCS Family— Coexpression of SOCS2 restored the SOCS-dependent signal- We next used mammalian protein-protein interaction trap ing blockade. These effects were dependent on either SOCS box (MAPPIT), a strategy designed to analyze protein-protein and were less pronounced for SOCS3-mediated LR inhibition interactions in intact mammalian cells (36), to investigate than for SOCS1-mediated LR inhibition (data not shown). We whether SOCS2 exerts its cross-modulatory function via direct further verified the cross-modulatory effects of SOCS2 in binding to other SOCS proteins. In MAPPIT, a bait protein is mouse N38 hypothalamic cells, which represent a physiological C-terminally linked to a chimeric receptor consisting of the context for LR signaling. This N38 cell line responds to leptin extracellular region of the EpoR linked to the transmembrane stimulation and is a part of a collection of clonal neuronal cell and the intracellular part of a signaling-deficient LR. The use of lines recently isolated by Belsham et al. (42). Similar to what we a triple Tyr-to-Phe mutant LR (further referred to as LR-F3) observed in HEK293-T cells, expression of SOCS1, SOCS3, or knocks out STAT3 activation and offers the added advantage their mutants lacking the SOCS box inhibited leptin signaling that negative feedback mechanisms are inoperative, implying (Fig. 3A). Coexpression of SOCS2 with SOCS1 (Fig. 3B)or enhanced signaling. SOCS3 (data not shown) in the N38 cells led to recovery of the MAPPIT prey constructs are composed of a prey protein leptin-induced signaling in a SOCS box-dependent manner. fused to a part of the gp130 chain carrying four STAT3 Moreover, expression of SOCS2 alone clearly stimulated recruitment sites. Coexpression of interacting bait and prey

32958 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281•NUMBER 44•NOVEMBER 3, 2006 - 164 - SOCS Cross-regulation

prompted us to investigate whether SOCS2 can bind to these SOCS family members. HEK293-T cells were cotransfected with a bait plas- mid encoding the SOCS boxes of SOCS1, SOCS2, SOCS3, or CIS combined with a plasmid encod- ing the SOCS2 or CIS prey and the STAT3-responsive luciferase reporter construct. We always used isolated SOCS boxes as bait proteins because, in the case of SOCS1 and SOCS3, the full-length baits inter- fered with the MAPPIT readout and therefore could not be investigated. Erythropoietin stimulation revealed Downloaded from clear interaction of SOCS2 with all baits examined. In contrast, the CIS prey failed to induce any reporter activity (Fig. 5B). The expression

levels of the FLAG-tagged prey pro- www.jbc.org teins were confirmed by immuno- blotting using anti-FLAG antibody. In Fig. 5C, we show, using MAPPIT, that the SOCS2(LC-QQ) mutant at BIOMEDISCHE BIBLIOTHEEK on February 12, 2008 lost its capacity to associate with an elongin B prey while maintaining its interaction with the CIS bait. A MAPPIT bait construct containing the Tyr402 motif of the EpoR was used as a positive control, as this receptor motif directly interacts with SOCS2 (36). This association of SOCS2 with SOCS1–3 and CIS was confirmed by co-immunopre- cipitation. We transiently cotrans- fected HEK293-T cells with a plas- mid encoding E-tagged SOCS2 FIGURE 4. The negative effect of SOCS2 on other SOCS proteins is dependent on recruitment of the together with FLAG-tagged plas- elongin BC complex. HEK293-T or N38 cells were transiently transfected with plasmids encoding SOCS1 or mids encoding SOCS1, SOCS2, and ⌬ SOCS3 at fixed amounts and with wild-type SOCS2 or SOCS2 BC box(LC-QQ) (S2(LC-QQ)) at increasing con- SOCS3, respectively, or we coex- centrations. The transfected cells were either left untreated or were stimulated with human GH (200 ng/ml), IFN-␤ (100 pM), or leptin (100 ng/ml). Luciferase and SEAP measurements were performed in triplicate. Data are pressed FLAG-tagged SOCS2 with expressed as -fold induction (stimulated/non-stimulated). A, HEK293-T cells were transfected with 10 ng of E-tagged SOCS1, SOCS2, and CIS. SOCS1, 100 ng of SOCS3, and increasing concentrations of SOCS2 derivatives. GH signaling was assayed as described in the legend to Fig. 1. B, HEK293-T cells were transfected with 10 ng of SOCS1, 20 ng of SOCS3, and SOCS2 co-immunoprecipitated increasing concentrations of SOCS2 derivatives. IFN signaling was assayed as described in the legend to Fig. 2. SOCS1–3 (Fig. 6A) and, in the case C, N38 cells were transfected with 30 ng of SOCS1, 15 ng of SOCS3, and increasing concentrations of SOCS2 of CIS, both the 37- and 32-kDa derivatives. Leptin signaling was assayed as described in the legend to Fig. 3. forms that correspond to mono- and non-ubiquitinated proteins, leads to functional complementation of STAT3 activity and respectively (44). Observed interactions of SOCS2 with SOCS induction of the STAT3-responsive rat pancreatitis-associ- proteins in HEK293-T cells depended on proteasomal inhibi- ated protein 1 promoter-luciferase reporter. MAPPIT per- tion with the proteasomal inhibitor MG132 (20 ␮M) for 6 h and mits the detection of both modification-independent and stimulation with IFN-␤ (100 pM) for 30 min. SOCS1 was still phosphorylation-dependent interactions in intact human co-immunoprecipitated with the SOCS2⌬box and SOCS2(LC- cells. The MAPPIT configuration used in this study is shown QQ) mutants, indicating that deletion of the SOCS box or the in Fig. 5A. BC box motif did not disrupt the capacity of SOCS2 to bind We have shown previously that SOCS2 directly interacts SOCS1 (Fig. 6B). Nevertheless, elimination of the SOCS box of with CIS (34). This observation and the abovementioned find- SOCS2 weakened the interaction with SOCS1, suggesting a role ings on cross-regulation between SOCS2 and SOCS1 or SOCS3 for this domain in SOCS-SOCS interactions.

NOVEMBER 3, 2006•VOLUME 281•NUMBER 44 JOURNAL OF BIOLOGICAL CHEMISTRY 32959 - 165 - SOCS Cross-regulation Downloaded from www.jbc.org at BIOMEDISCHE BIBLIOTHEEK on February 12, 2008

32960 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281•NUMBER 44•NOVEMBER 3, 2006 - 166 - SOCS Cross-regulation

SOCS2 and Also SOCS6 and SOCS7 Interact with All Members of the SOCS Family—Interaction studies performed with the other SOCS proteins used as baits revealed that the SOCS2 prey can also interact with the SOCS boxes of SOCS4–7 (Fig. 8A). Using the same approach, we performed a matrix- type interaction analysis of SOCS proteins, and we found that SOCS6 and SOCS7 preys also interacted with the SOCS box baits of all mem- bers of the SOCS family (Fig. 8, B and C). Of note, SOCS2, SOCS6, and SOCS7 also displayed binding Downloaded from to themselves. The MAPPIT data with the CIS prey were included as a negative control, and functionality of this CIS prey was demonstrated

using the interaction with the EpoR www.jbc.org Tyr402 motif as a control (Fig. 8D). The EpoR-LR-F3 bait provided a control for aspecific binding to the intracellular part of the LR and at BIOMEDISCHE BIBLIOTHEEK on February 12, 2008 JAK2. The expression of the differ- ent bait constructs was verified by checking the interaction with the SH2␤ prey, which binds the associ- FIGURE 6. A, SOCS2 interactions demonstrated by co-immunoprecipitation experiments. Lysates from ated JAK of LR-F3 (data not shown). HEK293-T cells cotransfected with FLAG- or E-tagged SOCS1 (S1), SOCS2 (S2), SOCS3 (S3), and CIS were immu- noprecipitated (IP) with anti-E tag or anti-FLAG antibody and Western-blotted (WB) with anti-FLAG or anti-E tag Possible complications that could antibody (upper panels). The whole cell lysate was Western-blotted with anti-FLAG or anti-E tag antibody as a arise from interference of the SOCS loading control (middle and lower panels). B, interaction analysis of SOCS1 and SOCS2 mutants. HEK293-T cells prey constructs with JAK activity or were transiently cotransfected with FLAG-tagged SOCS2, SOCS2⌬box (S2⌬box), SOCS2⌬BC box(LC-QQ) (S2(LC-QQ)), or the appropriate amount of empty vector and E-tagged SOCS1. Cell lysates were immunopre- STAT recruitment and that could cipitated with anti-FLAG antibody and subsequently immunoblotted with anti-E tag or anti-FLAG antibody. lead to false negative signals were considered and ruled out, as their coexpression with an established SOCS2 Promotes Degradation of SOCS1—The dependence MAPPIT interaction had no deleterious effect (data not of the SOCS2 effect on an intact BC box suggests that SOCS2 shown). From these experiments, we concluded that SOCS2, can target SOCS proteins for proteasomal degradation. SOCS6, and SOCS7 can interact with the SOCS boxes of all HEK293-T cells were transiently transfected with SOCS1 and SOCS family members. increasing concentrations of SOCS2 and then treated with the SOCS6 Is a Negative Regulator of Other SOCS Proteins—Sub- protein synthesis inhibitor cycloheximide (20 ␮M) for 6 h. Deg- sequently, we investigated whether SOCS6 displays similar radation of SOCS1 was observed when increasing concentra- functional SOCS cross-modulation as SOCS2. We found that tions of SOCS2 were coexpressed, whereas SOCS2(LC-QQ) SOCS6 antagonized the inhibition of SOCS proteins in GH and had no effect (Fig. 7). This suggests a mechanism in which IFN (Fig. 9, A and B) and leptin (data not shown) signaling in SOCS2 acts as an adaptor molecule between an E3 complex and HEK293-T cells. In N38 cells, SOCS6 interfered with SOCS1 SOCS proteins, targeting them for proteasomal turnover. and SOCS3 inhibition of leptin signaling (Fig. 9C).

FIGURE 5. MAPPIT analysis of SOCS interactions. A, principle of MAPPIT. See “Results” for details. rPAP1, rat pancreatitis-associated protein 1. B, SOCS2 interacts with the SOCS boxes of SOCS1–3 and CIS. HEK293-T cells were transiently cotransfected with plasmids encoding bait variants of the SOCS boxesof several SOCS proteins or with a mock bait lacking the SOCS motif, the pMG2-SOCS2 or pMG2-CIS prey construct, and the pXP2d2-rPAP1-luciferase reporter. After transfection, cells were either left untreated or were stimulated with erythropoietin (Epo) for 24 h. Luciferase activities were measured in triplicate. -Fold induction represents the ratio of luciferase activity determined in the presence or absence of ligand. Expression of the FLAG-tagged fusion prey proteins in the same transfected cells was verified on lysates using anti-FLAG antibody. C, the SOCS2(LC-QQ) mutant does not bind elongin B, whereas the interaction with CIS is preserved. HEK293-T cells were transiently cotransfected with plasmids encoding the chimeric EpoR-LR-F3 construct as a negative control, the EpoR Tyr402 bait as a positive control for SOCS2, the elongin B bait, or the CIS SOCS box bait and with the pMG2-SOCS2 or pMG2-SOCS2(LC-QQ) prey construct combined with pXP2d2-rPAP1-luciferase. The transfected cells were either stimulated for 24 h with erythropoietin or were left untreated. Luciferase measurements were performed in triplicate. Data are expressed as -fold induction (stimulated/non-stimulated).

NOVEMBER 3, 2006•VOLUME 281•NUMBER 44 JOURNAL OF BIOLOGICAL CHEMISTRY 32961 - 167 - SOCS Cross-regulation

SOCS2 undeniably plays a role as a negative regulator of GH signaling in vivo and in vitro (43), but can also enhance GH signaling when expressed at higher concentrations (25, 26). It binds to the GHR at multiple sites, some of which could also function as recruitment sites for negative regulators such as SHP-2 (53) and SOCS3 (54, 55). Such competition between SOCS2 and potentially more potent negative regulators was put forward as a potential explanation for the dual effect of SOCS2 (25). However, little direct evidence was reported in support of such a model, and recently, Greenhalgh et al. (43) showed that FIGURE 7. Coexpression of SOCS2 accelerates SOCS1 degradation. SOCS2 binds the GHR at Tyr487 and Tyr595, which are not usual Increasing concentrations of E-tagged SOCS2 or SOCS2(LC-QQ) were tran- siently coexpressed in HEK293-T cells with FLAG-tagged SOCS1. Cells were immunoreceptor tyrosine-based inhibitory motifs, suggesting treated with cycloheximide (20 ␮M) for up to 6 h. The lysates were blotted for that competition of SOCS3 at these sites is not involved. SOCS1 with anti-FLAG antibody and for SOCS2 with anti-E tag antibody. The key finding in this study is that a restricted set of SOCS proteins, including SOCS2, can bind to other members of the Like other SOCS molecules, SOCS6 was shown to bind to SOCSfamily,thuscontrollingtheiractivitythroughproteasome- Downloaded from elongins B and C in a SOCS box-dependent manner (45). Anal- dependent degradation. We found that SOCS2 can restore and ogous to SOCS2, disruption of elongin BC binding in SOCS6 potentiate GH signaling by antagonizing SOCS1 and SOCS3 in yielded a mutant that was not able to interfere with the inhibi- a SOCS box-dependent manner. This effect is not limited to the tory effect of other SOCS proteins (Fig. 9). Also, wild-type GH system because we found similar effects on signaling via the

SOCS6, but not the ⌬BC box mutant, reduced SOCS1 expres- endogenous IFN type I receptor and LR in HEK293-T and N38 www.jbc.org sion in a dose-dependent manner, indicating that SOCS6 medi- cells, respectively. ated the observed inhibition by accelerating turnover of other SOCS2 mutants lacking the binding site for elongin BC com- SOCS proteins (Fig. 10). Taken together, our data suggest that pletely lose their inhibitory potential, providing a strong argu- SOCS6 can negatively regulate SOCS function in a way very ment for proteasomal degradation of the target SOCS proteins. at BIOMEDISCHE BIBLIOTHEEK on February 12, 2008 similar to SOCS2. Indeed, as observed for SOCS1, coexpression of SOCS2 leads to lowered expression levels of this target SOCS protein. The crit- DISCUSSION ical elongin BC dependence of the inhibitory effect by SOCS2 Protein degradation by the ubiquitin-proteasome pathway strongly argues that SOCS2 functions as part of an E3 complex. plays an essential role in controlling the abundance of regula- Alternatively, higher expression levels of SOCS2 may compete tory molecules. Key to this is the sequential action of three for recruitment of the elongin BC complex, indirectly leading to protein sets: ubiquitin-activating enzymes, ubiquitin carrier destabilization of other SOCS proteins lacking this complex enzymes, and a large set of E3 enzymes, whereby the latter (see above). However, SOCS1 and SOCS3 proteins lacking their define substrate specificity. The SCF (Skp1-Cul1-F-box) E3 entire SOCS boxes are still able, although to a lesser extent, to complex is composed of the Cul1 scaffold protein, which binds inhibit cytokine signaling, but are completely refractory to the the Roc1/Rbx1 RING domain protein and the ubiquitin carrier SOCS2 effect, implying that SOCS2 binding is critical. More- enzyme and which recruits, via the Skp1 linker protein, F-box over, overexpression of CIS, which is equally well capable of proteins, which in turn bind substrates for ubiquitination. This sequestering elongin BC complexes, does not lead to any effect same architecture is also found in other SCF-like complexes, on other SOCS proteins. The SOCS box of the target SOCS including those based on the Cul2-von Hippel-Lindau and protein appears to be involved in SOCS2 binding. Although our Cul5-SOCS box adaptor proteins, whereby elongins B and C data support an involvement of the SOCS box in the interaction and SOCS or von Hippel-Lindau proteins fulfil the role of the between the inhibitory SOCS and targeted SOCS proteins, the Skp1 and F-box protein moieties, respectively (1). Evidence that precise nature of this inter-SOCS interaction is still unclear SOCS proteins can mediate proteasomal turnover of target and, given the MAPPIT configuration, may well depend on molecules is accumulating. Examples include the GHR and phosphorylation of critical tyrosine residues. Mutational anal- EpoR (44, 46), JAK2 (13), the Rac guanine nucleotide exchange ysis will be required to fully determine the binding modus factor Vav (47), Ras GTPase-activating protein (17), and insulin between different SOCS proteins. receptor substrates 1 and 2 (48). Of note, SOCS proteins them- Evidence that SOCS2 can act as a regulator of turnover of selves can be targeted for ubiquitination and proteasomal deg- other SOCS proteins was recently also reported by Tannahill radation, although contradictory reports exist regarding the et al. (29), who demonstrated SOCS2 regulation of the SOCS3- effect of elongin BC interaction on the protein stability of dependent inhibition of interleukin-2 and interleukin-3 signal- SOCS1, SOCS3 and CIS. Some data suggest that elongin BC ing, and by Lavens et al. (34), who showed elongin BC-depend- association targets SOCS proteins for degradation by the pro- ent interference of SOCS2 with binding of CIS to the LR at teasome, as has been demonstrated for CIS (44, 49), SOCS1 (10, Tyr985. In line with such a regulatory role of SOCS proteins is 50), and SOCS3 (10, 51). In contrast, there is also evidence that the sequential induction pattern of different SOCS molecules. elongin BC interaction can stabilize SOCS1 (9, 16, 52) and Unlike expression of SOCS1 and SOCS3, which is typically SOCS3 (17) and that disruption of this interaction leads to pro- induced in a rapid and transient manner upon cytokine stimu- teasome-mediated degradation of these SOCS proteins. lation, expression of SOCS2 usually occurs late after cytokine

32962 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281•NUMBER 44•NOVEMBER 3, 2006 - 168 - SOCS Cross-regulation Downloaded from www.jbc.org at BIOMEDISCHE BIBLIOTHEEK on February 12, 2008

FIGURE 8. SOCS2, SOCS6, and SOCS7 interact with the SOCS boxes of all SOCS family members. HEK293-T cells were transiently cotransfected with plasmids encoding bait variants of the SOCS boxes of all SOCS proteins or the chimeric EpoR-LR-F3 construct as a negative control; the pMG2-SOCS2, pMG2-SOCS6, pMG2-SOCS7, or pMG2-CIS prey; and the pXP2d2-rPAP1-luciferase reporter. After transfection, cells were either left untreated or were stimu- lated with erythropoietin (Epo) for 24 h. Luciferase activities were measured in triplicate. Data are expressed as -fold induction (stimulated/non-stimulated).

NOVEMBER 3, 2006•VOLUME 281•NUMBER 44 JOURNAL OF BIOLOGICAL CHEMISTRY 32963 - 169 - SOCS Cross-regulation Downloaded from www.jbc.org at BIOMEDISCHE BIBLIOTHEEK on February 12, 2008

FIGURE 9. The negative effect of SOCS6 on other SOCS proteins depends on recruitment of the elongin BC complex. HEK293-T or N38 cells were transiently transfected with plasmids encoding SOCS1 or SOCS3 at fixed amounts and wild-type SOCS6 or SOCS6⌬BC box(LC-QQ) (S6⌬(LC-QQ)) at increasing concentrations. The transfected cells were either left untreated or were stimulated with GH (200 ng/ml), IFN-␤ (100 pM), or leptin (100 ng/ml). Data are expressed as -fold induction (stimulated/non-stimulated). Luciferase and SEAP measurements were performed in triplicate. A, HEK293-T cells were transfected with 10 ng of SOCS1, 100 ng of SOCS3, and increasing concentrations of SOCS6 derivatives. GH signaling was assayed as described in the legend to Fig. 1. B, HEK293-T cells were transfected with 10 ng of SOCS1, 50 ng of SOCS3, and increasing concentrations of SOCS6 derivatives. IFN signaling was assayed as described in the legend to Fig. 2. C, N38 cells were transfected with 30 ng of SOCS1, 10 ng of SOCS3, and increasing concentrations of SOCS6 derivatives. Leptin signaling was assayed as described in the legend to Fig. 3.

32964 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281•NUMBER 44•NOVEMBER 3, 2006 - 170 - SOCS Cross-regulation

ily, but at present, 128 proteins harboring a SOCS box have been described in the mammalian genome (according to the Pfam Database). In summary, our findings point to the existence of a subfam- ily of SOCS proteins consisting of SOCS2, SOCS6, and SOCS7, capable of controlling SOCS protein stability. This functional cross-modulation between SOCS proteins requires the SOCS box, probably both as an inter-SOCS-binding domain and as a functional recruitment motif for elongin BC-containing E3 enzymes. The observation that several SOCS proteins do not FIGURE 10. SOCS6, but not SOCS6(LC-QQ), promotes degradation of act solely as inhibitors of cytokine signaling should be taken in SOCS1. Increasing concentrations of FLAG-tagged SOCS6 or SOCS6(LC-QQ) consideration in the evaluation of gene knock-out studies and were coexpressed transiently in HEK293-T cells with FLAG-tagged SOCS1. may be of relevance for several human pathologies. Cells were treated with cycloheximide (20 ␮M) for up to 6 h. The lysates were blotted for SOCS1 and SOCS6 expression with anti-FLAG antibody. Acknowledgments—We thank Dr. R. Starr for providing the pEF- stimulation and is more prolonged (27, 28, 32). Accumulation FLAG-I/mSOCS1, pEF-FLAG-I/mCIS, and pEF-FLAG-I/mSOCS2 Downloaded from of increasing levels of SOCS2 late after induction is consistent constructs; Dr. L. Tartaglia for the pMET7-mLR vector; and Dr. G. with a role in eliminating excess levels of SOCS proteins after Strous for the pcb6-rbGHR plasmid. The anti-SOCS2 antibody was receptor activation and may be involved in restoring cellular kindly donated by Dr. J. Johnston. responsiveness for subsequent stimulation. Interestingly,

SOCS2, SOCS6, and SOCS7 can also bind to themselves, sug- Note Added in Proof—After submission of this manuscript, a paper www.jbc.org gesting the possibility of self-elimination. A full and global was published by Ouyang et al. (58) demonstrating positive effects of insight into the precise inhibitory effects will thus require care- SOCS2 upon ectopic expression in C2C12 myoblasts. full analysis of the interaction pattern at the cytokine receptor,

REFERENCES at BIOMEDISCHE BIBLIOTHEEK on February 12, 2008 at the targeted SOCS protein, and at the level of self-interac- tion, bearing in mind the effect of the differences in binding 1. Kile, B. T., Schulman, B. A., Alexander, W. S., Nicola, N. A., Martin, H. M., and Hilton, D. J. (2002) Trends Biochem. Sci. 27, 235–241 affinities and relative expression levels of all components. 2. Hilton, D. J., Richardson, R. T., Alexander, W. S., Viney, E. M., Willson, Whereas SOCS1–3 and CIS have been studied extensively, so T. A., Sprigg, N. S., Starr, R., Nicholson, S. E., Metcalf, D., and Nicola, N. A. far little is known about the physiological role of the other four (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 114–119 SOCS proteins, SOCS4–7. We therefore analyzed matrix- 3. Cohney, S. J., Sanden, D., Cacalano, N. A., Yoshimura, A., Mui, A., Migone, wise all possible inter-SOCS interactions. The interaction map T. S., and Johnston, J. A. (1999) Mol. Cell. Biol. 19, 4980–4988 showed two characteristics: first, SOCS2 appears to bind to all 4. Nicholson, S. E., Willson, T. A., Farley, A., Starr, R., Zhang, J. G., Baca, M., Alexander, W. S., Metcalf, D., Hilton, D. J., and Nicola, N. A. (1999) EMBO SOCS proteins, including itself; and second, SOCS6 and SOCS7 J. 18, 375–385 display exactly the same binding profile. 5. Yasukawa, H., Misawa, H., Sakamoto, H., Masuhara, M., Sasaki, A., In line with a SOCS-counteracting role of SOCS6, we have Wakioka, T., Ohtsuka, S., Imaizumi, T., Matsuda, T., Ihle, J. N., and shown that its expression potentiates signaling via the GHR, Yoshimura, A. (1999) EMBO J. 18, 1309–1320 IFN type I receptor, and LR in a way quite similar to what we 6. Naka, T., Narazaki, M., Hirata, M., Matsumoto, T., Minamoto, S., Aono, observed for SOCS2. Similar data sets were also obtained for A., Nishimoto, N., Kajita, T., Taga, T., Yoshizaki, K., Akira, S., and Kishi- moto, T. (1997) Nature 387, 924–929 leptin signaling in the physiologically relevant N38 hypotha- 7. Endo, T. A., Masuhara, M., Yokouchi, M., Suzuki, R., Sakamoto, H., Mit- lamic cell line. These novel findings regarding SOCS6 provide sui, K., Matsumoto, A., Tanimura, S., Ohtsubo, M., Misawa, H., Miyazaki, an explanation for the significant enhancement of glucose T., Leonor, N., Taniguchi, T., Fujita, T., Kanakura, Y., Komiya, S., and metabolism observed in SOCS6 transgenic mice (31). More Yoshimura, A. (1997) Nature 387, 921–924 evidence for a positive role for SOCS6 in cytokine signaling 8. Starr, R., Willson, T. A., Viney, E. M., Murray, L. J., Rayner, J. R., Jenkins, B. J., Gonda, T. J., Alexander, W. S., Metcalf, D., Nicola, N. A., and Hilton, also comes from studies in Drosophila melanogaster, where D. J. (1997) Nature 387, 917–921 SOCS44A (which is similar to SOCS6) was shown to enhance 9. Kamura, T., Sato, S., Haque, D., Liu, L., Kaelin, W. G., Jr., Conaway, R. C., the activity of the growth factor receptor/mitogen-activated and Conaway, J. W. (1998) Genes Dev. 12, 3872–3881 protein kinase (MAPK) signaling cascade, in contrast to 10. Zhang, J. G., Farley, A., Nicholson, S. E., Willson, T. A., Zugaro, L. M., SOCS36E (which is similar to SOCS5) (56). Simpson, R. J., Moritz, R. L., Cary, D., Richardson, R., Hausmann, G., Kile, Because several SOCS molecules can mediate similar regula- B. J., Kent, S. B., Alexander, W. S., Metcalf, D., Hilton, D. J., Nicola, N. A., and Baca, M. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 2071–2076 tory effects, functional redundancy is not unlikely. This may be 11. Kamura, T., Burian, D., Yan, Q., Schmidt, S. L., Lane, W. S., Querido, E., particularly true for (but not limited to) SOCS6 and SOCS7, Branton, P. E., Shilatifard, A., Conaway, R. C., and Conaway, J. W. (2001) which show high homology and similarity in binding specificity J. Biol. Chem. 276, 29748–29753 (45). Compensatory effects between cross-modulatory SOCS 12. Kamizono, S., Hanada, T., Yasukawa, H., Minoguchi, S., Kato, R., molecules may perhaps have an effect on the phenotypes of Minoguchi, M., Hattori, K., Hatakeyama, S., Yada, M., Morita, S., SOCS2-, SOCS6-, and SOCS7-deficient mice (23, 45, 57), war- Kitamura, T., Kato, H., Nakayama, K., and Yoshimura, A. (2001) J. Biol. Chem. 276, 12530–12538 ranting analysis of double knock-out mice, which may uncover 13. Ungureanu, D., Saharinen, P., Junttila, I., Hilton, D. J., and Silvennoinen, additional physiological activities of particular SOCS proteins. O. (2002) Mol. Cell. Biol. 22, 3316–3326 Of note, the SOCS box is not limited to the SOCS protein fam- 14. Frantsve, J., Schwaller, J., Sternberg, D. W., Kutok, J., and Gilliland, D. G.

