DOCSLIB.ORG

Ephrinb3 Is an Anti-Apoptotic Ligand That Inhibits the Dependence Receptor Functions of Epha4 Receptors During Adult Neurogenesis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Ephrinb3 Is an Anti-Apoptotic Ligand That Inhibits the Dependence Receptor Functions of Epha4 Receptors During Adult Neurogenesis View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Biochimica et Biophysica Acta 1793 (2009) 231–238 Contents lists available at ScienceDirect Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbamcr EphrinB3 is an anti-apoptotic ligand that inhibits the dependence receptor functions of EphA4 receptors during adult neurogenesis Céline Furne a,1, Jerome Ricard b,1, Jorge Ruben Cabrera a, Laurent Pays a, John R. Bethea b, Patrick Mehlen a,⁎,2, Daniel J. Liebl b,⁎,2 a Laboratory Apoptosis Cancer and Development, CNRS UMR 5238, Center Léon Bérard, University of Lyon, Lyon, France b The Miami Project to Cure Paralysis and Department of Neurosurgery, University of Miami School of Medicine, Miami, FL, USA article info abstract Article history: Eph receptors have been implicated in regulating a diverse array of cellular functions in the developing Received 18 December 2007 nervous system. Recently, Eph receptors have been shown to promote cell death in adult germinal zones; Received in revised form 2 September 2008 however, their mechanisms of action remain ill-defined. In this study, we demonstrate that EphA4 is a new Accepted 15 September 2008 member of the dependence receptors family, which can initiate cell death in the absence of its ligand Available online 7 October 2008 ephrinB3. Upon removal of its ligand, EphA4 triggers cell death that is dependent on caspase activation as caspase inhibitors prevent cell death. EphA4 itself is cleaved by caspase-3-like caspase in the intracellular Keywords: Ephrin domain at position D773/774, which is necessary for cell death initiation as mutation of the cleavage site Eph receptor abolishes apoptosis. In the adult subventricular zone, abolishing ephrinB3 results in increased cell death, Dependence receptor while the absence of EphA4 results in excessive numbers of neuroblasts. Furthermore, infusion of soluble Apoptosis ephrinB3 into the lateral ventricle reduced cell death, and together these results support a dependence role for EphA4 in adult neurogenesis. © 2008 Elsevier B.V. All rights reserved. 1. Introduction Dependence receptors can transduce two different types of signals. When bound to their ligand, they transduce a positive signal that Eph receptors constitute the largest family of receptor tyrosine elicits a positive response such as survival, differentiation or kinases in mammalians and are subdivided into two A and B classes, and migration. However, when deprived of their ligand, they trigger bind either A-class or B-class ligands. Receptor–ligand interactions occur apoptosis. Dependence receptors include p75NTR, the netrin receptors upon cell–cell contact as both receptors and ligands are membrane- DCC and Unc5H1-3, Ret, the androgen receptor, Patched, the αVβ3 bound, and control various mechanisms such as axon pathfinding and integrin, APP [7], as well as Neogenin, Met, and TrkC [8–10]. branching, dendritic spine modeling, angiogenesis, cell migration and Dependence receptors are cleaved by specific caspases, leading to positioning [1]. Recently, they were shown to be expressed in the the release/exposure of an addiction/dependence domain (ADD), subventricular zone (SVZ), and control stem/progenitor cells prolifera- which can amplify caspase activity [11]. Mutation of the caspase tion and fate [2–5]. More surprisingly, some ephrins and Eph receptors cleavage site abolishes the pro-apoptotic activity of the receptors. were found to affect cell death in neurogenic regions. Stimulation of Furthermore, computational analyses unveiled a conserved motif in EphA7 through ectopic over-expression of ephrinA5 in the embryonic the transmembrane region of the known dependence receptors cortex induced a wave of neural progenitor apoptosis, thus influencing named the DART (Dependence-Associated