The Role of Septin 5 in Exocytosis

Eric Zholumbetov

A thesis submitted in conformity with the requirements for the degree of Master of Science Department of Biochemistry University of Toronto

Eric Zholumbetov

Master of Science

Department of Biochemistry University of Toronto

2011

Abstract

Septins are an evolutionarily conserved family of proteins that have been implicated in a multitude of cellular processes. Septin 5 is mainly expressed in the nervous system and it has been linked to regulated secretion through its binding to the SNARE protein syntaxin 1.

However, the exact mechanism of septin 5 function in localized exocytosis remains unknown.

Over-expression of septin 5 is known to lead to lower levels of secretion in HIT-T15 cells.

Interestingly, in the current study, the knock-down of septin 5 also results in reduced levels of regulated secretion in PC12 cells, suggesting a more complex role of septin 5 that includes both negative and positive effects on exocytosis. Septin 5 knock-down data point to a possibility of septin 5 facilitating formation of a tether between the vesicles and their site of secretion.

Acknowledgments

I would like to express my deepest gratitude to my supervisor Dr. William Trimble who provided me with continuous support and motivation from the beginning to the end of my thesis work. The completion of this thesis would not have been possible without his insightful advice, guidance and direction as well as his valuable encouragement during the difficult patches of this work. Thank you very much for the opportunity to work in such a great environment with an amazing team of researchers. I would also like to thank the members of my committee Dr. David Bazett- Jones and Dr. Allen Volchuk. Thank you for your very helpful input and advice throughout the different stages of my work.

I am very grateful to have had the privilege of working with the past and present members of the Trimble lab. From the very interesting and stimulating scientific discussions to the indispensable advices on the experimental procedures to the random daily conversations, it has been truly a pleasure to be working with all of you. I am proud to be one of the "Trimblites". Thank you very much for all of your advice and support and thank you for creating such an awesome workplace environment.

I would also like to thank my fiancée Melissa Hanton for her support, understanding and confidence in me as well as for her help in editing this and my other written works during my graduate program. A special thank you goes out to all my friends outside of the lab for their moral support throughout these years. Finally, I would like to express my heartfelt gratitude to my parents Emil Zholumbetov and Margarita Tsyganchuk. Thank you very much for your continuous emotional and material support, for encouraging me to overcome whatever obstacles I am facing and for believing in me. I would not have been able to do this without you.

iii

Table of Contents

Abstract ...... ii Acknowledgments ...... iii Table of Contents ...... iv List of Figures ...... vi List of Abbreviations ...... vii

Chapter 1: Introduction ...... 1 1.1 The Septins ...... 1 1.1.1 Monomeric septin structure ...... 2 1.1.2 Septin GTPase activity ...... 3 1.1.3 Septin complexes ...... 3 1.1.4 Septin complex assembly into filaments ...... 4 1.1.5 Septin function ...... 5 1.1.6 Diseases related to septins ...... 6 1.2 The Borgs ...... 7 1.3 The exocyst complex...... 8 1.4 Septin 5...... 9 1.4.1 Mouse septin 5 knock-out studies ...... 11 1.5 The SNARE hypothesis of secretion...... 11 1.6 Large dense core vesicles and synaptic vesicles within neuroendocrine cells ...... 13 1.7 Expression of human growth hormone in PC12 cells ...... 14 1.8 ATP-evoked regulated secretion ...... 14 1.9 Total internal reflection fluorescence (TIRF) microscopy ...... 15 1.10 Possible roles of septin 5 in exocytosis ...... 16 1.11 Rationale and Hypothesis ...... 18

Chapter 2: Materials and Methods ...... 19 2.1 Antibodies ...... 19 2.2 Subcloning...... 19 2.2.1 Polymerase chain reaction ...... 19 2.2.2 Restriction enzyme digestion ...... 19 2.2.3 Ligation ...... 20 2.2.4 Competent cells ...... 20 2.2.5 Transformation ...... 20 2.2.6 DNA purification ...... 21 2.3 Plasmids ...... 21 2.3.1 hGH-mCherry ...... 21

2.3.2 Plasmids containing Borg Domain 3 (GFP3-BD3, eGFP-BD3, eGFP-BD3-LVL) ..... 22 2.3.3 Septin 5 knock-down plasmids ...... 22 iv

2.3.4 VAMP2-GFP ...... 23 2.3.5 TeTx-LC ...... 23 2.4 Cell culture ...... 23 2.5 DNA transfection ...... 23 2.6 Western blotting ...... 24 2.7 Immunostaining...... 24 2.8 Spinning disk confocal microscopy ...... 25 2.9 Total internal reflection fluorescence (TIRF) microscopy ...... 26 2.10 Human growth hormone (hGH) release Assay ...... 26 2.10.1 Cell plating and transfection ...... 26 2.10.2 Evoking secretion ...... 27 2.10.3 Measuring hGH release ...... 28 2.10.4 Data analysis ...... 28

Chapter 3: Results ...... 29 3.1 Reporter protein hGH-mCherry for regulated exocytosis assays ...... 29 3.1.1 Expression of hGH-mCherry in PC12 cells ...... 29 3.1.2 Suitability of hGH-mCherry reporter protein for regulated exocytosis assays ...... 32 3.2 Regulated exocytosis observed by TIRF microscopy ...... 34 3.2.1 Secretion of hGH-mCherry ...... 34 3.2.2 Secretion of vesicles tagged with VAMP2-GFP ...... 37 3.2.3 Active zones of secretion on the plasma membrane of PC12 cells ...... 40 3.3 Effects of overexpression of Borg Domain 3 on regulated secretion ...... 42 3.3.1 Overexpression of BD3 in PC12 cells ...... 42 3.3.2 The hGH release assay of PC12 cells following BD3 overexpression...... 44 3.4 Effects of septin 5 knock-down on regulated secretion ...... 48 3.4.1 Septin 5 knock-down ...... 48 3.4.2 The hGH release assay of PC12 cells following septin 5 knock-down ...... 52

Chapter 4: Discussion ...... 54 4.1 hGH-mCherry was not secreted in regulated manner ...... 54 4.2 Observing hGH-mCherry granules in TIRF microscopy ...... 56 4.3 Observing VAMP2-GFP vesicles in TIRF microscopy ...... 59 4.4 Overexpression of BD3 did not affect the function of septin 5 ...... 61 4.5 Knock-down of septin 5 results in decrease of regulated secretion ...... 63 4.6 Distinguishing between possible mechanisms explaining the role of septin 5 ...... 64

Chapter 5: Conclusion and Future Directions ...... 67

References ...... 70

List of Figures

Figure 1: The septins are grouped based on phylogeny ...... 2 Figure 2: Structure of septin monomer ...... 2 Figure 3: Crystal structure of the septin 2/6/7 complex ...... 4 Figure 4: The SNARE hypothesis of vesicle fusion ...... 13 Figure 5: TIRF microscopy ...... 16 Figure 6: Expression of hGH-mCherry in PC12 cells ...... 31 Figure 7: Comparison of secretion level of hGH protein and hGH-mCherry fusion protein ...... 33 Figure 8: Observing hGH-mCherry in PC12 cells using TIRF microscopy ...... 36 Figure 9: Observing vesicles tagged with VAMP2-GFP in TIRF microscopy ...... 40 Figure 10: Map of vesicle fusion sites on the plasma membrane ...... 41 Figure 11: Overexpression of Borg Domain 3 constructs in PC12 cells ...... 43 Figure 12: The effects of eGFP-BD3 overexpression on evoked regulated exocytosis in PC12 cells ...... 46

Figure 13: The effects of GFP3-BD3 overexpression on evoked regulated exocytosis in PC12 cells ...... 47 Figure 14: Knock-down of septin 5 in PC12 cells ...... 49 Figure 15: Knock-down of septin 5 in NIH 3T3 cells ...... 51 Figure 16: The effects of septin 5 knock-down on evoked regulated exocytosis in PC12 cells ... 53

List of Abbreviations

α-SNAP soluble NSF-attachment protein ARMS Ankyrin repeat-rich membrane spanning ATP Adenosine triphosphate BD3 Borg homology domain 3 Borg Binder of Rho GTPases Cdc42 Cell division cycle 42 Cdk5 Cyclin-dependent kinase 5 CFTR Cystic fibrosis transmembrane regulator CHO Chinese hamster ovary CRIB Cdc42, Rac interactive binding DMEM Dubelco’s modified eagle’s medium DNA Deoxyribonucleic acid dNTP deoxyribonucleotid triphosphate ELISA Enzyme-linked immunosorbent assay GFP Green fluorescent protein GLUT4 Glucose transporter type 4 GTP Guanosine triphosphate GTPase Guanosine triphosphate hydrolase hGH Human growth hormone LB Lysogeny broth LDCV Large dense core vesicle MAP4 Microtubule-associated protein NSF N-ethylmaleimide-sensitive factor PBS Phosphate Buffered Saline PBS-T Phosphate Buffered Saline solution with 0.05% Tween-20 PC12 Pheochromocytoma 12 cell line PCR Polymerase chain reaction RNA Ribonucleic acid SDS-PAGE Sodium dodecyl sulphate - polyacrylamide gel electrophoresis SEM Standard error of the mean SNAP-25 Synaptosome-associated protein (25 kDA) SNARE Soluble N-ethylmaleimide-sensitive factor activating protein receptor SV Synaptic vesicle t-SNARE Target membrane-associated SNARE TeTx-LC Light chain of tetanus toxin TIRF Total internal reflection fluorescence v-SNARE Vesicle membrane-associated SNARE VAMP2 Vesicle-associated membrane protein 2

vii

Chapter 1 Introduction

1.1 The Septins Septins are an evolutionarily conserved family of GTPase proteins that have been implicated in a wide array of cellular processes and some diseases. These proteins were first discovered in temperature-sensitive Saccharomyces cerevisae mutants with aberrant cytokinesis manifested by the inability of the bud to separate from the mother cell (Hartwell et al., 1971). Further studies showed that the yeast septins comprised the 10nm diameter filaments that form a ring at the mother-bud neck of the budding yeast (Byers et al., 1976; Kim et al., 1991; Ford et al., 1991). The septin family was found also to be involved in cytokinesis of animal cells (Sanders and Field, 1994) following the discovery of the peanut gene in Drosophila melanogaster, which is necessary for cytokinesis and is related to the yeast septin proteins (Neufeld et al., 1994). Subsequent research of the septins revealed their absence from plants and protozoa, but they were found to be ubiquitously expressed in animals and fungi (Kinoshita, 2003b). Although they were discovered in the context of cytokinesis, the septins are currently implicated in a multitude of normal (cell polarity, exocytosis) and pathological (malignancy) cellular processes.

There have been 14 mammalian septin genes discovered to date (Hall et al., 2005, Nakahira et al., 2010). Furthermore, many of the septin genes contain several splice variants. The septins can be subdivided into four groups based on phylogeny (Figure 1; Cao et al., 2007). The septin 2 group is comprised of septin 1, septin 2, septin 4, and septin 5. The septin 3 group is comprised of septin 3, septin 9, and septin 12. Finally, the septin 6 group is comprised of septin 6, septin 8, septin 10, septin 11, and septin 14. The septin 7 group consists only of septin 7 and septin 13. Although it has never been proven, it is assumed that members within each group are functionally redundant with each other (Kinoshita, 2003a).

Figure 1: The septins are grouped based on phylogeny. The members of the septin family are subdivided into four groups based on phylogeny. The members within each group are thought to be functionally redundant with each other.

1.1.1 Monomeric septin structure The individual septins have a conserved structure (Figure 2) due to very high sequence identity of the septin family. Directly adjacent to the variable N-terminal tail is a short polybasic sequence that has been found to be responsible for binding of septins to membrane phospholipids (Zhang et al., 1999). It is followed by the GTP-binding domain that spans most of the septin sequence. All septins with the exception of the septin 3 group also contain a coiled-coil region right before the variable C-terminal tail (Nakahira et al., 2010). The coiled-coil region has been previously implicated in yeast septins to be mediating interactions between septins and other proteins (Casamayor et al., 2003).

Figure 2: Structure of septin monomer. The septins have a conserved structure consisting of a polybasic sequence, a GTP-binding domain and N- and C-terminal tails. The coiled-coil structure is present on all septins with the exception of septin 3 group.

1.1.2 Septin GTPase activity The septin GTP-binding domain is highly conserved among all of the members of the septin family. Several consensus motifs of the GTPase superfamily that are responsible for the GTPase activity of the protein can be identified within the septin GTP-binding domain. Namely, septins contain G1, G3, and G4 regions (Kinoshita, 2003b). The G1 region (GX4GK[S/T] consensus sequence) is responsible for binding phosphates of GTP (Bourne et al., 1991). The G3 region 2+ (DX2G consensus sequence) interacts with the catalytic Mg ion (Bourne et al., 1991). The G4 region ([N/T][K/Q]XD consensus sequence) stabilizes the GTP-binding site through interaction with the G1 region and is additionally responsible for interaction with the guanine ring (Bourne 1991). The G2 and G5 regions are not found in septins (Kinoshita, 2003b). The rate of GTP hydrolysis of septin GTPases is similar to that of Ras GTPase superfamily (Huang et al., 2006). However, the role of GTPase activity on septin function remains unclear.

1.1.3 Septin complexes Septins are known to form heteromeric complexes that act as a subunit in further assembly into filaments. The first septin complex was purified from Drosophila melanogaster as a heterotrimer in a 2:2:2 stoichiometric ratio of septins Pnut, Sep2, Sep1 (Field et al., 1996). The mammalian equivalent of this complex, septin 2/6/7 complex, is the most studied mammalian septin complex (Joberty et al., 2001, Kinoshita et al., 2002). The crystal structure of the septin 2/6/7 complex has been solved (Figure 3), showing a hexameric subunit of 25nm length with septin monomers binding each other at the N-C interface where the coiled-coils are located and at the GTP-binding domain interface (Sirajuddin et al., 2007). A three-dimensional reconstitution of septin 3/5/7 complex purified from rat brain from data obtained by electron microscopy also showed a ~27nm-long hexameric complex (Lukoyanova et al., 2008). Interestingly, a septin filament that coimmunoprecipitates with the rat brain exocyst complex was shown to be composed of four septins (septins 2/5/6/7) but was also measured by electron microscopy to be 25nm in length (Hsu et al., 1998). Therefore, although multiple studies showed a hexameric subunit of ~25nm length, the septin complexes may not always be arranged in the 2:2:2 stoichiometric ratio. Furthermore, it appears that each septin within the complex may be substituted for another member of its respective septin group (Kinoshita, 2003a). Further research must be carried out to determine the mechanism of septin complex formation in terms of different expression patterns

4 of septins within specific tissues. Interestingly, it has been observed that knock-down of septin 7 alone causes decreased expression of other septins as well (Kinoshita et al., 2002). It has been suggested that septin 7 may be the essential “core” septin that is needed for the septin complex formation to occur (Kinoshita, 2003a).

Figure 3: Crystal structure of the septin 2/6/7 complex. The septin 2/6/7 complex is a hexameric subunit of 25nm length. The septin monomers bind each other at the N-C interface and at the GTP- binding domain (G) interface. The coiled-coils are not seen in this crystal structure and their position is denoted by the arrows. The figure was adapted and modified from Sirajuddin et al., 2007.

1.1.4 Septin complex assembly into filaments The septin complexes are able to further assemble into longer filaments. The yeast septins make up the filaments that localize to the mother-bud interface during cytokinesis of the budding yeast (Byers et al., 1976). The purified mammalian septin complex that coimmunoprecipitates with the rat brain exocyst complex was observed by electron microscopy to be assembled into filaments of various lengths in multiples of 25nm (Hsu et al., 1998). In vitro studies of the recombinant septin 2/6/7 complex showed assembly of the complex into long filaments that further formed coiled bundles (Kinoshita et al., 2002). The crystal structure of the septin 2/6/7 complex also showed a bend in the middle of the complex where septin 2 forms a homodimer at its N-C coiled-coil interface (Sirajuddin et al., 2007). This bend is very likely to contribute to the coiled structure of the in vitro long septin filaments. Septins are known to colocalize in non-mitotic

5 mammalian cells with the stress fibers made up of actin filaments (Xie et al., 1999). The disruption of actin filaments resulted in punctate distribution of septins (Xie et al., 1999). Time- lapse imaging of GFP-Septin 6 in NIH 3T3 cells after actin disruption by cytochalasin D showed linear septin filaments coiling up into tight rings, similar to those of septin 2/6/7 complex filament observed in vitro (Kinoshita et al., 2002). It appears that actin provides a template for septins to assemble into linear filaments, whereas septin filaments adopt a coiled structure in the absence of this template (Kinoshita et al., 2002).

1.1.5 Septin function The functional roles of each individual septin as well as the septin family as a whole have been linked to many cellular mechanisms. Localization of septins to the actin stress fibers has been suggested to play a role in stabilization of actin filaments. Depletion of septins in NIH 3T3 cells resulted in disruption of actin filaments (Kinoshita et al., 2002). However, the proposed interaction between septins and actin is not direct. An adaptor protein, such as nonmuscle myosin II (Joo et al., 2007), is suggested to be facilitating the interaction.

Very recently, members of our lab were able to determine the role of several individual septins in cytokinesis. Depletion of septin 9 resulted in HeLa cells being unable to undergo the midbody abscission step, whereas depletion of septins 2, 7, and 11 were found to affect only early stages of cytokinesis (Estey et al., 2010).

Both mammalian and yeast septins may act as scaffolds, recruiting various proteins to their site of interaction. The septins are known to be able to interact with the plasma membrane (Zhang et al., 1999). Typically, the mammalian septins are observed to be localized to the plasma membrane and to the actin stress fibers. These dispersed mammalian septin complex subunits and short filaments have been suggested to be playing a role of scaffolds within the cell (Kinoshita et al., 2006). One example of such a role involves the septin 2/6/7 complex and its interaction with the MAP4 protein (Kremer et al., 2005). MAP4 is a microtubule-associated protein that is responsible for stabilization of microtubules (Andersen, 2000). The septins bind to and prevent MAP4 from exerting its stabilizing effect on microtubules (Kremer et al., 2005). Another example is the interaction between nonmuscle myosin II and septin 2. The disruption of

6 this interaction during cytokinesis leads to regression of cleavage furrow and subsequent cell binucleation (Joo et al., 2007). It is suggested that septin 2 may act as a scaffold for nonmuscle myosin II during cytokinesis (Joo et al., 2007).