NOVEMBER 3, 2006•VOLUME 281•NUMBER 44 JOURNAL OF BIOLOGICAL CHEMISTRY 32965 - 171 - SOCS Cross-regulation

(2001) Mol. Cell. Biol. 21, 3547–3557 36. Eyckerman, S., Verhee, A., Van der Heyden, J., Lemmens, I., Van Ostade, 15. Tyers, M., and Rottapel, R. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, X., Vandekerckhove, J., and Tavernier, J. (2001) Nat. Cell Biol. 3, 12230–12232 1114–1119 16. Hanada, T., Yoshida, T., Kinjyo, I., Minoguchi, S., Yasukawa, H., Kato, S., 37. Montoye, T., Lemmens, I., Catteeuw, D., Eyckerman, S., and Tavernier, J. Mimata, H., Nomura, Y., Seki, Y., Kubo, M., and Yoshimura, A. (2001) (2005) Blood 105, 4264–4271 J. Biol. Chem. 276, 40746–40754 38. van de Geijn, G. J., Gits, J., Aarts, L. H., Heijmans-Antonissen, C., and 17. Haan, S., Ferguson, P., Sommer, U., Hiremath, M., McVicar, D. W., Touw, I. P. (2004) Blood 104, 667–674 Heinrich, P. C., Johnston, J. A., and Cacalano, N. A. (2003) J. Biol. Chem. 39. Pattyn, E., Van Ostade, X., Schauvliege, L., Verhee, A., Kalai, M., 278, 31972–31979 Vandekerckhove, J., and Tavernier, J. (1999) J. Biol. Chem. 274, 18. Starr, R., Metcalf, D., Elefanty, A. G., Brysha, M., Willson, T. A., Nicola, 34838–34845 N. A., Hilton, D. J., and Alexander, W. S. (1998) Proc. Natl. Acad. Sci. 40. Sakamoto, H., Yasukawa, H., Masuhara, M., Tanimura, S., Sasaki, A., U. S. A. 95, 14395–14399 Yuge, K., Ohtsubo, M., Ohtsuka, A., Fujita, T., Ohta, T., Furukawa, Y., 19. Naka, T., Matsumoto, T., Narazaki, M., Fujimoto, M., Morita, Y., Ohsawa, Iwase, S., Yamada, H., and Yoshimura, A. (1998) Blood 92, 1668–1676 Y., Saito, H., Nagasawa, T., Uchiyama, Y., and Kishimoto, T. (1998) Proc. 41. Song, M. M., and Shuai, K. (1998) J. Biol. Chem. 273, 35056–35062 Natl. Acad. Sci. U. S. A. 95, 15577–15582 42. Belsham, D. D., Cai, F., Cui, H., Smukler, S. R., Salapatek, A. M., and 20. Alexander, W. S., Starr, R., Fenner, J. E., Scott, C. L., Handman, E., Sprigg, Shkreta, L. (2004) Endocrinology 145, 393–400 N. S., Corbin, J. E., Cornish, A. L., Darwiche, R., Owczarek, C. M., Kay, 43. Greenhalgh, C. J., Rico-Bautista, E., Lorentzon, M., Thaus, A. L., Morgan,

T. W., Nicola, N. A., Hertzog, P. J., Metcalf, D., and Hilton, D. J. (1999) Cell P. O., Willson, T. A., Zervoudakis, P., Metcalf, D., Street, I., Nicola, N. A., Downloaded from 98, 597–608 Nash, A. D., Fabri, L. J., Norstedt, G., Ohlsson, C., Flores-Morales, A., 21. Howard, J. K., Cave, B. J., Oksanen, L. J., Tzameli, I., Bjorbaek, C., and Flier, Alexander, W. S., and Hilton, D. J. (2005) J. Clin. Investig. 115, 397–406 J. S. (2004) Nat. Med. 10, 734–738 44. Verdier, F., Chretien, S., Muller, O., Varlet, P., Yoshimura, A., 22. Mori, H., Hanada, R., Hanada, T., Aki, D., Mashima, R., Nishinakamura, Gisselbrecht, S., Lacombe, C., and Mayeux, P. (1998) J. Biol. Chem. 273, H., Torisu, T., Chien, K. R., Yasukawa, H., and Yoshimura, A. (2004) Nat. 28185–28190 Med. 10, 739–743 45. Krebs, D. L., Uren, R. T., Metcalf, D., Rakar, S., Zhang, J. G., Starr, R., De 23. Metcalf, D., Greenhalgh, C. J., Viney, E., Willson, T. A., Starr, R., Nicola, Souza, D. P., Hanzinikolas, K., Eyles, J., Connolly, L. M., Simpson, R. J., www.jbc.org N. A., Hilton, D. J., and Alexander, W. S. (2000) Nature 405, 1069–1073 Nicola, N. A., Nicholson, S. E., Baca, M., Hilton, D. J., and Alexander, W. S. 24. Greenhalgh, C. J., Bertolino, P., Asa, S. L., Metcalf, D., Corbin, J. E., Adams, (2002) Mol. Cell. Biol. 22, 4567–4578 T. E., Davey, H. W., Nicola, N. A., Hilton, D. J., and Alexander, W. S. (2002) 46. Landsman, T., and Waxman, D. J. (2005) J. Biol. Chem. 280, 37471–37480

Mol. Endocrinol. 16, 1394–1406 47. De Sepulveda, P., Ilangumaran, S., and Rottapel, R. (2000) J. Biol. Chem. at BIOMEDISCHE BIBLIOTHEEK on February 12, 2008 25. Greenhalgh, C. J., Metcalf, D., Thaus, A. L., Corbin, J. E., Uren, R., Morgan, 275, 14005–14008 P. O., Fabri, L. J., Zhang, J. G., Martin, H. M., Willson, T. A., Billestrup, N., 48. Rui, L., Yuan, M., Frantz, D., Shoelson, S., and White, M. F. (2002) J. Biol. Nicola, N. A., Baca, M., Alexander, W. S., and Hilton, D. J. (2002) J. Biol. Chem. 277, 42394–42398 Chem. 277, 40181–40184 49. Ram, P. A., and Waxman, D. J. (2000) J. Biol. Chem. 275, 39487–39496 26. Favre, H., Benhamou, A., Finidori, J., Kelly, P. A., and Edery, M. (1999) 50. Chen, X. P., Losman, J. A., Cowan, S., Donahue, E., Fay, S., Vuong, B. Q., FEBS Lett. 453, 63–66 Nawijn, M. C., Capece, D., Cohan, V. L., and Rothman, P. (2002) Proc. 27. Adams, T. E., Hansen, J. A., Starr, R., Nicola, N. A., Hilton, D. J., and Natl. Acad. Sci. U. S. A. 99, 2175–2180 Billestrup, N. (1998) J. Biol. Chem. 273, 1285–1287 51. Sasaki, A., Inagaki-Ohara, K., Yoshida, T., Yamanaka, A., Sasaki, M., 28. Pezet, A., Favre, H., Kelly, P. A., and Edery, M. (1999) J. Biol. Chem. 274, Yasukawa, H., Koromilas, A. E., and Yoshimura, A. (2003) J. Biol. Chem. 24497–24502 278, 2432–2436 29. Tannahill, G. M., Elliott, J., Barry, A. C., Hibbert, L., Cacalano, N. A., and 52. Narazaki, M., Fujimoto, M., Matsumoto, T., Morita, Y., Saito, H., Kajita, Johnston, J. A. (2005) Mol. Cell. Biol. 25, 9115–9126 T., Yoshizaki, K., Naka, T., and Kishimoto, T. (1998) Proc. Natl. Acad. Sci. 30. Dif, F., Saunier, E., Demeneix, B., Kelly, P. A., and Edery, M. (2001) Endo- U. S. A. 95, 13130–13134 crinology 142, 5286–5293 53. Stofega, M. R., Herrington, J., Billestrup, N., and Carter-Su, C. (2000) Mol. 31. Li, L., Gronning, L. M., Anderson, P. O., Li, S., Edvardsen, K., Johnston, J., Endocrinol. 14, 1338–1350 Kioussis, D., Shepherd, P. R., and Wang, P. (2004) J. Biol. Chem. 279, 54. Ram, P. A., and Waxman, D. J. (1999) J. Biol. Chem. 274, 35553–35561 34107–34114 55. Hansen, J. A., Lindberg, K., Hilton, D. J., Nielsen, J. H., and Billestrup, N. 32. Brender, C., Nielsen, M., Ropke, C., Nissen, M. H., Svejgaard, A., (1999) Mol. Endocrinol. 13, 1832–1843 Billestrup, N., Geisler, C., and Odum, N. (2001) Exp. Clin. Immunogenet. 56. Rawlings, J. S., Rennebeck, G., Harrison, S. M., Xi, R., and Harrison, D. A. 18, 80–85 (2004) BMC Cell Biol. 5, 38 33. Eyckerman, S., Broekaert, D., Verhee, A., Vandekerckhove, J., and Tav- 57. Krebs, D. L., Metcalf, D., Merson, T. D., Voss, A. K., Thomas, T., Zhang, ernier, J. (2000) FEBS Lett. 486, 33–37 J. G., Rakar, S., O’Bryan, M. K., Willson, T. A., Viney, E. M., Mielke, L. A., 34. Lavens, D., Montoye, T., Piessevaux, J., Zabeau, L., Vandekerckhove, J., Nicola, N. A., Hilton, D. J., and Alexander, W. S. (2004) Proc. Natl. Acad. Gevaert, K., Becker, W., Eyckerman, S., and Tavernier, J. (2006) J. Cell Sci. Sci. U. S. A. 101, 15446–15451 119, 2214–2224 58. Ouyang, X., Fujimoto, M., Nakagawa, R., Serada, S., Tanaka, T., Nomura, 35. Tavernier, J., Eyckerman, S., Lemmens, I., Van der Heyden, J., Vandeker- S., Kawase, I., Kishimoto, T., and Naka, T. (2006) J. Cell. Physiol. 207, ckhove, J., and Van Ostade, X. (2002) Clin. Exp. Allergy 32, 1397–1404 428–436

32966 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281•NUMBER 44•NOVEMBER 3, 2006 - 172 - CHAPTER 10: CIS functions are controlled by Elongin B/C binding

I. Introduction Elongin B/C association is known to be involved in proteasomal targeting of substrates and regulation of protein stability. In the following study we show that Elongin B/C recruitment to the SOCS box of a protein can also control its substrate interaction. Receptor interaction of CIS and subsequent inhibition of STAT5 activity were found to crucially depend on Elongin B/C binding. This Elongin B/C- dependency for substrate interaction appears to be unique for CIS and structural basis for this distinct feature of CIS is provided by molecular modelling of the CIS- Elongin B/C complex. These findings imply a new role for the SOCS box which may form a regulatory on/off switch acting on the SH2 domain. Increasing evidence indicates a key role for proteasomal activity in CIS-mediated signal suppression (Hunter et al., 2004; Ram and Waxman, 2000; Uyttendaele et al., 2007). Our observation that Elongin B/C association cannot be uncoupled from CIS actions further supports a major contribution for the recruitment of E3 ligase activity in CIS- mediated inhibition.

II. Article: Elongin B/C recruitment regulates substrate binding by CIS. Submitted to Journal of Biological Chemistry, 2008

III. References

Hunter, M. G., Jacob, A., O'Donnell L, C., Agler, A., Druhan, L. J., Coggeshall, K. M., and Avalos, B. R. (2004). Loss of SHIP and CIS recruitment to the granulocyte colony-stimulating factor receptor contribute to hyperproliferative responses in severe congenital neutropenia/acute myelogenous leukemia. J Immunol 173, 5036-5045. Ram, P. A., and Waxman, D. J. (2000). Role of the cytokine-inducible SH2 protein CIS in desensitization of STAT5b signaling by continuous growth hormone. J Biol Chem 275, 39487- 39496. Uyttendaele, I., Lemmens, I., Verhee, A., De Smet, A. S., Vandekerckhove, J., Lavens, D., Peelman, F., and Tavernier, J. (2007). MAPPIT analysis of STAT5, CIS and SOCS2 interactions with the growth hormone receptor. Mol Endocrinol 21, 2821-2831.

Chapter 10: CIS functions are controlled by Elongin B/C binding

- 173 - ELONGIN B/C RECRUITMENT REGULATES SUBSTRATE BINDING BY CIS Julie Piessevaux1,2, Dominiek Catteeuw1,2, Frank Peelman1,2 and Jan Tavernier1,2 From the Department of Medical Protein Research1, VIB and the Department of Biochemistry2, Faculty of Medicine and Health Sciences, Ghent University, A. Baertsoenkaai 3, 9000 Ghent, Belgium. Running Title: Elongin B/C regulates CIS function Address correspondence to: Jan Tavernier, A. Baertsoenkaai 3, B-9000 Ghent, Belgium; Tel: +32-9- 2649302; Fax: +32-9-2649492; E-mail: [email protected]

SOCS proteins play a major role in the phosphatase 1B (PTP-1B) or T-cell protein regulation of cytokine signalling. They are tyrosine phosphatase (TCPTP) (1-5), members of recruited to activated receptors and can the protein inhibitors of activated STATs (PIAS) suppress signalling by different mechanisms (6-8) and suppressor of cytokine signalling including targeting of the receptor complex for (SOCS) families (9-11). proteasomal degradation. The activity of SOCS SOCS proteins are induced by a broad proteins is regulated at different levels including range of extracellular ligands and function in a transcriptional control and posttranslational negative feedback loop to modulate signal modification. We here describe a novel transduction by multiple cytokine and growth regulatory mechanism for CIS, one of the factor receptors (12,13,14,15,16). The eight members of this protein family. A CIS mutant members of the SOCS family, SOCS1-7 and that is deficient in recruiting the Elongin B/C cytokine-inducible SH2 containing protein (CIS), complex completely fails to suppress STAT5 share a common structure with a central SH2 activation. This deficiency was not caused by domain, an amino-terminal domain of variable altered turnover of CIS but by loss of cytokine length and divergent sequence, and a carboxy- receptor interaction. Intriguingly, no such effect terminal 40 amino-acid module that is known as was seen for binding to MyD88. The interaction the SOCS box (9,17,18). The SH2 domain is the between CIS and the Elongin B/C complex is main determinant of target recognition by the easily disrupted and depends on the levels of SOCS proteins as it mediates interaction with uncomplexed Elongin B/C. This regulatory phosphorylated tyrosine residues on their mechanism may be unique for CIS since similar specific substrates (18-20). This way, SOCS mutations in SOCS1, -2, -3, -6 and -7 had no proteins can suppress signalling by direct functional impact. Our findings indicate that the competition with signalling molecules for the SOCS box not only plays a role in the formation phosphorylated recruitment sites. SOCS1 and of E3 ligase complexes, but, at least for CIS, can SOCS3 can also inhibit JAK tyrosine kinase also regulate the binding modus of SOCS box activity through their kinase inhibitory region containing proteins. (KIR), which is proposed to function as a pseudosubstrate blocking the catalytic cleft of the Cytokines regulate multiple biological JAK kinase (21). Finally, SOCS proteins can processes by activating specific cell surface suppress signalling through proteolytic receptor complexes. This leads to a series of degradation of the activated receptor complexes. signalling events, including activation of the Conserved motives in their SOCS box couple to Janus kinase (JAK)/signal transducer and Elongin B and C (B/C), Cullin and Rbx proteins, activator of transcription (STAT), leading to the formation of an E3 ubiquitin ligase phosphoinositol 3-kinase (PI3K), phospholipase complex (22-25) and subsequent ubiquitin- C ɣ (PLCɣ) and mitogen activated protein kinase marking of the target protein for proteasomal degradation. The functional significance of the (MAPK) pathways. The magnitude and duration association of Elongin B/C to the SOCS box is of a cellular response is determined by the however complex as the SOCS box may also integration of different positive and negative target SOCS proteins themselves for proteasomal signals. Mechanisms of signal attenuation are degradation (23,26,27). Conversely, Elongin diverse and involve different protein families B/C binding was also found to stabilize SOCS including phosphatases such as protein tyrosine

- 174 - protein expression (22,28,29). Therefore, it is pGL3-β-casein-luciferase reporter consisting of five assumed that Elongin B/C binding has a double- repeats of the STAT5-responsive motif of the β- edged effect on SOCS proteins: a degrading role casein promoter was a gift from Dr. Ivo Touw (45) by the link with the E3 ubiquitin ligase complex, and the STAT5-responsive pGL2-SPI2.1-luciferase but also a protective function by prevention of reporter was a gift from Dr. Walter Becker (46). proteasomal turnover of the SOCS molecules The pRK5-mJAK2 construct was a gift from Dr. them selves. There is also evidence that the Yohan Royer. Generation of the chimeric bait SOCS box is involved in a SOCS cross- receptors containing the extracellular part of the modulatory mechanism as some SOCS members EpoR and the transmembrane and intracellular parts like SOCS2 can act as negative regulators of of the leptin receptor, such as pCEL, were reported other SOCS proteins by targeting them for elsewhere (44,47). The following constructs were proteasomal turnover (30-32). Furthermore, we described previously : mLR Y1138F (YYF) (48); reported that the SOCS box of CIS is required pCEL-EpoR Y402 and pMG-SVT (44); pCEL-GHR for functional interaction with cytokine receptor Y595 (41); pSV-EpoR pMG2-CIS and pMG2- motifs with a critical role for the single tyrosine SOCS2 (40); pMET7-FLAG-CIS and pMET7- residue at position 253 (33). FLAG-SOCS2 (49); pMG2-CISY253F and The founding member of the family, CIS, pCAGGS-E-mMyD88-DD (33); pMG2- can inhibit signalling by several cytokine receptors SOCS2ΔB/C, pMG2-SOCS6, pMG2-SOCS7, including the erythropoietin receptor (EpoR) and pMET7-E-SOCS1 and pMET7-FLAG- the growth hormone receptor (GHR). CIS SOCS2ΔB/C (31); pMET7-FLAG-SOCS3 (50). suppresses Epo-induced cell proliferation and induces apoptosis of erythroid progenitor cells Cell culture, transfection procedures and reporter (34,35). CIS transgenic mice exhibit growth assay- HEK293-T cells were cultured in 8% CO2 retardation, suggesting a defect in GH signal humidified atmosphere at 37°C, and grown using transduction (36). Other abnormalities of CIS Dulbecco’s modified Eagle’s medium (Invitrogen) overexpressing mice were detected in prolactin and with 10% fetal calf serum (Cambrex Corp.). For IL-2 signalling pathways and these phenotypes transfection experiments, HEK293-T cells were resembled those found in STAT5a and/or STAT5b freshly seeded in 6-wells plates and transfected knock-out mice, lending support for CIS as a overnight with approximately 2,5 µg plasmid DNA specific negative regulator of STAT5-mediated using a standard calcium phosphate precipitation cytokine signalling (36). Direct competition with procedure. The pMET7-SVT construct was used to STAT5 for common phosphotyrosine binding sites normalize for the amount of transfected DNA and is observed for the EpoR (37-40), but not for the load of the transcriptional and translational GHR (41). In addition, CIS was found to induce machinery. The next day, cells were washed with proteasome-dependent degradation of the EpoR and phosphate-buffered saline (PBS), transferred to a GHR (37,42,43) and in the latter case, CIS also was 96-well plate and left untreated or stimulated with reported to play a role in GHR internalization (43). ligand for at least 24 h. Recombinant mouse leptin In this report, we investigated the effect of Elongin and human erythropoietin (Epo) were purchased B/C binding on CIS function in greater detail. from R&D Systems. Luciferase activity from Notably, we found that Elongin B/C recruitment by triplicate samples was measured by CIS is crucial for interaction with its receptor chemiluminescence in a TopCount luminometer substrates and subsequent inhibition of STAT5 (Canberra Packard) and expressed as fold induction activity. (stimulated/non-stimulated). Ba/F3 cells were grown in RPMI medium (Invitrogen) supplemented Experimental Procedures with 10% fetal calf serum (Cambrex Corp.) and 1 ng/ml mIL-3 (Biogen). Transfection of the cell Constructs- All constructs used in this study were line was done by electroporation (300 V, 1500 μF). generated by standard PCR- or restriction-based 48 h after transfection cells were simultaneously cloning procedures and are represented in table 1. starved (removal of serum and mIL-3) for 24 h and The pXP2d2-rPAPI-luciferase reporter, originating stimulated with 1 ng/ml mIL-3 overnight. from the rPAPI (rat pancreatitis associated protein Activation of the pGL2-SPI2.1-luciferase reporter I) promoter was described previously (44). The

- 175 - was measured with the Topcount luminometer immunoprecipitation and SDS-PAGE, interactions (Canberra Packard). were detected by immunobloting using the appropriate antibody. Western blot analysis and co-immunoprecipitation- Transfected HEK293-T cells were lysed in (Phospho)peptide affinity chromatography- modified RIPA buffer (200 mM NaCl, 50 mM Tris- Approximately 2×107 HEK293-T cells transiently HCl pH 8.0, 0.05% SDS, 2mM EDTA, 1% Nonidet transfected as indicated were lysed in 5 ml lysis P-40, 0.5% deoxycholic acid, 1mM Na3VO4, 1mM buffer (150 mM NaCl, 20 mM HEPES pH 7.8, TM NaF, 20 mM β-glycerophosphate and Complete 0,5% Nonidet P-40, 20% glycerol, 1 mM MgCl2, protease inhibitor cocktail (Roche Applied 10 mM KCl, 0.5 mM DTT, 1 mM NaVO4, 1 mM Science)). Lysates were cleared by centrifugation at NaF, Complete™ Protease Inhibitor Cocktail 14,000 rpm for 10 minutes at 4°C. 5x loading (Roche Applied Science)). Lysates were cleared by buffer (156 mM Tris-HCl pH 6.8, 2% SDS, 25% centrifugation at 14,000 rpm for 10 minutes at 4°C glycerol, 0.01% bromophenol blue, 5% β- and loaded on a pre-column with Sepharose 4B mercaptoethanol) was added to the cell lysates, beads and streptavidin-agarose to prevent which were then resolved by SDS-PAGE and nonspecific interactions. Pre-cleared lysates were transferred to nitrocellulose membranes then incubated for 2 h at 4°C with the (Amersham Biosciences). Blotting efficiency was (phospho)tyrosine peptides as indicated coupled to checked by Ponceau S staining (Sigma). FLAG- streptavidin-agarose beads through their biotin tagged (corresponding to the peptide tag group. The beads were then washed twice with lysis DYKDDDDK) and E-tagged (corresponding to buffer and resuspended in 2x loading buffer (62.5 the peptide tag GAPVPYPDPLEPR) proteins were mM Tris-HCl pH 6.8, 3% SDS, 10% glycerol, revealed using respectively monoclonal anti-FLAG 0.01% bromophenol blue, 5% ß-mercaptoethanol). antibody M2 (Sigma) and monoclonal anti-E-tag Specific protein binding was revealed by SDS- antibody (GE Healthcare). Polyclonal rabbit anti- PAGE and immunoblotting using the anti-FLAG CIS, goat anti-Elongin C and rabbit anti-JAK2 were antibody. The sequences of the used peptides were 402 supplied by Santa Cruz Biotechnology. Western biotin-EGASAASFEY(P)TILDPSSQL for Y of blot analysis was performed using the Odyssey the EpoR and biotin-QRQPSVKY(P)ATLVSNDK Infrared Imaging System (Li-Cor) following the for Y985 of the LR. Synthesis and purification of the manufacturer’s guidelines. In brief, blots were biotinylated (phospho)tyrosine peptides and blocked in Odyssey blocking buffer (Li-Cor), then coupling to streptavidin-agarose beads was probed overnight with the appropriated antibodies described before (50). diluted in Odyssey blocking buffer with 0.1% Tween 20 and finally incubated with an IRDye 700 Gel filtration chromatography- Approximately 108 donkey anti-goat, IRDye 800 goat anti-mouse or Ba/F3 cells were stimulated with 10 ng/ml IL-3 for IRDye 800 goat anti-rabbit secondary antibody (Li- 1h at 37 °C and lysed in 3 ml lysis buffer Cor). For the co-immunoprecipitation experiments containing 150 mM NaCl, 50 mM Tris-HCl pH 8, 2 6 approximately 6 x 10 HEK293-T cells were mM EDTA, 0.875% Brij 97 (Sigma-Aldrich), transfected with FLAG-tagged or E-tagged 0.125% Nonidet P-40, 1mM Pefabloc and Protease expression vectors using the calcium phosphate Inhibitor Cocktail Set III (Calbiochem). Lysates transfection procedure and lysed after 48 h in 1ml were cleared by centrifugation at 14,000 rpm for 10 lysis buffer (50mM NaCl, 20mM Tris-HCl pH6.6, minutes at 4°C, quantified with the Bradford 1% Nonidet P-40, 2,5% glycerol, 1mM EDTA, method and applied to a calibrated Superdex 75 1mM Na3VO4, 1mM NaF, 20 mM β- PG16/60 gel filtration column (Amersham) run by TM glycerophosphate and Complete protease an Advanced Protein Purification System (APPS) inhibitor cocktail (Roche Applied Science)). apparatus (Waters). The running buffer consisted of Lysates were cleared by centrifugation at 14,000 50 mM Tris-HCl pH 7.4 and 150 mM NaCl. After rpm for 10 minutes at 4°C and incubated with 4,0 trichloroaceticacid (TCA) precipitation of equal µg/ml anti-FLAG mouse monoclonal antibody volumes of collected fractions, the samples were (Sigma) or anti E-tag mouse monoclonal antibody subjected to SDS−PAGE and immunoblotting (GE Healthcare) and protein G-sepharose using the indicated antibodies. (Amersham Biosciences). After