Receptor Transmembrane) the development of the brain [6]. In contrast, we observed that the motif [12]. Here we show that EphA4 is a new dependence receptor, absence of ephrinB3 was associated with an increase in TUNEL-positive where it induces apoptotic cell death, is cleaved by caspase, and that cells in the SVZ of adult mice [4]. The fact that the lack of ephrinB3 may its pro-apoptotic effect can be blocked by ephrinB3. In the adult increase cell death led us to question whether its receptor(s) may germinal zone, ephrinB3 and EphA4 function to regulate cell numbers, function as a dependence receptor. where EphA4 functions as a dependence receptor in the absence of ephrinB3. ⁎ Corresponding authors. P. Mehlen is to be contacted at Laboratory Apoptosis Cancer and Development, CNRS UMR 5238, Center Léon Bérard, University of Lyon, Lyon, 2. Materials and methods France. D.J. Liebl, The Miami Project to Cure Paralysis, The University of Miami, 1095 NW 14th Terrace, R-48, School of Medicine, Miami, FL 33136, USA. Tel.: +1 305 243 7143, fax: 2.1. Plasmids +1 305 243 3914. E-mail address: [email protected] (D.J. Liebl). 1 There authors contributed equally to this work. EphA4 was subcloned into pcDNA 3.1 His-V5 (InVitrogen). EphA4 2 There authors contributed equally to this work and are co-corresponding authors. intracellular domain was subcloned into pcDNA3.1 (InVitrogen) by 0167-4889/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.bbamcr.2008.09.009 232 C. Furne et al. / Biochimica et Biophysica Acta 1793 (2009) 231–238 PCR using the following primers: 5′-caccatgggcgatggagcca-3′ and 5′- (Promega). They were counted using a FACS Calibur (Becton tcagacaggaaccatcctgc-3′. The construct for the kinase dead mutant Dickinson) and cellQuest analysis software (excitation and emission: pcDNA3-EphA4-K653M was obtained from Dr Joachim Egea (Mar- 488 nm and 525–550 nm). Apoptosis was also quantified with the tinsried, Germany). EphA4 mutants were obtained by Quick change Caspase-3 Fluorometric Assay Kit (Gentaur). Caspase inhibitors z- site directed mutagenesis (Stratagene) using the following primers: VAD-fmk and z-DEVD-fmk were used at 10 μM. EphA4-D773/774N: ggtgctggagaataaccccgaagc and gcttcggggttattctc- cagcacc; EphA4-D806N: ctcagccagtaatgtctggag and ctccagacat- 2.3. Caspase cleavage reactions tactggctgag; EphA4-Y596/602F: agttctaacaccttgattcaaatgtttctc and caaggtgttagaacttttgtggatccc, tgtaaagggatccacataagttctaacacc and Purified caspases were a generous gift from Guy Salvesen (The gtggatccctttacattcgaagaccccaac. Burnham Institute, La Jolla, CA). The intracellular domain of EphA4 (amino acids 571–987) was cloned into pcDNA3.1 (InVitrogen) and 2.2. Cell culture and death analysis was transcribed and translated in vitro using the TNT system (Promega). To analyze receptor cleavage in 293T cells, cells were Cell death was analyzed as described previously [13]. Briefly, washed once in PBS and lysed in 20 mM Hepes–KOH, 10 mM KCl, 1.5 M 100,000 HEK 293T cells were transfected with 1.5 μg DNA using MgCl2, 1 mM sodium EDTA, 1 mM sodium EGTA, 0.1 mM PMSF buffer Lipofectamine (InVitrogen) for 6 h. The medium was replaced with containing DTT, pepstatin, leupeptin and aprotinin. The lysates were DMEM without serum and cell death was analyzed 48 h later using then incubated for 30 min at 37 °C. Immunoblots were then performed Trypan blue exclusion. Pre-clustered ephrinB3-Fc (R & D Systems) was using an anti-V5 antibody (InVitrogen). In vitro transcription/transla- added at the time of medium change and again 24 h later at a final tion and incubation with caspase 3 or 8 were performed as described concentration of 1 μg/ml. Clustering was performed with goat anti- previously [13]. human Fc antibodies (1:10 anti-Fc:ligand) for 1 h at 37 °C. Apoptosis was quantified by TUNEL assay (In Situ Cell Death kit, Roche) following 2.4. Protein analysis the manufacturer's instructions. Apoptosis was also analyzed using the caspase substrate caspACE FITC-VAD-fmk (Promega). Briefly, 48 h Expressed proteins were immunoprecipitated with an anti-V5 after transfection, the cells were washed and resuspended