Aside from roles in scaffolding and cytokinesis, septins also have functions in cells that do not undergo mitosis. Septins 4 and 12 were found to be components of the annulus within mature spermatozoa (Kissel et al., 2005; Ihara et al., 2005; Steels et al., 2007). The annulus is a ring- shaped structure that acts as a diffusion barrier between the mitochondrial sheath and the sperm tail. Depletion of septin 4 resulted in a complete absence of the annulus and other structural defects, including proper removal of cytoplasm during sperm development and lack of sperm motility (Kissel et al., 2005; Ihara et al., 2005). Therefore, the function of septins is implicated in male infertility as well as cell motility. Septins function in mammalian neurons as well. The studies of hippocampal neurons revealed that septin 7 plays an important role in dendrite branching (Tada et al., 2007; Xie et al., 2007). Septin 7 was observed to localize to the base of dendritic protrusions, and depletion of septin 7 resulted in defective branching of dendrites (Tada et al., 2007; Xie et al., 2007).

The septins further extend their functionality into processes related to membrane traffic. Septins 2 and 11 are required for FcγR-mediated phagocytosis (Huang et al., 2008). Depletion of either of those septins in CHO-IIA or RAW264.7 cells resulted in impairment of phagocytosis (Huang et al., 2008). The studies showing septins coimmunoprecipitating with the exocyst complex (Hsu et al., 1998) and the overexpression of septin 5 leading to inhibited secretion (Beites et al., 1999) implicate a role for septins in exocytosis. The function of septins in regulated secretion is thoroughly discussed in the next section that provides comprehensive review of septin 5.

1.1.6 Diseases related to septins Septins are involved in a variety of human disorders (Peterson and Petty, 2010). As mentioned previously, septins 4 and 12 are components of the annulus of the spermatozoa (Kissel et al., 2005; Ihara et al., 2005; Steels et al., 2007). Microarray analysis of testicular tissue taken from infertile male patients revealed septin 12 to be one of the genes downregulated in infertile men (Lin et al., 2006).

Septins have also been implicated in the entry of infectious bacteria Listeria (Mostowy and Cossart, 2009). Recruitment of septins 2, 9, and 11 was observed at the site of Listeria infection (Mostowy et al., 2009). The septins also prevent cell-to-cell dissemination of Shigella infection and play a role in Shigella autophagy within the cell (Mostowy et al., 2010).

Several septins appear to be involved in tumorigenesis (Hall et al., 2004). The isoform 1 of septin 9 was found to be highly expressed in human breast cancer cells (Gonzalez et al., 2007). Septins 5, 6, 9, and 11 are also implicated in leukaemia. These septin genes form translocations with the MLL leukaemia-associated gene (Hall et al., 2004).

It appears that septins play a role in neurological disorders as well. The septin 9 gene is linked to the hereditary neuralgic amyotrophy (Kuhlenbäumer et al., 2005). Septins 1, 2, and 4 were found in neurofibrillary tangles and other structures associated with Alzheimer`s disease in post- mortem affected brain tissues (Kinoshita et al., 1998). Septin 5 has been linked to Parkinson`s disease through being a target of Parkin ubiquitin ligase (Zhang et al., 2000; Choi et al., 2003). Moreover, the function of septin 5 is linked to the velo-cardio-facial and DiGeorge syndromes that arise from the 22q11.2 chromosomal region deletion that contains the septin 5 gene sequence (McKie et al., 1997).

1.2 The Borgs The Borg family of proteins is known to control the cellular organization of mammalian septins (Joberty et al., 2001). These proteins are important to this study as they form the basis for the experiments described further in this thesis. The Borgs were identified from the yeast two-hybrid screen to be interacting with TC10 and Cdc42 Rho GTPases (Joberty et al., 1999). The Rho GTPase protein family is responsible for actin cytoskeleton formation and organization in addition to controlling a vast array of essential cellular functions including cell division, cell migration, cell polarity and vesicle traffic (Jaffe et al., 2005). Cdc42 is a well characterized member of the Rho family of GTPases. Cdc42 controls formation of filopodia and establishment of cell polarity (Heasman et al., 2008). TC10 member of the Rho family of GTPases has been characterized more recently. TC10 is necessary for trafficking of the insulin-stimulated GLUT4 to the plasma membrane (Chiang et al., 2001) and it is known to interact with the Exo70

8 component of the exocyst complex (Inoue et al., 2003). Furthermore, TC10 is involved in the traffic of the Cystic Fibrosis Transmembrane Regulator (CFTR) to the plasma membrane (Cheng et al., 2005).

There are five members of the Borg family and all of them contain the Cdc42, Rac interactive binding (CRIB) domain. However, Borg3 did not bind to TC10 and only interacted with Cdc42, unlike the other four Borg proteins that interacted with both TC10 and Cdc42 (Joberty et al., 1999). Overexpression of Borg1 or Borg3 in NIH 3T3 cells resulted in protrusive lamellipodia and some loss of stress fibers. Furthermore, the spreading of NIH 3T3 cells was delayed in cells that overexpressed Borg1 or Borg3 (Joberty et al., 1999).

All of the Borg proteins contain several conserved domains, among them are three Borg homology domains (Joberty et al., 1999). The Borg homogoly domain 3 (BD3) was found to be responsible for binding to septins (Joberty et al., 2001). Septin 7 and Borg 3 coimmunoprecipitate with each other and overexpression of Borg3 affects septin organization within the cell. Overexpression of GFP-Borg3 in MDCK cells resulted in aggregation of septin 7 into a single perinuclear spot in the area of high GFP-Borg3 concentration. Furthermore, overexpression of BD3 alone fused to a triple-GFP (GFP3-BD3) resulted in the same septin aggregation effect. Cdc42-GTP was found to bind to Borg3, inhibiting its interaction with septins (Joberty et al., 2001). The exact mechanism by which Borgs control septin organization is not known. However, there is some evidence suggesting that the interaction between Borgs and septins occurs through binding of BD3 at the coiled-coil interface of a septin heterodimer, particularly Septin 6/7 (Sheffield et al., 2003).

1.3 The exocyst complex The targeting of vesicles to their sites of fusion with the plasma membrane is believed to be carried out by the exocyst complex (He et al., 2009). This multimeric complex is composed of eight proteins and it has been identified in yeast (TerBush et al., 1995) and mammalian cells (Hsu et al., 1996). The exocyst complex is essential for secretion. Mutations of the members of the complex resulted in abolished exocytosis as observed through the accumulation of secretory vesicles in yeast (Novick et al., 1980). The exocyst complex was shown to be essential for

9 exocytosis in animal cells as well (Inoue et al., 2003). Furthermore, mutation of sec8 protein of the exocyst complex was found to be embryonic-lethal in mice (Friedrich et al., 1997). However, a mutation of sec5 member of the exocyst complex in Drosophila melanogaster did not impact synaptic vesicle fusion and the resulting neurotransmitter release while still inhibiting membrane addition (Murthy et al., 2003). Nevertheless, mammalian exocyst complex was found to coimmunoprecipitate with syntaxin I t-SNARE (Hsu et al., 1996) and the septins 2, 5, 6, and 7 (Hsu et al., 1998; Vega et al., 2003).

1.4 Septin 5 The septin 5 protein is the member of the septin 2 group. It is predominantly expressed in the brain (Honer et al., 1993; Beites et al., 1999) and it was shown to localize to the presynaptic terminals in mouse brain axons (Kinoshita et al., 2000). There are two isoforms of septin 5: the adult and the fetal isoforms that were named based on the developmental stage that they are predominantly expressed in (Toda et al., 2000, Asada et al., 2010). Immunofluorescent staining of septin 5 in differentiated PC12 cells showed localization of septin 5 to the plasma membrane (Beites et al., 1999). When septin 5 was overexpressed in HeLa cells (HeLa cells do not express septin 5 endogenously), it localized to the actin stress fibers, whereas dominant-negative septin 5 with a mutation in its GTP-binding domain exhibited diffuse cytosolic localization (Beites et al., 2001). However, both wild-type septin 5 and its dominant-negative mutant localized to the cleavage furrow during HeLa cell division (Beites et al., 2001).

As mentioned previously, the septin family has been implicated in membrane traffic processes. In particular, there is considerable evidence linking the function of septin 5 to regulated secretion. Furthermore, very recently septin 5 has been linked to a neutrophin receptor-mediated signaling pathway in neurons. The ankyrin repeat-rich membrane spanning (ARMS) protein was identified to be interacting with septin 5 through a yeast-two hybrid screen and coimmunoprecipitation analysis (Park et al., 2010). The ARMS protein is one of the targets of the neurotrophin receptors (Kong et al., 2001) which are involved in a variety of signaling pathways within neurons including neurotransmitter release, cell differentiation and neurite outgrowth (Poo, 2001; Chao, 2003).

Septin 5 has been implicated in exocytosis as it was found to interact with syntaxin 1, a t- SNARE protein that mediates vesicle docking and fusion to the plasma membrane, by coimmunoprecipitation (Beites et al., 1999). Furthermore, septin 5 was found to be present on the synaptic vesicles (Beites et al., 1999). In particular, septin 5 binds syntaxin 1 that is part of the cis-SNARE complex (Beites et al., 2005). This interaction is disrupted by the α-SNAP protein (Beites et al., 2005) that is responsible for dissociation of the cis-SNARE complex into its individual protein components (Duman et al., 2003). The fact that the cis-SNARE complex was found to be present on the synaptic vesicles and not exclusively on the plasma membrane (Otto et al., 1997) may explain the association of septin 5 with the synaptic vesicles (Beites et al., 1999). The presence of the cis-SNARE on the synaptic membrane may indicate a possible functional role of septin 5 in vesicle docking or fusion. The SNARE hypothesis of vesicle fusion and the key proteins that are involved in that process are discussed in more detail in the next section.

Further research into septin 5 function revealed that overexpression of wild-type septin 5 in HIT- T15 cells resulted in inhibition of regulated secretion, whereas overexpression of a GTPase mutant S58A septin 5 resulted in potentiation of exocytosis (Beites et al., 1999). The dominant- negative phenotype of S58A septin 5 was determined to be binding syntaxin more efficiently compared to wild-type septin 5 (Beites et al., 1999). Septin 5 was also found to be phosphorylated by cyclin-dependent kinase 5 (Cdk5), which has been implicated in membrane traffic and vesicle formation at the Golgi apparatus and is also known to interact with Cdc42 (Paglini et al., 2001). Cdk5 is activated by a regulatory subunit p35, which is only expressed in neurons, forming the Cdk5/p35 complex (Tsai et al., 1994). In mice, Cdk5/p35 phosphorylates Ser17 residue of septin 5 (Taniguchi et al., 2007). However, that residue is not present in the human septin 5. Human septin 5 was found to be phosphorylated at the Ser327 residue instead (Amin et al., 2008). Differences in secondary structure may account for a different phosphorylation site in the two isoforms. Nonetheless, phosphorylation of either site was reported to result in decreased interaction of septin 5 with syntaxin 1 (Taniguchi et al., 2007; Amin et al., 2008). A S327A mutation at the Cdk5/p35 phosphorylation site of human septin 5 results in a more efficient binding to syntaxin 1 (Amin et al., 2008). Furthermore, when this nonphosphorylatable S327A mutant of septin 5 is overexpressed in PC12 cells, it yields an increased

11 level of regulated secretion (Amin et al., 2008). Therefore, it appears that more efficient interaction of septin 5 with syntaxin 1 results in potentiation of exocytosis, whereas overexpression of the wild-type septin 5 inhibits secretion, and this interaction is likely to be controlled by the phosphorylation state of septin 5. These previous studies suggest a strong link between septin 5 and exocytosis. However, the exact mechanism of septin 5 function in regulated secretion is still unknown.

1.4.1 Mouse septin 5 knock-out studies Several septin 5 gene knock-out studies in mice have been performed. Although the gene knock- out studies revealed that septin 5 is not essential for normal neuronal development and neurotransmitter release (Peng et al., 2002; Tsang et al., 2008), the septin 5 knock-out resulted in impaired social interaction and rewarded goal approach in mice (Suzuki et al., 2009). Moreover, stimulation of platelets from septin 5-/- mice with subthreshold levels of collagen led to enhanced secretion of serotonin (Dent et al., 2002). A recent study of mouse calyx of Held linked septin 5 to switching from the microdomain coupling that is present in immature stage of development to the nanodomain coupling that is present in the mature stage (Yang et al., 2010). The immature calyx of Held synapse of septin 5-/- mice was observed to have altered function and morphology, resembling that of the mature synapse of wild-type septin 5+/+ mice (Yang et al., 2010).

1.5 The SNARE hypothesis of secretion Septin 5 binds syntaxin 1 (Beites et al., 1999), which is a t-SNARE protein that is involved in the process of vesicle fusion to the plasma membrane. The soluble N-ethylmaleimide-sensitive factor activating protein receptor (SNARE) proteins are the components of cellular machinery that is responsible for the process of docking and fusion between the vesicle and the plasma membrane as described by the SNARE hypothesis (Figure 4; Söllner et al., 1993a). The SNARE hypothesis subdivides the SNARE proteins into vesicle-associated SNAREs (v-SNAREs) and the target membrane-associated SNAREs (t-SNAREs). The two t-SNAREs synaptosome-associated protein (SNAP-25; Oyler et al., 1989) and syntaxin (Bennett et al., 1992) and one v-SNARE vesicle-associated membrane protein 2 (VAMP-2, also known as synaptobrevin-2; Trimble et al., 1988) make up the three essential components needed for the formation of the SNARE complex (Söllner et al., 1993a). These SNARE proteins are sensitive to proteolytic cleavage by clostridial

12 neurotoxins (Hayashi et al., 1994), such as botulinium and tetanus toxins (Jahn et al., 1994). When the v-SNARE comes into close proximity to the t-SNAREs, the proteins interact with each other to form a trans-SNARE complex (Weber et al., 1998) composed of the tight four-helical coiled-coil bundle for which an X-ray structure has been solved (Sutton et al., 1998). This trans- SNARE complex is resistant to SDS and cleavage by the clostridial neurotoxins (Hayashi et al., 1994). The formation of the trans-SNARE complex brings the membranes into close proximity and drives membrane fusion, creating the cis-SNARE complex (Duman et al., 2003). The cis- SNARE complex is then disassembled into individual SNARE proteins for the subsequent rounds of vesicle fusion by N-ethylmaleimide-sensitive factor (NSF) and soluble NSF- attachment protein (α-SNAP; Söllner et al., 1993b; Lin et al., 2000).

There exists another method of naming SNAREs. Each SNARE protein contains either conserved glutamine (q-SNARE) or arginine (r-SNARE) amino-acid that participates in the ionic interactions in the center of the four-helical coiled-coil once the stable SNARE complex is formed (Fasshauer et al., 1998). Typically, q-SNAREs correspond to t-SNAREs and r-SNAREs correspond to v-SNAREs. However, the v- and t-SNARE nomenclature is used for naming SNARE proteins throughout this thesis.

Syntaxin 1 and SNAP-25 proteins are usually found on the plasma (target) membrane. However, it is known that vesicle membranes also contain these t-SNAREs in significant amounts (Walch- Solimena et al., 1995). Interestingly, synaptic vesicles were found to contain the cis-SNARE complex on their membranes (Otto et al., 1997). The presence of cis-SNARE complex on the vesicles may be explained by a lack of cis-SNARE complex disassembly. However, their presence could also indicate a possible function in exocytosis. As discussed previously, septin 5 binds syntaxin 1 that is part of the cis-SNARE complex (Beites et al., 2005). The possible functional role of the interaction between septin 5 and the cis-SNARE complex is discussed further in this thesis.

Figure 4: The SNARE hypothesis of vesicle fusion. The interaction between the v-SNAREs (VAMP2) and the t-SNAREs (syntaxin, SNAP-25) forms a tight four-helical trans-SNARE complex that brings the membranes into close proximity to each other and drives membrane fusion, resulting in the cis-SNARE complex. The cis-SNARE complex is disassembled by the NSF and α-SNAP proteins.

1.6 Large dense core vesicles and synaptic vesicles within neuroendocrine cells The PC12 cell line used in this study is a neuroendocrine cell line (Greene et al., 1976). As such, these cells contain large dense-core vesicles (LDCVs; Tsuboi et al., 2007) in addition to the synaptic vesicles (SVs; Liu et al., 2005). The LDCVs are large 100 to 300nm in diameter granules that are responsible for release of concentrated proteins such as neuropeptides and neurohormones, whereas SVs are small 50nm diameter vesicles that secrete acetylcholine and other “classic” neurotransmitters (Park et al., 2009). The secretion of SVs is known to occur at the active zones (Zenisek et al., 2000; Schoch et al., 2006). However, there is some debate about the spatial regulation of LDCV exocytosis. One of the possibilities suggests spatial regulation of exocytosis away from the lipid rafts due to the fact that only 20% of the t-SNARE SNAP-25 is associated with the lipid rafts in PC12 cells (Salaün et al., 2005). Furthermore, Elks protein that associates with the active zone is known to play a role in insulin secretion in ß-pancreatic cells, which occurs through LDCV exocytosis (Ohara-Imaizumi et al., 2005). On the other hand, the results of total internal reflection fluorescence (TIRF) microscopy analysis of LDCV secretion showed LDCV exocytosis not to be spatially organized into the active zones (Steyer et al., 1997).

Further observations by TIRF microscopy will help to determine whether LDCVs are secreted at the active zones. It is one of the aims of this thesis to observe LDCV secretion by TIRF microscopy and assess whether it occurs at the active zones.

1.7 Expression of human growth hormone in PC12 cells The human growth hormone (hGH) is known to localize into LDCVs when overexpressed in bovine chromaffin and PC12 cells (Wick et al., 1993). Therefore, it makes a great candidate to be a reporter protein for the study of regulated secretion. Furthermore, hGH plasmid co-transfects with the plasmid of interest within the transfected cell greater than 90% of the time (Wick et al., 1993). This ensures that only the transfected population of the cells is assayed, even when using a cell line with a low transfection rate, such as PC12 cells. The use of hGH as a reporter protein for measurements of the rate of secretion in PC12 cells has been successfully applied and previously described by Dr. Sugita (Sugita, 2004).