- 176 - Modelling method- Homology models for CIS, carboxy-terminally linked to a chimaeric receptor based on the crystal structures of SOCS2 (51) or that is deficient in STAT3 recruitment, while a prey SOCS4 (52) were created as described before (41). protein is fused to a part of the glycoprotein 130 (gp130) chain containing four functional STAT3 RESULTS recruitment sites. Co-expression of an interacting bait/prey pair leads to functional complementation CIS activity depends on Elongin B/C of STAT3 activity and induction of a STAT3- binding. To investigate the role of Elongin B/C and responsive luciferase reporter. MAPPIT permits Cullin5 binding on CIS function, we generated CIS the detection of both modification-independent and variants lacking their respective recruitment sites: phosphorylation-dependent interactions. The CISΔB/C (L222Q,C226Q) (22) and CISΔCul MAPPIT configurations used in this manuscript are (L240PLP244-AAAA) (53) (Fig. 1A). CIS activity described in Figure 2A. Functional expression of was evaluated by a STAT5-dependent reporter the different bait constructs was assessed by assay in HEK293-T cells that were transiently measuring interaction with the JAK2-binding Ring transfected with the human EpoR expression vector Finger Protein 41 (RNF41) prey (De Ceuninck et and CIS, SOCS2 or mutant constructs. While wild al., unpublished results). The CIS Y253F prey was type CIS clearly suppressed reporter activity as again used as a loss-of-function control. expected, the CISΔB/C derivative was almost As examples of known interaction partners completely unable to impair reporter induction (Fig. of CIS and SOCS2, we used the intracellular 1B). In contrast, the CISΔCul variant was still fully receptor tyrosine motifs Y402 of the EpoR (44) and functional, indicating that the effect of the Y595 of the GHR (41) as baits. We also analysed CISΔB/C mutation was specifically due to interactions with the leptin receptor (LR) by abrogated Elongin B/C recruitment and not to a mutating the STAT3-recruiting Y1138 to F (LR lack of formation of a larger E3 complex. As a (YYF)). This way, MAPPIT analysis of interactions control, we also included the Y253F loss-of- at positions Y985 and Y1077, that are known to recruit function CIS mutant (33). Much in contrast, a SOCS proteins (49,50,54) is possible using the full similar B/C box mutation in the highly related length LR. HEK293-T cells were cotransfected SOCS2 protein (SOCS2ΔB/C, L163Q,C167Q) with the aforementioned baits and prey constructs showed no effect on STAT5 signalling. To examine encoding the different CIS and SOCS2 variants, the function of the CIS mutants in a more combined with the STAT3-responsive rPAP1 physiological set-up, STAT5-dependent reporter luciferase reporter. Figure 2B shows that assays measuring interleukin-3 (IL-3) signalling elimination of the Elongin B/C binding site in the were performed in the murine Ba/F3 pro-B cell CIS prey caused complete loss of binding to all line. Again, we observed that the inhibitory effect studied receptor motifs. In contrast, deletion of the of CIS was completely dependent on an intact B/C conserved B/C box in the SOCS2 prey did not box (Fig. 1C). significantly affect interaction with the baits. The observed interaction patterns with the EpoR Y402 Elongin B/C recruitment to CIS is required bait were confirmed by phosphopeptide affinity for receptor substrate binding. It is well established chromatography. Complete loss of binding to the that the interaction of SOCS proteins with their phosphorylated Y402 of the EpoR was observed for receptor targets depends on their SH2 domains the CISΔB/C or Y253F mutants, while no effect was (18,20). In case of CIS, we recently demonstrated seen for a similar SOCS2ΔB/C mutant (Fig. 2C). that the carboxy-terminal Y253 residue is also In analogy with the observed interaction pattern of required for interaction with phosphotyrosine the CIS Y253F mutant (33), deletion of the B/C box motifs in cytokine receptors (33). Since disruption did not affect interaction with the TLR adaptor of Elongin B/C binding abrogated CIS function, we MyD88 (Fig. 2D). This implies that the structural next investigated the involvement of Elongin B/C integrity of the CIS prey is maintained upon recruitment in substrate binding. To address this deletion of the Elongin B/C recruitment site. In question we used the mammalian protein-protein Figure 2E we integrated binding controls for the interaction trap (MAPPIT) method, a strategy CIS mutants. The top panel shows a MAPPIT designed to analyse protein-protein interactions in experiment demonstrating that the CISΔB/C, but mammalian cells. In MAPPIT, a bait protein is not the CISΔCul prey is incapable to interact with

- 177 - an Elongin C bait. Similar data were obtained in a phosphopeptide affinity chromatography reciprocal setting: a complete loss of binding with experiment using the phosphorylated Y985 motif of the Elongin B and C (B/C) preys and Cullin5 prey the LR (Fig. 4D). is seen for the CISΔB/C bait, whilst interaction of only the Cullin5 prey is lost for the CISΔCul CIS and SOCS2 display different binding mutation. Finally, the bottom panels show co- properties for the Elongin B/C complex. Co- immunoprecipitation experiments demonstrating immunoprecipitation experiments demonstrated loss of interaction with the endogenous Elongin C that CIS coprecipitates less endogenous Elongin C and FLAG-tagged Cullin5 upon deletion of the B/C than SOCS2 (Fig. 5A). We next compared the motif or the Cullin box in CIS. relative binding properties of CIS and SOCS2 for Elongin C in a MAPPIT set-up. To this end, the Loss of substrate binding by CISΔB/C is interaction of a SOCS2 or CIS prey with the not due to an effect on CIS stability. Although we Elongin C bait was assessed by cotransfection of did not observe a significant effect of the CISΔB/C increasing amounts of wild type CIS or SOCS2, mutation on protein expression, we wanted to respectively (Fig. 5B). In contrast to SOCS2 that verify whether an altered protein half-life time strongly competed with the CIS prey for binding to could account for the loss of substrate binding. To Elongin C, CIS could not interfere with the this end, protein expression levels of CIS (with or interaction between the SOCS2 prey and the without co-expressed Elongin B/C) and of the Elongin C bait, suggesting a lower binding affinity CISΔB/C mutant were monitored in the presence of of CIS for Elongin C, in comparison with SOCS2. the translation inhibitor cycloheximide and half- Thus, the CIS interaction with the Elongin B/C lives were determined by quantification of the complex is easily disrupted and accordingly CIS observed band intensities. As shown in Figure 3, function may depend on the availability of a free the decline of the mutant was less pronounced than Elongin B/C pool within the cell. that of wild type CIS. The estimated half-life was 40’ for CIS and 1 h 30’ for CISΔB/C respectively, ruling out an effect of protein stability on the Elongin B/C levels can determine CIS interaction assays. Of note, Elongin B/C co- activity. To verify the concept that CIS expression also significantly extended CIS half-life functionality is regulated by the intracellular level time, indicating a stabilizing effect of Elongin B/C. of free Elongin B/C complex, we performed two distinct experiments. First, we examined using The CIS Elongin B/C-dependency for MAPPIT whether co-expression of Elongin B/C in substrate interaction is unique among SOCS HEK293-T cells could enhance CIS substrate proteins. We next questioned whether other SOCS binding. As shown in Figure 6A, this is clearly the family members also display a similar dependency case using the GHR Y595 motif as bait, while on Elongin B/C binding for substrate recognition. Elongin B/C co-expression was not inducing a We used MAPPIT to examine the binding of stronger binding of the SOCS2 prey to the GHR SOCS6 and SOCS7 or of their respective Elongin receptor motive. This implicates the existence of a B/C deletion mutants on the LR (YYF) bait. pool of free CIS prey that becomes activated upon Similar to SOCS2, the ΔB/C mutation in SOCS6 or Elongin B/C recruitment. We therefore examined in SOCS7 did not alter the interaction pattern (Fig. a second experiment whether an unbound 4A). Other read-outs were used for SOCS1 and endogenous CIS fraction exists. This was evaluated SOCS3 since these inhibit the MAPPIT assay due in the physiological background of BaF/3 cells. to their JAK suppressive activity. The interaction of Lysates of IL-3-stimulated Ba/F3 cells were SOCS1 with JAK2 was analysed by co- separated by gel filtration chromatography over a immunoprecipitation. As shown in Figure 4B, Superdex 75 PG16/60 column and the fractions SOCS1 and its ΔB/C mutant bind equally well to containing CIS and Elongin C were identified by JAK2. For SOCS3, no effect was seen for the immunoblotting. As shown in Figure 6B the SOCS3ΔB/C mutant in a STAT5-dependent majority of CIS eluted in fractions corresponding to reporter assay implying normal interaction with the complexes of smaller molecular weight or EpoR (Fig. 4C). Similarly, normal binding was monomeric CIS (< 37 kDa in mass) and only a seen for the SOCS3ΔB/C mutant in a subset of the total CIS pool co-eluted with Elongin

- 178 - C (complex of > 44,6 kDa). This provides Cullin box did not abolish completely the evidence for the occurrence of a cellular population inhibitory functions of CIS in EpoR (and IL-3R, of free CIS which can thus be bound and regulated data not shown) signalling and this is currently by Elongin B/C. being investigated in greater detail. Much in contrast, no evidence was DISCUSSION obtained for a role in substrate binding by the Elongin B/C box of SOCS1, -2, -3, -6 and -7. SOCS proteins are known to act as the Since none of the other examined SOCS substrate recognition part of a RING-type E3 members was found to depend on Elongin ubiquitin ligase complex. Association of the recruitment for interaction with target motifs, SOCS box with the adaptor proteins Elongin B this may be a unique feature of CIS. This and C mediates further assembly with Cullin and specific effect seems to parallel the effects Rbx proteins, resulting in the formation of a observed for the Y253F mutation in the carboxy- multiprotein E3 ligase. This complex will terminal portion of the CIS SOCS box. We function as a scaffold that presents bound previously demonstrated that this mutation also substrate to an E2 ubiquitin conjugating enzyme, completely abrogated functional interaction with ultimately leading to ubiquitination and most cytokine receptor-based interaction motifs degradation of the target molecule. Within the (33,41). Again, no such role for conserved SOCS box, conserved B/C and Cullin boxes tyrosines in the SOCS box was observed for the respectively mediate Elongin C (22,55-58) and highly related SOCS2 proteins, or for SOCS1 Cullin2 or 5 recruitment depending on the SOCS and -3. Mutation of the Elongin B/C motif or family member (53). We here report that Y253 in CIS both lead to loss of binding to all deletion of the B/C box completely abrogated substrates that were tested, except MyD88. CIS function through loss of substrate binding. Together, these data suggest that the Elongin Deletion of the Cullin5 box had no impact on the B/C mutation and Y253 mutation affect receptor inhibitory effects of CIS, indicating that solely binding through a common mechanism. binding of Elongin B/C, and not the association Two different homology models were of a larger E3 complex, is essential for built for CIS, with a SOCS box orientation as in interaction of CIS with its cognate cytokine SOCS2 (homology model 1, Fig. 7A) or SOCS4 receptor motifs. (homology model 2, Fig. 7B). Both models Two mechanisms for CIS inhibition have exclude a direct interaction of the SOCS box or been proposed: partial inhibition by direct Y253 with the phosphopeptide substrate. In the competition with STAT5 for common model, Y253 shows no direct interaction with the phosphotyrosine binding sites on the receptor Elongins and mutation of Y253 does not impair and proteasome-mediated degradation of the Elongin B/C binding (33). In both models, Y253 receptor-JAK2 signalling complex. In case of the is found in the interface between the SOCS box GHR, this latter mechanism may be coupled to and the SH2 domain, suggesting that it might internalization of the activated receptor complex, mediate an allosteric regulation of substrate a critical step preceding termination of receptor binding by the SOCS box domain. We propose signalling (43). SOCS-mediated inhibition of the that the correct position of Y253 is critical for GHR by competition for shared binding sites substrate binding and that this correct position is with STAT5 was recently ruled out based on the induced by structural changes in the SOCS box non-overlapping bindings pattern of CIS and upon binding of Elongins. Similar structural SOCS2 with STAT5 (41). Furthermore, the rearrangements take place in yeast Elongin C SOCS box of CIS was found to be essential for upon binding of a SOCS box peptide from the the apoptotic effect of CIS on erythroid von Hippel-Lindau (VHL) protein (59). VHL progenitor cells (35). Our observation that requires Elongin B/C binding to adopt a stable Elongin B/C recruitment cannot be uncoupled structure (60,61) and stable expression. The from CIS function lends further support for a deletion of the Elongin binding site in CIS primary role for the formation of an E3 ligase appeared to have no drastic effects on the complex in CIS-mediated signal suppression. structural integrity of the SH2 domain protein, Nevertheless, we found that deletion of the since B/C box independent interactions of CIS

- 179 - were still observed with MyD88. We verified part of different multiprotein complexes whether the loss-of-function of the CISΔB/C including the RNA polymerase II (Pol II) (62,63) mutant was not due to an altered half-life time. machinery and a large subfamily of E3 ubiquitin The particular CIS mutant appeared to be even ligases. This encompasses the VHL tumor more stable that the wild type protein. However, suppressor complex (64) and over 70 proteins Elongin B/C co-expression significantly harboring a SOCS box in the human genome extended the half-life time of wild type CIS, (according to Pfam database). As each of these indicating that a stabilizing effect of Elongin B/C could possibly sequester the Elongin B/C on CIS does exist. complex, it is clear that depending on induction In co-immunoprecipitation experiments pattern, subcellular localization and relative CIS appeared to display a lower affinity for binding affinities of all these SOCS box Elongin C than SOCS2. Furthermore, MAPPIT containing proteins, a competition for Elongin competition experiments showed that SOCS2 B/C will occur. Of note, also viral genomes can over-expression easily interfered with the encode proteins that recruit Elongin B/C, e.g. interaction between CIS and Elongin C, a HIV-1 Viral infectivity factor (Vif) that phenomenon that appeared to be unidirectional. suppresses the antiviral activity of APOBEC3G This sensitivity of CIS for Elongin recruitment (65). We here also mention that inappropriately suggests an underlying regulatory mechanism. elevated SOCS (66-71) or Elongin C (72) levels Conceivably, CIS activity may be down- can be found in several oncologic disorders. modulated by SOCS2 in a dual way. First, We can only speculate on the SOCS2 is induced at later stage post receptor physiological reason behind this built-in activation and may scavenge Elongin B/C from molecular on/off switch in CIS. It is intriguing CIS leading to loss of substrate binding. Second, that different effects are observed for different SOCS2 can interact with unbound CIS leading to substrates: CIS binding of several cytokine degradation of the free CIS pool. We previously receptors is under tight control, whilst no effect reported that this involves the SOCS box of CIS is seen for the interaction with MyD88. Perhaps, as interaction domain for SOCS2 and also the this observed Elongin B/C dependency may SOCS box of SOCS2 as template for building function as a ‘safety lock’ for ensuring complete the E3 ligase complex (31). suppression of signalling as only the CIS Lending further support for regulation at molecules that recruit an E3 ligase complex will this level is our observation that CIS activity be able to participate in the inhibition. depends on the levels of Elongin B/C within the Conceivably, such tight control may be required cell. Using MAPPIT we demonstrated that co- for the vital processes that are modulated by CIS expression of Elongin B/C increased CIS prey like the GHR mediated somatic growth and interaction with a receptor motif, while no such cellular metabolism. The remarkable effect was seen for SOCS2 prey binding. We discrepancy observed between the lack of also provided evidence for the existence of phenotype of CIS knock-out mice and the monomeric CIS protein in BaF/3 cells by gel defective phenotype in growth, mammary gland filtration analysis. These findings suggest that development and immune effects of CIS the activity of free CIS protein can be transgenic mice (36,73) may also suggest the functionally modulated by Elongin B/C and that high risk of unrestrained CIS activity. the availability of unbound Elongin B/C complex In conclusion, our findings further will determine CIS activity. So far, little is underscore the functional complexity of the SOCS known on the mechanisms that determine free box domain. Next to its role in protein turnover, the Elongin B/C levels in the cell and more detailed SOCS box domain appears also to be involved in studies are clearly required. Elongin B/C can be regulation of substrate binding.

- 180 - REFERENCES

1. Elchebly, M., Payette, P., Michaliszyn, E., Cromlish, W., Collins, S., Loy, A. L., Normandin, D., Cheng, A., Himms-Hagen, J., Chan, C. C., Ramachandran, C., Gresser, M. J., Tremblay, M. L., and Kennedy, B. P. (1999) Science 283, 1544-1548 2. Myers, M. P., Andersen, J. N., Cheng, A., Tremblay, M. L., Horvath, C. M., Parisien, J. P., Salmeen, A., Barford, D., and Tonks, N. K. (2001) J Biol Chem 276, 47771-47774 3. Lund, I. K., Hansen, J. A., Andersen, H. S., Moller, N. P., and Billestrup, N. (2005) J Mol Endocrinol 34, 339-351 4. Lorenzen, J. A., Dadabay, C. Y., and Fischer, E. H. (1995) J Cell Biol 131, 631-643 5. ten Hoeve, J., de Jesus Ibarra-Sanchez, M., Fu, Y., Zhu, W., Tremblay, M., David, M., and Shuai, K. (2002) Mol Cell Biol 22, 5662-5668 6. Chung, C. D., Liao, J., Liu, B., Rao, X., Jay, P., Berta, P., and Shuai, K. (1997) Science 278, 1803- 1805 7. Liu, B., Liao, J., Rao, X., Kushner, S. A., Chung, C. D., Chang, D. D., and Shuai, K. (1998) Proc Natl Acad Sci U S A 95, 10626-10631 8. Shuai, K., and Liu, B. (2005) Nat Rev Immunol 5, 593-605 9. Starr, R., Willson, T. A., Viney, E. M., Murray, L. J., Rayner, J. R., Jenkins, B. J., Gonda, T. J., Alexander, W. S., Metcalf, D., Nicola, N. A., and Hilton, D. J. (1997) Nature 387, 917-921 10. Naka, T., Narazaki, M., Hirata, M., Matsumoto, T., Minamoto, S., Aono, A., Nishimoto, N., Kajita, T., Taga, T., Yoshizaki, K., Akira, S., and Kishimoto, T. (1997) Nature 387, 924-929 11. Rakesh, K., and Agrawal, D. K. (2005) Biochem Pharmacol 70, 649-657 12. Yasukawa, H., Sasaki, A., and Yoshimura, A. (2000) Annu Rev Immunol 18, 143-164 13. Gadina, M., Hilton, D., Johnston, J. A., Morinobu, A., Lighvani, A., Zhou, Y. J., Visconti, R., and O'Shea, J. J. (2001) Curr Opin Immunol 13, 363-373 14. Krebs, D. L., and Hilton, D. J. (2001) Stem Cells 19, 378-387 15. Sadowski, C. L., Choi, T. S., Le, M., Wheeler, T. T., Wang, L. H., and Sadowski, H. B. (2001) J Biol Chem 276, 20703-20710 16. Dogusan, Z., Hooghe-Peters, E. L., Berus, D., Velkeniers, B., and Hooghe, R. (2000) J Neuroimmunol 109, 34-39 17. Hilton, D. J., Richardson, R. T., Alexander, W. S., Viney, E. M., Willson, T. A., Sprigg, N. S., Starr, R., Nicholson, S. E., Metcalf, D., and Nicola, N. A. (1998) Proc Natl Acad Sci U S A 95, 114-119 18. Narazaki, M., Fujimoto, M., Matsumoto, T., Morita, Y., Saito, H., Kajita, T., Yoshizaki, K., Naka, T., and Kishimoto, T. (1998) Proc Natl Acad Sci U S A 95, 13130-13134 19. Endo, T. A., Masuhara, M., Yokouchi, M., Suzuki, R., Sakamoto, H., Mitsui, K., Matsumoto, A., Tanimura, S., Ohtsubo, M., Misawa, H., Miyazaki, T., Leonor, N., Taniguchi, T., Fujita, T., Kanakura, Y., Komiya, S., and Yoshimura, A. (1997) Nature 387, 921-924 20. Nicholson, S. E., Willson, T. A., Farley, A., Starr, R., Zhang, J. G., Baca, M., Alexander, W. S., Metcalf, D., Hilton, D. J., and Nicola, N. A. (1999) Embo J 18, 375-385 21. Yasukawa, H., Misawa, H., Sakamoto, H., Masuhara, M., Sasaki, A., Wakioka, T., Ohtsuka, S., Imaizumi, T., Matsuda, T., Ihle, J. N., and Yoshimura, A. (1999) Embo J 18, 1309-1320 22. Kamura, T., Sato, S., Haque, D., Liu, L., Kaelin, W. G., Jr., Conaway, R. C., and Conaway, J. W. (1998) Genes Dev 12, 3872-3881 23. Zhang, J. G., Farley, A., Nicholson, S. E., Willson, T. A., Zugaro, L. M., Simpson, R. J., Moritz, R. L., Cary, D., Richardson, R., Hausmann, G., Kile, B. J., Kent, S. B., Alexander, W. S., Metcalf, D., Hilton, D. J., Nicola, N. A., and Baca, M. (1999) Proc Natl Acad Sci U S A 96, 2071-2076 24. Kamura, T., Burian, D., Yan, Q., Schmidt, S. L., Lane, W. S., Querido, E., Branton, P. E., Shilatifard, A., Conaway, R. C., and Conaway, J. W. (2001) J Biol Chem 276, 29748-29753 25. Kile, B. T., Schulman, B. A., Alexander, W. S., Nicola, N. A., Martin, H. M., and Hilton, D. J. (2002) Trends Biochem Sci 27, 235-241

- 181 - 26. Kamizono, S., Hanada, T., Yasukawa, H., Minoguchi, S., Kato, R., Minoguchi, M., Hattori, K., Hatakeyama, S., Yada, M., Morita, S., Kitamura, T., Kato, H., Nakayama, K., and Yoshimura, A. (2001) J Biol Chem 276, 12530-12538 27. Chen, X. P., Losman, J. A., Cowan, S., Donahue, E., Fay, S., Vuong, B. Q., Nawijn, M. C., Capece, D., Cohan, V. L., and Rothman, P. (2002) Proc Natl Acad Sci U S A 99, 2175-2180 28. Hanada, T., Yoshida, T., Kinjyo, I., Minoguchi, S., Yasukawa, H., Kato, S., Mimata, H., Nomura, Y., Seki, Y., Kubo, M., and Yoshimura, A. (2001) J Biol Chem 276, 40746-40754 29. Haan, S., Ferguson, P., Sommer, U., Hiremath, M., McVicar, D. W., Heinrich, P. C., Johnston, J. A., and Cacalano, N. A. (2003) J Biol Chem 278, 31972-31979 30. Tannahill, G. M., Elliott, J., Barry, A. C., Hibbert, L., Cacalano, N. A., and Johnston, J. A. (2005) Mol Cell Biol 25, 9115-9126 31. Piessevaux, J., Lavens, D., Montoye, T., Wauman, J., Catteeuw, D., Vandekerckhove, J., Belsham, D., Peelman, F., and Tavernier, J. (2006) J Biol Chem 281, 32953-32966 32. Wu, K. L., Miao, H., and Khan, S. (2007) Am J Physiol Renal Physiol 33. Lavens, D., Ulrichts, P., Catteeuw, D., Gevaert, K., Vandekerckhove, J., Peelman, F., Eyckerman, S., and Tavernier, J. (2007) Biochem J 401, 257-267 34. Matsumoto, A., Masuhara, M., Mitsui, K., Yokouchi, M., Ohtsubo, M., Misawa, H., Miyajima, A., and Yoshimura, A. (1997) Blood 89, 3148-3154 35. Ketteler, R., Moghraby, C. S., Hsiao, J. G., Sandra, O., Lodish, H. F., and Klingmuller, U. (2003) J Biol Chem 278, 2654-2660 36. Matsumoto, A., Seki, Y., Kubo, M., Ohtsuka, S., Suzuki, A., Hayashi, I., Tsuji, K., Nakahata, T., Okabe, M., Yamada, S., and Yoshimura, A. (1999) Mol Cell Biol 19, 6396-6407 37. Verdier, F., Chretien, S., Muller, O., Varlet, P., Yoshimura, A., Gisselbrecht, S., Lacombe, C., and Mayeux, P. (1998) J Biol Chem 273, 28185-28190 38. Hansen, L. H., Wang, X., Kopchick, J. J., Bouchelouche, P., Nielsen, J. H., Galsgaard, E. D., and Billestrup, N. (1996) J Biol Chem 271, 12669-12673 39. Ram, P. A., and Waxman, D. J. (1999) J Biol Chem 274, 35553-35561 40. Montoye, T., Lemmens, I., Catteeuw, D., Eyckerman, S., and Tavernier, J. (2005) Blood 105, 4264- 4271 41. Uyttendaele, I., Lemmens, I., Verhee, A., De Smet, A. S., Vandekerckhove, J., Lavens, D., Peelman, F., and Tavernier, J. (2007) Mol Endocrinol 42. Ram, P. A., and Waxman, D. J. (2000) J Biol Chem 275, 39487-39496 43. Landsman, T., and Waxman, D. J. (2005) J Biol Chem 44. Eyckerman, S., Verhee, A., der Heyden, J. V., Lemmens, I., Ostade, X. V., Vandekerckhove, J., and Tavernier, J. (2001) Nat Cell Biol 3, 1114-1119 45. van de Geijn, G. J., Gits, J., Aarts, L. H., Heijmans-Antonissen, C., and Touw, I. P. (2004) Blood 104, 667-674 46. Wood, T. J., Sliva, D., Lobie, P. E., Goullieux, F., Mui, A. L., Groner, B., Norstedt, G., and Haldosen, L. A. (1997) Mol Cell Endocrinol 130, 69-81 47. Tavernier, J., Eyckerman, S., Lemmens, I., Van der Heyden, J., Vandekerckhove, J., and Van Ostade, X. (2002) Clin Exp Allergy 32, 1397-1404 48. Eyckerman, S., Waelput, W., Verhee, A., Broekaert, D., Vandekerckhove, J., and Tavernier, J. (1999) Eur Cytokine Netw 10, 549-556 49. Lavens, D., Montoye, T., Piessevaux, J., Zabeau, L., Vandekerckhove, J., Gevaert, K., Becker, W., Eyckerman, S., and Tavernier, J. (2006) J Cell Sci 119, 2214-2224 50. Eyckerman, S., Broekaert, D., Verhee, A., Vandekerckhove, J., and Tavernier, J. (2000) FEBS Lett 486, 33-37 51. Bullock, A. N., Debreczeni, J. E., Edwards, A. M., Sundstrom, M., and Knapp, S. (2006) Proc Natl Acad Sci U S A 103, 7637-7642 52. Bullock, A. N., Rodriguez, M. C., Debreczeni, J. E., Songyang, Z., and Knapp, S. (2007) Structure 15, 1493-1504