in PBS and (Invitrogen) or anti-EphA4 antibody (Santa Cruz) (in the case of incubated 20 min at 37 °C with 10 μM caspACE-FITC-VAD-fmk EphA4-K653M) using a ratio of 1 μg Ab/100 μg protein extract Fig. 1. EphA4 enhances apoptotic cell death that is blocked in a dose-dependent manner by ephrinB3. (a) HEK 293T cell cultures over-expressing EphA4 showed a higher number of dead cells as measured by Trypan blue exclusion. Addition of pre-clustered soluble ephrinB3 in the medium was able to reduce the amount of cells stained by Trypan blue. (b) EphA4 over-expression leads to an increase in TUNEL-positive cells 48 h after transfection. The number of TUNEL-positive cells is reduced upon addition of soluble ephrinB3 in the medium. (c) Representative pictures of TUNEL staining (quantification shown in (b)). The TUNEL-positive cells appear dark (a few are seen in the middle panel). (d) EphrinB3 blocked EphA4 induce cell death in a dose-dependent manner. The experiments were performed at least three times and the bars on the graphs represent the means of three separate wells (one representative experiment shown). ⁎pb0.05; ⁎⁎pb0.01; ⁎⁎⁎pb0.001. C. Furne et al. / Biochimica et Biophysica Acta 1793 (2009) 231–238 233 overnight at 4 °C. 25 μl of protein G-agarose beads (Calbiochem) were added for 30 min. Washes were performed in 10 mM Tris–HCl, pH 7.0, 1 mM EDTA, 0.5% Triton X-100 with decreasing salt concentrations (1 M NaCl, then 0.2 M NaCl, then no NaCl). Immunoprecipitates were boiled and run on SDS-PAGE gels, transferred and the membranes were probed with either anti-V5 or anti-EphA4 antibodies, and anti- phosphotyrosine antibodies (BD Pharmingen). 2.5. Animals and tissue analysis Two-month old male CD1 mice were used following the University of Miami Institutional Animal Care and Use Committee guidelines. Animals were perfused intracardially with 4% paraformaldehyde and the brains were harvested, frozen in OCT (Tissue-Tek) and sectioned using a cryostat.
Load more

Recommended publications
  • Neurotrophin-3 Production Promotes Human Neuroblastoma Cell Survival by Inhibiting Trkc-Induced Apoptosis
    Neurotrophin-3 production promotes human neuroblastoma cell survival by inhibiting TrkC-induced apoptosis Jimena Bouzas-Rodriguez, … , Servane Tauszig-Delamasure, Patrick Mehlen J Clin Invest. 2010;120(3):850-858. https://doi.org/10.1172/JCI41013. Research Article Oncology Tropomyosin-related kinase receptor C (TrkC) is a neurotrophin receptor with tyrosine kinase activity that was expected to be oncogenic. However, it has several characteristics of a tumor suppressor: its expression in tumors has often been associated with good prognosis; and it was recently demonstrated to be a dependence receptor, transducing different positive signals in the presence of ligand but inducing apoptosis in the absence of ligand. Here we show that the TrkC ligand neurotrophin-3 (NT-3) is upregulated in a large fraction of aggressive human neuroblastomas (NBs) and that it blocks TrkC-induced apoptosis of human NB cell lines, consistent with the idea that TrkC is a dependence receptor. Functionally, both siRNA knockdown of NT-3 expression and incubation with a TrkC-specific blocking antibody triggered apoptosis in human NB cell lines. Importantly, disruption of the NT-3 autocrine loop in malignant human neuroblasts triggered in vitro NB cell death and inhibited tumor growth and metastasis in both a chick and a mouse xenograft model. Thus, we believe that our data suggest that NT-3/TrkC disruption is a putative alternative targeted therapeutic strategy for the treatment of NB. Find the latest version: https://jci.me/41013/pdf Research article Neurotrophin-3 production promotes human neuroblastoma cell survival by inhibiting TrkC-induced apoptosis Jimena Bouzas-Rodriguez,1 Jorge Ruben Cabrera,1 Céline Delloye-Bourgeois,1 Gabriel Ichim,1 Jean-Guy Delcros,1 Marie-Anne Raquin,2 Raphaël Rousseau,3 Valérie Combaret,3 Jean Bénard,4 Servane Tauszig-Delamasure,1 and Patrick Mehlen1 1Apoptosis, Cancer and Development Laboratory–Equipe labellisée “La Ligue,” CNRS UMR5238, Université de Lyon, France.