1.8 ATP-evoked regulated secretion Typically, regulated secretion is evoked by treating PC12 cells with a buffer containing high K+ concentration (Sugita, 2004). However, it is possible to induce catecholamine release from PC12 cells by treating the cells with a buffer containing ATP. Signaling for hormone and neurotransmitter release can be carried out by extracellular nucleotides such as ATP (Ralevic et al., 1998). ATP has a very strong effect on membrane depolarization through its interaction with two P2 purinoreceptors. The interaction between ATP and the P2X receptors results in an influx of Ca2+ and other cations through the non-selective cation channels (Fasolato et al., 1990; Nakazawa et al., 1990; Choi et al., 1996). This influx of positive charge inside the cell causes membrane depolarization and activates L-type voltage-gated Ca2+ channels that further facilitate the influx of Ca2+ inside of the cell (Hur et al., 2001). Additionally, ATP interacts with P2Y receptors, resulting in activation of phospholipase C which, in turn, releases the intracellular Ca2+ stores inside of the cell (Murrin et al., 1992; Suh et al., 1995). The rapid availability of intracellular Ca2+ evokes regulated secretion. Although exocytosis cannot be stimulated by ATP in all secretable cell types, PC12 cells express both P2X and P2Y receptors as shown by the above-cited studies that were all done in PC12 cells.

1.9 Total internal reflection fluorescence (TIRF) microscopy In order to answer the questions studied in this thesis, a special type of microscopy called total internal reflection fluorescence (TIRF) microscopy was used in several experiments discussed further in this work. Total internal reflection of a laser beam occurs when the laser beam is directed at a ‘critical angle’ to the interface between media of high index of refraction and low index of refraction, such as a glass cover-slip and the attached cell. The critical angle is dictated -1 by the following equation: θ = sin (n2/n1), where n1 is the refractive index of solid and n2 is the refractive index of liquid. This total internal reflection creates an “evanescent wave” of electromagnetic energy that is capable of exciting fluorophores within a very short distance from the solid-to-liquid interface in the liquid medium. The intensity of the evanescent wave decreases exponentially with distance and it is further dependent on the angle of incidence (Axelrod et al., 1984). Typically, the evanescent wave can be expected to penetrate ~100nm into the cell (Axelrod, 2001). Although light-scattering organelles within the cell may induce further propagation of the evanescent wave (Steyer et al., 1999), the depth of the evanescent wave penetration can be adjusted by manually increasing the angle of incidence to a value greater than the critical angle.

The short penetration depth of the evanescent wave makes TIRF microscopy very well suited for observations of plasma membrane-associated cellular processes as it illuminates fluorophores located in close proximity to the plasma membrane without the background cytosolic fluorescence contributing to the image capture (Figure 5). As a result, TIRF microscopy is ideal for live observation of exocytosis. The process of exocytosis can be visualized by loading the secretory vesicles with fluorescent cargo in the form of chemical dyes (e.g. acridine orange) or fluorescent fusion proteins (e.g. neuropeptide Y-Venus) or, alternatively, fluorescently-tagging the secretory vesicle itself (e.g. VAMP2-GFP) (Ravier et al., 2008). The fusion events between the vesicle and the plasma membrane are known to have distinct visual characteristics. Previous studies described vesicle fusion to appear as a sudden sharp increase in fluorescence intensity followed by a “spreading cloud” of fluorescence diffusing outward from the site of the initial signal (Allersma et al., 2004; Ravier et al., 2008). Such observational characteristics visually differentiate between vesicle fusion and vesicles resting near the plasma membrane.

Figure 5: TIRF microscopy. When a laser beam is directed to the interface between the glass cover-slip and the attached cell at a critical angle θ that is sufficient for the total internal fluorescence reflection, an evanescent wave of electromagnetic energy is created. The evanescent wave penetrates ~100nm into the cell, exciting only the fluorophores located in close proximity to the plasma membrane. 1.10 Possible roles of septin 5 in exocytosis It is possible to infer the role of septin 5 in regulated secretion by measuring the regulated release of hGH and observing regulated secretion of vesicles at the plasma membrane by tools such as enzyme-linked immunosorbent assay (ELISA) and TIRF microscopy after depletion of septin 5 from the cell. Due to their filamentous nature, the septins are good candidates to be or to partially make up the unknown filaments previously observed at synaptic vesicles and the plasma membrane (Hirokawa et al., 1989). Since the septins are known to form complexes and further assemble into filaments (Field et al., 1996; Kinoshita, 2003a), septin 5 may be facilitating recruitment and assembly of septin filaments at the sites of its interaction with syntaxin 1. Therefore, septin 5 may be playing a role in localized exocytosis at the plasma membrane.

Since overexpression of septin 5 leads to inhibition of regulated secretion, septin 5 is likely to play a negative role and we predict that septin 5 knock-down will result in potentiation of

17 exocytosis. Although one can measure the change in the rate of secretion by ELISA through hGH release, this result may not be able to further elucidate the function of septin 5 in localized exocytosis. Therefore, TIRF microscopy must be used in order to differentiate between the possible mechanisms of action of septin 5 in regulated secretion at the plasma membrane. We predict that septin 5 may exert its effect on exocytosis in one of three possible ways.

The septin 5 protein may facilitate formation of a septin filament that acts as a tether between a vesicle and its site of fusion. Septins 2, 5, 6, and 7 have been identified to be interacting with the exocyst complex (Hsu et al., 1998; Vega et al., 2003). Furthermore, septins 2 and 5 and the exocyst complex are known to interact with syntaxin 1 (Hsu et al., 1996; Beites et al., 1999). The exocyst complex is believed to be responsible for targeting the vesicle to its site of secretion (He et al., 2009) whereas syntaxin 1 is involved in the process of vesicle fusion to the plasma membrane (Duman et al., 2003). Therefore, by interacting with both the exocyst complex and syntaxin 1, septin filaments may be tethering the secretory vesicles to their sites of secretion. The length of the septin complex that coimmunoprecipitates with the exocyst complex is 25nm (Hsu et al., 1998), which is very similar to the observed distance of ~20nm that synaptic vesicles are held at before undergoing exocytosis (Zenisek et al., 2000). If septin 5 exerts its negative effect on regulated secretion by facilitating formation of a tether that restricts the vesicle movement to its site of fusion, then with the use of TIRF microscopy we may observe vesicle fusion events at a higher number of locations on the plasma membrane following septin 5 knock-down, compared to the wild-type cells.

The septin filaments may also act as a restraint, blocking vesicle docking to the plasma membrane by cross-linking vesicles to each other and to the plasma membrane. Electron microscopy imaging of presynaptic terminals revealed synaptic vesicles to be linked to each other and the plasma membrane by unknown filaments (Hirokawa et al., 1989). These unknown filaments may be the septin filaments interacting with synaptic vesicles and the plasma membrane through the binding of septin 5 to the syntaxin 1 that is part of the cis-SNARE complex. If the septin filaments act as a restraint, holding the secretory vesicles near their site of fusion, then we expect that knock-down of septin 5 will make a large number of vesicles readily-

18 available for fusion to the plasma membrane. Thus, we may observe a higher rate of vesicle fusion events but localized to the same active zones of secretion after septin 5 knock-down.

Finally, septin 5 may facilitate formation of septin filaments at the plasma membrane, thereby creating a filamentous mesh that acts as a physical barrier to vesicle docking and indirectly promotes formation of the active zones of secretion. The septin filaments may associate with the plasma membrane through the interaction between septin 5 and syntaxin 1 that is part of the cis- SNARE complex in addition to the function of the polybasic region that is present on all septins and is known to facilitate the interaction between septins and the membrane phospholipids (Zhang et al., 1999). The absence of this physical barrier may facilitate the formation of the active zone of secretion. Therefore, if septin filaments act as the physical barrier to vesicle fusion, we expect septin 5 knock-down to result in a higher frequency and random location of vesicle fusion being observed by TIRF microscopy.

1.11 Rationale and Hypothesis There is a large body of evidence linking the function of septin 5 to the regulated exocytosis. Multiple studies identified that interaction of septin 5 with syntaxin 1 has an effect on the rate of regulated secretion. To this day, only the effects of overexpression or mutation of septin 5 on exocytosis have been explored within cells. Studies of septin 5 knock-out in mice did not reveal any defects in neurotransmitter release, but identified an effect on higher-order cognitive functions and a platelet secretion defect.

Currently, the exact mechanism of septin 5 function in exocytosis is unknown. To answer the question of what role septin 5 plays in regulated secretion a knock-down of septin 5 is applied to PC12 cells, which serve as a model system of neuronal secretion.

I hypothesize that septin 5 plays a negative role in modulating regulated exocytosis, acting as a facilitator of tether formation that anchors the secretory vesicle to its site of fusion on the plasma membrane. This work aims to determine the effect of septin 5 knock-down on regulated secretion and to differentiate between the possible mechanisms of septin 5 function in localized regulated exocytosis.

Chapter 2 Materials and Methods

2.1 Antibodies The mouse monoclonal SP18 α-Septin 5 antibody was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). The mouse monoclonal α-GAPDH antibody was purchased from Chemicon (Temecula, CA).

2.2 Subcloning 2.2.1 Polymerase chain reaction Template DNA was amplified by the polymerase chain reaction (PCR) using Tsg Plus DNA polymerase (Bio Basic, Markham, ON). The 5’ and 3’ primers have been manually designed for each DNA template and the oligonucleotides have been ordered from Sigma-Aldrich (Oakville, ON). The following components have been added to double-distilled water to a final reaction volume of 100µl: 1µl DNA template (diluted 1:100), 5µl of 10µM 5’ primer, 5µl of 10µM 3’ primer, 2µl of 10mM dNTP mixture (Bio Basic, Markham, ON), 10µl of 10x Tsg+ buffer, and 1µl of Tsg+ DNA polymerase. The denaturation step of PCR lasted 30 seconds at 95°C, followed by primer annealing step at 55°C for 30 seconds and primer extension step at 72°C for 1 minute. In total, 30 cycles of PCR were performed before the reaction was stopped. Afterwards, the amplified DNA was purified using EZ-10 Spin Column PCR Products Purification kit (Bio Basic, Markham, ON) according to manufacturer’s instructions.

2.2.2 Restriction enzyme digestion Vectors and PCR products were digested by restriction enzymes purchased from New England Biolabs (Ipswich, MA). Restriction enzyme digestions were carried out according to manufacturer’s instructions. Digested vectors were treated with Calf Intestinal Alkaline Phosphatase (New England Biolabs, Ipswich, MA) according to manufacturer’s instructions to prevent vector self re-ligation.

DNA fragments digested by restriction enzymes were dissolved in 6x DNA gel loading buffer (0.25% bromophenol blue, 0.25% xylene cyanol FF, 40% w/v sucrose in water) and loaded into Tris-acetate (TAE) agarose gel (0.04M Tris-acetate, 0.001M EDTA, 1-2% agarose). Following agarose gel electrophoresis, DNA fragments separated by size were extracted and purified from the gel using EZ-10 Spin Column DNA Gel Extraction kit (Bio Basic, Markham, ON) according to manufacturer’s instructions.

2.2.3 Ligation Vector to insert ratio of 1:6 was combined in a 20µl total ligation reaction volume. Ligation was carried out at room temperature for 30 minutes using T4 DNA Ligase (New England Biolabs) according to manufacturer’s instructions.

2.2.4 Competent cells E. coli DH5α cells were made competent by rubidium chloride method. A single colony was grown overnight in 5mL of LB. In the morning of the following day, the 5mL cell suspension was transferred to 100mL of fresh LB and grown to OD550 of 0.5. The bacterial cells were then chilled on ice and centrifuged in two 50mL Falcon tubes, forming a cell pellet. Old LB was removed and the pellets were resuspended in 15mL of ice cold TFB1 buffer (30mM potassium acetate, 50mM MnCl2, 100mM RbCl, 10mM CaCl2, 15% v/v glycerol, pH adjusted to 5.8 with dilute acetic acid) per each 50mL Falcon tube. The cell suspension was incubated on ice for 90 to 120 minutes. Afterwards, the cells were spun down once again. TFB1 buffer was removed and the pellets were very gently resuspended in 2mL of TFB2 buffer (10mM MOPS, 75mM CaCl2, 10mM RbCl, 15% v/v glycerol, pH adjusted to 7.0 with dilute NaOH) per each 50mL Falcon tube. Furthermore, 60µl of DMSO were added to each tube to increase transformation efficiency. The now competent E. coli DH5α cells were then frozen on dry ice in 200µl aliquots and stored in -80°C freezer.

2.2.5 Transformation Bacterial transformation was done by adding 100ng to 1µg of plasmid DNA to 100µl of competent cells, followed by 20 minute incubation on ice. The cells were then heat-shocked for 2 minutes at 42°C and further incubated on ice for 10 to 15 minutes. The bacteria were allowed to

21 recover in 1mL of LB without antibiotics at 37°C for 30 to 60 minutes. Afterwards, the cells were plated on LB-agar plates containing selective antibiotics and incubated overnight at 37°C.

2.2.6 DNA purification DNA purification was carried out through commercially available kits. For small scale plasmid purifications, EZ-10 Spin Column Plasmid DNA Minipreps kit (Bio Basic, Markham, ON) was used according to manufacturer’s instructions. For large-scale plasmid purifications, HiSpeed Plasmid Maxi kit (Qiagen, Mississauga, ON) was used according to manufacturer’s instructions. Purified plasmids were verified against mutations through DNA sequencing at an external commercial facility.

2.3 Plasmids 2.3.1 hGH-mCherry The hGH-mCherry plasmid was created by inserting full-length human grown hormone (hGH) DNA sequence into mCherry-N1 vector.

The mCherry-N1 vector was previously created in our lab by removing GFP sequence from pEGFP-N1 vector (Clonetech) and inserting DNA sequence coding for mCherry in its place while retaining the multiple cloning site.

The pXGH5 plasmid (Selden et al., 1986), containing full-length hGH sequence coupled to mouse metallothionein promoter, was used as a template for hGH in PCR. During PCR, EcoRI and BamHI cut sites were introduced at the 5’ and 3’ ends, respectively, using the following primers: hGH forward primer 5’ GCGCGGAATTCCAAGGCCCAACTCCCC 3’ and hGH reverse primer 5’ GCGCGGATCCGCGAAGCCACAGCTGCCC 3’. The amplified DNA fragment coding for full-length hGH was then inserted into mCherry-N1 vector.

2.3.2 Plasmids containing Borg Domain 3 (GFP3-BD3, eGFP-BD3, eGFP-BD3- LVL)

The GFP3-BD3 plasmid was a gift from Dr. Ian Macara (University of Virginia). This plasmid contains DNA sequence coding for three GFP proteins in a row fused to the N terminus of Borg Domain 3.

The eGFP-BD3 plasmid was created using pEGFP-C1 (Clonetech) vector with a modified multiple cloning site. This modified multiple cloning site of pEGFP-C1 allowed for insertion of a DNA fragment with XhoI cut site at 5’ end and EcoRI cut site at 3’ end. The DNA sequence of

Borg Domain 3 (BD3) of Borg 3 was amplified from Dr. Ian Macara’s GFP3-BD3 plasmid through PCR using primers coding for XhoI and EcoRI cut sites at 5’ and 3’ ends, respectively. These primers are BD3 forward primer 5’ GCGCGAATTCGTGCCTTCACCTGCGGAC CCGCTGC 3’ and BD3 reverse primer 5’ GCGCCTCGAGCTAGTCCATGACGCCTAAC ACCG 3’.

Similarly to eGFP-BD3, the eGFP-BD3-LVL plasmid was created using Dr. Ian Macara’s GFP3- BD3 plasmid as the template and pEGFP-C1 vector with modified multiple cloning site as the backbone. However, in order to introduce mutations of three amino acids Leucine, Valine, and Leucine (LVL) into three Alanine amino acids, a different reverse primer was used during PCR: 5’ GCGCCTCGAGTCAGTCCATGACGCCTGCCGCCGCGTCCGCCATAGAGGG 3’. In total, five nucleotides of this mutation primer were different from the original BD3 sequence and they are denoted by bold letters. The restriction enzyme cut sites (XhoI at 5’ and EcoRI at 3’ ends) remained the same.

2.3.3 Septin 5 knock-down plasmids The pSUP5-1 and pSUP5-1m2 plasmids were previously created in our lab by Chris Tsang. Both of these plasmids are based on the pSUPER (Oligoengine) backbone vector. The pSUP5-1 plasmid codes for short-hairpin interfering RNA molecule that suppresses expression of Septin 5 gene. The pSUP5-1m2 plasmid contains a scrambled DNA sequence resulting in a mutated short-hairpin interfering RNA molecule that is unable to suppress Septin 5 expression.

2.3.4 VAMP2-GFP The VAMP2-GFP plasmid has been previously created in our lab by Dr. Xiao-Rong Peng. Full length VAMP2 DNA sequence was inserted into the pEGFP-N1 (Clonetech) backbone vector.

2.3.5 TeTx-LC The TeTx-LC plasmid was previously created in our lab by Hong Xie. This plasmid codes for the light chain of tetanus toxin as part of the pCDNA3.1+ (Invitrogen) backbone vector.

2.4 Cell culture PC12 cells were cultured in Dubelco’s modified eagle’s medium (DMEM, BioWhittaker) containing 10% donor equine serum (HyClone) and 5% fetal bovine serum (PAA Laboratories) 2 2 in 75cm flask at 37°C in 5.0% CO2. The 75cm flasks were pre-coated with poly-D-lysine overnight at 37°C prior to culturing PC12 cells to facilitate cell adherence to plastic. Poly-D- lysine solution was prepared by dissolving 5mg of poly-D-lysine lyophilized powder (Sigma) in 100mM Borax Buffer, pH 8.5, comprised of sodium borate with boric acid powder to adjust the pH of the buffer. The flasks coated with poly-D-lysine were washed twice with phosphate buffered saline solution (BioWhittaker) before use. PC12 cells were split 1 to 2 times per week and fresh media was added to the cells every 2 to 3 days.

When PC12 cells were plated on the 6-well plate, poly-D-lysine was added to the plate at least 24 hours prior to seeding the cells. In cases where coverslips were used, the coverslips were double-coated with poly-D-lysine and collagen. Collagen solution was prepared by dissolving Type 1 collagen from rat tail (Sigma) in 0.2% acetic acid to a concentration of 50mg/L. NIH 3T3 cells were cultured DMEM (BioWhittaker) containing 10% fetal bovine serum (PAA 2 Laboratories) in 75cm flask at 37°C in 5.0% CO2. These cells were split at a ratio of 1:10 every 2 days.