- 182 - 53. Kamura, T., Maenaka, K., Kotoshiba, S., Matsumoto, M., Kohda, D., Conaway, R. C., Conaway, J. W., and Nakayama, K. I. (2004) Genes Dev 18, 3055-3065 54. Bjorbaek, C., Lavery, H. J., Bates, S. H., Olson, R. K., Davis, S. M., Flier, J. S., and Myers, M. G., Jr. (2000) J Biol Chem 275, 40649-40657 55. Duan, D. R., Humphrey, J. S., Chen, D. Y., Weng, Y., Sukegawa, J., Lee, S., Gnarra, J. R., Linehan, W. M., and Klausner, R. D. (1995) Proc Natl Acad Sci U S A 92, 6459-6463 56. Duan, D. R., Pause, A., Burgess, W. H., Aso, T., Chen, D. Y., Garrett, K. P., Conaway, R. C., Conaway, J. W., Linehan, W. M., and Klausner, R. D. (1995) Science 269, 1402-1406 57. Aso, T., Haque, D., Barstead, R. J., Conaway, R. C., and Conaway, J. W. (1996) Embo J 15, 5557- 5566 58. Kibel, A., Iliopoulos, O., DeCaprio, J. A., and Kaelin, W. G., Jr. (1995) Science 269, 1444-1446 59. Botuyan, M. V., Koth, C. M., Mer, G., Chakrabartty, A., Conaway, J. W., Conaway, R. C., Edwards, A. M., Arrowsmith, C. H., and Chazin, W. J. (1999) Proc Natl Acad Sci U S A 96, 9033- 9038 60. Feldman, D. E., Thulasiraman, V., Ferreyra, R. G., and Frydman, J. (1999) Mol Cell 4, 1051-1061 61. Melville, M. W., McClellan, A. J., Meyer, A. S., Darveau, A., and Frydman, J. (2003) Mol Cell Biol 23, 3141-3151 62. Bradsher, J. N., Jackson, K. W., Conaway, R. C., and Conaway, J. W. (1993) J Biol Chem 268, 25587-25593 63. Aso, T., Lane, W. S., Conaway, J. W., and Conaway, R. C. (1995) Science 269, 1439-1443 64. Lonergan, K. M., Iliopoulos, O., Ohh, M., Kamura, T., Conaway, R. C., Conaway, J. W., and Kaelin, W. G., Jr. (1998) Mol Cell Biol 18, 732-741 65. Rose, K. M., Marin, M., Kozak, S. L., and Kabat, D. (2004) Trends Mol Med 10, 291-297 66. Schultheis, B., Carapeti-Marootian, M., Hochhaus, A., Weisser, A., Goldman, J. M., and Melo, J. V. (2002) Blood 99, 1766-1775 67. Raccurt, M., Tam, S. P., Lau, P., Mertani, H. C., Lambert, A., Garcia-Caballero, T., Li, H., Brown, R. J., McGuckin, M. A., Morel, G., and Waters, M. J. (2003) Br J Cancer 89, 524-532 68. Li, Z., Metze, D., Nashan, D., Muller-Tidow, C., Serve, H. L., Poremba, C., Luger, T. A., and Bohm, M. (2004) J Invest Dermatol 123, 737-745 69. Evans, M. K., Yu, C. R., Lohani, A., Mahdi, R. M., Liu, X., Trzeciak, A. R., and Egwuagu, C. E. (2007) Oncogene 26, 1941-1948 70. Zheng, C., Li, L., Haak, M., Brors, B., Frank, O., Giehl, M., Fabarius, A., Schatz, M., Weisser, A., Lorentz, C., Gretz, N., Hehlmann, R., Hochhaus, A., and Seifarth, W. (2006) Leukemia 20, 1028- 1034 71. Hookham, M. B., Elliott, J., Suessmuth, Y., Staerk, J., Ward, A. C., Vainchenker, W., Percy, M. J., McMullin, M. F., Constantinescu, S. N., and Johnston, J. A. (2007) Blood 109, 4924-4929 72. Porkka, K., Saramaki, O., Tanner, M., and Visakorpi, T. (2002) Lab Invest 82, 629-637 73. Li, S., Chen, S., Xu, X., Sundstedt, A., Paulsson, K. M., Anderson, P., Karlsson, S., Sjogren, H. O., and Wang, P. (2000) J Exp Med 191, 985-994 74. Bradshaw, J. M., Mitaxov, V., and Waksman, G. (1999) J Mol Biol 293, 971-985 75. Aman, M. J., Migone, T. S., Sasaki, A., Ascherman, D. P., Zhu, M., Soldaini, E., Imada, K., Miyajima, A., Yoshimura, A., and Leonard, W. J. (1999) J Biol Chem 274, 30266-30272

FOOTNOTES

We greatly acknowledge the technical support from Marc Goethals for peptid synthesis and from Hans Casters for the assistance with the gel filtration experiments. This work was supported by grants from the Fund for Scientific Research – Flanders (FWO-V Grant N° 1.5.446.98 to J.P.), Ghent University (GOA 12051401) and the IUAP-6 (N° P6:28). The abbreviations used are : JAK, Janus kinase; STAT, signal transducer and activator of transcription; SOCS, suppressor of cytokine signalling; CIS, cytokine inducible SH2 containing protein; SH2, src homology; MAPPIT, mammalian protein-protein interaction trap.

- 183 - FIGURE LEGENDS

Table 1. Overview of the constructs used in the present study

Fig. 1. CIS inhibition of Epo and IL-3 signalling depends on Elongin B/C recruitment. A. Domain structure of CIS and amino-acid sequence alignment of the SOCS boxes of mouse SOCS1, SOCS2, SOCS3 and CIS. Conserved residues are highlighted by different colors in the sequence alignment. The B/C box and IPLN/LPXP motif, which respectively confer Elongin B/C and Cullin binding, are indicated. B. HEK293-T cells were transfected with expression vectors for CIS, SOCS2 or their ΔB/C or ΔCul box deletion mutants, combined with the human EpoR and the STAT5-responsive β-casein-luciferase reporter. 24 h after transfection, cells were left untreated or were stimulated overnight with Epo (5 ng/ml) and luciferase measurements were performed in triplicate. Data are expressed as fold induction (stimulated/non stimulated ratio). Expression of the FLAG-tagged CIS and SOCS2 proteins was verified on lysates using anti-FLAG antibody. C. Ba/F3 cells were transiently electroporated with plasmids encoding CIS or CISΔB/C, combined with the STAT5-responsive pGL2-SPI2.1-luciferase reporter. 48 h after electroporation, the cells were starved and were left untreated or were stimulated overnight with mIL-3 (1ng/ml). Luciferase activities are represented as fold induction (stimulated/non stimulated ratio).

Fig. 2. Elongin B/C binding is critical for interaction of CIS with receptor motifs. A. Diagrammatic presentation of the MAPPIT configurations used in this study. The left panel shows the bait and prey chimeras. The right panel shows a variant of the MAPPIT technique wherein the LR itself functions as bait protein. See main text for explanation of the MAPPIT technique. B. HEK-293T cells were transiently cotransfected with bait plasmids encoding the LR (YYF), the EpoR Y402 or the GHR Y595 motif and prey plasmids encoding RNF41 as positive control, CIS, SOCS or derived mutant constructs, combined with the STAT3 responsive pXP2d2-rPAPI-luciferase reporter. 24 h after transfection, cells were left untreated or were stimulated with leptin (100 ng/ml) or Epo (5ng/ml) overnight. Luciferase data of triplicate measurements are expressed as fold induction (stimulated/non stimulated ratio). The expression of the FLAG-tagged prey proteins were evaluated by immunoblotting using anti-FLAG antibody. C. (Phospho)peptide affinity chromatography. HEK-293T cells were transfected with FLAG-tagged CIS, SOCS2 or mutant derivatives. The lysates were incubated with phosphorylated or non-phosphorylated peptides corresponding to the Y402 motif of the EpoR. Specific protein binding was revealed by SDS- polyacrylamide gel electrophoresis (PAGE) and immunoblotting using the anti-FLAG antibody. D. HEK- 293T cells were transiently cotransfected with bait plasmids encoding the GHR Y595 motif or MyD88 and prey plasmids encoding CIS or mutants, combined with the STAT3 responsive pXP2d2-rPAPI-luciferase reporter. MAPPIT signalling was assayed as described in Figure 2B. E. Verification of the interaction pattern of the CIS mutants. In the upper panel HEK293-T cells were transiently cotransfected with plasmids encoding the Simian Virus 40 large T-antigen (SVT) as a negative control, Elongin B, CIS or derived mutant prey constructs, combined with the indicated bait constructs and the pXP2d2-rPAP1-luciferase reporter. MAPPIT signalling was assayed as described in Figure 2B. In the bottom panels the bindings mode of the CIS mutants are demonstrated by co-immunoprecipiation experiments. Lysates of HEK-293T cells transfected with FLAG-tagged CIS or CISΔB/C were immunoprecipitated (IP) with anti-FLAG and subsequently immunoblotted (IB) with anti-Elongin C (left panel). HEK293-T cells were cotransfected with combinations of FLAG-tagged Cullin5 and E-tagged CIS, CISΔB/C or CISΔCul and the lysates were immunoprecipitated with anti-E and then immunoblotted with anti-FLAG (right panel).

Fig. 3. Effect of Elongin B/C on CIS half-life. HEK293-T cells were transiently transfected with combinations of FLAG-tagged CIS, CISΔB/C or Elongin B/C. 24 h after transfection, cells were treated with cycloheximide (CHX) (20µg/ml) for different time points. The lysates were revealed by SDS-PAGE and immunoblotting using the anti-FLAG antibody. CIS expression levels were detected and quantified using the Odyssey Infrared Imaging System (Li-Cor) and normalized for β-actin expression levels. The graph shows processed data of the degradation assay above in which the initial maximal expression was defined as 100%.

- 184 -

Fig. 4. Substrate interaction of other SOCS proteins is not Elongin B/C dependent. A. MAPPIT analysis of the binding modus of SOCS6 and SOCS7 (ΔB/C) preys with the leptin receptor. HEK293-T cells were transiently cotransfected with plasmids encoding the indicated prey constructs, combined with the LR(YYF) bait and the pXP2d2-rPAP1-luciferase reporter. MAPPIT signalling was assayed as described in Figure 2B. B. Co-immunoprecipitation analysis of the interaction between JAK2 and SOCS1(ΔB/C). HEK-293T cells were transiently transfected with combinations of JAK2 and E-tagged SOCS1, SOCS1ΔB/C or MyD88 as negative control. Cell lysates were immunoprecipitated with anti-E-tag and subsequently immunoblotted with anti-JAK2. C. Effect of the deletion of the B/C box on SOCS3 inhibition of EpoR signalling. HEK293-T cells were transfected with expression vectors for SOCS3, CIS or their ΔB/C deletion mutants, combined with the human EpoR and the β-casein-derived luciferase reporter gene. EpoR signalling was assayed as described in the legend of Figure 1B. D. (Phospho)peptide affinity chromatography to analyse the interaction between SOCS3 or its ΔB/C mutant and the Y985 motif of the LR. HEK-293T cells were transfected with FLAG-tagged SOCS3 or SOCS3ΔB/C and lysates were incubated with phosphorylated or non-phosphorylated peptides corresponding to the Y985 motif of the LR. Specific protein binding was revealed by SDS-PAGE and immunoblotting using the anti-FLAG antibody.

Fig. 5. CIS displays a lower affinity for Elongin C in comparison to SOCS2. A. Co-immunoprecipitation analysis of the interaction between CIS or SOCS2 and endogenous Elongin C. HEK-293T cells were transiently transfected with E-tagged CIS, SOCS2 or APOBEC3G as a negative control. Cell lysates were immunoprecipitated with anti-E-tag and subsequently immunoblotted with anti-Elongin C. B. MAPPIT competition assay in HEK293-T cells transiently expressing the pXP2d2-rPAP1-luciferase reporter and the Elongin C bait combined with the SOCS2 or CIS preys and increasing amounts of a competitor (CIS for the SOCS2 prey and SOCS2 for the CIS prey). MAPPIT signalling was assayed as described in Figure 2B.

Fig. 6. Elongin B/C levels can determine CIS activity. A. The bindings potency of the CIS prey depends on Elongin B/C levels in MAPPIT. HEK-293T cells were transiently cotransfected with expression vectors encoding the pXP2d2-rPAP1-luci reporter, the GHR Y595 bait and CIS or SOCS2 (ΔB/C) preys, with or without Elongin B/C co-expression. MAPPIT signalling was assayed as described in Figure 2B. B. Occurrence of uncomplexed CIS in Ba/F3 cells. Lysates of IL-3 activated Ba/F3 cells (108 cells) harboring endogenous CIS were size fractionated by gel filtration on a Superdex 75 PG16/60 column. The individual fractions were subjected to SDS−PAGE and immunoblotting using anti-CIS and anti-Elongin C antibody. As a standard, a mix of proteins of defined molecular weights was also fractionated on the same column, allowing an estimation of the molecular weight of the different fractions.

Fig. 7. Homology models for CIS. Two different homology models were built for CIS, with a SOCS box orientation as in SOCS2 (homology model 1, panel A) or SOCS4 (homology model 2, panel B). In homology model 1 for CIS, Y253 forms a hydrogen bond with the buried C-terminal carboxyl group (panel C). The C-terminal residue L257 in CIS interacts with residues in the βG strand (P212) and the αB helix (V160, V164) of the CIS SH2 domain. In this model, mutating Y253 might lead to structure changes in the adjacent EF and BG loops. As these loops interact with the phosphopeptide substrate in the CIS homology model, this can affect substrate binding. In a model for CIS based on the SOCS4 structure (homology model 2), Y253 forms a hydrogen bond with D108 (panel D). R107 in CIS is the βB5 arginine, a residue that is critical in SH2 domain phosphopeptide binding (74). A CIS R107K mutant is dominant-negative for CIS, but still associates with IL-2R (75), reminiscent of the binding of our CIS mutants to MyD88. If the second model is correct, disruption of the hydrogen bond to D108 might affect the position of R107 and thus the affinity for phosphopeptide substrates.

- 185 - Table 1.

Name of the construct Template Cloning Cloning Primers vector sites MAPPIT bait constructs pCEL-Elongin C pMG2-mElongin C pCEL BamHI-NotI 5’CGCGGATCCGATGGAGAGGAGAAGACC 5’CGCTGCGGCCGCTTAACAATCTAGGAAG pCEL-CIS pMG2-mCIS pCEL SacI-NotI 5’GCGCGAGCTCAATGGTCCTCTGCGTACAGGG 5’GCTCGCGGCCGCTCAGAGTTGGAAGGGGTACTGTCGG pCEL-CISΔB/C pCEL-mCIS mutagenesis 5’GAGCAGTGCCCGCAGCCAACAACATCTGCAACGACTAGTCATCAACCGTC 5’GACGGTTGATGACTAGTCGTTGCAGATGTTGTTGGCTGCGGGCACTGCTC pCEL-CISΔCul pCEL-mCIS mutagenesis 5’CGACGTGGACTGC GCCGCGGCAGCA CGGCGTATGGCCG 5’CGGCCATACGCCGTGCTGCCGCGGCGCAGTCCACGTCG MAPPIT prey constructs pMG-RNF41 CDNA of HEK293-T (human) pMG2 EcoRI-SalI 5’GGCATGGAGGCTGCGACTG 5’GTTACTTAAGCTAGCTTGC pMG2-CISΔB/C pMG2-mCIS mutagenesis 5’GAGCAGTGCCCGCAGCCAACAACATCTGCAACGACTAGTCATCAACCGTC 5’GACGGTTGATGACTAGTCGTTGCAGATGTTGTTGGCTGCGGGCACTGCTC pMG2-CISΔCul pMET7-FLAG-mCISΔCul pMG2 PvuII-SacI pMG2-Elongin B cDNA of N38 (mouse) pMG2 EcoRI-NotI 5’GCGAGAATTCGACGTGTTTCTCATGATCC 5’CGCTGCGGCCGCTCACTGCACAGCTTGTTC pMG2-Elongin C cDNA of N38 (mouse) pMG2 EcoRI-NotI 5’GCGAGAATTCGATGGAGAGGAGAAG 5’CGCTGCGGCCGCTTAACAATCTAGGAAG pMG2-Cullin5 pMET7-FLAG-mCullin5 pMG2 EcoRI-KpnI pMG2-SOCS6ΔB/C pMG2-mSOCS6 mutagenesis 5’TGCAGGTGCGCTCGCAACAGTACCTGCAACGCTTTGTTATCCGT 5’ACGGATAACAAAGCGTTGCAGGTACTGTTGCGAGCGCACCTGCA pMG2-SOCS7ΔB/C pMG2-mSOCS7 mutagenesis 5’CAGCAATGTCAAGTCCCAACAGCATCTTCAACGTTTCCGGATCCGGCAG 5’CTGCCGGATCCGGAAACGTTGAAGATGCTGTTGGGACTTGACATTGCTG Non-MAPPIT constructs pMET7-FLAG-CISΔB/C pMG2-mCISΔB/C pMET7- EcoRI-XbaI FLAG pMET7-FLAG-CISΔCul pMET7-FLAG-mCIS mutagenesis 5’CGACGTGGACTGC GCCGCGGCAGCA CGGCGTATGGCCG 5’CGGCCATACGCCGTGCTGCCGCGGCGCAGTCCACGTCG pMET7-E-SOCS1ΔB/C pMET7-E-mSOCS1ΔB/C mutagenesis 5’GCCGCGTGCGGCCGCAGCAGGAGCTGCAACGCCAGCGCATCGTG 5’CACGATGCGCTGGCGTTGCAGCTCCTGCTGCGGCCGCACGCGGC pMET7-FLAG-SOCS3ΔB/C pMET7-FLAG-ratSOCS3 mutagenesis 5’CAACGTGGCTACCCAGCAGCATCTTCAGCGGAAGACTGTCAACGGCCACCTGGACT CC 5’GGAGTCCAGGTGGCCGTTGACAGTCTTCCGCTGAAGATGCTGCTGGGTAGCCACGTT G pMET7-FLAG-Cullin5 cDNA of 3T3-F442A (mouse) pMET7 EcoRI-XhoI 5’CCGGAATTCACCATGGATTACAAGGATGACGACGATAAGGCGACGTCTAATCTGTT AAAG 5’CCGCTCGAGCTAGGCCATGTAGATGAAGG pMET7-FLAG-Elongin B pMG2-mElongin B pMET7- EcoRI-XbaI FLAG pMET7-FLAG-Elongin C pMG2-mElongin C pMET7- SacI-EcoRI FLAG pMET7-E-APOBEC3G pMG2-APOBEC3G pMET7-E NotI-XbaI 5’CGTACGCGGCCGCGATGAAGCCTCACTTCAG 5’GGTCATCTAGATCAGTTTTCCTGATTCTG

- 186 - Figure 1 Pre-SH2 domain SH2 domain SOCS box A CIS

B/C box Cullin box SOCS1 R R V R P L Q E L C R Q R I V A A V G R E - N L A R I P L N P V L R D Y L S S F P F Q I - 212 SOCS2 T S A P T L Q H F C R L A I N K C T G T - - - I W G L P L P T R L K D Y L E E Y K F Q V - 198 SOCS3 S N V A T L Q H L C R K T V N G H L D S Y E K V T Q L P G P - - I R E F L D Q Y D A P L - 225 CIS S S A R S L Q H L C R L V I N R L V A D - - - V D C L P L P R R M A D Y L R Q Y P F Q L - 257

Q Q A AAA F B

35

30

25

n 20

15 fold inductio

10

5

0 / CIS CISΔB/C CISΔCul CISY253F / SOCS2 SOCS2ΔB/C

anti-FLAG

C 25

20

15

10 fold induction

5

0 / CIS CISΔB/C

- 187 - Figure 2

A EpoR E Ligand binding domain LR L Ligand binding domain

extracellular extracellular intrac ellula r intrac ellula r JAK JAK JAK Box1 Box1 Box1 Box1 JAK Box2 Box2 Box2 Box2

Y - p Y - p Y Y - -p Y-p p F985 F985 Y - P-Y985 985Y-P Y p -p Y p- Y -p S TAT Y -p gp130 gp130 F1077 LR(F3) F1077 P-Y1077 LR(YYF) 1077Y-P Y P rey p- Y F1138 F1138 p- F1138 F1138 -Y p-Y p Y p- EpoR Y402 Bait Bait P rey GHR Y595 MyD88

Y-p activated Y-p activated p-Y STAT complex p-Y STAT complex

rPAP1 promoter rPAP1 promoter induction induction B 60 anti-FLAG

50

40

30 fold induction 20

10

0 B/C B/C B/C Δ Δ Δ B/C prey B/C prey B/C prey B/C prey B/C prey B/C prey CIS prey CIS CIS prey CIS CIS prey CIS Δ Δ Δ RNF41 prey RNF41 RNF41 prey RNF41 RNF41 prey RNF41 SOCS2 prey SOCS2 SOCS2 prey SOCS2 SOCS2 prey SOCS2 SOCS2 SOCS2 SOCS2 CIS CIS CIS CISY253F prey CISY253F CISY253F prey CISY253F CISY253F prey CISY253F + LR (YYF) + EpoR Y402 bait + GHR Y595 bait

C Y402 pY402 lysate

CIS

CISΔB/C

CIS Y253F

SOCS2

SOCS2ΔB/C

- 188 - D

70

60

50

40

30 fold induction induction fold

20

10

0 B/C B/C Δ Δ prey prey prey prey CIS prey CIS prey CIS CIS CISY253F CISY253F + GHR Y595 bait + MyD88 bait

E

109 116 70

60

50

40

30 fold induction . 20

10

0 Cul B/C prey prey prey Δ SVT SVT SVT SVT SVT SVT Δ prey prey prey prey Cullin5 Cullin5 Cullin5 B prey prey Elongin Elongin Elongin Elongin CIS B/C prey B/C prey B/C prey CI S SVT prey CIS prey Elongin C bait CIS bait CISΔB/C bait CISΔCul bait

E-tag : CIS CISΔB/C CISΔCul FLAG-tag : CIS CISΔB/C FLAG-tag : Cul5 Cul5 Cul5 IP : anti-FLAG IP : anti-E IB : anti-Elongin C IB : anti-FLAG total lysate : total lysate : anti-FLAG anti-FLAG

anti-E

- 189 - Figure 3

CIS CISΔB/C CIS + Elongin B/C CHX (hrs) : 0 1 3 6 0 1 3 6 0 1 3 6

β-actin

CIS

120 CIS CISΔB/C 100 CIS + Elongin B/C

80

60 % CIS remaining remaining % CIS 40

20

0 01234567 time (hours)

- 190 - Figure 4

A 250

200

150

100 fold induction

50

0 B/C B/C Δ Δ prey prey B/C prey B/C CIS prey CIS SVT prey Δ RNF41 prey RNF41 SOCS7 SOCS6 SOCS7 prey SOCS7 SOCS6 prey SOCS6 CIS + LR (YYF)

B E-tag : MyD88 SOCS1 SOCS1ΔB/C IP : anti-E IB : anti-JAK2 total lysate : anti-JAK2

anti-E

C 20 18

16

14

n 12

10

fold inductio fold 8

6

4

2

0 / SOCS3 SOCS3ΔB/C CIS CISΔB/C

D Y985 pY985 lysate SOCS3

SOCS3ΔB/C

- 191 - Figure 5 A E-tag : SOCS2 CIS APOBEC3G IP : anti-E IB : anti-Elongin C

total lysate : anti-E

B 25 prey 20 CIS SOCS2

15

10 fold induction induction fold

5

0 / / / + 0,3µg CIS + 1µg CIS / +0,3µg +1µg SOCS2 SOCS2

SVT prey RNF41 prey SOCS2 prey CIS prey

ElonginC bait

- 192 - Figure 6

A 60 prey 50 + / + Elongin B/C 40

30 fold induction induction fold

20

10

0 B/C Δ prey CIS prey B/C prey Δ RNF41 prey SOCS2 SOCS2 prey CIS + GHR Y595 bait

B

fractions 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. anti-CIS anti-Elongin C

thyroglobulin ɣ-globulin ovalbumin myoglobulin (670kDa) (158kDa) (44kDa) (17kDa)

- 193 - Figure 7

- 194 - CHAPTER 11: Versatility of the SOCS box domain

I. Review: The many faces of the SOCS box

The many faces of the SOCS box (Review)

Julie Piessevaux, Delphine Lavens, Lennart Zabeau, Frank Peelman and Jan Tavernier1

Department of Medical Protein Research, VIB, Department of Biochemistry, Faculty of Medicine and Health Sciences, Ghent University, A. Baertsoenkaai 3, 9000 Ghent, Belgium.