    [Show full text]
  • View Open Access Neurodegeneration in Alzheimer's Disease: Caspases and Synaptic Element Interdependence Dale E Bredesen1,2
    Molecular Neurodegeneration BioMed Central Review Open Access Neurodegeneration in Alzheimer's disease: caspases and synaptic element interdependence Dale E Bredesen1,2 Address: 1Buck Institute for Age Research, 8001 Redwood Blvd., Novato, CA USA 94945 and 2Department of Neurology, University of California, San Francisco, CA USA 94143 Email: Dale E Bredesen - [email protected] Published: 26 June 2009 Received: 4 March 2009 Accepted: 26 June 2009 Molecular Neurodegeneration 2009, 4:27 doi:10.1186/1750-1326-4-27 This article is available from: http://www.molecularneurodegeneration.com/content/4/1/27 © 2009 Bredesen; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Extensive genetic, biochemical, and histological evidence has implicated the amyloid-β peptide (Aβ) in Alzheimer's disease pathogenesis, and several mechanisms have been suggested, such as metal binding, reactive oxygen species production, and membrane pore formation. However, recent evidence argues for an additional role for signaling mediated by the amyloid precursor protein, APP, in part via the caspase cleavage of APP at aspartate 664. Here we review the effects and implications of this cleavage event, and propose a model of Alzheimer's disease that focuses on the critical nature of this cleavage and its downstream effects. Review: programmed cell death, cell death revealed a more active, and more plastic, role for the cell signaling, and neurodegenerative disease in its own life/death decision than was previously appre- Many of the diseases that affect the nervous system feature ciated.
    [Show full text]
  • Control of Cell Death/Survival Balance by the MET Dependence Receptor
    RESEARCH ARTICLE Control of cell death/survival balance by the MET dependence receptor Leslie Duplaquet1, Catherine Leroy1†, Audrey Vinchent1†, Sonia Paget1, Jonathan Lefebvre1, Fabien Vanden Abeele2, Steve Lancel3, Florence Giffard4, Re´ jane Paumelle3, Gabriel Bidaux5, Laurent Heliot5, Laurent Poulain4, Alessandro Furlan1,5*, David Tulasne1* 1Univ. Lille, CNRS, Institut Pasteur de Lille, UMR 8161 - M3T - Mechanisms of Tumorigenesis and Targeted Therapies, Lille, France; 2Univ. Lille, Inserm, U1003 - PHYCEL - Physiologie Cellulaire, Lille, France; 3Univ. Lille, Inserm, CHU Lille, Institut Pasteur de Lille, U1011 - EGID, Lille, France; 4Normandie Universite´, UNICAEN, INSERM U1086 ANTICIPE, UNICANCER, Cancer Centre F. Baclesse, Caen, France; 5Univ. Lille, CNRS, UMR8523 - PhLAM – laboratoire de Physique des Lasers, Atomes et Mole´cules, Lille, France Abstract Control of cell death/survival balance is an important feature to maintain tissue homeostasis. Dependence receptors are able to induce either survival or cell death in presence or absence of their ligand, respectively. However, their precise mechanism of action and their physiological importance are still elusive for most of them including the MET receptor. We evidence that pro-apoptotic fragment generated by caspase cleavage of MET localizes to the mitochondria-associated membrane region. This fragment triggers a calcium transfer from endoplasmic reticulum to mitochondria, which is instrumental for the apoptotic action of the *For correspondence: receptor. Knock-in mice bearing a mutation of MET caspase cleavage site highlighted that p40MET [email protected] (AF); production is important for FAS-driven hepatocyte apoptosis, and demonstrate that MET acts as a [email protected] (DT) dependence receptor in vivo. Our data shed light on new signaling mechanisms for dependence †These authors contributed receptors’ control of cell survival/death balance, which may offer new clues for the pathophysiology equally to this work of epithelial structures.