2.5 DNA transfection The reagent of choice for transient DNA transfections was Lipofectamine 2000 (Invitrogen). The transfection procedure was carried out according to manufacturer’s instructions with a few

24 modifications. Cells were grown in a 6-well plate to 80-90% confluence prior to transfection. During the transfection procedure, DNA was mixed with 10µl of Lipofectamine 2000 in 500µl of serum free media pre-warmed to 37°C. The mixture was incubated for 20 minutes at room temperature before addition to the cells. Subsequently, media in the 6-well plate was replaced with 500µl of transfection mixture and the cells were left in the 37°C incubator for 4 hours. After the incubation, 2ml of fresh cell media was added to the cells following removal of the transfection mixture. The cells were then allowed to grow for the duration of time required by the specific assay.

2.6 Western blotting Cells were lysed using 2x SDS sample buffer containing 5% ß-mercaptoethanol. The lysates were boiled for 5 minutes and their protein concentration was determined using the Bradford assay (Bio-Rad). The protein from the lysates was loaded in equal amounts to be resolved by SDS-PAGE and subsequently transferred to a polyvinylidene fluoride (PVDF) membrane. Phosphate Buffered Saline solution with 0.05% Tween-20 (PBS-T) and 5% milk was used to block the PVDF membrane for 1 hour at room temperature or 4°C overnight. Following the blocking step, the membrane was rinsed once in PBS-T and incubated with primary antibody diluted with PBS-T for 1 hour at room temperature on a plate-shaker. The membrane was washed 3 times in PBS-T for 10 minutes each before the next 1 hour incubation with secondary antibodies diluted with PBS-T. After washing the membrane 3 more times in PBS-T for 10 minutes each, the western blot was developed photographically using enhanced chemiluminescence kit Western LightningTM Plus-ECL (PerkinElmer).

2.7 Immunostaining PC12 cells were grown on poly-D-lysine and collagen double-coated coverslips for at least 24 hours before the immunostaining procedure. The cells were then fixed for 5-10 minutes in 4% paraformaldehyde (Electron Microscopy Sciences) and then the fixation was deactivated for 10- 15 minutes using 25mM glycine and 25mM ammonium chloride. The cells were permeated for 15 minutes with 0.2% Triton X-100 (Sigma) and subsequently blocked with a solution of 0.1% saponin, 1% donor equine serum (HyClone), and 2% bovine serum albumin (Roche) for 30-60 minutes.

The cells fixed to the coverslips were incubated in the primary antibody diluted with PBS for 1 hour at room temperature. In cases where the amount of primary antibody was limited, 30-50µl of the diluted antibody was applied to a piece of paraffin wax. The coverslips were taken out of the 6-well plate and placed upside-down on the drop of the antibody on the paraffin wax so that the side of the coveslip with the fixed cells is in full contact with the antibody.

After 1 hour incubation, the coverslips were placed back into the 6-well plate and washed with PBS 5 times for 5 minutes. After the secondary antibody diluted with PBS was added to the coverslips, the 6-well plate was wrapped in aluminum foil and placed on a plate shaker for an hour to ensure even distribution of the secondary antibody over the coverslips.

In cases where it was needed to visualize the cell nucleus, a diluted solution of Hoechst stain was added to the coverslips for 1 – 2 minutes following removal of the secondary antibody. Once again, the coverslips were washed 5 times for 5 minutes with PBS and then mounted to the glass slides with Dako fluorescent mounting medium (Dako North America) reagent according to the manufacturer’s instructions. To ensure proper seal between the glass slides and the coverslips, the samples were left overnight prior to use on the microscope.

2.8 Spinning disk confocal microscopy Immunostained slides were observed under Leica DM IRE2 inverted fluorescence microscope (Leica Microsystems, Germany) with Quorum spinning-disk confocal scan head (Quorum Technologies, Guelph, ON). Leica HCX PL APO objective (63x magnification, 1.40 numerical aperture; Leica Microsystems, Germany) along with Hamamatsu Back-Thinned EM-CCD camera (Hamamatsu City, Japan) were used to capture images. The microscope was equipped with Improvision Piezo Focus Drive (Perkin Elmer) and 4 separate diode-pumped solid state laser lines (Spectral Applied Research) with the following wavelengths: 405nm, 491nm, 561nm, and 638nm. Volocity software (Perkin Elmer) was used to control the microscope and to compile and analyze single images as well as 3D stacks. The 405nm laser was used to excite fluorescence of Hoechst-stained cellular nuclei. GFP and mCherry fluorescence was visualized through excitation by the 491nm and 561nm lasers, respectively. The 638nm laser was used to excite fluorescence of far red cy5 antibody-conjugated fluorescent dye.

2.9 Total internal reflection fluorescence (TIRF) microscopy PC12 cells were plated on poly-D-lysine and collagen double coated 25mm coverslips in a 6- well plate 24 hours prior to the transfection procedure. Transfection was carried out as described previously in this section. Total amount of DNA used per sample was 2 µg of the reporter plasmid (VAMP2-GFP or hGH-mCherry). After the 4 hour incubation in the transfection mixture, the cells were grown in the 37°C incubator for 48 to 72 hours.

Zeiss Axiovert 200 inverted fluorescence microscope (Carl Zeiss MicroImaging, Germany) with Hamamatsu Back-Thinned EM-CCD camera (Hamamatsu City, Japan) and Zeiss α Plan- FLUAR objective (100x magnification, 1.45 numerical aperture; Carl Zeiss MicroImaging, Germany) were used to image the cells in TIRF. Two separate diode pumped solid-state laser lines (Spectral Applied Research) were linked to the TIRF slider on the microscope. The wavelengths of the lasers were 488nm and 561nm. Volocity software (Perkin Elmer) was used to control the microscope and to acquire and analyze TIRF movies. TIRF microscopy was performed only on live cells. Stage-top 37°C incubator was used to maintain the temperature of the cells during observations under the microscope. During the transfer of coverslips to the stage- top incubator, cell media was replaced with PBS.

Movies of exocytotic events were captured in the following way: the cell was imaged for 60 seconds before addition of ATP to a final concentration of 300µM directly into PBS in the general area of the imaged cell, followed by continuous image capture for an additional 8 to 10 minutes, depending on the fluorescence intensity. The resulting movie was a collection of images captured at about 8 frames per second for a total time of 9 to 11 minutes. GFP fluorescence was visualized through excitation by 488nm laser, whereas mCherry fluorescence was visualized through excitation by 561nm laser.

2.10 Human growth hormone (hGH) release Assay 2.10.1 Cell plating and transfection The cells were counted beforehand and plated 24 hours prior to transfection at 2.5x106 cells per one well of the 6-well plate double-coated with poly-D-lysine and collagen. The overall

27 transfection procedure of PC12 cells for the hGH release assay was carried out as described previously in this section. On the day of the transfection, cell confluency would reach 80-90%. The mixture of 10µl of Lipofectamine 2000 and DNA in 500µl of serum free DMEM that has been pre-warmed to 37°C was incubated for 20 minutes at room temperature and then applied to each well of the 6-well plate. The total amount of transfected DNA used for this assay was 2.0µg divided in the following way: 0.8µg of plasmid expressing hGH and 1.2µg of plasmid expressing protein or knock-down RNA sequence of interest. The cells were incubated in the Lipofectamine/DNA transfection mixture for 4 hours in the 37°C incubator. Afterwards, the transfection mixture was removed and 2ml of fresh DMEM containing serum was added to each well. The cells in the 6-well plate were allowed to grow for 48 hours in the 37°C incubator.

Following the two-day incubation, the cells were washed and fed with fresh DMEM. The cells were then harvested from the 6-well plate by a cell scraper and re-plated on the 12-well plate. Thereby, each well of the 6-well plate was split into two wells of the 12-well plate. This was done to facilitate measurements of both basal constitutive release of hGH and regulated Ca2+- dependent evoked release of hGH from the same population of cells of a particular sample. The 12-well plate has been double-coated with poly-D-lysine and collagen prior to its use just like the 6-well plate. The cells now plated on the 12-well plate were incubated for 24 more hours before carrying out the assay. In total, the cells have been incubated for 72 hours from the time of transfection to the start of the assay.

2.10.2 Evoking secretion To prepare the cells for hGH release assay, each well of the 12-well plate was washed 3 times for about 1 minute with PBS at room temperature. Meanwhile, buffers that are applied to the cells for hGH release have been pre-warmed to 37°C. For basal release of hGH, a modified Krebs

Buffer was used (145mM NaCl. 20mM HEPES pH 7.4, 5mM KCl, 1.3mM MgCl2, 1.2mM

NaH2PO4 pH 8.0, 10mM glucose, 3mM CaCl2). Whereas in order to evoke regulated exocytosis, the modified Krebs Buffer was supplemented with 300µM ATP.

Once the cells have been washed and the buffers warmed up to 37°C, 500µl of either Krebs Buffer or Krebs Buffer with ATP was added to the corresponding well of each sample in the 12-

28 well plate. The plate was then incubated for 10 minutes in the 37°C incubator. After the incubation, the plate was quickly put on ice for 15 minutes in order to effectively stop hGH release in all of the samples at once.

2.10.3 Measuring hGH release The supernatant from each well was transferred to pre-chilled 1.5mL microfuge tubes and centrifuged at 2000 x g for 3 minutes at 4°C to pellet cells that dissociated from the well during supernatant transfer. This supernatant contained hGH secreted from the cells (basal or evoked secreted hGH). Following centrifugation, an aliquot of the supernatant of each sample was transferred to the wells of an ELISA plate and the rest was discarded while retaining the microfuge tubes.

In the meantime, the cells remaining in the wells of the 12-well plate were lysed with 1.5mL of 0.1% Triton X-100 in PBS. These lysates contained remaining hGH that was not secreted but stored inside of the cells (cellular hGH). The lysate from each well was transferred to the retained microfuge tube that contained secreted hGH supernatant from that specific well. This was done to lyse the remaining cells in the pellet left over from secreted hGH supernatant centrifugation. Each microfuge tube was then pulsed on a vortex and centrifuged at 16000 x g for 5 minutes at room temperature to pellet cell debris. Following centrifugation, an aliquot of the lysate of each sample was transferred to the wells of an ELISA plate. The amount of secreted hGH and cellular hGH was measured by hGH ELISA assay kit (Roche). The ELISA assay was carried out according to manufacturer’s instructions.

2.10.4 Data analysis For data analysis purposes, hGH release was quantified as a % of total, calculated by dividing concentration of secreted hGH by total hGH concentration (secreted hGH + cellular hGH) and multiplying by 100. Furthermore, percentage of basal hGH release was subtracted from percentage of evoked hGH release in order to analyze and compare only the regulated portion of hGH release across different samples. Statistical data analysis was performed using Student’s t- test and final results are shown as mean ± SEM.

Chapter 3 Results

3.1 Reporter protein hGH-mCherry for regulated exocytosis assays Septin 5 has been implicated in regulated secretion, but the mechanism of its action is unknown. The results from the calyx of Held synapse suggest that septin 5 may coordinate the spatio- temporal regulation of exocytosis (Yang et al., 2010). In order to test this hypothesis in a model system, it would be necessary to use a reporter of secretion which could be assessed both quantitatively and visually.

3.1.1 Expression of hGH-mCherry in PC12 cells The best secretion reporter to date involves the transfection of the hGH reporter protein which can be detected by a commercial ELISA kit. Unfortunately, this kit is very expensive and hGH cannot be easily visualized by microscopy. In order to develop an assay in which we could combine visualization of exocytosis with quantitative secretion capability, we set out to develop a fluorescent version of hGH. Using a fluorimeter, we would measure the amount of a fluorescent protein secreted into the media by PC12 cells following stimulation of exocytosis. The fluorimeter-based assay would work on the same principles as the ELISA-based assay (hGH release assay described in Chapter 2), but it would forgo long incubation times required by ELISA. Furthermore, the same secretable fluorescent protein would also be used as a reporter molecule to visualize individual exocytosis events for the subsequent experiments involving TIRF microscopy.

Since most of the plasmids that would be used for co-transfection with the reporter molecule express GFP as part of their sequence, mCherry fluorescent protein was chosen for the fluorimeter-based assay as the most suitable fluorophore. The excitation and emission wavelengths of GFP are 488nm and 507nm, respectively (Cormack et al., 1996), whereas the excitation and emission wavelengths of mCherry are 587nm and 610nm, respectively (Shu et al., 2006). The spectra of both fluorophores are far apart enough not to cause fluorescence bleed- through.

In order to target mCherry to the LCDVs where it would be secreted through regulated exocytosis, hGH was fused to the fluorescent protein, creating the hGH-mCherry plasmid as described previously in Chapter 2. The mCherry fluorescent protein was fused to the C terminus of hGH because the 26 amino acid signal sequence that targets hGH to the regulated exocytosis pathway is located at the N terminus of hGH (Tompkins et al., 2002).

The hGH protein was chosen for fusion with mCherry for several reasons. The secretion of hGH from PC12 cells has been well characterized in the literature (Sugita, 2004). HGH is known to localize to LCDVs along with other catecholamines endogenous to PC12 cells (Wick et al., 1993). The rate of co-transfection of hGH with another plasmid is above 90% even for cells with a very low transfection rate (Wick et al., 1993), such as PC12 cells. Also, a method of measuring secretion of hGH-EGFP fusion protein by a fluorimeter has been previously used to study exocytosis of insulin-secreting cells (Tompkins et al., 2002).

The hGH-mCherry fusion protein was aimed to be a universal reporter molecule for three different methods of assaying regulated exocytosis. The fluorescent properties of the protein make it suitable to be used in the fluorimeter-based assay of secretion levels as well as for visualization of secretory events with TIRF microscopy. Since the protein contains hGH, it can also be used in the ELISA-based hGH release assay, providing comparison and validation of the fluorimeter-based assay.

After the hGH-mCherry plasmid was created, its expression was tested in PC12 cells. The hGH- mCherry protein was observed to localize into granules (Figure 6), presumably organized into the LDCVs. We attempted to observe whether septin 5 is likely to interact with the hGH- mCherry granules. However, staining for septin 5 revealed little to no colocalization between septin 5 and hGH-mCherry.

Figure 6: Expression of hGH-mCherry in PC12 cells. The hGH-mCherry construct has been overexpressed in PC12 cells. The image captured with a confocal spinning disk microscope shows an extended focus of granules containing hGH-mCherry (red) and the endogenous expression of septin 5 (green). The endogenous expression of septin 5 was detected by immunofluorescence. The nuclei of the cells were stained with the Hoechst stain. The panel showing merged fluorescence of hGH-mCherry and septin 5 shows very limited colocalization. The scale bar indicates 8.00µm.

3.1.2 Suitability of hGH-mCherry reporter protein for regulated exocytosis assays As soon as proper expression of hGH-mCherry was verified, its suitability for measurement of levels of secretion in PC12 cells in comparison to hGH plasmid was tested by the ELISA-based hGH release assay. Both plasmids were co-transfected along with either an empty pCDNA3.1+ vector or a plasmid expressing tetanus toxin light chain. Tetanus toxin light chain was used as a positive control since it is known that it inhibits Ca2+-dependent regulated exocytosis (Jahn et al., 1994).

After carrying out ELISA-based hGH-release assay, the PC12 cells expressing the hGH reporter protein and the tetanus toxin light chain exhibited more than 60% reduction of the regulated secretion levels compared to the cells expressing the hGH reporter plasmid and the empty vector. This amount of reduction of regulated secretion levels is typical when the cells express the tetanus toxin light chain and it has been previously reported in the literature (Sugita, 2004). However, the levels of secretion obtained from hGH-mCherry co-transfected with an empty vector were shown to be reduced by almost 56% compared to the levels obtained from hGH co- transfected with an empty vector (Figure 7). The secretion levels of hGH-mCherry reporter protein were observed to be very similar and not statistically different in both cases of co- transfection with an empty vector (44.17% ± 3.142% SEM of control) and with the vector expressing tetanus toxin light chain (39.53% ± 3.549% SEM of control). Furthermore, the secretion levels of hGH-mCherry did not vary significantly from hGH co-transfected with the vector expressing tetanus toxin light chain (38.68% ± 4.900% SEM of control).

The ELISA-based hGH release assay showed that regulated secretion of hGH-mCherry is significantly impaired compared to secretion of hGH. The degree of impairment is very similar to what was observed for cells expressing the light chain of tetanus toxin. These results show that hGH-mCherry is not a suitable reporter protein for use in the secretion assays of regulated exocytosis.

Figure 7: Comparison of secretion level of hGH protein and hGH-mCherry fusion protein. The two reporter plasmids expressing hGH and hGH-mCherry were each co-transfected in PC12 cells with either an empty vector pCDNA3.1+ or TeTx-LC plasmid expressing the light chain of tetanus toxin. Following the hGH release assay, the levels of regulated secretion were quantified as described in Chapter 2 and normalized to the levels of hGH/pCDNA3.1+ empty vector control (100%). The secretion levels of hGH- mCherry reporter protein co-transfected with an empty vector were reduced by ~56% compared to the secretion levels of hGH/empty vector control and were very similar to the secretion levels of both reporter proteins co-transfected with the plasmid expressing tetanus toxin light chain. Data is shown as mean ± SEM (n = 4). The asterisks denote statistically significant differences from the control value (p < 0.05) as determined by Student’s t-test.

3.2 Regulated exocytosis observed by TIRF microscopy 3.2.1 Secretion of hGH-mCherry Although hGH-mCherry was shown to be unsuitable for measurement of levels of regulated secretion due to its impaired release from PC12 cells, there remained a possibility that it could be used for observation of localized secretion events on the cell membrane by TIRF microscopy. Low levels of hGH-mCherry secretion were detected following stimulation of regulated exocytosis pathway, but at the single cell level this may still be sufficient to monitor exocytosis. In particular, since septin 5 may regulate the location of secretion events by tethering vesicles to the sites of secretion or by forming a physical barrier at the cell membrane, it may still be possible to visualize differences in the location of events.

Typically, a secretion event observed by TIRF microscopy is characterized by a sudden sharp increase in fluorescence intensity of a vesicle right before the rapid dissipation of the fluorescence of that vesicle (Ravier et al., 2008). The fusion between the fluorescently-tagged vesicle and the plasma membrane is seen as a small explosion or a “puff” of fluorescence. Other authors described it as a change from a dot into a diffuse ‘spreading cloud’ (Allersma et al., 2004). Such characteristics mark the difference between the secretion event of a vesicle fusing to the plasma membrane and ordinary vesicle traffic near the membrane.