1Corresponding author: A. Baertsoenkaai 3, B-9000 Ghent, Belgium Tel: +32-9-2649302; fax: +32-9-2649492; E-mail: [email protected]

Short title: Versatility of the SOCS box

Key words: regulation, signal transduction, SOCS, SOCS box

Chapter 11: Versatility of the SOCS box domain

- 195 - ABSTRACT

The SOCS box is a structural domain found at the C-terminus of over 200 human proteins. It is usually coupled to a protein interaction domain such as an SH2 domain in case of the SOCS proteins. Most insights into the role of the SOCS box come from studies on these important regulators of cytokine signalling. A well established, general function of the SOCS box is the recruitment of Elongin B/C and Cullin proteins leading to the formation of an E3 ligase complex. SOCS proteins thus can negatively regulate signalling by marking tyrosine-phosphorylated cytokine receptors for proteasomal degradation. A similar mechanism was more recently uncovered for controlling SOCS activity itself, since SOCS2 was found to enhance the turnover of other SOCS proteins, thus restoring cytokine responses. The SOCS box can add unique features to individual SOCS proteins: it can function as an adaptor domain coupling activated receptors to downstream signalling pathways as was demonstrated for SOCS3, or as modulator of substrate binding by the SH2 domain in case of CIS. In this review we discuss these multiple roles of the SOCS box, which emerges as a versatile module controlling SOCS protein activity and cytokine signalling via multiple mechanisms.

INTRODUCTION

Cytokines are secreted proteins that regulate a broad range of biological processes as diverse as haematopoiesis, immune responses, cell development and growth. Binding of cytokines to cell surface receptors on target cells leads to multiple signalling events, including activation of the Janus kinase (JAK)/signal transducer and activator of transcription (STAT) pathway (figure 1) (reviewed in (Ihle et al., 1994; Leonard and O'Shea, 1998; Rawlings et al., 2004b)). Cytokine- induced signal transduction must be tightly regulated to avoid the detrimental consequences of excessive stimulation. Accordingly, several mechanisms exist to control the kinetics and magnitude of signalling at different levels. Three major classes of negative regulators are the protein tyrosine phosphatases (PTPs), protein inhibitors of activated STATs (PIAS) and suppressors of cytokine signalling (SOCS) proteins (reviewed in (Greenhalgh and Hilton, 2001)). Chapter 11: Versatility of the SOCS box domain

- 196 -

Figure 1: JAK-STAT signal transduction and SOCS inhibition. Cytokine binding to its receptor complex induces reorganisation of the receptor chains, which leads to juxtaposition and activation of the JAKs by cross-phosphorylation. JAKs phosphorylate the cytoplasmatic domains of receptors, creating docking sites for cytoplasmatic proteins such as STATs. Following phosphorylation by the action of the JAKs, STATs form dimers and migrate to the nucleus to induce target genes, including those that express the SOCS. Acting in a negative feedback loop, SOCS will then attenuate receptor signalling by different mechanisms (see text).

Chapter 11: Versatility of the SOCS box domain

- 197 - The SOCS family consists of eights proteins, SOCS1-7 and CIS, of which the expression is induced in response to a wide range of cytokines, growth factors and hormones (Adams et al., 1998; Dogusan et al., 2000; Krebs and Hilton, 2003; Yasukawa et al., 2000). They were identified as inhibitors of the JAK-STAT signalling pathway, operating as part of a classical negative feedback loop (Fujimoto and Naka, 2003; Greenhalgh and Hilton, 2001; Krebs and Hilton, 2001). SOCS proteins display a similar domain architecture with an N-terminal region of variable length, a central Src homology 2 (SH2) domain which is involved in binding of phosphotyrosine motifs and a conserved C-terminal domain, known as the SOCS box (figure 2).

Figure 2: Domain structure of the SOCS protein family The major structural characteristics of the SOCS family are the presence of two domains with relatively well conserved AA sequence: a SH2 domain in the middle portion and a SOCS box at the C-terminus. Only SOCS1 and -3 possess a KIR immediately upstream of the SH2 domain. Conserved tyrosines in the SOCS box are indicated by a black line

SOCS proteins modulate cytokine receptor responses by different mechanisms (figure 1). First, they can suppress signalling by competing with other signal transductors for binding to phosphorylated motifs of the activated receptor via their SH2 domain (Ram and Waxman, 1999; Yoshimura et al., 1995). Second, a small kinase inhibitory region (KIR) found in the N-terminal domain of SOCS1 and SOCS3 inhibits the activity of JAKs by acting as a pseudo-substrate (Yasukawa et al., 1999). SOCS1 binds directly to the phosphorylated activation loop of JAK2, Chapter 11: Versatility of the SOCS box domain

- 198 - whereas SOCS3 shows only weak affinity for JAK2 and is thought to bind to the receptor in close proximity of the kinase (Giordanetto and Kroemer, 2003; Nicholson et al., 2000; Sasaki et al., 2000). Third, SOCS proteins can regulate signal transduction by linking their substrates to ubiquitination and proteasomal degradation via the SOCS box. This latter domain was found to recruit Elongin B and C (B/C) proteins (Kamura et al., 1998; Zhang et al., 1999) which can associate to a Cullin-Rbx module reconstituting an E3 ubiquitin ligase complex (Kamura et al., 2001). The involvement of the SOCS box in proteasomal degradation will be discussed in more detail in the next section. In addition to proteasomal turnover, SOCS proteins can also direct the internalisation and routing of cytokine receptors as was for example demonstrated for the growth hormone (GH) and granulocyte- colony stimulating factor (G-CSF) receptors (Irandoust et al., 2007; Landsman and Waxman, 2005). SOCS proteins not only control kinetics and magnitude of signalling but can also be involved in the shaping of cytokine responses. For example, SOCS3 that is induced by different cytokine receptors regulates both the quantity and type of STAT signalling generated from the IL-6R. In the absence of SOCS3, IL-6 induces a wider transcriptional response that is dominated by interferon (IFN)-like gene expression owing to an excess of STAT1 phosphorylation (Croker et al., 2003; Lang et al., 2003; Yasukawa et al., 2003). SOCS proteins thus regulate cytokine receptor signalling at different levels and by multiple complementary mechanisms, the importance of which differs according to both the individual SOCS molecule and the triggered cytokine pathway.

THE ROLE OF THE SOCS BOX IN TARGET PROTEIN DEGRADATION

Protein degradation by the ubiquitin-proteasome pathway requires a cascade of enzymatic reactions involving an E1 ubiquitin-activating enzyme, an E2 ubiquitin- conjugating enzyme, and finally an E3 ligating enzyme. This latter enzyme defines substrate specificity and covalently associates ubiquitin to lysine side chains in the substrate. The Elongin C-Cullin-SOCS box (ECS)-type E3 ubiquitin ligases include among others the Von Hippel-Lindau (VHL) tumor suppressor protein and the SOCS family members, that fulfill the role of substrate recognition unit of the complex (Ivan and Kaelin, 2001; Kibel et al., 1995; Kile et al., 2002). The SOCS box domain of Chapter 11: Versatility of the SOCS box domain

- 199 - these proteins mediates the interaction with Elongin C by the B/C box, a xxLxxxCxxx (A/I/L/V) conserved sequence (Aso et al., 1996; Duan et al., 1995; Kamura et al., 1998; Kibel et al., 1995). Elongin B binds Elongin C and this dimer acts as a linker that bridges the substrate recognized by the SOCS box protein to a Cullin scaffold protein. This association with a Cullin protein is further supported by a conserved Cullin box motif, located downstream of the B/C box in the SOCS box (Kamura et al., 2004). Cullin in turns recruits a RING finger-containing protein Rbx, thereby completing the assembly of the E3 ligase complex (figure 3A) (Iwai et al., 1999; Pause et al., 1997).

Figure 3: Involvement of the SOCS box in protein degradation (A.) Mechanism by which SOCS can target associated proteins for proteasome-mediated destruction. (B.) Proposed mechanism whereby SOCS themselves can be targeted for degradation by E3 recruitment or other SOCS proteins.

SOCS can act as the substrate recognition component of an ECS-type E3 ubiquitin ligase to regulate the half-life of proteins. First of all, signal transduction of several cytokines is prolonged in the presence of proteasome inhibitors (Callus and Mathey-Prevot, 1998; Verdier et al., 1998). More specifically, it was demonstrated that SOCS1 promotes the ubiquitination and turnover of JAK2 and the TEL-JAK2 oncogene in a SOCS box dependent fashion (Frantsve et al., 2001; Kamizono et al.,

Chapter 11: Versatility of the SOCS box domain

- 200 - 2001; Ungureanu et al., 2002) while SOCS3 can target receptors for proteasomal degradation as it accelerates destruction of CD33 and sialic acid-binding immunoglobulin-like lectin (Siglec) 7, members of the Siglec family of receptors (Orr et al., 2007a; Orr et al., 2007b). This proteolytic activity is not restricted to the receptor complex or associated JAKs but also targets substrates as diverse as the signal transducer VAV, the p65/RelA subunit of NF-κB, the Toll-like receptor (TLR) adaptor Mal and the E7 protein of Human papilloma viruses (HPV) in case of SOCS1 (De Sepulveda et al., 2000; Kamio et al., 2004; Mansell et al., 2006; Ryo et al., 2003). Furthermore, SOCS1 and SOCS3 can both promote destruction of Insulin Receptor Substrate (IRS) 1 or IRS2 and focal adhesion kinase (FAK) (Liu et al., 2003; Rui et al., 2002). Compellingly, an essential role for the SOCS box of these SOCS members was demonstrated in vivo. Transgenic mice expressing a SOCS box deletion variant of SOCS1 or SOCS3 exhibit impaired regulation of respectively INFγ (Zhang et al., 2001) and Granulocyte-colony stimulating factor (G- CSF) signalling and response to inflammatory stimuli (Boyle et al., 2007).

In contrast to SOCS1 and SOCS3, CIS and SOCS2 cannot directly inhibit JAK activity thus implicating a stronger dependency on substrate competition or proteasomal degradation of target proteins. CIS association was demonstrated to induce proteasome-dependent degradation of the erythropoietine receptor (EpoR) and growth hormone receptor (GHR) (Landsman and Waxman, 2005; Ram and Waxman, 2000; Verdier et al., 1998). The SOCS box of SOCS2 appeared to be crucial for the negative regulation of GH signalling (Greenhalgh et al., 2005). The crystal structure of the SOCS2-Elongin B/C complex revealed a SOCS box ubiquitin ligase architecture similar to the one of VHL (Bullock et al., 2006), further supporting a role for SOCS2 in E3 ligase activity. The SOCS box shows an extensive interaction with Elongin C, centered around the B/C box motif. The SOCS box also directly interacts with Elongin B (figure 4A and 4B).

The remaining SOCS members SOCS4-SOCS7 have been less extensively examined. SOCS4 and SOCS5 are induced upon epidermal growth factor (EGF) stimulation and subsequent SOCS box dependent turnover of EGFR was reported, thereby inhibiting the mitogenic signalling (Kario et al., 2005; Nicholson et al., 2005). Also, the structural resolution of the SOCS4-Elongin B/C complex revealed a Chapter 11: Versatility of the SOCS box domain

- 201 - molecular basis for SOCS-mediated EGFR degradation (Bullock et al., 2007). SOCS6 was found to interact with haem-oxidized IRP2 ubiquitin ligase 1 (HOIL1), thereby driving ubiquitination and degradation of associated proteins (Bayle et al., 2006). This observation illustrates that SOCS proteins may interact with different E3 ubiquitin ligases in addition to a common ECS-based complex. Even though more direct evidence for SOCS ubiquitin ligase activity remains to be demonstrated for the latter SOCS members, together these data point to the key role of the SOCS box in mediating protein turnover as a general SOCS mechanism of action. While many receptor complexes recruit SOCS, only a few of these receptors or their associated JAK/STAT proteins are known targets for SOCS mediated degradation. This may indicate a broader role for SOCS proteins in the regulation of downstream substrates. Accordingly, proteasomal targeting of substrates as diverse as other SOCS proteins, TLR adaptors and viral proteins have been reported (Kamio et al., 2004; Mansell et al., 2006; Piessevaux et al., 2006; Tannahill et al., 2005).

The crystal structures of SOCS2 and SOCS4 with Elongins B and C show a remarkable difference. While the interactions of the Elongins with the SOCS box are very similar, the SOCS box itself assumes a different orientation versus the SH2 domain (figure 4A and 4B). Based on the structural information of SOCS2, it was proposed that in SOCS1-3 and CIS the C-terminus is buried in the core of the structure where it stabilizes the interaction between the SH2 domain and the SOCS box. This packing partially exposes the N-terminal ESS providing better accessibility for the SOCS1 and SOCS3 KIR domain. This domain organization precludes C- terminal extensions and explains the strictly conserved length of the C-terminal parts in CIS and SOCS1-3 (Bullock et al., 2006). In contrast, the SOCS4-7 subclass contains extended C-termini and there the N-terminal ESS helix is buried in the SOCS box / SH2 interface to fulfill an equivalent packing role as could be demonstrated in the SOCS4 structure. The function of the C-terminus is then redefined to stabilize an interface with the N-terminal domain (Bullock et al., 2007).

Chapter 11: Versatility of the SOCS box domain

- 202 -

Elongin B Elongin B A C-terminal B

Elongin C Elongin C

SOCS2 SOCS4 N-terminal N-terminal helix C-terminal extension strand

CD

E

Figure 4: Structure of SOCS and SOCS-Elongin B/C complexes A. Structure of the SOCS2-Elongin B-Elongin C complex. B. Structure of the SOCS4- Elongin B-Elongin C complex. In A & B, the SOCS SH2 and pre-SH2 domain is colored orange, the SOCS box is colored red, Elongin B is yellow, Elongin C is green. In the SOCS4 complex, the SH2 domain differs from its orientation in the SOCS2 complex. C & D. Accessible surface plot of SOCS4, when the SOCS4 molecule is oriented as in the ribbon plot below (E)(In E, the SOCS box is colored red). In C, the surface is colored according to the atom colors. In D, the surface is colored according to residue conservation in the human SOCS proteins. Strictly conserved residues are colored red, unconserved residues are colored dark blue. The Elongin binding site (circled area) is hydrophobic and highly conserved.

Chapter 11: Versatility of the SOCS box domain

- 203 - THE SOCS BOX AND SOCS PROTEIN TURNOVER

Effect of E3 ligase environment on SOCS stability

Next to its role in the degradation of associated substrates, the SOCS box may also be involved in the regulation of the expression levels of the SOCS proteins themselves. Reports in the literature are however somewhat paradoxical indicating that the functional significance of the interaction between Elongin B/C and the SOCS box is complex. Some data suggest that the Elongin B/C complex constitutively links SOCS to E3 ligase activity, thereby promoting its degradation by the proteasome. Accordingly, mutations or post-translational modifications of SOCS proteins that disrupt Elongin B/C recruitment have a positive effect on protein stability as has been shown for SOCS1 (Chen et al., 2002; Kamura et al., 1998){Lirnander, 2004 #156}, SOCS3 (Sasaki et al., 2003; Zhang et al., 1999) and CIS (Ram and Waxman, 2000; Verdier et al., 1998). Overall, it appears that the proteasomal pathway plays a key role in SOCS protein down-modulation (Bayle et al., 2006; Narazaki et al., 1998; Sasaki et al., 2003; Verdier et al., 1998; Zhang et al., 1999). In addition, CIS and SOCS3 are found to be degraded concomitantly with their GHR or Siglec receptor target respectively (see above), suggesting a stimulation-dependent mechanism for SOCS turnover (Orr et al., 2007a; Orr et al., 2007b; Ram and Waxman, 2000). In contrast, the interaction between the SOCS box and Elongin B/C has also been shown to stabilize SOCS proteins (Haan et al., 2003; Hanada et al., 2001; Kamura et al., 1998; Narazaki et al., 1998; Zhang et al., 1999; Zhang et al., 2001). In the same line, the VHL protein required Elongin B/C binding for correct folding and stable expression (Feldman et al., 1999; Kamura et al., 2002; Melville et al., 2003). The interaction of the SOCS box with both Elongins is dominated by hydrophobic interactions. Removing the Elongins in the crystal structure of SOCS2 or SOCS4 exposes a large hydrophobic surface patch in both Elongin C and in the SOCS box (figure 4C). It is therefore not unlikely that the structure of the SOCS box will be unstable and undergo structural changes in the absence of Elongins. No structure of a SOCS box in the absence of Elongins has been determined: the crystal structures of SOCS2, SOCS4 and VHL were only determined upon co-crystallization with Elongin B and C (Bullock et al., 2006; Bullock et al., 2007; Stebbins et al., 1999). Together, these observations imply that Chapter 11: Versatility of the SOCS box domain

- 204 - assembly of the E3 ligase induces structural reorganization and stabilization of the different components.

While the cytokine-dependent regulation of SOCS synthesis is well documented, the mechanisms controlling SOCS turnover remain elusive with a paradoxical role for the SOCS box. Conceivably, stabilization by Elongin B/C recruitment represents a mechanism whereby SOCS proteins are themselves prevented from proteasomal degradation. This protection may allow SOCS proteins molecules to function properly in an ubiquitin ligase complex. At some point however, negative control is required for SOCS turnover which could occur via either co-degradation with the targeted protein or by the degrading action of another SOCS member.

SOCS cross-modulation

Emerging evidence points to regulatory cross-talk between SOCS family members. SOCS protein down-modulation is likely necessary to restore cellular sensitivity. Initially, it was found that SOCS2 exerts a dual effect on GH signal transduction: low SOCS2 levels moderately suppressed GH actions whereas higher levels restored and even enhanced signalling by blocking the inhibitory effects of other SOCS proteins (Favre et al., 1999; Greenhalgh et al., 2002). This dual role of SOCS2 was further supported by the observation that SOCS2-deficient mice exhibited an overgrowth phenotype (Metcalf et al., 2000), while SOCS2 transgenic mice also grew significantly larger than their wild type littermates (Greenhalgh et al., 2002). Interference of SOCS2 with other SOCS proteins has been observed in several cytokine receptor systems including prolactin receptor (PRL) (Dif et al., 2001; Pezet et al., 1999), IL-2 and IL-3 (Tannahill et al., 2005), IFN type I and leptin signalling (Lavens et al., 2006; Piessevaux et al., 2006). A stimulatory role for SOCS2 was also proposed in mesenchymal precursor cells where it could potentiate osteoblast differentiation through upregulation of JunB expression, possibly through its negative effect on other SOCS proteins (Ouyang et al., 2006). In vivo observations further support a stimulatory role of SOCS2. Proteasomal degradation of SOCS1 induced by endogenous SOCS2 was proposed as the Chapter 11: Versatility of the SOCS box domain

- 205 - molecular mechanism behind the constitutively activated phenotype associated with VHL-mediated Renal Cell Carcinoma (Wu et al., 2007). SOCS2 upregulation was found to correlate with advanced stages of chronic myeloid leukemia (CML) (Schultheis et al., 2002; Zheng et al., 2006) or acute myeloid leukemia (AML) (Faderl et al., 2003)(personal communication, Dr. I Touw), possibly by inhibiting the tumor suppressor function of other SOCS proteins.

Although the exact nature of these SOCS interactions and consequent cross- regulation is yet to be determined, the effect relied on the presence of the SOCS box of the targeted SOCS and the B/C box of SOCS2 (Piessevaux et al., 2006). Using MAPPIT we found that SOCS2 (and SOCS6 and -7) can bind with all members of the SOCS protein family and the SOCS box of the targeted SOCS appears to be implicated. This might indicate that SOCS2 can promote turnover of associated SOCS molecules by linking them to proteasomal activity (figure 3B). Mapping SOCS residue conservation on the surface of the SOCS structures shows that the Elongin binding site is the only conserved feature in the surface of SOCS proteins, indicating the importance of Elongin binding and a similar way of Elongin binding for all SOCS proteins (figure 4D). The conserved patch in the SOCS box is a possible SOCS2 binding site. SOCS2 may also compete for recruitment of the Elongin B/C proteins to other SOCS proteins, resulting in destabilization of these other SOCS proteins lacking the complex. In analogy with SOCS2, SOCS6 may also potentiate cytokine signalling by controlling SOCS protein stability (Piessevaux et al., 2006). This latter finding might explain the improvement in glucose metabolism observed in SOCS6 transgenic mice (Li et al., 2004). Furthermore, the Drosophila melanogaster SOCS protein SOCS44A, which is most similar to SOCS6, was found to enhance the activity of the EGFR/MAPK signalling cascade, providing further evidence for a positive role for SOCS6 in cytokine signalling (Rawlings et al., 2004a). In line with such a SOCS cross-regulatory mechanism is the sequential induction pattern of different SOCS molecules. In contrast to CIS, SOCS1 and SOCS3, which are typically induced in a rapid and transient manner upon receptor activation, expression of SOCS2 usually occurs later after cytokine stimulation and is more prolonged (Adams et al., 1998; Brender et al., 2001; Pezet et al., 1999; Tannahill et al., 2005). Accordingly, the cytokine induced levels of some SOCS Chapter 11: Versatility of the SOCS box domain

- 206 - members might act to restore cellular sensitivity for subsequent stimulation by suppressing the inhibitory effects of other SOCS proteins.

Other mechanisms regulating SOCS turnover

Next to the effects of Elongin B/C and the modulation by other SOCS proteins, the half-life time of SOCS molecules can be controlled by other protein- protein interactions. SOCS1 levels are negatively regulated by association with the tripartite motif (TRIM)8/Glioblastoma Expressed RING-finger Protein (GERP) which is a putative E3 ubiquitin ligase (Toniato et al., 2002), while SOCS6 is stabilized by the Ring-finger HOIL-1 protein (Bayle et al., 2006). Phosphorylation is also implicated in the control of SOCS turnover. SOCS1 expression levels are positively regulated through phosphorylation by the Pim serine/threonine kinase (Chen et al., 2002). In contrast, JAK-dependent phosphorylation of SOCS3 at two tyrosine residues in the SOCS box correlates with disrupted Elongin C interaction and accelerated SOCS3 degradation (Haan et al., 2003). It remains to be determined whether other SOCS can also be modulated by phosphorylation. Given the high degree of conservation of SOCS box tyrosine residues this mechanism may also occur for other SOCS proteins, but evidence for this is lacking so far. An unstructured PEST (proline-, glutamic acid-, serine and threonine rich) motif in the SH2 domain of SOCS3 can negatively regulate its protein stability (Babon et al., 2006). This multitude of mechanisms controlling SOCS stability suggests that the turnover of SOCS must be crucial in cytokine mediated responses.

ADAPTOR FUNCTIONS OF THE SOCS BOX

The SOCS box functions primarily as a linker that associates substrate binding domains such as the SH2 domain for SOCS proteins with the ubiquitin ligase components Elongin C and B (Hilton et al., 1998). In addition, this domain also couples SOCS actions to other downstream signalling pathways like the MAPK pathway. SOCS3 is phosphorylated on C-terminal tyrosines in response to insulin, IL-6 and many growth factors including IL-2, Epo, EGF and PDGF (Cacalano et al., Chapter 11: Versatility of the SOCS box domain

- 207 - 2001; Peraldi et al., 2001; Sommer et al., 2005). Upon stimulation by the latter growth factors phosphorylated SOCS3 can interact with the Ras inhibitor p120 RasGAP, thereby inhibiting its functions. This way, SOCS3 maintains ERK activation and ensures cell survival and proliferation through the Ras/MAPK pathway (Cacalano et al., 2001). As phosphorylated SOCS3 was still able to block STAT5 activation, SOCS3 can act as a molecular switch turning off JAK-STAT mediated signals while sustaining ERK activation through the same receptor. Tyrosine phosphorylation of the SOCS box of SOCS3 was also found to mediate association and activation of the adaptor proteins Nck and Crk-L, which are known to couple activated receptors to multiple downstream signalling pathways and the actin cytoskeleton (Sitko et al., 2004). The effects of SOCS3 phosphorylation induced by insulin and IL-6 remains unclear but it can be envisioned that also here binding sites for SH2-containing molecules are created, thereby providing a link to other signalling systems (Peraldi et al., 2001; Sommer et al., 2005). Similar to SOCS3, other SOCS members posses a conserved tyrosine residue in the SOCS box (Hilton et al., 1998) and many of these are in a potential SH2 domain-binding motif. It remains to be elucidated how these tyrosines contribute to SOCS function. In this context, CIS was reported to promote T cell receptor mediated proliferation and to prolong survival of activated T cells. The latter responses are dependent on increased MAPK activation and a direct interaction of CIS and protein kinase Cθ (Li et al., 2000). It remains to be determined if the SOCS box is implicated in these regulatory events.

THE SOCS BOX CAN PARTICIPATE IN SUBSTRATE RECOGNITION

A SOCS box can be a critical determinant for substrate recognition, as we recently demonstrated for CIS. The Elongin B/C recruitment site (B/C box), as well as a conserved C-terminal tyrosine (Y253) are required for CIS binding to EpoR, GHR and leptin receptor motifs (Lavens et al., 2007; Uyttendaele et al., 2007)(Piessevaux et al., submitted to JBC). Indirect effects on the structural integrity of CIS due to deletion of these sites can be excluded, as SOCS box independent interactions were observed with the unrelated TLR adaptor MyD88 (Lavens et al., 2007)(Piessevaux et al., submitted to JBC). This SOCS box dependency appeared Chapter 11: Versatility of the SOCS box domain

- 208 - to be unique for CIS, as none of the other examined SOCS members required Elongin B/C association or the homologous tyrosine for receptor substrate interaction. At present 70 proteins harboring a SOCS box have been described in the human genome (according to Pfam), possibly their substrate binding could also be controlled by Elongin B/C recruitment.