    [Show full text]
  • Thirty Years of Research on Met Receptor to Move a Biomarker from Bench to Bedside
    Published OnlineFirst November 19, 2014; DOI: 10.1158/0008-5472.CAN-14-1932 Cancer Review Research Thirty Years of Research on Met Receptor to Move a Biomarker from Bench to Bedside Alessandro Furlan1, Zoulika Kherrouche1,Remi Montagne1, Marie-Christine Copin1,2, and David Tulasne1 Abstract Met receptor tyrosine kinase was discovered in 1984 as an oncogene. Thirty years later, Met and its ligand hepatocyte growth factor/scatter factor are promising targets for the novel therapies developed to fight against cancers, with more than 240 clinical trials currently conducted. In this review, we offer to trace and highlight the most recent findings of the exemplary track record of research on Met receptor, which allowed moving this biomarker from bench to bedside. Indeed, three decades of basic research unravelled the structural basis of the ligand/receptor interaction and their complex downstream signaling network. During this period, animal models highlighted their crucial role in the development and homeostasis of epithelial organs. In parallel, involvement of Met in tumorigenesis was confirmed by the direct association of its deregulation to poor prognosis in numerous cancers. On the basis of these data, pharmaceutical companies developed many Met inhibitors, some of which are in phase III clinical trials. These impressive achievements should not detract from many questions that still remain, such as the precise Met signaling involvement in development or homeostasis of specific epithelial structures. In addition, the processes involving Met in resistance to current therapies or the appearance of resistances to Met-targeted therapies are far from being fully understood. Cancer Res; 74(23); 6737–44.
    [Show full text]
  • Death Pathways Activated in the Neurotrophic Factror-Deprived Neurons
    Death pathways activated in the neurotrophic factor-deprived neurons Li-ying Yu The Finnish Graduate School of Neuroscience Institute of Biotechnology and Department of Biological and Environmental Sciences Faculty of Biosciences University of Helsinki Academic dissertation To be presented for public criticism, with the permission of the Faculty of Biosciences of the University of Helsinki, in the auditorium 2402 at Viikki Biocenter 3 on the 13th of February 2009, at 12 o’clock noon. Helsinki 2009 Supervised by: Docent Urmas Arumäe Institute of Biotechnology University of Helsinki Finland Reviewed by: Docent Matti Airaksinen Neuroscience Center University of Helsinki Finland And Docent Esa Kuismanen Department of Biosciences Division of Biochemistry University of Helsinki Finland Opponent: Professor Dale E. Bredesen Buck Institute for Age Research Novato, California United States of America ISBN 978-952-10-5272-9 (pbk) ISBN 978-952-10-5273-6 (PDF) ISSN 1795-7079 Yliopistopaino, Helsinki, 2009 咃㒠䤓㦏䓀 㪝䚞 㹔 TABLE OF CONTENTS ABBREVIATIONS LIST OF ORIGINAL PUBLICATIONS ABSTRACT 1. REVIEW OF THE LITERATURE ..........................................................................1 1.1. Programed cell death ............................................................................................1 1.1.1. Programed cell death in the development of nervous system.....................1 1.2. Neurotrophic factors .............................................................................................2 1.2.1. Neurotrophin family ...................................................................................3
    [Show full text]
  • The Trkc Receptor Induces Apoptosis When the Dependence Receptor Notion Meets the Neurotrophin Paradigm
    The TrkC receptor induces apoptosis when the dependence receptor notion meets the neurotrophin paradigm Servane Tauszig-Delamasure*, Li-Ying Yu†, Jorge Ruben Cabrera*, Jimena Bouzas-Rodriguez*, Catherine Mermet- Bouvier*, Catherine Guix*, Marie-Claire Bordeaux*, Urmas Aruma¨ e†, and Patrick Mehlen*‡ *Apoptosis, Cancer and Development Laboratory, Equipe Labellise´e La Ligue, Centre National de la Recherche Scientifique, Unite´Mixte de Recherche 5238, Universite´de Lyon, Centre Le´onBe´ rard, 69008 Lyon, France; and †Research Program in Molecular Neurobiology, University of Helsinki, P.O. Box 56, Viikki Biocenter, FIN-00014, Helsinki, Finland Edited by Hans Thoenen, Max Planck Institute of Neurobiology, Martinsried, Germany, and approved June 21, 2007 (received for review February 9, 2007) The TrkC/NT-3 receptor/ligand pair is believed to be part of the neuron migration or localization during the development of the classic neurotrophic theory claiming that neuronal death occurs by nervous system and to inhibit tumor growth in adult. This activity default when neurotrophic factors become limited, through loss of has been exemplified in vivo with the dependence receptor survival signals. Here, we show that TrkC is a dependence receptor Patched and the survival of neuroepithelial cells in the devel- and, as such, induces caspase-dependent apoptotic death in the oping spinal cord (4) as well as for the netrin-1 receptors DCC absence of NT-3 in immortalized cells, a proapoptotic activity and/or UNC5H in colorectal tumorigenesis (5). Here, we pro- inhibited by the presence of NT-3. This proapoptotic activity of TrkC vide evidence that the protein tyrosine kinase receptor TrkC, a relies on the caspase-mediated cleavage of the intracellular domain main cognate receptor for NT-3, is also a dependence receptor.