Several attempts were made to observe secretion of hGH-mCherry from PC12 cells by TIRF microscopy. Following stimulation of regulated exocytosis by addition of ATP to the cell media, granules containing hGH-mCherry were observed to have increased movement 3 – 4 minutes after the cell stimulation by ATP. More granules became visible as they moved closer towards the plasma membrane (Figure 8A) and the speed of lateral movement of the granules was increased. However, no typical secretion events that would be seen as small explosions or dissipation of hGH-mCherry fluorescence were observed. Frequently, the fluorescence of a granule containing hGH-mCherry would reach a very strong intensity, but the increase would be relatively gradual, mostly taking 2 - 3 seconds (Figure 8B). The strong fluorescence intensity would persist for more than 30 seconds for some granules. The decrease of granule fluorescence would once again be gradual in most cases with the fluorescence signal of the granule decreasing in size, as opposed to dissipating as a ‘spreading cloud’. Such characteristics are not typically

35 associated with a vesicle fusion event and conform more to a description of a vesicle moving towards the plasma membrane and then regressing back.

Since no secretion events could be observed in PC12 cells expressing hGH-mCherry, the hGH- mCherry fusion protein cannot be used to study localized exocytosis. It is imperative to be able to observe secretion events in order to identify vesicle fusion sites to further analyze the effects of Septin 5 knock-down on localized secretion.

Figure 8: Observing hGH-mCherry in PC12 cells using TIRF microscopy. The hGH-mCherry construct has been overexpressed in PC12 cells. The cell was imaged in TIRF microscopy for 9 minutes. ATP was added to the media in the general area of the cell being imaged at 1:00 minute timepoint after the start of movie capture. The scale bar represents 7.00µm. A) The individual frames of the movie showing behaviour of hGH-mCherry in PC12 cells during stimulation by ATP were selected at an interval of 30 seconds. The number of granules containing hGH-mCherry has increased during the course of the movie as the granules moved closer towards the plasma membrane. The arrows track one of several hGH- mCherry granules that appeared during the time course of the movie. B) A single granule containing hGH-mCherry has been isolated, showing the course of the increase of its fluorescence intensity, the persistence of the strong fluorescence signal, as well as the subsequent decrease of its fluorescence intensity. The arrows denote the granule of interest. The behaviour of this granule does not conform to the established characteristics of vesicle fusion. Instead, the granule is seen approaching the plasma membrane and regressing back after 30 seconds.

3.2.2 Secretion of vesicles tagged with VAMP2-GFP In order to observe vesicle fusion at the plasma membrane, the vesicles have to be fluorescently tagged. Aside from using fluorescent cargo, as was the case with hGH-mCherry, it is possible to fluorescently label vesicle-associated membrane proteins. VAMP2 is a good candidate since it is one of the SNARE proteins present on the synaptic vesicles. It is endogenously expressed in nerve terminals and it participates in vesicle fusion (Trimble et al., 1988; Söllner et al., 1993a). Therefore, VAMP2 fused to GFP was overexpressed in PC12 cells to observe vesicle fusion events.

After focusing on the cell membrane in TIRF microscopy, the regulated secretion of the cell was stimulated by adding ATP into the media. The cells were imaged for 60 seconds prior to stimulation of exocytosis. During that time, it was common to observe vesicle fusion events. However, about 2 – 3 minutes after addition of ATP to the cell media, the incidence of vesicle fusion events was observed to increase dramatically (Figure 9A). Furthermore, the fluorescence of plasma membrane was observed to gradually increase in intensity over the course of the imaging session. The vesicles tagged with VAMP2-GFP were observed to undergo a sudden sharp increase in fluorescence intensity followed by rapid dissipation (Figure 9B) just as described previously for typical characteristics of a secretion event observed by TIRF microscopy (Allersma et al., 2004; Ravier et al., 2008). These explosions of VAMP2-GFP fluorescence marked the sites of vesicle fusion to the plasma membrane. Interestingly, addition of ATP to the media had an initial quenching effect on VAMP2-GFP fluorescence which was quickly overcome through increased traffic of VAMP2-GFP-tagged vesicles towards the plasma membrane due to stimulated exocytosis.

VAMP2-GFP proved to be a useful construct for observation of localized secretion. The fusion of vesicles containing VAMP2-GFP with the plasma membrane was clearly observed in TIRF microscopy as a localized explosion of fluorescence which corresponds to the previously described characteristic of a secretion event (Allersma et al., 2004; Ravier et al., 2008). The effects of Septin 5 knock-down on localized secretion can now be identified through the observation of the overall pattern of secretion sites on the plasma membrane as marked by VAMP2-GFP.

Figure 9: Observing vesicles tagged with VAMP2-GFP in TIRF microscopy. The VAMP2-GFP construct was transfected into PC12 cells. The cell was imaged in TIRF microscopy. ATP was added to the media 1:00 minute after the start of movie capture to stimulate regulated exocytosis. A) Stimulated regulated exocytosis of vesicles tagged with VAMP2-GFP. The movie was divided into frames at an interval of 30 seconds. Addition of ATP at 1:00 minute timepoint had a slight quenching effect on the fluorescence of VAMP2-GFP, but the fluorescence of plasma membrane gradually increased in intensity over the course of the imaging session. The arrows denote various vesicles containing VAMP2-GFP that appeared during the time course of the move. The scale bar represents 8.00µm. B) A vesicle tagged with VAMP2-GFP undergoing fusion to the plasma membrane. An arrow denotes the vesicle of interest that is enlarged and shown in the low right corner of each frame. The vesicle is seen to undergo a sudden sharp increase in fluorescence intensity followed by rapid dissipation and diffusion into the plasma membrane. The duration of vesicle appearance and the subsequent fusion to the plasma membrane is slightly longer than 1 second. The scale bar represents 3.90µm.

3.2.3 Active zones of secretion on the plasma membrane of PC12 cells The exocytosis of synaptic vesicles is known to occur at specific sites on the plasma membrane, termed the “active zones” of secretion (Schoch et al., 2006). Synaptic vesicles undergo fusion to the plasma membrane only in these active zones. Since septin 5 may play a role in the spatial as well as temporal regulation of vesicle fusion to the plasma membrane, observing the locations of active zones of secretion and the frequency of secretion events at the active zones before and after septin 5 knock-down will help elucidate the function of septin 5 in localized exocytosis. Therefore, the active zones of secretion have to be identified on the plasma membrane of wild- type PC12 cells.

To determine if exocytosis in PC12 cells occurs at active zones, multiple movies of evoked regulated exocytosis of vesicles tagged with VAMP2-GFP were analyzed. Vesicle fusion events were manually identified according to the previously described characteristic of a localized fluorescence explosion at the plasma membrane. All of the vesicle fusion events were manually marked on the cell using Volocity software during the playback of the movie, creating a map of the locations of sites of secretion. This map was then overlaid on top of a static image of the cell (Figure 10).

The locations of the sites of vesicle fusion to the plasma membrane were expected to identify the active zones of secretion. The clustering of secretion sites in a specific area on the plasma membrane would indicate the location of the active zone. However, the vesicle fusion events

41 were observed to occur at random locations on the plasma membrane of PC12 cells. Two or more vesicle fusion events were rarely seen to be near each other. This observation indicates that regulated exocytosis may not be organized into active zones in PC12 cells.

Without the vesicle fusion sites being organized into active zones of secretion, it is impossible to identify the effects of septin 5 knock-down on spatial regulation of vesicle fusion to the plasma membrane. Since it is not feasible to discern a clear pattern of secretion sites on the plasma membrane of PC12 cells, TIRF microscopy cannot be used further to determine the role of septin 5 in regulated exocytosis.

Figure 10: Map of vesicle fusion sites on the plasma membrane. The PC12 cells have been transfected with VAMP2-GFP and imaged with TIRF microscopy after stimulation of the regulated exocytosis. Each vesicle fusion event seen during the 12 minute imaging session was manually marked using Volocity software, creating a map of secretion sites. Although the cells were stimulated with ATP 2 minutes after the start of the movie capture, no vesicle fusion events were observed before the stimulation. The map of the secretion sites was overlaid on top of a DIC image of the cell taken after imaging by TIRF microscopy. The red dots denote the sites of secretion. The secretion sites are seen to be scattered randomly across the plasma membrane without any clear organization into the active zones. The scale bar represents 3.90µm.

3.3 Effects of overexpression of Borg Domain 3 on regulated secretion 3.3.1 Overexpression of BD3 in PC12 cells The cellular organization of mammalian septins is known to be controlled by the Borg proteins (Joberty et al., 2001). Specifically, the Borgs interact with septins through the Borg Domain 3 (BD3). Previous studies have shown that overexpression of BD3 of Borg 3 fused to a triple GFP

(GFP3-BD3) led to a disruption of septin 7 organization in MDCK cells, causing aggregation of septin 7 (Joberty et al., 2001). The aggregation occurred in the area of high GFP3-BD3 concentration, resulting mostly in a single perinuclear spot. When the three conserved amino acid residues (Leucine, Valine, Leucine) of BD3 have been mutated into three Alanine residues (BD3-LVL mutant), the interaction with the septin 7 was abolished (Joberty et al., 2001).

Furthermore, the aggregation of septins caused by overexpression of GFP3-BD3 was shown to lead to the loss of septin function (Huang et al., 2008). Therefore, BD3 may be used to inhibit the function of septin 5, allowing for further observation of the effect that loss of septin 5 function on regulated exocytosis.

The ability of BD3 to cause aggregation of septin 5 has been tested in PC12 cells. In order to create both inhibitory and negative controls vectors, the BD3 of Borg 3 was fused to eGFP (eGFP-BD3). Furthermore, the BD3 was mutated to create the LVL mutant (eGFP-BD3-LVL) to act as a control. All of the three constructs GFP3-BD3, eGFP-BD3, and eGFP-BD3-LVL were then tested in PC12 cells.

The cells transfected with GFP3-BD3 (Figure 11A) exhibited septin aggregation similar to what was described by Joberty et al. (2001). However, the main phenotype of GFP3-BD3 overexpression was observed to have multiple aggregates of septin 5. Nevertheless, large single perinuclear aggregates were also observed.

The eGFP-BD3 construct appeared to have less of an effect on septin 5 aggregation than GFP3- BD3 (Figure 11B). Although no single large aggregates of septin 5 were observed in the eGFP- BD3-positive PC12 cells, multiple septin 5 aggregates were still present in the transfected cells.

No septin 5 aggregates were seen in the cells transfected with the eGFP-BD3-LVL construct (Figure 11C). Therefore, as expected, septin 5 organization was not disrupted by the LVL mutant of BD3. Since both GFP3-BD3 and eGFP-BD3 constructs induced aggregation of septin 5, these constructs were next used to assay the effect of septin 5 aggregation on regulated exocytosis. A)

Figure 11: Overexpression of Borg Domain 3 constructs in PC12 cells. The BD3 constructs were overexpressed in PC12 cells. The images captured with a confocal spinning disk microscope show an extended focus of BD3 overexpression (green) and the endogenous expression of septin 5 (red). The endogenous expression of septin 5 was detected by immunofluorescence. The scale bar indicates 8.00µm.

A) GFP3-BD3. The overexpression of GFP3-BD3 resulted mainly in multiple septin 5 aggregates within the cell. Single large perinuclear aggregates were also observed in some cells. B) eGFP-BD3. Multiple septin 5 aggregates were still present in the transfected cells. These aggregates were smaller in size but they occurred at a higher frequency per cell compared to the multiple aggregates caused by GFP3-BD3 overexpression. No single large aggregates of septin 5 were observed. C) eGFP-BD3-LVL. No septin 5 aggregates were seen in the transfected cells.

3.3.2 The hGH release assay of PC12 cells following BD3 overexpression.

Both GFP3-BD3 and eGFP-BD3 constructs were found to cause disruption of septin 5 organization inside PC12 cells. The resulting aggregation of septin 5 by BD3 is assumed to cause the loss of septin 5 function, since previous studies showed the inhibition of septin function following overexpression of GFP3-BD3 (Huang et al., 2008). Therefore, the effect of the BD3- induced loss of septin 5 function on the regulated exocytosis can be determined by the ELISA- based hGH release assay in PC12 cells.

The eGFP-BD3 construct was tested first. The eGFP-BD3-LVL mutant was used as a negative control in addition to the empty vector control to account for possible effects of eGFP expression on hGH release. The light chain of tetanus toxin was once again selected to be the positive control for the assay.

After the results of hGH release were normalized to the evoked secretion levels obtained from eGFP-BD3-LVL mutant control, no statistically significant difference was observed between the evoked hGH release of the cells transfected with eGFP-BD3 (90.77% ± 5.895% SEM of control) and the control cells transfected with eGFP-BD3-LVL (100%; Figure 12). Furthermore, the secretion levels of the cells transfected with an empty pCDNA3.1+ vector (89.21% ± 11.12% SEM of control) were also not statistically different from eGFP-BD3-LVL control. However, the expression of tetanus toxin light chain caused a reduction of evoked hGH release by more than 70% of the control (27.80% ± 5.308% SEM of control), as it has been previously reported in literature (Sugita, 2004).

Since eGFP-BD3 construct appeared to have a weaker effect on septin 5 aggregation compared to GFP3-BD3, the hGH release of cells overexpressing the GFP3-BD3 construct was also tested. A previous experiment showed that the secretion levels of the cells transfected with an empty pCDNA3.1+ vector and the eGFP-BD3-LVL were not statistically different from each other. Therefore, the use of an empty vector sample as the only negative control along with the tetanus toxin light chain as the positive control was sufficient for the assay.

The results of the assay testing hGH release of PC12 cells with overexpressed GFP3-BD3 were normalized to the evoked secretion levels of the empty vector control (100%). The evoked hGH release of GFP3-BD3 sample (108.2% ± 15.30% SEM of control) was also observed to have no statistically significant difference compared to the control (Figure 13). The cells expressing tetanus toxin light chain exhibited a reduction in secretion levels of more than 60% of the control (37.29% ± 8.387% SEM of control), which is within the range previously reported in literature (Sugita 2004).

The hGH release assay of PC12 cells showed that overexpression of either eGFP-BD3 or GFP3- BD3 has no effect on regulated secretion. However, this result leaves uncertainty with respect to the role of septin 5 in exocytosis. The lack of an effect on the hGH release from PC12 cells could indicate that septin 5 has no function in the regulated exocytosis. On the other hand, there remains a possibility that the effect of the overexpression of BD3 and the consequent septin 5 aggregation is not strong enough to inhibit the function of septin 5. Therefore, septin 5 knock- down must be carried out in order to identify the function of septin 5 in exocytosis.

Figure 12: The effects of eGFP-BD3 overexpression on evoked regulated exocytosis in PC12 cells. The eGFP-BD3 construct was transfected into PC12 cells along with eGFP-BD3-LVL construct that served as a negative control. Additionally, an empty pCDNA3.1+ vector served as another negative control and the TeTx-LC plasmid expressing the light chain of tetanus toxin served as a positive control. Following the hGH release assay, the levels of regulated secretion were quantified as described in Chapter 2 and normalized to the levels of eGFP-BD3-LVL vector control (100%). There was no statistically significant difference between the secretion levels of cells transfected with eGFP-BD3 and either of the two negative control samples. The cells expressing the light chain of tetanus toxin had a greater that 70% decrease of evoked regulated secretion compared to the eGFP-BD3-LVL control. Data is shown as mean ± SEM (n = 5). The asterisks denote statistically significant differences from the control value (p < 0.05) as determined by Student’s t-test.

Figure 13: The effects of GFP3-BD3 overexpression on evoked regulated exocytosis in PC12 cells.

The GFP3-BD3 construct was transfected into PC12 cells along with an empty pCDNA3.1+ vector that served as a negative control. The TeTx-LC plasmid expressing the light chain of tetanus toxin served as a positive control. Following the hGH release assay, the levels of regulated secretion were quantified as described in Chapter 2 and normalized to the levels of empty pCDNA3.1+ vector control (100%). There was no statistically significant difference between the secretion levels of cells transfected with GFP3-BD3 and the negative control sample. The cells expressing the light chain of tetanus toxin had a greater than 60% decrease of evoked regulated secretion compared to the empty pCDNA3.1+ control. Data is shown as mean ± SEM (n = 3). The asterisks denote statistically significant differences from the control value (p < 0.05) as determined by Student’s t-test.

3.4 Effects of septin 5 knock-down on regulated secretion 3.4.1 Septin 5 knock-down The lack of an effect of BD3 overexpression on hGH release from PC12 cells leads to two possibilities with respect to the function of septin 5. Either septin 5 does not play a role in regulated secretion or septin 5 is still able to carry out its function after its aggregation has been induced by BD3 overexpression. To determine which one of these possibilities is true, a more direct method of inhibiting septin 5 function has to be used. Thus, the knock-down of septin 5 expression was attempted.

The knock-down of septin 5 was carried out using the short-hairpin interfering RNA (shRNA) molecule that suppresses the expression of septin 5 gene. The plasmids containing the shRNA sequence specific to septin 5 (pSUP5-1) and a mutated short-hairpin interfering RNA (pSUP5- 1m2) sequence that is unable to suppress septin 5 expression have been previously created in our lab. Chris Tsang verified the successful septin 5 knock-down in the primary rat hippocampal neurons by immunofluorescence (Tsang, 2007).

Testing the efficiency of septin 5 knock-down proved to be very difficult in PC12 cells. These cells have a very low transfection rate (estimated at less than 10%), resulting in a high background signal on a Western blot. Since the knock-down plasmids contained sequence coding for GFP expression, cell sorting by flow cytometry was attempted to isolate the transfected cell population. However, the procedure for the collection of a large number of transfected cells that is sufficient for Western blot analysis was not stringent enough to exclude all of untransfected cells due to PC12 cell autofluorescence. The presence of untransfected cells once again led to an increase of the background signal on a Western blot. On the other hand, adjusting the cell sorting procedure for a very stringent collection of only high GFP-expressing cells resulted in longer duration of the cell sorting procedure as well as the collection of a low number of cells (average of 1.5×105 cells). The number of cells was further reduced during the subsequent cell transfer to the lysis buffer and the final number of cells was not sufficient for a Western blot analysis. The sample size was increased in order to collect more high GFP-expressing cells, but it led to a significant increase in the duration of the cell sorting procedure. Therefore, cell sorting by flow cytometry was also not a viable method of testing septin 5 knock-down in PC12 cells.