We could show that under physiological conditions CIS can exist in an uncoupled form, lending further support to a regulatory mechanism by which free CIS can be bound and regulated by the cellular Elongin B/C levels (Piessevaux et al., submitted to JBC). This way, the SOCS box may represent a regulatory on/off switch acting on the SH2 domain of CIS thereby controlling receptor binding. Accordingly, a CIS variant with a defective SH2 domain (CIS R107K) behaved as a dominant negative variant (Aman et al., 1999; Ram and Waxman, 2000) and we propose that this effect is due to the scavenging of Elongin B/C by the mutant resulting in loss of substrate binding by endogenous CIS. Our observation that Elongin B/C association cannot be uncoupled from CIS receptor binding further supports a major contribution for the recruitment of E3 ligase activity in CIS- mediated inhibition. This Elongin B/C-dependency also implicates that CIS activity may be suppressed by SOCS2 in a dual way. SOCS2 that is expressed at a later stage may scavenge Elongin B/C from CIS leading to loss of receptor interaction. Subsequently, SOCS2 can bind with uncomplexed CIS resulting in proteasomal targeting of CIS. Further studies are needed to establish the physiological significance of this modulatory mechanism. Given the important physiological processes in which CIS takes part such as the GHR-mediated growth or EpoR- dependent haematopoeisis, this molecular on/off switch may constitute a safety lock to ensure complete inhibition of cytokine activity since only CIS molecules that are able to recruit the E3 ligase activity will associate with the receptor.

MEDICAL IMPLICATIONS

Aberrant control of SOCS protein function, e.g. by deregulated expression levels, can contribute to several pathologies. Certain pathogens have developed strategies to induce the host SOCS system for manipulating cytokine signalling and Chapter 11: Versatility of the SOCS box domain

- 209 - evading immune counter actions (Alexander et al., 1999; Moutsopoulos et al., 2006; Stoiber et al., 2001; Zimmermann et al., 2006). Alterations in SOCS protein levels, and more specifically SOCS3, has been implicated in the pathogenesis of various inflammatory diseases including rheumatoid arthritis (RA), Crohn’s disease and inflammatory bowel diseases (IBD) (Egan et al., 2003; Isomaki et al., 2007; Lovato et al., 2003; Rakoff-Nahoum et al., 2006; Suzuki et al., 2001). A prominent role for increased SOCS3 levels in leptin resistance and consequent obesity was also reported (Bjorbaek et al., 1998; Dunn et al., 2005; Howard et al., 2004; Mori et al., 2004). Furthermore, SOCS1 and SOCS3 might be players in the development of insulin resistance associated with type 2 diabetes (Emanuelli et al., 2001; Emanuelli et al., 2000; Kawazoe et al., 2001; Ueki et al., 2005; Ueki et al., 2004). Upregulated SOCS1 and SOCS3 expression also seems to be responsible for the unresponsiveness to IFN therapy in the treatment of hepatitis C virus infection or leukaemia (Bode et al., 2003; Roman-Gomez et al., 2004; Sakai et al., 2002). Compellingly, development and progression of tumors in various human cancers was correlated with both inactivation (Farabegoli et al., 2005; Galm et al., 2003; He et al., 2003; Komazaki et al., 2004; Nagai et al., 2003; Watanabe et al., 2004; Wikman et al., 2002; Yoshikawa et al., 2001) and inappropriate upregulation of certain SOCS proteins (Evans et al., 2007; Haffner et al., 2007; Komyod et al., 2007; Raccurt et al., 2003; Roman-Gomez et al., 2004). As mentioned above, increased expression of SOCS2 in malignancies like chronic myeloid leukemia (CML) (Schultheis et al., 2002; Zheng et al., 2006), could contribute to transformation by negative interference with other SOCS molecules that normally would suppress tumor development.

Manipulation of SOCS protein function might provide novel therapeutic options in the treatment of these disorders. Besides administration of SOCS proteins or mimetics and the specific downregulation of SOCS expression by siRNA or antisense approaches, the emerging knowledge about SOCS regulation may provide a structural basis for SOCS inhibitor design. The SOCS protein structure reveals specific domains that can be targeted to alter their function and expression: these include the SH2 domain to modulate association with other signalling molecules and the SOCS box to control SOCS stability and actions. Definitely, further insights in the molecular mechanisms behind SOCS regulation will be Chapter 11: Versatility of the SOCS box domain

- 210 - important to completely understand their control of signalling pathways and their relationship with pathologies.

CONCLUDING REMARKS

Through their regulation of diverse signal transduction pathways, SOCS proteins are involved in a variety of crucial processes including immune functions, haematopoeiesis, growth and metabolism. Accordingly, regulation of SOCS functions it self is subjected to tight control. Here a complex role for the SOCS box emerges (figure 5).

Figure 5: Versatility of SOCS functions The different domains of the SOCS box mediate distinct interactions and functions. Some of them are specific for some SOCS members (e.g. KIR-dependent inhibition of JAK activity by SOCS1 and SOCS3) while others appear to be general (competition for receptor motifs). The SOCS box is involved in functions as diverse as target degradation, control of SOCS stability and receptor interaction.

First, the domain is involved in the destruction of targets by linking them to the proteasomal machinery. Second, it may also protect SOCS from this proteasome mediated turnover. Third, the SOCS box is involved in a cross-

Chapter 11: Versatility of the SOCS box domain

- 211 - regulatory mechanism in which a restricted set of SOCS proteins can interfere with the inhibitory actions of other members of the family. As the latter mechanism will exert a negative effect on SOCS half-life time, this also may provide an explanation for the apparent duality of the SOCS box on SOCS stability. Together, these data suggest that the association between the SOCS box and the Elongin B/C complex could function, at least in part, to fine-tune the concentration and actions of SOCS proteins in cells. Finally, the SOCS box can also be involved in a unique regulatory mechanism controlling SH2 domain functions as was demonstrated for CIS.

Since SOCS proteins are involved in several important human pathologies, a full understanding of the mechanisms controlling their activity is of great importance. This should not be underestimated given the remarkably different contribution of the SOCS box in the activity pattern of individual SOCS proteins. Full insight into their finely tuned activity will require detailed analysis of the mechanisms controlling their expression levels and interaction patterns.

Chapter 11: Versatility of the SOCS box domain

- 212 - II. References

Adams, T. E., Hansen, J. A., Starr, R., Nicola, N. A., Hilton, D. J., and Billestrup, N. (1998). Growth hormone preferentially induces the rapid, transient expression of SOCS-3, a novel inhibitor of cytokine receptor signaling. J Biol Chem 273, 1285-1287. Alexander, W. S., Starr, R., Fenner, J. E., Scott, C. L., Handman, E., Sprigg, N. S., Corbin, J. E., Cornish, A. L., Darwiche, R., Owczarek, C. M., et al. (1999). SOCS1 is a critical inhibitor of interferon gamma signaling and prevents the potentially fatal neonatal actions of this cytokine. Cell 98, 597-608. Aman, M. J., Migone, T. S., Sasaki, A., Ascherman, D. P., Zhu, M., Soldaini, E., Imada, K., Miyajima, A., Yoshimura, A., and Leonard, W. J. (1999). CIS associates with the interleukin-2 receptor beta chain and inhibits interleukin-2-dependent signaling. J Biol Chem 274, 30266-30272. Aso, T., Haque, D., Barstead, R. J., Conaway, R. C., and Conaway, J. W. (1996). The inducible elongin A elongation activation domain: structure, function and interaction with the elongin BC complex. Embo J 15, 5557-5566. Babon, J. J., McManus, E. J., Yao, S., DeSouza, D. P., Mielke, L. A., Sprigg, N. S., Willson, T. A., Hilton, D. J., Nicola, N. A., Baca, M., et al. (2006). The structure of SOCS3 reveals the basis of the extended SH2 domain function and identifies an unstructured insertion that regulates stability. Mol Cell 22, 205-216. Bayle, J., Lopez, S., Iwai, K., Dubreuil, P., and De Sepulveda, P. (2006). The E3 ubiquitin ligase HOIL-1 induces the polyubiquitination and degradation of SOCS6 associated proteins. FEBS Lett 580, 2609-2614. Bjorbaek, C., Elmquist, J. K., Frantz, J. D., Shoelson, S. E., and Flier, J. S. (1998). Identification of SOCS-3 as a potential mediator of central leptin resistance. Mol Cell 1, 619-625. Bode, J. G., Ludwig, S., Ehrhardt, C., Albrecht, U., Erhardt, A., Schaper, F., Heinrich, P. C., and Haussinger, D. (2003). IFN-alpha antagonistic activity of HCV core protein involves induction of suppressor of cytokine signaling-3. Faseb J 17, 488-490. Boyle, K., Egan, P., Rakar, S., Willson, T. A., Wicks, I. P., Metcalf, D., Hilton, D. J., Nicola, N. A., Alexander, W. S., Roberts, A. W., and Robb, L. (2007). The SOCS box of suppressor of cytokine signaling-3 contributes to the control of G-CSF responsiveness in vivo. Blood. Brender, C., Nielsen, M., Ropke, C., Nissen, M. H., Svejgaard, A., Billestrup, N., Geisler, C., and Odum, N. (2001). Interferon-alpha induces transient suppressors of cytokine signalling expression in human T cells. Exp Clin Immunogenet 18, 80-85. Bullock, A. N., Debreczeni, J. E., Edwards, A. M., Sundstrom, M., and Knapp, S. (2006). Crystal structure of the SOCS2-elongin C-elongin B complex defines a prototypical SOCS box ubiquitin ligase. Proc Natl Acad Sci U S A 103, 7637-7642. Bullock, A. N., Rodriguez, M. C., Debreczeni, J. E., Songyang, Z., and Knapp, S. (2007). Structure of the SOCS4-ElonginB/C Complex Reveals a Distinct SOCS Box Interface and the Molecular Basis for SOCS-Dependent EGFR Degradation. Structure 15, 1493-1504. Cacalano, N. A., Sanden, D., and Johnston, J. A. (2001). Tyrosine-phosphorylated SOCS-3 inhibits STAT activation but binds to p120 RasGAP and activates Ras. Nat Cell Biol 3, 460-465. Callus, B. A., and Mathey-Prevot, B. (1998). Interleukin-3-induced activation of the JAK/STAT pathway is prolonged by proteasome inhibitors. Blood 91, 3182-3192. Chen, X. P., Losman, J. A., Cowan, S., Donahue, E., Fay, S., Vuong, B. Q., Nawijn, M. C., Capece, D., Cohan, V. L., and Rothman, P. (2002). Pim serine/threonine kinases regulate the stability of Socs-1 protein. Proc Natl Acad Sci U S A 99, 2175-2180. Croker, B. A., Krebs, D. L., Zhang, J. G., Wormald, S., Willson, T. A., Stanley, E. G., Robb, L., Greenhalgh, C. J., Forster, I., Clausen, B. E., et al. (2003). SOCS3 negatively regulates IL-6 signaling in vivo. Nat Immunol 4, 540-545. De Sepulveda, P., Ilangumaran, S., and Rottapel, R. (2000). Suppressor of cytokine signaling-1 inhibits VAV function through protein degradation. J Biol Chem 275, 14005-14008. Dif, F., Saunier, E., Demeneix, B., Kelly, P. A., and Edery, M. (2001). Cytokine-inducible SH2-containing protein suppresses PRL signaling by binding the PRL receptor. Endocrinology 142, 5286-5293. Dogusan, Z., Hooghe-Peters, E. L., Berus, D., Velkeniers, B., and Hooghe, R. (2000). Expression of SOCS genes in normal and leukemic human leukocytes stimulated by prolactin, growth hormone and cytokines. J Neuroimmunol 109, 34-39. Duan, D. R., Pause, A., Burgess, W. H., Aso, T., Chen, D. Y., Garrett, K. P., Conaway, R. C., Conaway, J. W., Linehan, W. M., and Klausner, R. D. (1995). Inhibition of transcription elongation by the VHL tumor suppressor protein. Science 269, 1402-1406.

Chapter 11: Versatility of the SOCS box domain

- 213 - Dunn, S. L., Bjornholm, M., Bates, S. H., Chen, Z., Seifert, M., and Myers, M. G., Jr. (2005). Feedback inhibition of leptin receptor/Jak2 signaling via Tyr1138 of the leptin receptor and suppressor of cytokine signaling 3. Mol Endocrinol 19, 925-938. Egan, P. J., Lawlor, K. E., Alexander, W. S., and Wicks, I. P. (2003). Suppressor of cytokine signaling-1 regulates acute inflammatory arthritis and T cell activation. J Clin Invest 111, 915-924. Emanuelli, B., Peraldi, P., Filloux, C., Chavey, C., Freidinger, K., Hilton, D. J., Hotamisligil, G. S., and Van Obberghen, E. (2001). SOCS-3 inhibits insulin signaling and is up-regulated in response to tumor necrosis factor-alpha in the adipose tissue of obese mice. J Biol Chem 276, 47944-47949. Emanuelli, B., Peraldi, P., Filloux, C., Sawka-Verhelle, D., Hilton, D., and Van Obberghen, E. (2000). SOCS-3 is an insulin-induced negative regulator of insulin signaling. J Biol Chem 275, 15985- 15991. Evans, M. K., Yu, C. R., Lohani, A., Mahdi, R. M., Liu, X., Trzeciak, A. R., and Egwuagu, C. E. (2007). Expression of SOCS1 and SOCS3 genes is differentially regulated in breast cancer cells in response to proinflammatory cytokine and growth factor signals. Oncogene 26, 1941-1948. Faderl, S., Harris, D., Van, Q., Kantarjian, H. M., Talpaz, M., and Estrov, Z. (2003). Granulocyte- macrophage colony-stimulating factor (GM-CSF) induces antiapoptotic and proapoptotic signals in acute myeloid leukemia. Blood 102, 630-637. Farabegoli, F., Ceccarelli, C., Santini, D., and Taffurelli, M. (2005). Suppressor of cytokine signalling 2 (SOCS-2) expression in breast carcinoma. J Clin Pathol 58, 1046-1050. Favre, H., Benhamou, A., Finidori, J., Kelly, P. A., and Edery, M. (1999). Dual effects of suppressor of cytokine signaling (SOCS-2) on growth hormone signal transduction. FEBS Lett 453, 63-66. Feldman, D. E., Thulasiraman, V., Ferreyra, R. G., and Frydman, J. (1999). Formation of the VHL- elongin BC tumor suppressor complex is mediated by the chaperonin TRiC. Mol Cell 4, 1051-1061. Frantsve, J., Schwaller, J., Sternberg, D. W., Kutok, J., and Gilliland, D. G. (2001). Socs-1 inhibits TEL- JAK2-mediated transformation of hematopoietic cells through inhibition of JAK2 kinase activity and induction of proteasome-mediated degradation. Mol Cell Biol 21, 3547-3557. Fujimoto, M., and Naka, T. (2003). Regulation of cytokine signaling by SOCS family molecules. Trends Immunol 24, 659-666. Galm, O., Yoshikawa, H., Esteller, M., Osieka, R., and Herman, J. G. (2003). SOCS-1, a negative regulator of cytokine signaling, is frequently silenced by methylation in multiple myeloma. Blood 101, 2784-2788. Giordanetto, F., and Kroemer, R. T. (2003). A three-dimensional model of Suppressor Of Cytokine Signalling 1 (SOCS-1). Protein Eng 16, 115-124. Greenhalgh, C. J., and Hilton, D. J. (2001). Negative regulation of cytokine signaling. J Leukoc Biol 70, 348-356. Greenhalgh, C. J., Metcalf, D., Thaus, A. L., Corbin, J. E., Uren, R., Morgan, P. O., Fabri, L. J., Zhang, J. G., Martin, H. M., Willson, T. A., et al. (2002). Biological evidence that SOCS-2 can act either as an enhancer or suppressor of growth hormone signaling. J Biol Chem 277, 40181-40184. Greenhalgh, C. J., Rico-Bautista, E., Lorentzon, M., Thaus, A. L., Morgan, P. O., Willson, T. A., Zervoudakis, P., Metcalf, D., Street, I., Nicola, N. A., et al. (2005). SOCS2 negatively regulates growth hormone action in vitro and in vivo. J Clin Invest 115, 397-406. Haan, S., Ferguson, P., Sommer, U., Hiremath, M., McVicar, D. W., Heinrich, P. C., Johnston, J. A., and Cacalano, N. A. (2003). Tyrosine phosphorylation disrupts elongin interaction and accelerates SOCS3 degradation. J Biol Chem 278, 31972-31979. Haffner, M. C., Petridou, B., Peyrat, J. P., Revillion, F., Muller-Holzner, E., Daxenbichler, G., Marth, C., and Doppler, W. (2007). Favorable prognostic value of SOCS2 and IGF-I in breast cancer. BMC Cancer 7, 136. Hanada, T., Yoshida, T., Kinjyo, I., Minoguchi, S., Yasukawa, H., Kato, S., Mimata, H., Nomura, Y., Seki, Y., Kubo, M., and Yoshimura, A. (2001). A mutant form of JAB/SOCS1 augments the cytokine-induced JAK/STAT pathway by accelerating degradation of wild-type JAB/CIS family proteins through the SOCS-box. J Biol Chem 276, 40746-40754. He, B., You, L., Uematsu, K., Zang, K., Xu, Z., Lee, A. Y., Costello, J. F., McCormick, F., and Jablons, D. M. (2003). SOCS-3 is frequently silenced by hypermethylation and suppresses cell growth in human lung cancer. Proc Natl Acad Sci U S A 100, 14133-14138. Hilton, D. J., Richardson, R. T., Alexander, W. S., Viney, E. M., Willson, T. A., Sprigg, N. S., Starr, R., Nicholson, S. E., Metcalf, D., and Nicola, N. A. (1998). Twenty proteins containing a C-terminal SOCS box form five structural classes. Proc Natl Acad Sci U S A 95, 114-119. Howard, J. K., Cave, B. J., Oksanen, L. J., Tzameli, I., Bjorbaek, C., and Flier, J. S. (2004). Enhanced leptin sensitivity and attenuation of diet-induced obesity in mice with haploinsufficiency of Socs3. Nat Med 10, 734-738.

Chapter 11: Versatility of the SOCS box domain

- 214 - Ihle, J. N., Witthuhn, B. A., Quelle, F. W., Yamamoto, K., Thierfelder, W. E., Kreider, B., and Silvennoinen, O. (1994). Signaling by the cytokine receptor superfamily: JAKs and STATs. Trends Biochem Sci 19, 222-227. Irandoust, M. I., Aarts, L. H., Roovers, O., Gits, J., Erkeland, S. J., and Touw, I. P. (2007). Suppressor of cytokine signaling 3 controls lysosomal routing of G-CSF receptor. Embo J 26, 2822. Isomaki, P., Alanara, T., Isohanni, P., Lagerstedt, A., Korpela, M., Moilanen, T., Visakorpi, T., and Silvennoinen, O. (2007). The expression of SOCS is altered in rheumatoid arthritis. Rheumatology (Oxford) 46, 1538-1546. Ivan, M., and Kaelin, W. G., Jr. (2001). The von Hippel-Lindau tumor suppressor protein. Curr Opin Genet Dev 11, 27-34. Iwai, K., Yamanaka, K., Kamura, T., Minato, N., Conaway, R. C., Conaway, J. W., Klausner, R. D., and Pause, A. (1999). Identification of the von Hippel-lindau tumor-suppressor protein as part of an active E3 ubiquitin ligase complex. Proc Natl Acad Sci U S A 96, 12436-12441. Kamio, M., Yoshida, T., Ogata, H., Douchi, T., Nagata, Y., Inoue, M., Hasegawa, M., Yonemitsu, Y., and Yoshimura, A. (2004). SOCS1 [corrected] inhibits HPV-E7-mediated transformation by inducing degradation of E7 protein. Oncogene 23, 3107-3115. Kamizono, S., Hanada, T., Yasukawa, H., Minoguchi, S., Kato, R., Minoguchi, M., Hattori, K., Hatakeyama, S., Yada, M., Morita, S., et al. (2001). The SOCS box of SOCS-1 accelerates ubiquitin-dependent proteolysis of TEL-JAK2. J Biol Chem 276, 12530-12538. Kamura, T., Brower, C. S., Conaway, R. C., and Conaway, J. W. (2002). A molecular basis for stabilization of the von Hippel-Lindau (VHL) tumor suppressor protein by components of the VHL ubiquitin ligase. J Biol Chem 277, 30388-30393. Kamura, T., Burian, D., Yan, Q., Schmidt, S. L., Lane, W. S., Querido, E., Branton, P. E., Shilatifard, A., Conaway, R. C., and Conaway, J. W. (2001). Muf1, a novel Elongin BC-interacting leucine-rich repeat protein that can assemble with Cul5 and Rbx1 to reconstitute a ubiquitin ligase. J Biol Chem 276, 29748-29753. Kamura, T., Maenaka, K., Kotoshiba, S., Matsumoto, M., Kohda, D., Conaway, R. C., Conaway, J. W., and Nakayama, K. I. (2004). VHL-box and SOCS-box domains determine binding specificity for Cul2-Rbx1 and Cul5-Rbx2 modules of ubiquitin ligases. Genes Dev 18, 3055-3065. Kamura, T., Sato, S., Haque, D., Liu, L., Kaelin, W. G., Jr., Conaway, R. C., and Conaway, J. W. (1998). The Elongin BC complex interacts with the conserved SOCS-box motif present in members of the SOCS, ras, WD-40 repeat, and ankyrin repeat families. Genes Dev 12, 3872-3881. Kario, E., Marmor, M. D., Adamsky, K., Citri, A., Amit, I., Amariglio, N., Rechavi, G., and Yarden, Y. (2005). Suppressors of cytokine signaling 4 and 5 regulate epidermal growth factor receptor signaling. J Biol Chem 280, 7038-7048. Kawazoe, Y., Naka, T., Fujimoto, M., Kohzaki, H., Morita, Y., Narazaki, M., Okumura, K., Saitoh, H., Nakagawa, R., Uchiyama, Y., et al. (2001). Signal transducer and activator of transcription (STAT)- induced STAT inhibitor 1 (SSI-1)/suppressor of cytokine signaling 1 (SOCS1) inhibits insulin signal transduction pathway through modulating insulin receptor substrate 1 (IRS-1) phosphorylation. J Exp Med 193, 263-269. Kibel, A., Iliopoulos, O., DeCaprio, J. A., and Kaelin, W. G., Jr. (1995). Binding of the von Hippel-Lindau tumor suppressor protein to Elongin B and C. Science 269, 1444-1446. Kile, B. T., Schulman, B. A., Alexander, W. S., Nicola, N. A., Martin, H. M., and Hilton, D. J. (2002). The SOCS box: a tale of destruction and degradation. Trends Biochem Sci 27, 235-241. Komazaki, T., Nagai, H., Emi, M., Terada, Y., Yabe, A., Jin, E., Kawanami, O., Konishi, N., Moriyama, Y., Naka, T., and Kishimoto, T. (2004). Hypermethylation-associated inactivation of the SOCS-1 gene, a JAK/STAT inhibitor, in human pancreatic cancers. Jpn J Clin Oncol 34, 191-194. Komyod, W., Bohm, M., Metze, D., Heinrich, P. C., and Behrmann, I. (2007). Constitutive suppressor of cytokine signaling 3 expression confers a growth advantage to a human melanoma cell line. Mol Cancer Res 5, 271-281. Krebs, D. L., and Hilton, D. J. (2001). SOCS proteins: negative regulators of cytokine signaling. Stem Cells 19, 378-387. Krebs, D. L., and Hilton, D. J. (2003). A new role for SOCS in insulin action. Suppressor of cytokine signaling. Sci STKE 2003, PE6. Landsman, T., and Waxman, D. J. (2005). Role of the cytokine-induced SH2-containing protein CIS in growth hormone receptor internalization. J Biol Chem. Lang, R., Pauleau, A. L., Parganas, E., Takahashi, Y., Mages, J., Ihle, J. N., Rutschman, R., and Murray, P. J. (2003). SOCS3 regulates the plasticity of gp130 signaling. Nat Immunol 4, 546-550.