    [Show full text]
  • Curriculum Vitae
    CURRICULUM VITAE Name : Prof. Devrim GOZUACIK, MD PhD Address : Koç University, School of Medicine, KUTTAM Research Center for Translational Medicine, Topkapi 34010, Istanbul, TURKEY. Phone : +90 212 467 87 00 E-mail : [email protected] Orcid ID : https://orcid.org/0000-0001-7739-2346 EDUCATION 2001, Ph.D. of Molecular Cell Biology, Paris Pasteur Institute and Paris-Sud (XI) University. 1997, M.Sc. (French D.E.A. degree) of Biochemistry, Ecole Polytechnique and Paris-Sud University. 1995, Medical doctor (MD) degree, Hacettepe University, Faculty of Medicine (in English). 1994, Research fellow, Dept. of Tumor Biology, Rotterdam Erasmus Medical Center. 1989-1995, Student researcher, Hacettepe Children’s Hospital Medical Biology Dept. and Hacettepe Oncology Institute. EMPLOYMENT June 2020-today, Professor, School of Medicine, KUTTAM Research Center for Translational Medicine, Koç University. 2018-today, Affiliate Member, Autophagy, Inflammation and Metabolism (AIM) Center of Biomedical Research Excellence, University of New Mexico Health Sciences Center, USA. 2018-today, Part-Time Senior Researcher, SUNUM Nanotechnology Research and Application Center. 2016-2020, Co-Founder and Board Member, EFSUN Nanodiagnostics Center of Excellence. 2018-2020, Professor, Molecular Biology Genetics and Bioengineering Program, Sabanci University. 2011-2018, Associate Professor, Molecular Biology Genetics and Bioengineering Program, Sabanci University. Sept. 2006-2011, Assistant Professor, Biological Sciences and Bioengineering Program, Sabanci University. 2001-2006, Postdoctoral fellow, Weizmann Institute of Science (Adi Kimchi Lab). CITATIONS AND H-INDEX 8338 citations in the Science Citation Index (SCI, Thomson-Reuters), h-index: 25. 8710 citations in Scopus, h-index: 25 13670 citations in Google Scholar, h-index: 28. 11 publications with >100 citations.
    [Show full text]
  • Receptors That Mediate Cellular Dependence
    Cell Death and Differentiation (2005) 12, 1031–1043 & 2005 Nature Publishing Group All rights reserved 1350-9047/05 $30.00 www.nature.com/cdd Review Receptors that mediate cellular dependence DE Bredesen*,1,2, P Mehlen1,3 and S Rabizadeh1 cell death (PCD) initiated by a loss of adhesion. Other cells may undergo PCD following the withdrawal of trophic factors 1 The Buck Institute for Age Research, Novato, CA 94945, USA (e.g., the neurotrophins), cytokines, hormonal support, 2 University of California, San Francisco, San Francisco, CA 94143, USA electrical activity, or other stimuli.2 3 Apoptose, Cancer et De´veloppement, Centre Le´on Be´rard – CNRS FRE2870, Depending on the cell type and its state of differentiation, 28 rue Laennec, 69008 Lyon, France cells require different supportive stimuli for survival. For * Corresponding author: DE Bredesen, The Buck Institute for Age Research, 8001 Redwood Blvd., Novato, CA 94945, USA. example, prostate epithelial cells may require testosterone for Tel: þ 1 415 209 2084; Fax: þ 1 415 209 2230; survival, and for such cells the withdrawal of testosterone leads E-mail: [email protected] to apoptosis. Therefore, prostate neoplasms are often treated by withdrawing testosterone because this induces apoptosis, Received 08.3.05; revised 30.3.05; accepted 26.4.05 and thus tumor shrinkage; unfortunately, the few remaining Edited by G Melino cells that are androgen independent typically repopulate the tumors, and therefore alternative therapy is required. Abstract For any given required stimulus, withdrawal leads to PCD; that is, the loss of trophic support somehow triggers an active Cells depend for their survival on stimulation by trophic process of cell suicide.