As a result, the septin 5 knock-down in PC12 cells was tested by immunofluorescence. The cells were transfected with septin 5 knock-down or control shRNAs and incubated for 72 hours. Following the incubation, the cells were stained for endogenous septin 5 and the intensity of septin 5 fluorescence was compared between the transfected and the untransfected cells of the same sample. The transfection of control shRNA into PC12 cells did not affect the fluorescence intensity of endogenous septin 5 when compared to the untransfected cells of the same sample. However, when the cells were treated with the septin 5 knock-down shRNA, the transfected cells exhibited reduced endogenous septin 5 fluorescence intensity compared to the untransfected cells (Figure 14). The intensity of the endogenous septin 5 fluorescence may serve as the measure of the level of septin 5 expression within the cell. Therefore, the reduced intensity of septin 5 fluorescence in PC12 cells transfected with septin 5 shRNA indicates the knock-down of septin 5 expression.

Figure 14: Knock-down of septin 5 in PC12 cells. The PC12 cells were transfected with the septin 5 knock-down shRNA and control shRNA and incubated for 72 hours prior to fixing and staining. The images captured with a confocal spinning disk microscope show an extended focus of cells transfected with shRNA (green) and the endogenous expression of septin 5 (red). The endogenous expression of septin 5 was detected by immunofluorescence. The arrows denote transfected cells. The scale bar indicates 8.00µm. A) Septin 5 shRNA. The intensity of the endogenous septin 5 fluorescence of transfected PC12 cells is reduced compared to the untransfected cells. Thus, the expression of septin 5 is reduced in cells transfected with the knock-down septin 5 shRNA. B) Control shRNA. The intensity of the endogenous septin 5 remains the same across the transfected and untransfected cells. Therefore, the control shRNA does not affect the expression of septin 5.

In order to test the efficiency of septin 5 knock-down by Western blot analysis instead of the immunofluorescence, a different cell line, the NIH 3T3 cells (Jainchill et al., 1969), was used. The NIH 3T3 is a mouse (Mus musculus) fibroblast cell line, unlike the PC12 cell line that originated from a rat (Rattus norvegicus) adrenal pheochromocytoma. Although the organisms are different, the shRNA was designed to target the sequence of septin 5 that is conserved across these two organisms. The endogenous expression of septin 5 in the NIH 3T3 cells was confirmed by Western blot analysis.

The NIH 3T3 cells were transfected (estimated at less than 60% transfection efficiency) with the septin 5 knock-down pSUP5-1 and the mutant pSUP5-1m2 plasmids and incubated for 48 hours prior to cell lysis. The incubation period was only 48 hours due to the rapid growth of untransfected cells that contribute to the background signal upon lysis. The protein concentration of each lysate sample was measured by the Bradford assay (BioRad). The lysates of each sample were then loaded on the SDS-PAGE in equal protein amounts. The Western blot analysis showed a decrease of septin 5 expression in the cell sample transfected with the septin 5 knock-down plasmid compared to the sample transfected with the mutant plasmid and the non-transfected cell lysate (Figure 15).

This result indicates that the knock-down of septin 5 expression can be achieved with the pSUP5-1 construct in NIH 3T3 cells. The results of Western blot analysis of the knock-down in NIH 3T3 cells may not necessarily indicate the same level of effectiveness of the pSUP5-1 construct in PC12 cells. However, this construct was shown by immunofluorescence to effectively reduce the intensity of the endogenous septin 5 fluorescence in transfected PC12 cells. Therefore, the pSUP5-1 construct is capable of knocking down the expression of septin 5 within PC12 cells. The knock-down of septin 5 expression should effectively inhibit septin 5 function in the cell, affecting the cellular processes that require septin 5. The effects of septin 5 knock-down on regulated exocytosis can be observed by carrying out the hGH release assay in PC12 cells.

Figure 15: Knock-down of septin 5 in NIH 3T3 cells. The NIH3T3 cells were transfected with the septin 5 knock-down pSUP5-1 and the mutant pSUP5-1m2 plasmids and incubated for 48 hours prior to cell lysis. The incubation period was only 48 hours due to the rapid growth of untransfected cells that contribute to the background signal upon lysis. The protein concentration of each lysate sample was measured by the Bradford assay (BioRad). The lysates of each sample were then loaded on the SDS- PAGE in equal protein amounts. GAPDH serves as the loading control. The intensity of the septin 5 band of the knock-down sample is reduced compared to the mutant control shRNA sample and the untransfected cell lysate. Thus, the expression of septin 5 is reduced in the cells transfected with the knock-down pSUP5-1 plasmid. This experiment has been repeated twice.

3.4.2 The hGH release assay of PC12 cells following septin 5 knock-down The knock-down of septin 5 was successful in PC12 and NIH 3T3 cells. Unlike overexpression of BD3, the shRNA directly inhibits septin 5 expression. Thus, any changes in levels of regulated secretion following transfection of pSUP5-1 construct are due to lack of septin 5 in the cell. The regulated secretion levels can be determined by the hGH release assay.

The septin 5 knock-down construct pSUP5-1 was tested in PC12 cells. The pSUP5-1m2 mutant construct was used as one of the negative controls in addition to the empty vector control to account for possible effects of shRNA expression on hGH release. The positive control for the assay was the construct expressing the light chain of tetanus toxin. The cells were incubated for 72 hours following the transfection in order to let the knock-down take effect.

The data obtained from the results of hGH release in PC12 cells was normalized to the evoked secretion levels of the control shRNA pSUP5-1m2 (Figure 15). There was no statistically significant difference between the evoked hGH release of the control shRNA sample (100%) and the empty vector control (85.86% ± 9.828% SEM of control). Furthermore, the evoked hGH release of the cells expressing the light chain of tetanus toxin was reduced by more than 70% of the control (22.85% ± 6.326% SEM of control), as it has been previously reported in literature (Sugita, 2004). However, the evoked secretion levels obtained from the cells transfected with the septin 5 knock-down shRNA construct pSUP5-1 were reduced by more than 55% of the control (44.22% ± 13.27% SEM of control). The hGH release assay showed that the knock-down of septin 5 in PC12 cells has an inhibitory effect on regulated secretion.

Figure 16: The effects of septin 5 knock-down on evoked regulated exocytosis in PC12 cells. The septin 5 knock-down construct pSUP5-1 was transfected into PC12 cells along with the mutant pSUP5- 1m2 construct that served as a negative control. Additionally, an empty pCDNA3.1+ vector served as another negative control and the TeTx-LC plasmid expressing the light chain of tetanus toxin served as a positive control. Following the hGH release assay, the levels of regulated secretion were quantified as described in Chapter 2 and normalized to the levels of pSUP5-1m2 control shRNA (100%). There was no statistically significant difference between the secretion levels of pSUP5-1m2 control shRNA sample and the cells transfected with the empty pCDNA3.1+ vector. The cells expressing the light chain of tetanus toxin had a greater than 70% decrease of evoked regulated secretion compared to the control shRNA. Knock-down of septin 5 by the pSUP5-1 septin 5 shRNA has caused a greater than 50% reduction in the evoked regulated secretion levels. Data is shown as mean ± SEM (n = 3). The asterisks denote statistically significant differences from the control value (p < 0.05) as determined by Student’s t-test.

Chapter 4 Discussion

4.1 hGH-mCherry was not secreted in regulated manner There is a considerable amount of evidence in the literature suggesting a link between septin 5 and regulated secretion. Therefore, the present study focused on determining the role of septin 5 in exocytosis. Furthermore, the experimental procedures carried out in this study attempted to answer the question of whether the septin filaments anchored to the SNARE complexes by septin 5 act as a tether, a restraint, or a barrier during exocytosis. The frequency and location of secretion events were observed on the plasma membrane of PC12 cells by TIRF microscopy. Also, the septin 5 knock-down was carried out in PC12 cells and the resulting effects on secretion were determined by hGH-ELISA assay.

Visualization by microscopic techniques is an ideal complement to biochemical assays in order to answer the question of how septin 5 modulates regulated exocytosis. To achieve this goal, a fluorescent reporter molecule hGH-mCherry was created to combine quantitative measurements of secretion levels with visualization of exocytosis. The N-terminal signal sequence of hGH targets the protein to the LDCVs (Tompkins et al., 2002), where it is secreted along with other catecholamines through regulated exocytosis (Wick et al., 1993). Thus, with the aid of hGH- mCherry, the regulated secretion can be measured by commercial hGH-ELISA kit and visualized by TIRF microscopy due to the mCherry fluorescence.

However, comparison of hGH reporter molecule with the hGH-mCherry revealed that the regulated secretion of hGH-mCherry was reduced to the levels of the control cell sample expressing the light chain of tetanus toxin. The regulated secretion levels of hGH-mCherry were less than 40% of the regulated secretion levels of hGH. The hGH is not exclusively secreted through the regulated exocytosis pathway and some of it leaks out of the cell by means of constitutive secretion (Taupenot, 2007). Thus, the evoked secretion levels always contain hGH that is secreted regardless of the stimulus and it is not part of the regulated secretion. Therefore, for the purposes of this assay, the regulated secretion was calculated as the difference between

55 the basal and the evoked secretion levels. After comparing the raw data of basal and evoked levels of hGH and hGH-mCherry (data not shown), it was observed that the rate of basal secretion of hGH-mCherry is significantly higher than that of hGH. This indicates that hGH- mCherry is mainly being secreted through the constitutive as opposed to the regulated pathway.

It is unclear how the hGH-mCherry fusion protein is packaged within the PC12 cells. Although the signal sequence of hGH should target the protein into the LDCVs (Wick et al., 1993; Tompkins et al., 2002), the fusion of mCherry may have affected the proper sorting of the fusion protein into the regulated secretion pathway. There is much debate about the underlying mechanisms of targeted protein sorting and packaging into LDCVs. The LDCVs vary in size from 100 to 300nm and contain highly concentrated proteins such as neuropeptides and neurohormones (Park and Kim, 2009). The immature granule is the intermediate step in the biogenesis of LCDVs that occurs after the targeted protein has been sorted in the trans-Golgi network (Arvan et al., 1991). These immature granules appear to exhibit both regulated and constitutive properties of secretion. The Pilkey group (Arvan et al., 1991) postulated a mechanism in which the inefficient concentration of protein destined for regulated release inside the immature granules results in a proportion of this regulated protein localizing to the vesicles that bud from the immature granules and undergo “constitutive-like” secretion. Thereby, the regulated protein is secreted under basal conditions without proper stimulus.

One of the differences between the backbone constructs of hGH and hGH-mCherry is the promoter sequence. The hGH plasmid pXGH5 contains the mouse metallothionein I promoter (Selden et al., 1986), which is weaker than the CMV promoter that is present on the hGH- mCherry plasmid. Although the levels of secretion are not affected by the levels of hGH expression and the use of the CMV promoter to express hGH has been previously reported in literature (Sugita et al., 1999), the presence of mCherry coupled with a high expression rate of the fusion protein may have led to hGH-mCherry being secreted through the “constitutive-like” pathway. The fusion of mCherry to hGH may have resulted in difficulties for the packaging machinery in concentrating hGH-mCherry inside the immature granules. The high expression rate facilitated by the CMV promoter provided large quantities of the fusion protein that needed to be concentrated inside the immature granules. It is possible that inefficient concentration

56 inside the immature granules led to a large excess of hGH-mCherry being secreted through the “constitutive-like” pathway.

Another explanation for high basal secretion of hGH-mCherry is the possible conformational change of hGH due to fusion of mCherry protein. A conformational change may have led to obstruction of the signal sequence, resulting in inefficient recognition of the signal and inhibition of proper sorting of hGH-mCherry into the regulated pathway in the trans-Golgi network. Data from observation of hGH-mCherry vesicles using TIRF microscopy supports this possibility. The movement of tubular vesicles was occasionally observed in PC12 cells expressing hGH- mCherry. Tubular-shaped vesicles have been previously reported in PC12 and PtK2 chromaffin cells during observation of constitutive secretion by TIRF microscopy (Schmoranzer et al., 2000; Toomre et al., 2000). Furthermore, spherical vesicles of various sizes have also been previously observed during constitutive exocytosis, although constitutive vesicles have been reported to be smaller on average than the regulated LDCVs (Toomre et al., 2000). Likewise, we have observed larger hGH-mCherry granules in PC12 cells following stimulation by ATP, compared to the hGH-mCherry granules visible under basal conditions. Therefore, the presence of hGH-mCherry inside of vesicles commonly observed during constitutive exocytosis supports the possibility that a signal sequence was less accessible due to the mCherry-induced conformational change of full- length hGH. The structural obstruction of the signal sequence may have led to hGH-mCherry being mis-sorted into the constitutive secretion pathway. However, hGH-mCherry was also observed in larger granules following stimulation of PC12 cells by ATP, indicating that the signal sequence may only be partially blocked, allowing some hGH-mCherry molecules to be properly targeted into the regulated secretion pathway.

4.2 Observing hGH-mCherry granules in TIRF microscopy The mis-sorting of hGH-mCherry into the constitutive pathway along with high expression of this reporter molecule due to the CMV promoter may explain the high basal levels of secretion that were obtained using hGH-ELISA. However, no secretion events were observed using TIRF microscopy during imaging of either ATP-stimulated or resting PC12 cells. While the observed secretion events of membrane-bound VAMP2-GFP were clearly identified by the often-reported

57 bright flashes and the subsequent dissipation of fluorescence, the release of lumenal fluorescent marker such as hGH-mCherry is not as easily detectable in PC12 cells.

Some constitutive granules, particularly tubular-shaped vesicles, were observed to form transient fusion pores (Toomre et al., 2000), resulting in only partial release of their cargo. Furthermore, the lumenal markers are known to diffuse very fast once secreted out of the cell, effectively disappearing in less than a second (Steyer et al., 1997). The fact that most of the fluorescent cargo remains inside of the vesicle that stays in the same spot as it carries out “kiss-and-run”- type secretion provides very high background, making it difficult to observe very fast dissipation of small quantities of hGH-mCherry.

In cases of vesicles disappearing after arriving to the plasma membrane, it may be impossible to distinguish between the slow full release of cargo and the regression of the vesicle back into the cell out of the range of the evanescent field. The combination of epifluorescence and TIRF during imaging would show the presence or absence of the vesicle in question following its disappearance from the evanescent field, indicating whether the vesicle regressed back or completely fused with the plasma membrane. However, technical limitations of the microscopy equipment rendered it impossible to effectively switch between the EPI- and TIR-fluorescence during the imaging due to the slow turret response.

Moreover, since constitutive vesicles are of various sizes and are generally smaller than the LDCVs (Schmoranzer et al., 2000; Toomre et al., 2000), the bulk of constitutive release of hGH- mCherry may have occurred through small vesicles. However, the presence of large vesicles resulted in high intensity fluorescence that prevented effective visualization of low intensity fluorescence of smaller vesicles. The problem may have been further aggravated by the TIRF laser that was used to excite hGH-mCherry fluorescence. The optimal excitation wavelength of mCherry fluorescence protein is 587 nm (Shaner et al., 2004). Meanwhile, the wavelength of the TIRF laser was 561 nm. Therefore, excitation of the mCherry fluorophore at the suboptimal wavelength resulted in the overall decrease of mCherry fluorescence intensity, lowering the already low fluorescence intensity of small vesicles below the detection limit. Adjustments to the

58 sensitivity levels of the microscope only led to the increase in fluorescence intensity of large vesicles and consequent signal oversaturation in the red channel.

The visualization of lumenal cargo release is difficult for the reasons outlined above. Fast diffusion of released lumenal cargo, partial release due to transient fusion pores, and several equipment limitations make it impossible to correctly identify exocytosis events of hGH- mCherry. However, the observed behaviours of vesicles containing hGH-mCherry are similar to those previously reported in literature. We observed these vesicles to gradually move towards the plasma membrane, with very strong fluorescence signal persisting for more than 30 seconds for some granules before the gradual decrease of fluorescence intensity due to the assumed regression of the vesicle back into cytosol. While observing the regulated secretion of LDCVs in bovine chromaffin cells, Steyer et al. (1997) also noted that fusion of the granule occurred minutes after it reached the plasma membrane.

During the initial stages of the fusion pore formation between the LDCV and the plasma membrane, the diameter of the fusion pore remains constricted for up to 10 seconds, preventing the release of the neuropeptides (Barg et al., 2002). The fusion pore has to expand in order to accommodate the size of the neuropeptides. Furthermore, studies of LDCV release in PC12 cells produced evidence for the model of direct retrieval of the LDCVs following their fusion (Holroyd et al., 2002; Taraska et al., 2003), similar to the model of “kiss-and-run” exocytosis of synaptic vesicles (Valtorta et al., 2001). Unlike the classical model of full fusion of the vesicle to the plasma membrane and the subsequent clathrin-mediated endocytosis, the vesicles of regulated exocytosis are thought to be recycled by closing their fusion pore and pinching off while remaining intact (Ryan, 2003). The Almers group (Taraska et al., 2003) reported observing a proportion of lumenal cargo being retained in the LDCVs of PC12 cells after those granules have undergone fusion and the release of some of their lumenal cargo. It was also noted that some of the lumenal proteins are released slower than others (Taraska et al., 2003).

Therefore, our observations of prolonged strong fluorescence signal of granules containing hGH- mCherry after their arrival to the plasma membrane may be due to the initial delay in lumenal cargo release and the fact that hGH-mCherry is retained inside of the LDCVs even after the

59 granules have undergone exocytosis. The properties of hGH-mCherry may also contribute to its retention within the LDCVs at a higher proportion than other proteins. The lack of visible hGH- mCherry exocytosis as identified by a diffuse cloud of fluorescence is possible due to the combination of the strong background fluorescence intensity of the hGH-mCherry retained inside of the LDCVs, very fast diffusion of the released protein, and the slow release of low quantities of hGH-mCherry. In contrast, the exocytosis events visualized through VAMP2-GFP have been observed as the often-reported “puffs” of fluorescence because VAMP2-GFP is a transmembrane protein. Formation of the transient fusion pore between the LDCV and the plasma membrane allowed VAMP2-GFP to diffuse into the plasma membrane of the cell. The diffusion of VAMP2-GFP should occur at a slower rate than that of hGH-mCherry because the transmembrane protein has to diffuse across the viscous plasma membrane. Furthermore, VAMP2-GFP is not hindered by the initial constraints of the small fusion pore or the lumenal retention of the LDCV cargo proteins and readily diffuses into the plasma membrane (Allersma et al., 2004).