Chapter 11: Versatility of the SOCS box domain

- 215 - Lavens, D., Montoye, T., Piessevaux, J., Zabeau, L., Vandekerckhove, J., Gevaert, K., Becker, W., Eyckerman, S., and Tavernier, J. (2006). A complex interaction pattern of CIS and SOCS2 with the leptin receptor. J Cell Sci 119, 2214-2224. Lavens, D., Ulrichts, P., Catteeuw, D., Gevaert, K., Vandekerckhove, J., Peelman, F., Eyckerman, S., and Tavernier, J. (2007). The C-terminus of CIS defines its interaction pattern. Biochem J 401, 257- 267. Leonard, W. J., and O'Shea, J. J. (1998). Jaks and STATs: biological implications. Annu Rev Immunol 16, 293-322. Li, L., Gronning, L. M., Anderson, P. O., Li, S., Edvardsen, K., Johnston, J., Kioussis, D., Shepherd, P. R., and Wang, P. (2004). Insulin induces SOCS-6 expression and its binding to the p85 monomer of phosphoinositide 3-kinase, resulting in improvement in glucose metabolism. J Biol Chem 279, 34107-34114. Li, S., Chen, S., Xu, X., Sundstedt, A., Paulsson, K. M., Anderson, P., Karlsson, S., Sjogren, H. O., and Wang, P. (2000). Cytokine-induced Src homology 2 protein (CIS) promotes T cell receptor- mediated proliferation and prolongs survival of activated T cells. J Exp Med 191, 985-994. Liu, E., Cote, J. F., and Vuori, K. (2003). Negative regulation of FAK signaling by SOCS proteins. Embo J 22, 5036-5046. Lovato, P., Brender, C., Agnholt, J., Kelsen, J., Kaltoft, K., Svejgaard, A., Eriksen, K. W., Woetmann, A., and Odum, N. (2003). Constitutive STAT3 activation in intestinal T cells from patients with Crohn's disease. J Biol Chem 278, 16777-16781. Mansell, A., Smith, R., Doyle, S. L., Gray, P., Fenner, J. E., Crack, P. J., Nicholson, S. E., Hilton, D. J., O'Neill, L. A., and Hertzog, P. J. (2006). Suppressor of cytokine signaling 1 negatively regulates Toll-like receptor signaling by mediating Mal degradation. Nat Immunol 7, 148-155. Melville, M. W., McClellan, A. J., Meyer, A. S., Darveau, A., and Frydman, J. (2003). The Hsp70 and TRiC/CCT chaperone systems cooperate in vivo to assemble the von Hippel-Lindau tumor suppressor complex. Mol Cell Biol 23, 3141-3151. Metcalf, D., Greenhalgh, C. J., Viney, E., Willson, T. A., Starr, R., Nicola, N. A., Hilton, D. J., and Alexander, W. S. (2000). Gigantism in mice lacking suppressor of cytokine signalling-2. Nature 405, 1069-1073. Mori, H., Hanada, R., Hanada, T., Aki, D., Mashima, R., Nishinakamura, H., Torisu, T., Chien, K. R., Yasukawa, H., and Yoshimura, A. (2004). Socs3 deficiency in the brain elevates leptin sensitivity and confers resistance to diet-induced obesity. Nat Med 10, 739-743. Moutsopoulos, N. M., Vazquez, N., Greenwell-Wild, T., Ecevit, I., Horn, J., Orenstein, J., and Wahl, S. M. (2006). Regulation of the tonsil cytokine milieu favors HIV susceptibility. J Leukoc Biol 80, 1145- 1155. Nagai, H., Naka, T., Terada, Y., Komazaki, T., Yabe, A., Jin, E., Kawanami, O., Kishimoto, T., Konishi, N., Nakamura, M., et al. (2003). Hypermethylation associated with inactivation of the SOCS-1 gene, a JAK/STAT inhibitor, in human hepatoblastomas. J Hum Genet 48, 65-69. Narazaki, M., Fujimoto, M., Matsumoto, T., Morita, Y., Saito, H., Kajita, T., Yoshizaki, K., Naka, T., and Kishimoto, T. (1998). Three distinct domains of SSI-1/SOCS-1/JAB protein are required for its suppression of interleukin 6 signaling. Proc Natl Acad Sci U S A 95, 13130-13134. Nicholson, S. E., De Souza, D., Fabri, L. J., Corbin, J., Willson, T. A., Zhang, J. G., Silva, A., Asimakis, M., Farley, A., Nash, A. D., et al. (2000). Suppressor of cytokine signaling-3 preferentially binds to the SHP-2-binding site on the shared cytokine receptor subunit gp130. Proc Natl Acad Sci U S A 97, 6493-6498. Nicholson, S. E., Metcalf, D., Sprigg, N. S., Columbus, R., Walker, F., Silva, A., Cary, D., Willson, T. A., Zhang, J. G., Hilton, D. J., et al. (2005). Suppressor of cytokine signaling (SOCS)-5 is a potential negative regulator of epidermal growth factor signaling. Proc Natl Acad Sci U S A 102, 2328-2333. Orr, S. J., Morgan, N. M., Buick, R. J., Boyd, C. R., Elliott, J., Burrows, J. F., Jefferies, C. A., Crocker, P. R., and Johnston, J. A. (2007a). SOCS3 targets Siglec 7 for proteasomal degradation and blocks Siglec 7-mediated responses. J Biol Chem 282, 3418-3422. Orr, S. J., Morgan, N. M., Elliott, J., Burrows, J. F., Scott, C. J., McVicar, D. W., and Johnston, J. A. (2007b). CD33 responses are blocked by SOCS3 through accelerated proteasomal-mediated turnover. Blood 109, 1061-1068. Ouyang, X., Fujimoto, M., Nakagawa, R., Serada, S., Tanaka, T., Nomura, S., Kawase, I., Kishimoto, T., and Naka, T. (2006). SOCS-2 interferes with myotube formation and potentiates osteoblast differentiation through upregulation of JunB in C2C12 cells. J Cell Physiol 207, 428-436. Pause, A., Lee, S., Worrell, R. A., Chen, D. Y., Burgess, W. H., Linehan, W. M., and Klausner, R. D. (1997). The von Hippel-Lindau tumor-suppressor gene product forms a stable complex with human CUL-2, a member of the Cdc53 family of proteins. Proc Natl Acad Sci U S A 94, 2156-2161.

Chapter 11: Versatility of the SOCS box domain

- 216 - Peraldi, P., Filloux, C., Emanuelli, B., Hilton, D. J., and Van Obberghen, E. (2001). Insulin induces suppressor of cytokine signaling-3 tyrosine phosphorylation through janus-activated kinase. J Biol Chem 276, 24614-24620. Pezet, A., Favre, H., Kelly, P. A., and Edery, M. (1999). Inhibition and restoration of prolactin signal transduction by suppressors of cytokine signaling. J Biol Chem 274, 24497-24502. Piessevaux, J., Lavens, D., Montoye, T., Wauman, J., Catteeuw, D., Vandekerckhove, J., Belsham, D., Peelman, F., and Tavernier, J. (2006). Functional cross-modulation between SOCS proteins can stimulate cytokine signaling. J Biol Chem 281, 32953-32966. Raccurt, M., Tam, S. P., Lau, P., Mertani, H. C., Lambert, A., Garcia-Caballero, T., Li, H., Brown, R. J., McGuckin, M. A., Morel, G., and Waters, M. J. (2003). Suppressor of cytokine signalling gene expression is elevated in breast carcinoma. Br J Cancer 89, 524-532. Rakoff-Nahoum, S., Hao, L., and Medzhitov, R. (2006). Role of toll-like receptors in spontaneous commensal-dependent colitis. Immunity 25, 319-329. Ram, P. A., and Waxman, D. J. (1999). SOCS/CIS protein inhibition of growth hormone-stimulated STAT5 signaling by multiple mechanisms. J Biol Chem 274, 35553-35561. Ram, P. A., and Waxman, D. J. (2000). Role of the cytokine-inducible SH2 protein CIS in desensitization of STAT5b signaling by continuous growth hormone. J Biol Chem 275, 39487-39496. Rawlings, J. S., Rennebeck, G., Harrison, S. M., Xi, R., and Harrison, D. A. (2004a). Two Drosophila suppressors of cytokine signaling (SOCS) differentially regulate JAK and EGFR pathway activities. BMC Cell Biol 5, 38. Rawlings, J. S., Rosler, K. M., and Harrison, D. A. (2004b). The JAK/STAT signaling pathway. J Cell Sci 117, 1281-1283. Roman-Gomez, J., Jimenez-Velasco, A., Castillejo, J. A., Cervantes, F., Barrios, M., Colomer, D., Heiniger, A., and Torres, A. (2004). The suppressor of cytokine signaling-1 is constitutively expressed in chronic myeloid leukemia and correlates with poor cytogenetic response to interferon- alpha. Haematologica 89, 42-48. Rui, L., Yuan, M., Frantz, D., Shoelson, S., and White, M. F. (2002). SOCS-1 and SOCS-3 block insulin signaling by ubiquitin-mediated degradation of IRS1 and IRS2. J Biol Chem 277, 42394-42398. Ryo, A., Suizu, F., Yoshida, Y., Perrem, K., Liou, Y. C., Wulf, G., Rottapel, R., Yamaoka, S., and Lu, K. P. (2003). Regulation of NF-kappaB signaling by Pin1-dependent prolyl isomerization and ubiquitin- mediated proteolysis of p65/RelA. Mol Cell 12, 1413-1426. Sakai, I., Takeuchi, K., Yamauchi, H., Narumi, H., and Fujita, S. (2002). Constitutive expression of SOCS3 confers resistance to IFN-alpha in chronic myelogenous leukemia cells. Blood 100, 2926- 2931. Sasaki, A., Inagaki-Ohara, K., Yoshida, T., Yamanaka, A., Sasaki, M., Yasukawa, H., Koromilas, A. E., and Yoshimura, A. (2003). The N-terminal truncated isoform of SOCS3 translated from an alternative initiation AUG codon under stress conditions is stable due to the lack of a major ubiquitination site, Lys-6. J Biol Chem 278, 2432-2436. Sasaki, A., Yasukawa, H., Shouda, T., Kitamura, T., Dikic, I., and Yoshimura, A. (2000). CIS3/SOCS-3 suppresses erythropoietin (EPO) signaling by binding the EPO receptor and JAK2. J Biol Chem 275, 29338-29347. Schultheis, B., Carapeti-Marootian, M., Hochhaus, A., Weisser, A., Goldman, J. M., and Melo, J. V. (2002). Overexpression of SOCS-2 in advanced stages of chronic myeloid leukemia: possible inadequacy of a negative feedback mechanism. Blood 99, 1766-1775. Sitko, J. C., Guevara, C. I., and Cacalano, N. A. (2004). Tyrosine-phosphorylated SOCS3 interacts with the Nck and Crk-L adapter proteins and regulates Nck activation. J Biol Chem 279, 37662-37669. Sommer, U., Schmid, C., Sobota, R. M., Lehmann, U., Stevenson, N. J., Johnston, J. A., Schaper, F., Heinrich, P. C., and Haan, S. (2005). Mechanisms of SOCS3 phosphorylation upon interleukin-6 stimulation. Contributions of Src- and receptor-tyrosine kinases. J Biol Chem 280, 31478-31488. Stebbins, C. E., Kaelin, W. G., Jr., and Pavletich, N. P. (1999). Structure of the VHL-ElonginC-ElonginB complex: implications for VHL tumor suppressor function. Science 284, 455-461. Stoiber, D., Stockinger, S., Steinlein, P., Kovarik, J., and Decker, T. (2001). Listeria monocytogenes modulates macrophage cytokine responses through STAT serine phosphorylation and the induction of suppressor of cytokine signaling 3. J Immunol 166, 466-472. Suzuki, A., Hanada, T., Mitsuyama, K., Yoshida, T., Kamizono, S., Hoshino, T., Kubo, M., Yamashita, A., Okabe, M., Takeda, K., et al. (2001). CIS3/SOCS3/SSI3 plays a negative regulatory role in STAT3 activation and intestinal inflammation. J Exp Med 193, 471-481. Tannahill, G. M., Elliott, J., Barry, A. C., Hibbert, L., Cacalano, N. A., and Johnston, J. A. (2005). SOCS2 can enhance interleukin-2 (IL-2) and IL-3 signaling by accelerating SOCS3 degradation. Mol Cell Biol 25, 9115-9126.

Chapter 11: Versatility of the SOCS box domain

- 217 - Toniato, E., Chen, X. P., Losman, J., Flati, V., Donahue, L., and Rothman, P. (2002). TRIM8/GERP RING finger protein interacts with SOCS-1. J Biol Chem 277, 37315-37322. Ueki, K., Kadowaki, T., and Kahn, C. R. (2005). Role of suppressors of cytokine signaling SOCS-1 and SOCS-3 in hepatic steatosis and the metabolic syndrome. Hepatol Res 33, 185-192. Ueki, K., Kondo, T., and Kahn, C. R. (2004). Suppressor of cytokine signaling 1 (SOCS-1) and SOCS-3 cause insulin resistance through inhibition of tyrosine phosphorylation of insulin receptor substrate proteins by discrete mechanisms. Mol Cell Biol 24, 5434-5446. Ungureanu, D., Saharinen, P., Junttila, I., Hilton, D. J., and Silvennoinen, O. (2002). Regulation of Jak2 through the ubiquitin-proteasome pathway involves phosphorylation of Jak2 on Y1007 and interaction with SOCS-1. Mol Cell Biol 22, 3316-3326. Uyttendaele, I., Lemmens, I., Verhee, A., De Smet, A. S., Vandekerckhove, J., Lavens, D., Peelman, F., and Tavernier, J. (2007). MAPPIT analysis of STAT5, CIS and SOCS2 interactions with the growth hormone receptor. Mol Endocrinol 21, 2821-2831. Verdier, F., Chretien, S., Muller, O., Varlet, P., Yoshimura, A., Gisselbrecht, S., Lacombe, C., and Mayeux, P. (1998). Proteasomes regulate erythropoietin receptor and signal transducer and activator of transcription 5 (STAT5) activation. Possible involvement of the ubiquitinated Cis protein. J Biol Chem 273, 28185-28190. Watanabe, D., Ezoe, S., Fujimoto, M., Kimura, A., Saito, Y., Nagai, H., Tachibana, I., Matsumura, I., Tanaka, T., Kanegane, H., et al. (2004). Suppressor of cytokine signalling-1 gene silencing in acute myeloid leukaemia and human haematopoietic cell lines. Br J Haematol 126, 726-735. Wikman, H., Kettunen, E., Seppanen, J. K., Karjalainen, A., Hollmen, J., Anttila, S., and Knuutila, S. (2002). Identification of differentially expressed genes in pulmonary adenocarcinoma by using cDNA array. Oncogene 21, 5804-5813. Wu, K. L., Miao, H., and Khan, S. (2007). JAK Kinases Promote Invasiveness in VHL-Mediated Renal Cell Carcinoma by a Suppressor of Cytokine Signaling-Regulated, HIF-Independent Mechanism. Am J Physiol Renal Physiol. Yasukawa, H., Misawa, H., Sakamoto, H., Masuhara, M., Sasaki, A., Wakioka, T., Ohtsuka, S., Imaizumi, T., Matsuda, T., Ihle, J. N., and Yoshimura, A. (1999). The JAK-binding protein JAB inhibits Janus tyrosine kinase activity through binding in the activation loop. Embo J 18, 1309-1320. Yasukawa, H., Ohishi, M., Mori, H., Murakami, M., Chinen, T., Aki, D., Hanada, T., Takeda, K., Akira, S., Hoshijima, M., et al. (2003). IL-6 induces an anti-inflammatory response in the absence of SOCS3 in macrophages. Nat Immunol 4, 551-556. Yasukawa, H., Sasaki, A., and Yoshimura, A. (2000). Negative regulation of cytokine signaling pathways. Annu Rev Immunol 18, 143-164. Yoshikawa, H., Matsubara, K., Qian, G. S., Jackson, P., Groopman, J. D., Manning, J. E., Harris, C. C., and Herman, J. G. (2001). SOCS-1, a negative regulator of the JAK/STAT pathway, is silenced by methylation in human hepatocellular carcinoma and shows growth-suppression activity. Nat Genet 28, 29-35. Yoshimura, A., Ohkubo, T., Kiguchi, T., Jenkins, N. A., Gilbert, D. J., Copeland, N. G., Hara, T., and Miyajima, A. (1995). A novel cytokine-inducible gene CIS encodes an SH2-containing protein that binds to tyrosine-phosphorylated interleukin 3 and erythropoietin receptors. Embo J 14, 2816-2826. Zhang, J. G., Farley, A., Nicholson, S. E., Willson, T. A., Zugaro, L. M., Simpson, R. J., Moritz, R. L., Cary, D., Richardson, R., Hausmann, G., et al. (1999). The conserved SOCS box motif in suppressors of cytokine signaling binds to elongins B and C and may couple bound proteins to proteasomal degradation. Proc Natl Acad Sci U S A 96, 2071-2076. Zhang, J. G., Metcalf, D., Rakar, S., Asimakis, M., Greenhalgh, C. J., Willson, T. A., Starr, R., Nicholson, S. E., Carter, W., Alexander, W. S., et al. (2001). The SOCS box of suppressor of cytokine signaling-1 is important for inhibition of cytokine action in vivo. Proc Natl Acad Sci U S A 98, 13261- 13265. Zheng, C., Li, L., Haak, M., Brors, B., Frank, O., Giehl, M., Fabarius, A., Schatz, M., Weisser, A., Lorentz, C., et al. (2006). Gene expression profiling of CD34+ cells identifies a molecular signature of chronic myeloid leukemia blast crisis. Leukemia 20, 1028-1034. Zimmermann, S., Murray, P. J., Heeg, K., and Dalpke, A. H. (2006). Induction of suppressor of cytokine signaling-1 by Toxoplasma gondii contributes to immune evasion in macrophages by blocking IFN- gamma signaling. J Immunol 176, 1840-1847.

Chapter 11: Versatility of the SOCS box domain

- 218 - Conclusions and future prospects

Interactions between proteins are fundamental to virtually every biological process. Therefore, the characterisation of such protein-protein interactions is imperative in the understanding of cellular mechanisms and makes them new targets for drug design. Proteins can function as components of large, highly structured complexes such as ribosomes, enhanceosomes or the proteasome complex. But protein associations also contribute to the regulation of signal transduction, which are generally of a temporary nature. Full characterisation of a particular protein-protein interaction or the comprehensive large-scale determination of the proteome within a particular organism necessitates the complementary use of different methodologies. Each approach will add unique advantages and opportunities but will also have specific drawbacks. As discussed in chapter 4, a broad range of both biochemical and genetic techniques have been developed to study protein-protein interactions. Biochemical methods have the advantage that signalling complexes can be analysed in its entirety. However, the inevitable lysis step in these approaches disrupts the normal cellular context, which can lead to false positive interactions between proteins normally residing in separate cellular compartments. Also, protein interactions involved in dynamic intracellular processes including signal transduction may be too weak or transient to be detected with biochemical techniques. Genetic approaches use hybrid bait and prey molecules, of which interaction generates a measurable signal. The most commonly used, yeast-two-hybrid, is cost-effective, easy to implement and scalable. This method suffers from two major intrinsic limitations: interactions between mammalian proteins often require post-translational modifications which are hard to reproduce in yeast cells and as the bait-prey interaction need to occur in the nucleus this will exclude the analysis of membrane bound proteins. In order to work in an optimal physiological context, a variety of two- hybrid systems in mammalian cells, have been developed. MAPPIT is such a technique that relies on signal transduction via type I cytokine receptors (www.mappit.be) (Eyckerman et al., 2001). Interaction of bait and prey hybrids leads to functional complementation of a signalling-deficient receptor by STAT3

Conclusions and future prospects

- 219 - recruitment sites in the prey protein. Throughout this thesis MAPPIT was extensively used to study (cross)regulation by SOCS molecules. The technology was also expanded by application of different variants and by working in diverse cellular contexts, demonstrating the versatility of MAPPIT as an analytical tool.

Since cytokine signalling cascades are vital to many physiological processes, strict control of these pathways is equally important. SOCS proteins are an important family of regulators of these cytokine responses. Biochemical and genetic studies have provided profound insights into the modes of action and selectivity by which the different SOCS proteins regulate distinct signal transduction pathways. Anyhow, the mechanisms underlying SOCS functions need to be further elucidated. Better insight into these may help to understand the regulatory mechanisms underlying differential cellular responsiveness to cytokines. The importance of this is underscored by the contribution of inappropriately regulated SOCS levels to several pathologies.

In the first part of this thesis we focussed on the role of SOCS proteins in modulation of leptin signalling. This cytokine-like hormone is crucially involved in body weight regulation by communicating the status of body fat stores to the hypothalamus. Aberrantly high leptin levels are associated with the majority of the obesity cases, pointing to a central failure to respond correctly to the leptin signal. Accumulating evidence indicates that alterations in cellular LR signalling, with a key role for SOCS3, have a major contribution in this leptin resistance (Munzberg et al., 2005). We found that CIS and SOCS2 are new interaction partners of the LR. In general, the closely related CIS and SOCS2 proteins display a great overlap in their binding mode with cytokine receptors. By using MAPPIT and peptide affinity chromatography we observed a differential interaction pattern of CIS and SOCS2 with phosphotyrosine motifs of the LR. Whereas both CIS and SOCS2 associate with the P-Y1077 position, only CIS interacts with the more membrane proximal P- Y985. We analysed the functionality of SOCS2 in the context of LR signalling and showed that it can impede STAT5 recruitment. We further observed that SOCS2 interferes with CIS association at P-Y1077 and unexpectedly also at the P-Y985 position, although SOCS2 itself does not interact with this tyrosine. Since SOCS2

Conclusions and future prospects

- 220 - was found to associate with CIS and the interfering effect appeared to be dependent on Elongin B/C recruitment to SOCS2, proteasomal degradation of CIS is likely involved. This observed cross-regulation between SOCS proteins was analysed in more detail in the second part of this thesis (see further). We conclude that besides the well characterized inhibitory actions of SOCS3, other SOCS proteins interact with the LR and may be implicated in the modulation of its signalling. Upregulation of CIS or SOCS2 expression is not detectable in the hypothalamus upon leptin administration in mice (Bjorbaek et al., 1998), but it should be considered that SOCS proteins can mediate cross-talk between different signalling pathways. Also their expression may be relevant in peripheral cell types and accordingly, SOCS2 and CIS expression upon leptin stimulation were found in RINm5F insulinoma cells (Lavens et al., 2006). Leptin has been increasingly recognized as a regulator of peripheral functions like immune responses, reproduction, angiogenesis and haematopoiesis. Nevertheless, signalling events induced by leptin in haematopoietic progenitor cells remain far from clear. In order to gain more insight in this issue, we studied the interaction partners of the LR in a haematopoietic background. We adapted the MAPPIT strategy to this cellular context that is characterized by prevalent STAT5 signalling by exchanging the gp130 part of the preys by a portion of the cytoplasmatic tail of the βc-receptor containing STAT5 interaction sites. This so-called βc-MAPPIT was successfully used in different haematopoietic cell lines. The interaction of different signalling molecules with tyrosine motifs of the LR was tested. Known interactions could be confirmed: we found binding of STAT5 to the P-Y1077 and of SOCS3 to the P-Y985 and P-Y1077 motif (Eyckerman et al., 2000; Gong et al., 2007; Hekerman et al., 2005). Furthermore, we reported the involvement of the phospholipase C pathway in haematopoietic leptin signalling by showing the interaction of PLCγ with the P-Y1077. Since our previous interaction studies with the classical MAPPIT method demonstrated binding of CIS and SOCS2 to the LR in HEK-293T cells, we next examined all SOCS family members on LR interaction. CIS and SOCS7 were found to both interact with the P-Y985 and P-Y1077 motifs, while SOCS2 and -6 only bind to the P-Y1077 of the LR. Association of SOCS2, -6 and -7 at P-Y1077 may be indirect as it was recently reported that IRS4 functions as an adaptor of the LR at this position, recruiting different proteins including these

Conclusions and future prospects

- 221 - SOCS members (Wauman et al., 2007). The inability to distinct direct from indirect interactions is inherent to all two-hybrid methods and full proof of this requires in vitro interaction analysis of the purified recombinant binding partners. These data further support the implication of other SOCS molecules, besides SOCS3, in the modulation of leptin signalling. Also, our study provides a basis for more detailed functional analysis of leptin signalling in haematopoietic cells.

The second part of this thesis deals with the versatile functions of the SOCS box on the regulation of SOCS proteins and cytokine signalling. A growing body of evidence indicates that the functions of some SOCS proteins may not be simply inhibitory. In this respect, SOCS2 was described as a dual regulator, exerting both inhibitory and stimulatory effects on GH signalling in vitro and in vivo (Favre et al., 1999; Greenhalgh et al., 2002; Metcalf et al., 2000). We unravelled the underlying mechanism of this paradoxal effect. First we showed that SOCS2 antagonizes the inhibition of SOCS1 and SOCS3 in a SOCS box-dependent manner, thereby restoring signalling via the GHR, LR and IFN type I receptor. This interfering capacity of SOCS2 was found to depend on Elongin B/C recruitment. Accordingly, degradation of SOCS1 was promoted by SOCS2 but not by the Elongin B/C recruitment-deficient mutant, suggesting that SOCS2 targets other SOCS proteins for proteasomal degradation. Using MAPPIT we demonstrated that SOCS2 can bind to all members of the SOCS protein family. We finally provide evidence for the involvement of SOCS6 in a similar interfering mechanism. This might reflect a crucial physiological role of SOCS2 in restoring cellular responsiveness after cytokine activation. It can be presumed that SOCS2 requires a threshold concentration to act on SOCS protein degradation. In line with this, SOCS2 expression usually occurs at later time points compared with CIS, SOCS1 and -3 and is more prolonged (Adams et al., 1998; Brender et al., 2001; Pezet et al., 1999; Tannahill et al., 2005). Elevated SOCS expression is associated with several pathologies demonstrating the importance of a tight control of SOCS protein expression levels. Enhanced SOCS2 levels for example correlate with some cancers like chronic myeloid leukaemia (Schultheis et al., 2002; Zheng et al., 2006). It will be of special interest to examine whether SOCS2 interference with the tumor suppressor functions of other SOCS proteins is the underlying mechanism

Conclusions and future prospects

- 222 - contributing to oncogenesis. We uncovered in this thesis a novel level of inter-SOCS regulation that is most likely involved in restoring basal cellular responsiveness, adding a further layer of complexity to regulation of cytokine responses. Although the SOCS box of the targeted SOCS seems to be implicated in the interaction with the inhibitory SOCS, the precise nature of this inter-SOCS interaction is still unclear and needs further examination. Detailed analysis of the kinetics of relative expression levels and the binding affinities of all interacting components in a particular cellular background will be required to achieve full and global insights into the precise regulatory control. Finally, we demonstrated that besides the SH2 domain, the SOCS box can also be involved in substrate recognition by SOCS proteins. Receptor interaction and functionality of CIS were shown to require Elongin B/C recruitment to the SOCS box. This Elongin B/C dependency seems to be an exclusive property of CIS since none of the other examined SOCS members was found to need Elongin recruitment for interaction with target receptor motifs. This is reminiscent of the effects observed for the Y253F mutation in the C-terminal part of the CIS SOCS box as this mutation also completely abrogates functional interaction with most cytokine receptor interaction motifs (Lavens et al., 2007; Uyttendaele et al., 2007). Modelling studies based on the crystal structure of SOCS2 and SOCS4 in complex with Elongin B/C (Bullock et al., 2006; Bullock et al., 2007) predict that the C-terminus of CIS is buried in the interface between the SH2 domain and the SOCS box. Based on this model a direct interaction of the SOCS box or Y253 with the phosphopeptide substrate could be excluded. We propose that the correct positioning of the CIS C-terminus and more specifically of Y253 is essential for substrate binding and that it is induced by structural changes in the SOCS box upon binding of Elongins. Taken together, we report that Elongin B/C association to CIS may control substrate binding via allosteric modulation of the SOCS box. This represents a unique regulatory mechanism by which the SOCS box may form an on/off switch acting on the SH2 domain. Our observation that Elongin B/C association cannot be uncoupled from CIS functions further supports a major contribution for the recruitment of E3 ligase activity in CIS-mediated inhibition. Furthermore, this implicates that the previous observation concerning SOCS2 interference with the interaction of CIS at the Y985 of the LR, can be explained in a dual way. First, SOCS2 that binds Elongin C with higher affinity than CIS may scavenge Elongin B/C complexes from CIS leading to loss of substrate binding. Second, SOCS2 can interact with unbound CIS leading to

Conclusions and future prospects

- 223 - degradation of the free CIS pool. The list of multiprotein complexes containing Elongin B/C is growing, suggesting that dependent of the expression, localization and relative binding affinities of all these B/C box containing proteins, a competition for Elongin B/C will occur. Accordingly, the availability of free Elongin B/C complex may determine CIS activity. Perhaps, this Elongin B/C dependency of CIS may function as a ‘safety lock’ that guarantees total termination of signalling as only the CIS molecules that are able to recruit the proteasomal machinery will contribute to inhibition. The remarkable discrepancy observed between the unaltered phenotype of CIS-deficient mice and the severe defects in growth, mammary gland development and immune effects of CIS transgenic mice (Li et al., 2000; Matsumoto et al., 1999) may also be indicative of the high risk of unrestrained CIS activity.