    [Show full text]
  • Molecular Mechanisms of Cell Death
    Edinburgh Research Explorer Molecular mechanisms of cell death Citation for published version: Galluzzi, L, Vitale, I, Aaronson, SA, Abrams, JM, Adam, D, Agostinis, P, Alnemri, ES, Altucci, L, Amelio, I, Andrews, DW, Annicchiarico-Petruzzelli, M, Antonov, AV, Arama, E, Baehrecke, EH, Barlev, NA, Bazan, NG, Bernassola, F, Bertrand, MJM, Bianchi, K, Blagosklonny, MV, Blomgren, K, Borner, C, Boya, P, Brenner, C, Campanella, M, Candi, E, Carmona-Gutierrez, D, Cecconi, F, Chan, FK-M, Chandel, NS, Cheng, EH, Chipuk, JE, Cidlowski, JA, Ciechanover, A, Cohen, GM, Conrad, M, Cubillos-Ruiz, JR, Czabotar, PE, D'Angiolella, V, Dawson, TM, Dawson, VL, De laurenzi, V, De Maria, R, Debatin, K-M, DeBerardinis, RJ, Deshmukh, M, Di Daniele, N, Di Virgilio, F, Dixit, VM, Dixon, SJ, Duckett, CS, Dynlacht, BD, El-Deiry, WS, Elrod, JW, Fimia, GM, Fulda, S, Garcia-Saez, AJ, Garg, AD, Garrido, C, Gavathiotis, E, Golstein, P, Gottlieb, E, Green, DR, Greene, LA, Gronemeyer, H, Gross, A, Hajnoczky, G, Hardwick, JM, Harris, IS, Hengartner, MO, Hetz, C, Ichijo, H, Jaattela, M, Joseph, B, Jost, PJ, Juin, PP, Kaiser, WJ, Karin, M, Kaufmann, T, Kepp, O, Kimchi, A, Kitsis, RN, Klionsky, DJ, Knight, RA, Kumar, S, Lee, SW, Lemasters, JJ, Levine, B, Linkermann, A, Lipton, SA, Lockshin, RA, Lopez-Otin, C, Lowe, SW, Luedde, T, Lugli, E, MacFarlane, M, Madeo, F, Malewicz, M, Malorni, W, Manic, G, Marine, J-C, Martin, SJ, Martinou, J-C, Medema, JP, Mehlen, P, Meier, P, Melino, S, Miao, EA, Molkentin, JD, Moll, UM, Munoz-Pinedo, C, Nagata, S, Nunez, G, Oberst, A, Oren, M, Overholtzer,
    [Show full text]
  • Opposing Roles of Netrin-1 and the Dependence Receptor DCC in Cancer Cell Invasion, Tumor Growth and Metastasis
    Oncogene (2007) 26, 5615–5625 & 2007 Nature Publishing Group All rights reserved 0950-9232/07 $30.00 www.nature.com/onc ORIGINAL ARTICLE Opposing roles of netrin-1 and the dependence receptor DCC in cancer cell invasion, tumor growth and metastasis S Rodrigues1,2, O De Wever1,3, E Bruyneel3, RJ Rooney4 and C Gespach1,2 1INSERM, U673, Paris, France; 2Universite´ Pierre et Marie Curie-Paris 6, Faculte´ de Me´decine, Laboratory of Molecular and Clinical Oncology of Solid Tumors, Paris, France; 3Ghent University Hospital, Laboratory of Experimental Cancerology, Ghent, Belgium and 4Genome Explorations Inc., Memphis, TN, USA Deleted in colon cancer (DCC) and UNC5 function as Introduction netrin dependence receptors by inducing apoptosis in the absence of their ligand and accordingly were recently Netrin-1 belongs to a family of laminin-related secreted designated as putative conditional tumor suppressors. proteins expressed in the brain and peripheral tissues Herein, we determined whether netrin-1 and its receptors (Serafini et al., 1994). Netrins act through immunoglo- are implicated in cancer cell invasion and tumor progres- bulin-like transmembrane receptors, namely deleted sion. Expression of DCC, UNC5 and adenosine in colon cancer (DCC)/neogenin and UNC5A-D, as A2B-receptors (A2B-Rs) was investigated by reverse well as the G-protein-coupled adenosine A2B-receptor transcription polymerase chain reaction in human colon (A2B-R), acting as a DCC co-receptor (Arakawa, 2004). cancer cells. The impact of DCC restitution and netrin-1 Somatic loss of heterozygosity at chromosome 18q, was evaluated on collagen type I invasion, tumor growth frequently observed in colon, pancreatic and breast and metastasis in nude mice, cancer cell survival and gene cancers, is often associated with loss and abnormalities expression profiling.