4.3 Observing VAMP2-GFP vesicles in TIRF microscopy Overexpression of VAMP2-GFP in PC12 cells allowed us to observe and clearly identify the vesicle fusion events on the plasma membrane. Each fusion event could be visually identified by a sudden sharp increase in fluorescence intensity followed by rapid dissipation. Such visual characteristic of vesicle fusion observed by TIRF microscopy has been previously reported in several studies (Allersma et al., 2004; Ravier et al., 2008) and it can be readily used to discern between a secretion event and vesicle regression back into the cytoplasm of the cell. The analysis of the pattern of secretion sites before and after septin 5 knock-down in PC12 cells could help elucidate the role of septin 5 in exocytosis.

Unlike the hGH, the VAMP2-GFP protein is not targeted exclusively to the LDCVs of PC12 cells. These particular neuroendocrine cells contain both SVs and LDCVs (Schubert et al., 1977; Bauerfeind et al., 1993; Liu et al., 2005; Tsuboi et al., 2007). Whereas LDCVs are responsible for secretion of catecholamines, SVs secrete classic neurotransmitters (Park and Kim, 2009). The SVs in PC12 cells are 55nm in diameter (Liu et al., 2005) and are considerably smaller than the LDCVs of PC12 cells which range from 75 to 120 nm in diameter (Westerink and Ewing, 2008).

Since VAMP2 is a v-SNARE, it is present on all granules that undergo fusion to the plasma membrane. Therefore, overexpression of VAMP2-GFP allows for observation of both SVs and LDCVs inside PC12 cells.

The fusion events that we observed using VAMP2-GFP were considerably faster than the assumed fusion of LDCVs containing hGH-mCherry. The sharp increase in fluorescence intensity of the vesicle and the subsequent diffusion of VAMP2-GFP across the plasma membrane generally took slightly more than a second. Although it is highly probable that the original vesicle remained at the plasma membrane for longer, the diffusion of VAMP2-GFP away from the membrane of the LDCV and into the plasma membrane renders the fused LDCV invisible. The VAMP2-GFP protein is not restricted to the membrane of the fused LDCV and is able to freely and rapidly diffuse into the membrane of the cell (Allersma et al., 2004). Any of the VAMP2-GFP molecules remaining on the membrane of the fused LDCV did not produce a strong enough fluorescence signal to be differentiated from the background fluorescence of VAMP2-GFP present on the plasma membrane of the cell. Unlike the fluorescence of hGH- mCherry inside of the LDCVs that persisted for more than 30 seconds for some of the granules due to slow release and retention of the lumenal cargo, the VAMP2-GFP only showed the initial fusion step between the vesicle and the plasma membrane.

We recorded the locations of fusion events on the plasma membrane of PC12 cells in order to identify the “active zones” of secretion. The secretion of SVs is known to be organized into specific locations at the neuronal synapse, termed the “active zones” of secretion (Zenisek et al., 2000; Schoch et al., 2006). On the other hand, the secretion of LDCVs is not organized and appears scattered across the plasma membrane (Steyer et al., 1997). This difference is partly due to the fact that the release of LDCVs is stimulated by increased calcium concentration far from the Ca2+ channels, whereas the SV exocytosis is triggered by rising calcium concentration in close proximity to the Ca2+ channels (Scalettar, 2006). Indeed, we observed the secretion of granules tagged with VAMP2-GFP to occur at random locations on the membrane of PC12 cells without being organized into active zones. For the purposes of our study, we only considered visually pronounced and unambiguous explosions of fluorescence to be indicative of a vesicle fusion event. Therefore, we have only been observing the fusion events of LDCVs. Since SVs of

PC12 cells are only 55nm in diameter (Liu et al., 2005), we could not clearly observe and identify SVs or SV fusion events due to the resolution limitations of the microscopy equipment. However, the observed gradual increase of the fluorescence intensity of the plasma membrane following stimulation of PC12 cells even before the surge of LDCV fusion events is indicative of SV fusion to the plasma membrane. Since we could not effective identify SVs, it is unknown if the SV exocytosis is organized into active zones of secretion in undifferentiated PC12 cells, but the secretion of LDCVs was observed to occur randomly across the plasma membrane. Identifying the role that septin 5 may play in spatial regulation of exocytosis relies on distinct organization of secretion events into active zones. Since no active zones were observed on the plasma membrane of PC12 cells, TIRF microscopy was not used further in our study to elucidate the function of septin 5 in regulated secretion.

4.4 Overexpression of BD3 did not affect the function of septin 5 In an attempt to disrupt the function of septin 5, BD3 was overexpressed in PC12 cells. The Borgs are the downstream effectors of CDC42 and TC10 Rho GTPases (Joberty et al., 1999). They are known to regulate cellular organization of septins by binding through the conserved

BD3 domain, with the overexpression of GFP3-BD3 causing aggregation of septins into a single perinuclear spot at the site of GFP3-BD3 concentration (Joberty et al., 2001). Septin aggregation is thought to lead to inavailability of septins for participation in cellular processes, resulting in the loss of septin function. However, the results of hGH ELISA secretion assay showed that overexpression of GFP3-BD3 or eGFP-BD3 has no effect on regulated secretion in PC12 cells. Although the lack of an effect on regulated secretion may be explained by septin 5 having no function in exocytosis, the septin 5 knock-down data that is discussed later provides evidence contrary to this possibility. Therefore, BD3 overexpression in PC12 cells does not seem to lead to the loss of function of septin 5 in regulated secretion.

Due to their recent characterization, not much is known about the mechanisms of Borg’s regulation of septins. There have been no studies done to determine how BD3 overexpression affects the organization and function of each individual septin. In a study of phagosome formation in CHO-IIA and RAW 264.7 cells, overexpression of GFP3-BD3 resulted in the septin 2 aggregation and the consequent inability of the cell to phagocytose latex beads, which was

62 attributed to the loss of septin 2 function (Huang et al., 2008). The authors noted that only ~50% of transfected CHO-IIA cells contained septin 2 aggregates that colocalized with GFP3-BD3. As a result, the authors only analysed those cells that contained clear septin 2 aggregates in their observations of phagosome formation.

The results of the original study that characterized the effect of GFP3-BD3 overexpression on septins showed ~70% of transfected MDCK cells containing septin aggregates (Joberty et al., 2001), whereas overexpression in CHO-IIA cells caused septin aggregates in ~50% of the transfected cells (Huang et al., 2008). Therefore, it is possible that the degree of septin aggregation after GFP3-BD3 overexpression varies between different cell types. We only observed single perinuclear septin 5 aggregates in a small percentage of PC12 cells transfected with GFP3-BD3. The occurrence of multiple septin aggregates was the prevalent aggregation phenotype in PC12 cells transfected with GFP3-BD3 and the only aggregation phenotype in PC12 cells transfected with eGFP-BD3. Furthermore, not every transfected PC12 cell contained septin 5 aggregates.

The BD3-LVL mutant was needed to act as one of the controls in addition to an empty vector control during the hGH ELISA secretion assay. However, due to the initial difficulties in site- directed mutagenesis of GFP3-BD3, the BD3 and BD3-LVL sequences were fused to eGFP, creating two plasmids eGFP-BD3 and eGFP-BD3-LVL. Interestingly, the original GFP3-BD3 construct appeared to have a stronger effect on septin 5 aggregation than the eGFP-BD3. The differences of patterns of septin 5 aggregation between GFP3-BD3 and eGFP-BD3 may be due to the presence of triple-GFP in GFP3-BD3 construct. The overexpression of eGFP-BD3 construct resulted in a greater number of smaller septin 5 aggregates, whereas GFP3-BD3 caused formation of several larger septin 5 aggregates or even a single large septin 5 aggregate within PC12 cells.

In the case of GFP3-BD3, the triple GFP protein may be acting as a nucleation core, promoting the formation of large septin 5 aggregates. GFP proteins can dimerize in solution (Yang et al., 1996). Therefore, the triple-GFP may promote GFP oligomerization and the consequent BD3 concentration in a smaller area, ultimately resulting in formation of a large septin 5 aggregate.

Nonetheless, both GFP3-BD3 and eGFP-BD3 constructs did not have any effect on regulated secretion of hGH from PC12 cells, regardless of their ability to form large aggregates. The lack of an effect may be partially explained by the fact that only a proportion of transfected cells forms septin 5 aggregates. Since the hGH ELISA secretion assay measures hGH release from the whole transfected population, the cells that did not form septin 5 aggregates in presence of BD3 are also assayed, masking the effects that septin 5 aggregation may exert on regulated secretion. Furthermore, the BD3-induced aggregation of septin 5 may not be strong enough to fully disrupt septin 5 function in exocytosis. It is not known how BD3 affects each individual septin, particularly septin 5. The interaction between septin 5 and syntaxin 1 may be stronger than the interaction between septin 5 and BD3. In such a case, septin 5 will still be able to participate in exocytosis even in the presence of BD3 in the cell. With all of these uncertainties with regards to disruption of septin 5 function after BD3 overexpression, performing a knock-down of septin 5 provides a direct measure of the effect that a loss of septin 5 function may have on regulated secretion.

4.5 Knock-down of septin 5 results in decrease of regulated secretion The hGH ELISA assay has been carried out following the knock-down of septin 5 in PC12 cells to observe the effect that a lack of septin 5 within the cell will have on regulated secretion. Contrary to the results obtained after BD3 overexpression, there was a significant change in secretion levels of PC12 cells with the septin 5 knock-down. Interestingly, the secretion levels were decreased by more than 55% after the septin 5 knock-down. This was unexpected since the overexpression of septin 5 also leads to decreased levels of secretion (Beites et al., 1999).

The fact that overexpression of septin 5 leads to reduced exocytosis suggested that the knock- down of septin 5 should have an opposite effect. Nonetheless, other studies showed that overexpression of septin 5 dominant-negative GTPase S58A mutant (Beites et al., 1999) or the nonphosphorylatable septin 5 S327A mutant (Amin et al., 2008) results in increased levels of secretion. Furthermore, both of these septin 5 mutants exhibited a more efficient binding to syntaxin compared to the wild-type septin 5 (Beites et al., 1999; Amin et al., 2008). Since a stronger binding between septin 5 and syntaxin potentiates exocytosis, it is possible that a reduced level of interaction between septin 5 and syntaxin will result in reduced levels of

64 secretion. Our observations of the decreased levels of hGH release in PC12 cells following the knock-down of septin 5 can be explained by the knock-down resulting in a shortage of the septin 5 protein available for interaction with syntaxin which then led to a decrease in exocytosis levels. In contrast, the overexpression of septin 5 resulting in reduced secretion levels may be explained by a saturation effect. Overabundance of septin 5 may result in binding of septin 5 to all available syntaxin within the cell, thereby reducing the rate of vesicle fusion. The data showing both overexpression and knock-down of septin 5 having an inhibitory effect on regulated secretion suggests that septin 5 may play both a positive and a negative role in exocytosis.

4.6 Distinguishing between possible mechanisms explaining the role of septin 5 The exact mechanism by which septin 5 exerts its effect on exocytosis is still unknown. Three distinct possibilities have been described previously. Septin 5 may be involved in tethering of the vesicle to the site of secretion. It may facilitate formation of septin filaments that link vesicles to each other and to the plasma membrane, acting as a restraint and inhibiting vesicle docking. It may also act as a physical barrier at the plasma membrane, preventing vesicle fusion and indirectly aiding in formation of active zones of secretion. We initially attempted to elucidate the mechanism of the function of septin 5 in exocytosis through TIRF microscopy, but the data of the hGH release from septin 5 knock-down PC12 cells that we obtained through the hGH ELISA secretion assay helps in distinguishing between these three possibilities.

Since the knock-down of septin 5 resulted in a decrease of regulated secretion, it is unlikely that septin 5 is facilitating the formation of septin filaments at the plasma membrane that act as a physical barrier to vesicle fusion. If septin 5 was indeed involved in formation of the physical barrier, then the septin 5 knock-down would be expected to result in an increase of secretion levels due to a lack of a barrier and the resulting higher availability of vesicle fusion sites. The removal of the physical barrier to secretion should not result in a decrease of secretion levels.

Similarly, the reduced levels of exocytosis are not expected after the removal of a filamentous restraint that links the vesicles to each other and to the plasma membrane. If the vesicle-linking filaments that had been observed by Hirokawa and colleagues (Hirokawa et al., 1989) were, in

65 fact, septin filaments that are initiated by septin 5, then the knock-down of septin 5 should have resulted in potentiation of exocytosis or no change in secretion levels at all. It is difficult to explain the decreased levels of exocytosis in terms of a lack of a vesicle restraint or fusion barrier.

On the other hand, the mechanism of septin 5 facilitating a tether between the vesicle and its site of secretion fits with the obtained data. The lack of a tether guiding the vesicle to the site of exocytosis is likely to lead to a decreased rate of vesicle docking and fusion, resulting in reduced levels of secretion. Therefore, our results showing decreased levels of regulated secretion of hGH in PC12 cells after septin 5 knock-down suggest a possible involvement of septin 5 in tethering of the vesicle to the site of secretion. The exocyst complex is known to regulate the targeting and docking of the secretory vesicles (He et al., 2009). Furthermore, the exocyst complex interacts with syntaxin (Hsu et al., 1996) and several septins, including septin 5 (Hsu et al., 1998). Since individual septins are known to form complexes that assemble into filaments (Kinoshita, 2003a), septin 5 may facilitate formation of the septin filament between the exocyst complex and the vesicle. This septin filament can be attached to the site of secretion through the interaction between the septins and the exocyst complex (Hsu et al., 1998) and to the vesicle through the interaction between septin 5 and the cis-SNARE (Beites et al., 2005), that is known to be present on the synaptic vesicles (Otto et al., 1997). Thereby, the septin filament can tether the vesicle to the site of secretion, facilitating vesicle fusion to the plasma membrane. In the absence of this tether, such as due to septin 5 knock-down, vesicle targeting or docking to the exocyst complex may be disrupted, resulting in the reduced rate of vesicle fusion during regulated secretion.

However, it is likely that septin 5 is able to play multiple roles in exocytosis, depending on the type and the developmental stage of the cell. Several mouse septin 5 knock-out studies looked at the effects that a lack of septin 5 has on the organism. Recently, septin 5 has been implicated in the switch from the microdomain coupling of immature mouse calyx of Held synapse to the nanodomain coupling of the mature stage that occurs during mouse development. The lack of septin 5 in septin 5-/- mice has only affected the function and morphology of immature calyx of Held synapse, while having no effect on the mature stage (Yang et al., 2010). The authors concluded that septin 5 filaments or septin filaments containing septin 5 associate with the active

66 zones of secretion, preventing exocytosis of SVs during the immature stages of development, whereas during the mature stage these filaments recede to the periphery of the active zone, increasing the size of the readily-releasable pool of SVs (Yang et al., 2010). Other septin 5 knock-out studies revealed that while stimulation of platelets from septin 5-/- mice with subthreshold levels of collagen led to enhanced secretion of serotonin (Dent et al., 2002), septin 5 did not appear to be necessary for normal neuronal development or neurotransmitter release (Peng et al., 2002; Tsang et al., 2008). Although the mouse septin 5 knock-out studies, coupled with our observations of septin 5 knock-down causing a decrease in secretion levels but not completely abolishing exocytosis, suggest that septin 5 is not essential for regulated secretion, there is evidence to suggest that a lack of septin 5 affects higher cognitive functions. The septin 5-/- mice exhibited several behavioural deficiencies that were independent of the genetic background, including impaired social interaction and rewarded goal approach (Suzuki et al., 2009).

Chapter 5 Conclusion and Future Directions

The knock-down of septin 5 in PC12 cells was determined to have a negative effect on regulated secretion. This was an unexpected result, since a previous study on overexpression of septin 5 reported the same effect. Nonetheless, since more efficient interaction between septin 5 and syntaxin 1 has been shown to have a positive effect on exocytosis, it is possible that decreased binding of septin 5 to syntaxin 1 due to the septin 5 knock-down yields lower secretion levels, as we observed.

We have not been able to identify the active zones of secretion on the plasma membrane of PC12 cells by TIRF microscopy. Due to the resolution limitations of the microscopy equipment, only fusion events of LDCVs have been observed, the secretion of which did not appear to be spatially organized into active zones, corresponding to the previously reported observations in literature. The fusion events of SVs could not be effectively identified.

In light of the data showing the knock-down of septin 5 having a negative rather than a positive effect on secretion, it was possible to differentiate between the proposed mechanisms of function of septin 5 in localized exocytosis. Out of the three possible mechanisms, the one suggesting septin 5 facilitating formation of a tether between the vesicle and its site of secretion fits within the data obtained from measurements of levels of secretion following septin 5 knock-down. Lack of septin 5 induced by the knock-down may disrupt the formation of this tether leading to a decreased rate of vesicle docking and fusion to the plasma membrane and, thus, decreasing the levels of secretion.

Although this work shows septin 5 playing a positive role in exocytosis, it is likely that the function of septin 5 is more complex, having both positive and negative effects. Moreover, septin 5 may play a support rather than an essential role in exocytosis as shown by the mouse septin 5 knock-down studies and our observation of septin 5 knock-down decreasing but not completely abolishing regulated secretion. Further research has to be carried out in order to determine the

68 function of septin 5 in different cell types and to explore the role of septin 5 in the possible septin complex that may constitute the tether between the vesicles and their site of secretion.

In the future studies, the knock-down of septin 5 should be carried out in HIT-T15 cells. This is the cell line that was used in the original study of septin 5 overexpression. Unlike PC12 cells, HIT-T15 is a β-pancreatic cell line that can be stimulated by glucose to secrete insulin. It would be interesting to see if the knock-down of septin 5 in HIT-T15 cells will also have a negative effect on exocytosis.

Although only LDCVs were observed by TIRF microscopy and their fusion was not spatially organized into active zones, observing the behaviour of LDCVs following septin 5 knock-down may shed more light on the function of septin 5 in localized secretion. Currently, both the knock- down plasmid and the reporter protein used to label LDCVs express GFP as part of their sequence. Changing the fluorophore on one of these plasmids will allow for simultaneous identification of the cell with septin 5 knock-down and observation of vesicle fusion.

The effect of septin 2 knock-down on regulated secretion should also be investigated. Since both septin 5 and septin 2 belong to the same septin group, it is possible that these proteins may have redundant functions and are able to substitute for each other. Furthermore, just like septin 5, septin 2 is known to interact with syntaxin and the exocyst complex (Hsu 1998, Beites 1999), although the exact nature of interaction between septin 2 and syntaxin is not as well characterized as in the case of septin 5. It should be determined whether septin 2 knock-down alone or simultaneously with septin 5 knock-down enhances or has no effect on regulated secretion.