Taken together, our findings further underscore the functional complexity of the SOCS box. The diverse effects of this domain are reviewed in chapter 11 and the SOCS box increasingly appears as an important modulator of cytokine actions. Undoubtedly, knowledge of how SOCS proteins are regulated and/or degraded, may lead to development of new strategies that utilize the properties of SOCS for therapeutic purposes. Further clarification of the nature of SOCS regulation will have to deal with major questions: Given the many receptor complexes that are known to recruit SOCS, why did we only identify few substrates of the ubiquitin E3 ligase activity of each SOCS protein in comparison? Some receptors and JAK2 are reported to be degraded by SOCS but no clear evidence exists concerning other receptor complex components like STATs. Probably, SOCS substrates go beyond the cytokine receptor complex since targets as diverse as other SOCS proteins, TLR adaptors and viral proteins have been reported (Kamio et al., 2004; Mansell et al., 2006; Piessevaux et al., 2006; Tannahill et al., 2005). Further studies are also required to define if the cross-regulatory mechanism functions beyond the SOCS family. At present 210 proteins harboring a SOCS box have been described in the mammalian genome. Possibly they could also be subjected to cross-modulation through SOCS-box dependent degradation or scavenging of Elongin B/C. Of note, the manipulation of SOCS actions might provide potent therapeutic options in the treatment of several disorders. Better understanding of the specific domains or residues that have to be targeted to alter their function and expression may provide a structural basis for SOCS inhibitor design in the development of therapies.

Conclusions and future prospects

- 224 - References

Adams, T. E., Hansen, J. A., Starr, R., Nicola, N. A., Hilton, D. J., and Billestrup, N. (1998). Growth hormone preferentially induces the rapid, transient expression of SOCS-3, a novel inhibitor of cytokine receptor signaling. J Biol Chem 273, 1285-1287. Bjorbaek, C., Elmquist, J. K., Frantz, J. D., Shoelson, S. E., and Flier, J. S. (1998). Identification of SOCS-3 as a potential mediator of central leptin resistance. Mol Cell 1, 619-625. Brender, C., Nielsen, M., Ropke, C., Nissen, M. H., Svejgaard, A., Billestrup, N., Geisler, C., and Odum, N. (2001). Interferon-alpha induces transient suppressors of cytokine signalling expression in human T cells. Exp Clin Immunogenet 18, 80-85. Bullock, A. N., Debreczeni, J. E., Edwards, A. M., Sundstrom, M., and Knapp, S. (2006). Crystal structure of the SOCS2-elongin C-elongin B complex defines a prototypical SOCS box ubiquitin ligase. Proc Natl Acad Sci U S A 103, 7637-7642. Bullock, A. N., Rodriguez, M. C., Debreczeni, J. E., Songyang, Z., and Knapp, S. (2007). Structure of the SOCS4-ElonginB/C Complex Reveals a Distinct SOCS Box Interface and the Molecular Basis for SOCS-Dependent EGFR Degradation. Structure 15, 1493-1504. Eyckerman, S., Broekaert, D., Verhee, A., Vandekerckhove, J., and Tavernier, J. (2000). Identification of the Y985 and Y1077 motifs as SOCS3 recruitment sites in the murine leptin receptor. FEBS Lett 486, 33-37. Eyckerman, S., Verhee, A., Van der Heyden, J., Lemmens, I., Van Ostade, X., Vandekerckhove, J., and Tavernier, J. (2001). Design and application of a cytokine-receptor-based interaction trap. Nat Cell Biol 3, 1114-1119. Favre, H., Benhamou, A., Finidori, J., Kelly, P. A., and Edery, M. (1999). Dual effects of suppressor of cytokine signaling (SOCS-2) on growth hormone signal transduction. FEBS Lett 453, 63-66. Gong, Y., Ishida-Takahashi, R., Villanueva, E. C., Fingar, D. C., Munzberg, H., and Myers, M. G., Jr. (2007). The long form of the leptin receptor regulates STAT5 and ribosomal protein S6 via alternate mechanisms. J Biol Chem 282, 31019-31027. Greenhalgh, C. J., Metcalf, D., Thaus, A. L., Corbin, J. E., Uren, R., Morgan, P. O., Fabri, L. J., Zhang, J. G., Martin, H. M., Willson, T. A., et al. (2002). Biological evidence that SOCS-2 can act either as an enhancer or suppressor of growth hormone signaling. J Biol Chem 277, 40181- 40184. Hekerman, P., Zeidler, J., Bamberg-Lemper, S., Knobelspies, H., Lavens, D., Tavernier, J., Joost, H. G., and Becker, W. (2005). Pleiotropy of leptin receptor signalling is defined by distinct roles of the intracellular tyrosines. Febs J 272, 109-119. Kamio, M., Yoshida, T., Ogata, H., Douchi, T., Nagata, Y., Inoue, M., Hasegawa, M., Yonemitsu, Y., and Yoshimura, A. (2004). SOCS1 [corrected] inhibits HPV-E7-mediated transformation by inducing degradation of E7 protein. Oncogene 23, 3107-3115. Lavens, D., Montoye, T., Piessevaux, J., Zabeau, L., Vandekerckhove, J., Gevaert, K., Becker, W., Eyckerman, S., and Tavernier, J. (2006). A complex interaction pattern of CIS and SOCS2 with the leptin receptor. J Cell Sci 119, 2214-2224. Lavens, D., Ulrichts, P., Catteeuw, D., Gevaert, K., Vandekerckhove, J., Peelman, F., Eyckerman, S., and Tavernier, J. (2007). The C-terminus of CIS defines its interaction pattern. Biochem J 401, 257-267. Li, S., Chen, S., Xu, X., Sundstedt, A., Paulsson, K. M., Anderson, P., Karlsson, S., Sjogren, H. O., and Wang, P. (2000). Cytokine-induced Src homology 2 protein (CIS) promotes T cell receptor- mediated proliferation and prolongs survival of activated T cells. J Exp Med 191, 985-994. Mansell, A., Smith, R., Doyle, S. L., Gray, P., Fenner, J. E., Crack, P. J., Nicholson, S. E., Hilton, D. J., O'Neill, L. A., and Hertzog, P. J. (2006). Suppressor of cytokine signaling 1 negatively regulates Toll-like receptor signaling by mediating Mal degradation. Nat Immunol 7, 148-155. Matsumoto, A., Seki, Y., Kubo, M., Ohtsuka, S., Suzuki, A., Hayashi, I., Tsuji, K., Nakahata, T., Okabe, M., Yamada, S., and Yoshimura, A. (1999). Suppression of STAT5 functions in liver, mammary glands, and T cells in cytokine-inducible SH2-containing protein 1 transgenic mice. Mol Cell Biol 19, 6396-6407. Metcalf, D., Greenhalgh, C. J., Viney, E., Willson, T. A., Starr, R., Nicola, N. A., Hilton, D. J., and Alexander, W. S. (2000). Gigantism in mice lacking suppressor of cytokine signalling-2. Nature 405, 1069-1073. Munzberg, H., Bjornholm, M., Bates, S. H., and Myers, M. G., Jr. (2005). Leptin receptor action and mechanisms of leptin resistance. Cell Mol Life Sci 62, 642-652.

Conclusions and future prospects

- 225 - Pezet, A., Favre, H., Kelly, P. A., and Edery, M. (1999). Inhibition and restoration of prolactin signal transduction by suppressors of cytokine signaling. J Biol Chem 274, 24497-24502. Piessevaux, J., Lavens, D., Montoye, T., Wauman, J., Catteeuw, D., Vandekerckhove, J., Belsham, D., Peelman, F., and Tavernier, J. (2006). Functional cross-modulation between SOCS proteins can stimulate cytokine signaling. J Biol Chem 281, 32953-32966. Schultheis, B., Carapeti-Marootian, M., Hochhaus, A., Weisser, A., Goldman, J. M., and Melo, J. V. (2002). Overexpression of SOCS-2 in advanced stages of chronic myeloid leukemia: possible inadequacy of a negative feedback mechanism. Blood 99, 1766-1775. Tannahill, G. M., Elliott, J., Barry, A. C., Hibbert, L., Cacalano, N. A., and Johnston, J. A. (2005). SOCS2 can enhance interleukin-2 (IL-2) and IL-3 signaling by accelerating SOCS3 degradation. Mol Cell Biol 25, 9115-9126. Uyttendaele, I., Lemmens, I., Verhee, A., De Smet, A. S., Vandekerckhove, J., Lavens, D., Peelman, F., and Tavernier, J. (2007). MAPPIT analysis of STAT5, CIS and SOCS2 interactions with the growth hormone receptor. Mol Endocrinol 21, 2821-2831. Wauman, J., De Smet, A. S., Catteeuw, D., Belsham, D., and Tavernier, J. (2007). Insulin Receptor Substrate 4 Couples the Leptin Receptor to Multiple Signaling Pathways. Mol Endocrinol 22, 965-977. Zheng, C., Li, L., Haak, M., Brors, B., Frank, O., Giehl, M., Fabarius, A., Schatz, M., Weisser, A., Lorentz, C., et al. (2006). Gene expression profiling of CD34+ cells identifies a molecular signature of chronic myeloid leukemia blast crisis. Leukemia 20, 1028-1034.

Conclusions and future prospects

- 226 -

Curriculum Vitae

Personalia

Name Julie Piessevaux Adress Zavelput 6 1730 Asbeek (Belgium) Mobile 0486/541572 E-mail [email protected] Date of birth 14/03/1978 (Ghent, Belgium)

Education and Working Experience

1990-1996: Studies of Latin-Mathematics at the Sint-Pietersinstituut (Ghent).

1996-2001: Studies of Biochemistry at the Ghent University. Licentiate’s thesis with the title: ‘Inducible activation and inhibition of the Wnt signal transduction pathway in embryo’s of Xenopus Laevis’ at the Faculty of Sciences, Ghent University, Department of Molecular Biology, VIB. Promotor: Prof. Dr. F. Van Roy.

2001-2005: FWO PhD scholarship at the Department of Biochemistry, Faculty of Medicine and Health Sciences, Ghent University, Department of Medical Protein Research, VIB. Promotor: Prof. Dr. Jan Tavernier.

2005-2008: Scientific assistant (IUAP project) at the Department of Biochemistry, Faculty of Medicine and Health Sciences, Ghent University, Department of Medical Protein Research, VIB. Doctoral thesis with the title: ‘SOCS proteins and cytokine signalling: The many faces of the SOCS box’. Promotor: Prof. Dr. Jan Tavernier.

Publications

Lavens D, Montoye T, Piessevaux J, Zabeau L, Vandekerckhove J, Gevaert K, Becker W, Eyckerman S, Tavernier J. A complex interaction pattern of CIS and SOCS2 with the leptin receptor. J Cell Sci. 2006 Jun 1;119(Pt 11):2214-24.

- 227 -

Montoye T, Piessevaux J, Lavens D, Wauman J, Catteeuw D, Vandekerckhove J, Lemmens I, Tavernier J. Analysis of leptin signalling in hematopoietic cells using an adapted MAPPIT strategy. FEBS Lett. 2006 May 29;580(13):3301-7.

Piessevaux J, Lavens D, Montoye T, Wauman J, Catteeuw D, Vandekerckhove J, Belsham D, Peelman F, Tavernier J. Functional cross-modulation between SOCS proteins can stimulate cytokine signaling. J Biol Chem. 2006 Nov 3;281(44):32953-66.

Lavens D, Piessevaux J, Tavernier J. Review: Negative regulation of leptin receptor signalling. Eur Cytokine Netw. 2006 Sep;17(3):211-9.

Piessevaux J, Catteeuw D, Peelman F, Tavernier J. Elongin B/C recruitment regulates substrate binding by CIS. Revised version submitted to J Biol Chem.

Pattyn E, Verhee A, Uyttendaele I, Piessevaux J, Timmerman E, Gevaert K, Vandekerckhove J, Peelman F, Tavernier J. HyperISGylation of Old World Monkey ISG15 in Human cells. Revised version submitted to PLoS ONE

Piessevaux J, Lavens D, Zabeau L, Peelman F, Tavernier J. The many faces of the SOCS box (Review).

Abstracts and Presentations

Lievens S, Piessevaux J, Pattyn E, van der Heyden J, Vandekerckhove J, Tavernier J. Uncoupling of STAT3 phosporylation and STAT3-mediated gene induction in interferon signalling. Abstract, VIB Seminar, Blankenberge, Belgium, March 13-14, 2003.

Lievens S, Piessevaux J, Pattyn E, Tavernier J. Uncoupling of STAT3 phosporylation and STAT3-mediated gene induction in interferon signaling. Abstract, FEBS Special Meeting on Signal Transduction, Brussels, Belgium, July 3-8, 2003.

Lievens S, Piessevaux J, Pattyn E, van der Heyden J, Vandekerckhove J, Tavernier J. Uncoupling of STAT3 phosporylation and STAT3-mediated gene induction in interferon signalling. Abstract, ELSO, Dresden, Germany, Sept. 20-24, 2003.

- 228 - Piessevaux J, Lavens D, Montoye T, Eyckerman S, Peelman F, Catteeuw D, Vandekerckhove J and Tavernier J. How SOCS2 modulates cytokine signalling. Oral presentation, MPR Departemental Seminar, Ghent, Belgium, July 5-6, 2005.

Tavernier J, Lavens D, Lemmens I, Montoye T, Piessevaux J, Peelman F, Ulrichts P. MAPPIT Analysis of SOCS Protein Interactions. Abstract, ISICR Meeting Shanghai, China, Oct. 20-24, 2005.

Piessevaux J, Lavens D, Eyckerman S, Montoye T, Vandekerckhove J, Tavernier J. A complex interaction pattern of CIS and SOCS2 with the leptin receptor. Oral presentation, VIB Seminar, Blankenberge, Belgium, March 9-10, 2006.

Piessevaux J, Lavens D, Montoye T, Wauman J, Catteeuw D, Vandekerckhove J, Belsham D, Peelman F, Tavernier J. Cross-modulation between SOCS proteins can stimulate cytokine signaling. Abstract, FEBS Special Meeting on Cellular Signaling,Dubrovnik,Croatia,May26-June1,2006.

Piessevaux J, Lavens D, Montoye T, Wauman J, Catteeuw D, Vandekerckhove J, Peelman F, Tavernier J. Functional cross-modulation between SOCS proteins can stimulate cytokine signaling. Oral presentation, Young Scientist Day, Meeting of the Belgian Society of Biochemistry and the 2005-2006 International Francqui Chair, Gembloux, Belgium, Dec. 18, 2006.

Piessevaux J, Lavens D, Montoye T, Wauman J, Catteeuw D, Vandekerckhove J, Belsham D, Peelman F, Tavernier J. Functional cross-modulation between SOCS proteins can stimulate cytokine signaling. Abstract, VIB Seminar, Blankenberge, Belgium, March 1-2, 2007.

Piessevaux J, Lavens D, Montoye T, Wauman J, Catteeuw D, Vandekerckhove J, Peelman F, Tavernier J. Functional cross-modulation between SOCS proteins can stimulate cytokine signaling. Oral presentation, Horizons in Molecular Biology, Göttingen, Germany, Sept. 12-15, 2007.

Piessevaux J, Catteeuw D, Peelman F, Tavernier J. Elongin B/C recruitment regulates substrate binding by CIS. Oral presentation, MPR Departemental Seminar, Ghent, Belgium, Dec. 13-14, 2007.

Tavernier J, Piessevaux J, Lavens D, Catteeuw D, Peelman F. Structure-function studies of the SOCS box. Abstract, 2nd ReceptEUR Network Meeting, Carlingford, Ireland, April 3-4, 2008.

- 229 -

- 230 - 30 April 2008, met een warm en dankbaar gevoel blik ik terug op de zes voorbije jaren en daar hebben verschillende van jullie toe bijgedragen.

In de eerste plaats gaat mijn dank naar mijn promotor, Prof. Jan Tavernier. Hij beperkt zich niet tot het creëren en richten van projecten maar weet zijn mensen ook wetenschappelijk te bezielen met zijn (berucht) enthousiasme. Bedankt voor de kansen en het vertrouwen, Jan. Je haalt het maximum uit het leven (en je werknemers...) en ik heb bewondering voor de baas en mens die je bent. Vervolgens wens ik onze vakgroepvoorzitter (en tevens voorzitter van mijn examencommissie), Prof. Joël Vandekerckhove te bedanken om mij de kans gegeven te hebben mijn onderzoek uit te voeren op deze uitzonderlijk mooie locatie. De omkadering, infrastructuur en organisatie waren echt optimaal. Prof. Dany Broeckaert zou ik oprecht willen danken voor zijn interesse in mijn werk en bemoedigende woorden in mijn ‘magere onderzoeksjaren’. Ook op menselijk vlak viel er heel wat te delen met jou. Ik wil hier ook de overige leden van mijn doctoraatscommissie; Prof. Gertler, Prof. Libert, Prof. Leybaert, Prof. Ampe en Dr. Vandenberghe bedanken voor hun kritische evaluatie van dit werk. In deze lijst hoort ook Prof. Frank Peelman thuis. Een dikke merci voor de verrijkende samenwerkingen en babbels ! Je wetenschappelijke motivatie heb ik altijd als een inspirerend voorbeeld gezien.

Een zorgzame begeleiding in mijn eerste jaren staat op Els’ palmares, waarvoor dank. Verder ben ik altijd blij geweest de bench, flow, zwangerschapssenilititeiten en andere met jou te delen. Irma, ons ‘eerste-prijsbeest-dynamiek-nuchterheid-en-efficiëntie’, weet desondanks haar georganiseerde dagplanning altijd tijd te maken voor een vraag of probleem. Bedankt voor je betrokkenheid en optimisme. Ook was het leuk samenwerken met Sam een aantal jaren terug, jammer dat die vijver nooit opgevuld geraakt is met champagne. Van onze tuin en andere rood-groene-babbels tot je Samiaanse ogen en mijn studie over je rug-krab-patroon, het waren allemaal kleine dingen die de dag aangenamer konden maken. Blijft er nog de meest passionele van het post-doc lokaal ... Een immens grote blijk van dank gaat naar jou, Leo: voor je kostbare hulp bij mijn werk en schrijven, je attentheid, humor en alle zo fijne momenten die ik koester. Je kan als geen ander een feest maken van de meest dagdagelijkse dingen. En inderdaad, er zijn blijkbaar dingen die nog ingewikkelder zijn dan het clusteren van cytokine receptoren maar weet dat ik je aanwezigheid en vriendschap altijd heel sterk geapprecieerd heb.

Een ander persoon die doorheen de jaren een speciaal plaatsje ingenomen heeft is José: vuurtoren, stoïcijn, techno-muziek kenner en uitmuntend wetenschapper, maar bovenal een fantastisch mens. Ben zo blij dat je je weer onder ons bevindt (en dat onze relatie

- 231 - ondertussen zodanig gegroeid is dat ze zelfs vergeten verjaardagen, twijfelachtige cow-boy films en verwelkte azalea’s overleeft!). Het tweede deel van onze experimentele elite, Annick, wil ik bedanken voor haar hulp bij kloneringsproblemen, de leuke ski-momenten (en heerlijke spaghetti-saus), haar eeuwig goed humeur en lach (meest vreugdevolle en aanstekelijke lach ooit !). En nu Patrick ver van huis is, zal het aan ons zijn om er voor te zorgen dat ze die laatste behoudt. Maar het moet gezegd worden dat Annick deel uit maakt van een groter geheel, ‘The Magic Four’ (ofte Domi en zijn chicks). Lid nr.2: Anne-Sophie, de sequentie-queen, altijd de eerste om aan een verjaardag of gebeurtenis te denken, bedankt voor je behulpzaamheid. Lid nr.3: Nele, onze FACS-babe, bij jou kon ik terecht voor van alles: een gezellige babbel, een massage, hulp bij het ontfermen over éénzame vrijgezel vrienden, ... je bent een schat! Lid nr. 4: Dominiek, klonerings- en eiwit- 8ste wereldwonder. Vond het altijd zeer fijn (en vruchtbaar) om met je samen te werken, een dikke dikke merci voor al je hulp! (nog een laatste gelfiltratie ... ?)

En dan is er de nieuwe garde doctoraatstudenten: jong, onstuimig en bezeten door de wetenschappen: Celia, onze recentste aanwinst, indrukwekkend op de dansvloer en al volledig ingeburgerd in de groep. Laura, she is bringing a bit of Italy and sun into the lab. Margarida, the other exotic touch of our lab, see you for other VIBes ! Isabelle, maakt ook deel uit van de goede ski-herinneringen en gaat binnenkort een grote dag meemaken (het aftellen kan beginnen...). Leentje, het was altijd een plezier om met jou te babbelen, de dansles te delen of te werken -tot we er bij neervallen- (maar in stijl natuurlijk!). Zelden zoveel motivatie, werklust en pit gezien bij iemand. Hoop dat je binnenkort al die papers binnenhaalt die je zo hard verdient. En dan de Jos, mijne copin, de man die IRS4 temde of die maar naar de vrouwen moet kijken om ze zwanger te maken. Voor de rest is hij ook nog eens een leuke bench- en bureau-genoot. Heb veel aan je gehad, waarvoor dank.

Met vijf zijn we toenertijd gestart en Jan zijn pronostiek dat ik als eerste ging doctoreren is niet helemaal uitgekomen... Delphine en Peter lopen ondertussen als volwaardige post-docs (en stralende mama/papa) rond in het lab en zijn twee mensen op wie ik altijd kon rekenen. Delphine, bedankt voor de aangename samenwerkingen (Goooo SOCSSSS !) en gezellige vrouwenbabbels. Pedro, naast zijn viriel-vetzak-voetbal-imago ook een inlevingsvermogen en opmerkzaamheid waar je zelfs als vrouw op jaloers moet zijn, dank u voor al de grappige momenten en absurde discussies in de flow. Hannes heeft de finish als eerste gehaald waarna hij de patentenwereld is gaan verkennen en veroveren. Je was een toffe collega waarvan we de encyclopedische kennis, rigi-scan , limericks en chocomousse niet snel gaan vergeten. Een heel speciale dank u gaat naar Toon, mijn allerbeste maatje. Als ik terugdenk aan al die gedeelde momenten: de studententijd met onze examen-stress nachten en evenveel Overpoort nachten erna als compensatie, onze hippe lunch-middagen, minder hippe

- 232 - cassoulet-avonden en ‘cinefiele’ rendez-vous, de gele pistes en carbonnades, onze steeds te korte discussie momenten, het shuffelen en de rock ’n roll moods, de wederzijdse steun in moeilijkere momenten, ... dan wil ik je zo hard bedanken voor die mooie vriendschap! Acht mijzelf gelukkig om permanent iemand met zo een positieve ingesteldheid, heldere kijk en levenslust in de buurt gehad te hebben.

Twee andere ex-collega’s die ook in deze dankbetuiging thuishoren zijn Sven en Gertie: Svenneman, bedankt voor de wetenschappelijke raadgevingen en memorabele ski-trips; Gertie alias Mam’selle, bedankt voor alle goede momenten in en rond het labo.

Een welgemeende dank aan het adres van Johan en Serge voor hun eerste klasse service. En Johan, bedankt ook voor het organiseren van de barbeques en skireizen en al je goede zorgen (de kathedraal staat er nog in volle glorie!). Heel veel dank ook aan Veronique, Kristien en Dirk voor het uitstekende secretariaatswerk.

Mijn vrienden (met op kop mijn 2 soulmates Marie en Gaëlle) waren er gedurende al die jaren altijd met hun opkikkertjes (allerhande...), psychologische sessie’s, discussie-, lach- en feestmomenten. Bedankt voor het steeds weer opladen van mijn batterijen!

Uit het diepste van mijn hart wil ik mijn ouders danken, al 30 jaar dat jullie mij alle mogelijke kansen geven. Een blijk van dank ook aan mijn zusje, één van de pilaren van mijn leven.

Mijn laatste woorden zijn voor jou Cédric. Ik weet nog altijd niet waaraan ik je tederheid, nooit aflatende steun en onvoorwaardelijke liefde te danken heb. Weet dat je me zeer gelukkig maakt. En nu ik ons kind mag dragen is mijn dankbaarheid wel een toppunt aan het bereiken! Je t’aime mon amour.

Julie

- 233 -

‘Be the change you want to see in the world’

Mahatma Gandhi

- 234 -