    [Show full text]
  • Dependence Receptor Trkc Is a Putative Colon Cancer Tumor
    Dependence receptor TrkC is a putative colon cancer SEE COMMENTARY tumor suppressor Anne-Laure Genevoisa,1, Gabriel Ichima,1, Marie-May Coissieuxa, Marie-Pierre Lambertb, Fabrice Laviala, David Goldschneidera, Loraine Jarrosson-Wuillemea, Florian Lepinassec, Géraldine Gouyssec, Zdenko Hercegb, Jean-Yves Scoazecc, Servane Tauszig-Delamasurea,2, and Patrick Mehlena,2,3 aApoptosis, Cancer and Development Laboratory, Equipe labellisée “La Ligue,” LabEx DEVweCAN, Centre de Recherche en Cancérologie de Lyon, Institut National de la Santé et de la Recherche Médicale Unité 1052, Centre National de la Recherche Scientifique, Unité Mixte de Recherche 5286, Université de Lyon, Centre Léon Bérard, 69008 Lyon, France; bEpigenetics Group, International Agency for Research on Cancer, 69008 Lyon, France; and cEndocrine Differentiation Laboratory, Centre de Recherche en Cancérologie de Lyon, Institut National de la Santé et de la Recherche Médicale Unité 1052, Centre National de la Recherche Scientifique, Unité Mixte de Recherche 5286, Université de Lyon, Hospices Civils de Lyon, Hôpital Edouard Herriot, Anatomie Pathologique, 69437 Lyon, France † Edited by Albert de la Chapelle, Ohio State University Comprehensive Cancer Center, Columbus, OH, and approved December 7, 2012 (received for review July 19, 2012) The TrkC neurotrophin receptor belongs to the functional depen- bound by their respective trophic ligands. These receptors thus dence receptor family, members of which share the ability to induce create cellular states of dependence on their respective
    [Show full text]
  • Clinical Significance of UNC5B Expression in Colorectal Cancer
    INTERNATIONAL JOURNAL OF ONCOLOGY 40: 209-216, 2012 Clinical significance of UNC5B expression in colorectal cancer SatoSHI okAzAkI1, ToSHIAkI ISHIkawa1, SatoRU IIDA1, MEGUMI ISHIGURo1, HIRoToSHI koBAyASHI1, TETSURo HIGUCHI1, MASAyUkI ENoMoTo1, kAoRU MoGUSHI2, HIRoSHI MIzUSHIMA3, HIRoSHI TANAkA2, HIRoyUkI UetakE1 and kENICHI SUGIHARA1 Departments of 1Surgical oncology, 2Systems Biology and 3Medical omics Informatics Biology, Graduate School, Tokyo Medical and Dental University, 1-5-45, yushima, Bunkyo-ku, Tokyo, Japan Received June 23, 2011; Accepted August 2, 2011 DoI: 10.3892/ijo.2011.1201 Abstract. The purpose of this study was to find a methylation- Epigenetic alterations, such as aberrant DNA hypermethylation, related gene that could become a biomarker or therapeutic target are now recognized as one of the crucial mechanisms of tumor- in colorectal carcinoma (CRC). We screened candidate genes suppressor gene inactivation (2). Recent studies have shown the suspected to be silenced by DNA methylation using cDNA methylation of multiple genes that control apoptosis, cell cycle microarray analysis. To investigate the clinical significance of one regulation, or other cellular behaviors with advances in genome- candidate gene (UNC5B), we analyzed the correlation between wide methylation analysis technology (3,4). mRNA expression and clinicopathological features using clinical A number of genes, including hMLH1, MGMT, and p14ARF, tissue samples. Moreover, methylation specific PCR analysis was are known to be frequently methylated (5,6) in CRC tumor samples, performed to reveal whether the promoter region was methy- and some studies have suggested that there is a subgroup of CRC lated in CRC cell lines. We found 75 candidate genes that were that hypermethylates a high proportion of genes, termed CIMP potentially suppressed by DNA methylation in CRC.
    [Show full text]