As it has been frequently observed in our lab and previously reported in literature, knock-down of septin 7 alone results in decreased expression levels of other septins as well (Kinoshita 2002). Preliminary experiments assaying the effect of septin 7 knock-down on the expression of septin 5 showed that unlike other septins, particularly septin 2, the expression of septin 5 did not decrease. Exploring this effect further may help to elucidate the role of septin 5 in a septin

69 complex, as septin 7 is considered to be an essential “core” septin that is required for septin complex formation (Kinoshita 2003a).

The involvement of septin 5 in regulated secretion may be extended into a possible role in membrane trafficking in developing neurons. Recent findings show septin 5 being linked to a signaling pathway implicated in neurite outgrowth and cell differentiation (Park 2010). Therefore, it would be interesting to observe the effect that septin 5 knock-down may have on the ability of PC12 cells to differentiate.

Septin 5 is predominantly expressed in neural tissues. Multiple studies implicated this septin in the process of exocytosis. Although it is not essential for normal neuronal development, it appears to have an effect on higher-order cognitive functions. The data presented in this thesis suggests that septin 5 may have a more complex function in regulated secretion, having both positive and negative roles. The studies proposed for future research should further help in elucidating the function of septin 5.

References

Allersma, M., L. Wang, D. Axelrod, and R. Holz. 2004. Visualization of regulated exocytosis with a granule-membrane probe using total internal reflection microscopy. Mol.Biol.Cell. 15:4658-4668.

Amin, N., Y. Zheng, S. Kesavapany, J. Kanungo, T. Guszczynski, R. Sihag, P. Rudrabhatla, W. Albers, P. Grant, and H. Pant. 2008. Cyclin-dependent kinase 5 phosphorylation of human septin SEPT5 (hCDCrel-1) modulates exocytosis. The Journal of Neuroscience. 28:3631-3643.

Andersen, S.S. 2000. Spindle assembly and the art of regulating microtubule dynamics by MAPs and Stathmin/Op18. Trends Cell Biol. 10:261-267.

Arvan, P., R. Kuliawat, D. Prabakaran, A.M. Zavacki, D. Elahi, S. Wang, and D. Pilkey. 1991. Protein discharge from immature secretory granules displays both regulated and constitutive characteristics. J.Biol.Chem. 266:14171-14174.

Asada, A., J. Takahashi, M. Taniguchi, H. Yamamoto, T. Kimura, T. Saito, and S. Hisanaga. 2010. Neuronal expression of two isoforms of mouse Septin 5. J.Neurosci.Res. 88:1309- 1316.

Axelrod, D. 2001. Total internal reflection fluorescence microscopy in cell biology. Traffic. 2:764-774.

Axelrod, D., T.P. Burghardt, and N.L. Thompson. 1984. Total internal reflection fluorescence. Annu.Rev.Biophys.Bioeng. 13:247-268.

Barg, S., C. Olofsson, J. Schriever-Abeln, A. Wendt, S. Gebre-Medhin, E. Renstrm, and P. Rorsman. 2002. Delay between fusion pore opening and peptide release from large dense-core vesicles in neuroendocrine cells. Neuron. 33:287-299.

Bauerfeind, R., A. Rgnier-Vigouroux, T. Flatmark, and W.B. Huttner. 1993. Selective storage of acetylcholine, but not catecholamines, in neuroendocrine synaptic-like microvesicles of early endosomal origin. Neuron. 11:105-121.

Beites, C.L., X.R. Peng, and W.S. Trimble. 2001. Expression and analysis of properties of septin CDCrel-1 in exocytosis. Meth.Enzymol. 329:499-510.

Beites, C.L., H. Xie, R. Bowser, and W.S. Trimble. 1999. The septin CDCrel-1 binds syntaxin and inhibits exocytosis. Nat.Neurosci. 2:434-439.

Beites, C., K. Campbell, and W. Trimble. 2005. The septin Sept5/CDCrel-1 competes with alpha-SNAP for binding to the SNARE complex. Biochem.J. 385:347-353.

Bennett, M.K., N. Calakos, and R.H. Scheller. 1992. Syntaxin: a synaptic protein implicated in docking of synaptic vesicles at presynaptic active zones. Science. 257:255-259.

Bourne, H.R., D.A. Sanders, and F. McCormick. 1991. The GTPase superfamily: conserved structure and molecular mechanism. Nature. 349:117-127.

Byers, B., and L. Goetsch. 1976. A highly ordered ring of membrane-associated filaments in budding yeast. J.Cell Biol. 69:717-721.

Cao, L., X. Ding, W. Yu, X. Yang, S. Shen, and L. Yu. 2007. Phylogenetic and evolutionary analysis of the septin protein family in metazoan. FEBS Lett. 581:5526-5532.

Casamayor, A., and M. Snyder. 2003. Molecular dissection of a yeast septin: distinct domains are required for septin interaction, localization, and function. Mol.Cell.Biol. 23:2762- 2777.

Chao, M. 2003. Neurotrophins and their receptors: a convergence point for many signalling pathways. Nature Reviews.Neuroscience. 4:299-309.

Cheng, J., H. Wang, and W. Guggino. 2005. Regulation of cystic fibrosis transmembrane regulator trafficking and protein expression by a Rho family small GTPase TC10. J.Biol.Chem. 280:3731-3739.

Chiang, S.H., C.A. Baumann, M. Kanzaki, D.C. Thurmond, R.T. Watson, C.L. Neudauer, I.G. Macara, J.E. Pessin, and A.R. Saltiel. 2001. Insulin-stimulated GLUT4 translocation requires the CAP-dependent activation of TC10. Nature. 410:944-948.

Choi, P., H. Snyder, L. Petrucelli, C. Theisler, M. Chong, Y. Zhang, K. Lim, K.K.K. Chung, K. Kehoe, L. D'Adamio, J.M. Lee, E. Cochran, R. Bowser, T.M. Dawson, and B. Wolozin. 2003. SEPT5_v2 is a parkin-binding protein. Mol.Brain Res. 117:179-189.

Choi, S.Y., and K.T. Kim. 1996. Characterization of Na influx mediated by ATP(4-)-activated P2 purinoceptors in PC12 cells. Br.J.Pharmacol. 118:935-940.

Cormack, B.P., R.H. Valdivia, and S. Falkow. 1996. FACS-optimized mutants of the green fluorescent protein (GFP). Gene. 173:33-38.

Dent, J., K. Kato, X. Peng, C. Martinez, M. Cattaneo, C. Poujol, P. Nurden, A. Nurden, W. Trimble, and J. Ware. 2002. A prototypic platelet septin and its participation in secretion. Proc.Natl.Acad.Sci.U.S.A. 99:3064-3069.

Duman, J., and J. Forte. 2003. What is the role of SNARE proteins in membrane fusion? American Journal of Physiology.Cell Physiology. 285:C237-C249.

Estey, M., C. Di Ciano-Oliveira, C. Froese, M. Bejide, and W. Trimble. 2010. Distinct roles of septins in cytokinesis: SEPT9 mediates midbody abscission. J.Cell Biol. 191:741-749.

Fasshauer, D., R.B. Sutton, A.T. Brunger, and R. Jahn. 1998. Conserved structural features of the synaptic fusion complex: SNARE proteins reclassified as Q- and R- SNAREs. Proc.Natl.Acad.Sci.U.S.A. 95:15781-15786

Fasolato, C., P. Pizzo, and T. Pozzan. 1990. Receptor-mediated calcium influx in PC12 cells. ATP and bradykinin activate two independent pathways. J.Biol.Chem. 265:20351- 20355.

Field, C.M., O. al-Awar, J. Rosenblatt, M.L. Wong, B. Alberts, and T.J. Mitchison. 1996. A purified Drosophila septin complex forms filaments and exhibits GTPase activity. J.Cell Biol. 133:605-616.

Ford, S.K., and J.R. Pringle. 1991. Cellular morphogenesis in the Saccharomyces cerevisiae cell cycle: localization of the CDC11 gene product and the timing of events at the budding site. Dev.Genet. 12:281-292.

Friedrich, G.A., J.D. Hildebrand, and P. Soriano. 1997. The secretory protein Sec8 is required for paraxial mesoderm formation in the mouse. Dev.Biol. 192:364-374.

Gonzalez, M., E. Peterson, L. Privette, J. Loffreda-Wren, L. Kalikin, and E. Petty. 2007. High SEPT9_v1 expression in human breast cancer cells is associated with oncogenic phenotypes. Cancer Res. 67:8554-8564.

Greene, L.A., and A.S. Tischler. 1976. Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor. Proc.Natl.Acad.Sci.U.S.A. 73:2424-2428.

Hall, P., K. Jung, K. Hillan, and S.E.H. Russell. 2005. Expression profiling the human septin gene family. J.Pathol. 206:269-278.

Hall, P., and S.E.H. Russell. 2004. The pathobiology of the septin gene family. J.Pathol. 204:489-505.

Hartwell, L.H. 1971. Genetic control of the cell division cycle in yeast. IV. Genes controlling bud emergence and cytokinesis. Exp.Cell Res. 69:265-276.

Hayashi, T., H. McMahon, S. Yamasaki, T. Binz, Y. Hata, T.C. Sdhof, and H. Niemann. 1994. Synaptic vesicle membrane fusion complex: action of clostridial neurotoxins on assembly. EMBO J. 13:5051-5061.

He, B., and W. Guo. 2009. The exocyst complex in polarized exocytosis. Curr.Opin.Cell Biol. 21:537-542.

Heasman, S., and A. Ridley. 2008. Mammalian Rho GTPases: new insights into their functions from in vivo studies. Nature Reviews.Molecular Cell Biology. 9:690-701.

Hirokawa, N., K. Sobue, K. Kanda, A. Harada, and H. Yorifuji. 1989. The cytoskeletal architecture of the presynaptic terminal and molecular structure of synapsin 1. J.Cell Biol. 108:111-126.

Holroyd, P., T. Lang, D. Wenzel, P. De Camilli, and R. Jahn. 2002. Imaging direct, dynamin- dependent recapture of fusing secretory granules on plasma membrane lawns from PC12 cells. Proc.Natl.Acad.Sci.U.S.A. 99:16806-16811.

Honer, W.G., L. Hu, and P. Davies. 1993. Human synaptic proteins with a heterogeneous distribution in cerebellum and visual cortex. Brain Res. 609:9-20.

Hsu, S.C., C.D. Hazuka, R. Roth, D.L. Foletti, J. Heuser, and R.H. Scheller. 1998. Subunit composition, protein interactions, and structures of the mammalian brain sec6/8 complex and septin filaments. Neuron. 20:1111-1122.

Hsu, S.C., A.E. Ting, C.D. Hazuka, S. Davanger, J.W. Kenny, Y. Kee, and R.H. Scheller. 1996. The mammalian brain rsec6/8 complex. Neuron. 17:1209-1219.

Huang, Y., M. Surka, D. Reynaud, C. Pace-Asciak, and W. Trimble. 2006. GTP binding and hydrolysis kinetics of human septin 2. The FEBS Journal. 273:3248-3260.

Huang, Y., M. Yan, R. Collins, J. Diciccio, S. Grinstein, and W. Trimble. 2008. Mammalian septins are required for phagosome formation. Mol.Biol.Cell. 19:1717-1726.

Hur, E.M., T.J. Park, and K.T. Kim. 2001. Coupling of L-type voltage-sensitive calcium channels to P2X(2) purinoceptors in PC-12 cells. American Journal of Physiology.Cell Physiology. 280:C1121-C1129.

Ihara, M., A. Kinoshita, S. Yamada, H. Tanaka, A. Tanigaki, A. Kitano, M. Goto, K. Okubo, H. Nishiyama, O. Ogawa, C. Takahashi, S. Itohara, Y. Nishimune, M. Noda, and M. Kinoshita. 2005. Cortical organization by the septin cytoskeleton is essential for structural and mechanical integrity of mammalian spermatozoa. Developmental Cell. 8:343-352.

Inoue, M., L. Chang, J. Hwang, S. Chiang, and A. Saltiel. 2003. The exocyst complex is required for targeting of Glut4 to the plasma membrane by insulin. Nature. 422:629-633.

Jaffe, A., and A. Hall. 2005. Rho GTPases: biochemistry and biology. Annu.Rev.Cell Dev.Biol. 21:247-269.

Jahn, R., and H. Niemann. 1994. Molecular mechanisms of clostridial neurotoxins. Ann.N.Y.Acad.Sci. 733:245-255.

Jainchill, J.L., S.A. Aaronson, and G.J. Todaro. 1969. Murine sarcoma and leukemia viruses: assay using clonal lines of contact-inhibited mouse cells. J.Virol. 4:549-553.

Joberty, G., R.R. Perlungher, and I.G. Macara. 1999. The Borgs, a new family of Cdc42 and TC10 GTPase-interacting proteins. Mol.Cell.Biol. 19:6585-6597.

Joberty, G., R.R. Perlungher, P.J. Sheffield, M. Kinoshita, M. Noda, T. Haystead, and I.G. Macara. 2001. Borg proteins control septin organization and are negatively regulated by Cdc42. Nat.Cell Biol. 3:861-866.

Joo, E., M. Surka, and W. Trimble. 2007. Mammalian SEPT2 is required for scaffolding nonmuscle myosin II and its kinases. Developmental Cell. 13:677-690.

Kim, H.B., B.K. Haarer, and J.R. Pringle. 1991. Cellular morphogenesis in the Saccharomyces cerevisiae cell cycle: localization of the CDC3 gene product and the timing of events at the budding site. J.Cell Biol. 112:535-544.

Kinoshita, A., M. Kinoshita, H. Akiyama, H. Tomimoto, I. Akiguchi, S. Kumar, M. Noda, and J. Kimura. 1998. Identification of septins in neurofibrillary tangles in Alzheimer's disease. The American Journal of Pathology. 153:1551-1560.

Kinoshita, A., M. Noda, and M. Kinoshita. 2000. Differential localization of septins in the mouse brain. J.Comp.Neurol. 428:223-239.

Kinoshita, M. 2003a. Assembly of mammalian septins. The Journal of Biochemistry. 134:491- 496.

Kinoshita, M. 2003b. The septins. GenomeBiology.Com. 4:236-236.

Kinoshita, M., C. Field, M. Coughlin, A. Straight, and T. Mitchison. 2002. Self- and actin- templated assembly of Mammalian septins. Developmental Cell. 3:791-802.

Kissel, H., M. Georgescu, S. Larisch, K. Manova, G. Hunnicutt, and H. Steller. 2005. The Sept4 septin locus is required for sperm terminal differentiation in mice. Developmental Cell. 8:353-364.

Kong, H., J. Boulter, J.L. Weber, C. Lai, and M.V. Chao. 2001. An evolutionarily conserved transmembrane protein that is a novel downstream target of neurotrophin and ephrin receptors. The Journal of Neuroscience. 21:176-185.

Kremer, B., T. Haystead, and I. Macara. 2005. Mammalian septins regulate microtubule stability through interaction with the microtubule-binding protein MAP4. Mol.Biol.Cell. 16:4648-4659.

Kuhlenbäumer, G., M. Hannibal, E. Nelis, A. Schirmacher, N. Verpoorten, J. Meuleman, G.D.J. Watts, E. De Vriendt, P. Young, F. Stgbauer, H. Halfter, J. Irobi, D. Goossens, J. Del- Favero, B. Betz, H. Hor, G. Kurlemann, T. Bird, E. Airaksinen, T. Mononen, A. Serradell, J. Prats, C. Van Broeckhoven, P. De Jonghe, V. Timmerman, E.B. Ringelstein, and P. Chance. 2005. Mutations in SEPT9 cause hereditary neuralgic amyotrophy. Nat.Genet. 37:1044-1046.

Lin, R.C., and R.H. Scheller. 2000. Mechanisms of synaptic vesicle exocytosis. Annu.Rev.Cell Dev.Biol. 16:19-49.

Lin, Y., Y. Lin, Y. Teng, T. Hsieh, Y. Lin, and P. Kuo. 2006. Identification of ten novel genes involved in human spermatogenesis by microarray analysis of testicular tissue. Fertil.Steril. 86:1650-1658.

Liu, T., T. Kishimoto, H. Hatakeyama, T. Nemoto, N. Takahashi, and H. Kasai. 2005. Exocytosis and endocytosis of small vesicles in PC12 cells studied with TEPIQ (two- photon extracellular polar-tracer imaging-based quantification) analysis. J.Physiol.(Lond.). 568:917-929.

Lukoyanova, N., S. Baldwin, and J. Trinick. 2008. 3D reconstruction of mammalian septin filaments. J.Mol.Biol. 376:1-7.

McKie, J.M., H.F. Sutherland, E. Harvey, U.J. Kim, and P.J. Scambler. 1997. A human gene similar to Drosophila melanogaster peanut maps to the DiGeorge syndrome region of 22q11. Hum.Genet. 101:6-12.

Mostowy, S., M. Bonazzi, M. Hamon, T. Tham, A. Mallet, M. Lelek, E. Gouin, C. Demangel, R. Brosch, C. Zimmer, A. Sartori, M. Kinoshita, M. Lecuit, and P. Cossart. 2010. Entrapment of intracytosolic bacteria by septin cage-like structures. Cell Host Microbe. 8:433-444.

Mostowy, S., and P. Cossart. 2009. Cytoskeleton rearrangements during Listeria infection: clathrin and septins as new players in the game. Cell Motil.Cytoskeleton. 66:816-823.

Mostowy, S., T. Tham, A. Danckaert, S. Guadagnini, S. Boisson-Dupuis, J. Pizarro-Cerd, and P. Cossart. 2009. Septins regulate bacterial entry into host cells. PloS One. 4:e4196-e4196.

Murrin, R.J., and M.R. Boarder. 1992. Neuronal "nucleotide" receptor linked to phospholipase C and phospholipase D? Stimulation of PC12 cells by ATP analogues and UTP. Mol.Pharmacol. 41:561-568.

Murthy, M., D. Garza, R. Scheller, and T. Schwarz. 2003. Mutations in the exocyst component Sec5 disrupt neuronal membrane traffic, but neurotransmitter release persists. Neuron. 37:433-447.

Nakahira, M., J.N.A. Macedo, T. Seraphim, N. Cavalcante, T.A.C.B. Souza, J.C.P. Damalio, L. Reyes, E. Assmann, M. Alborghetti, R. Garratt, A.P.U. Araujo, N.I.T. Zanchin, J.A.R.G. Barbosa, and J. Kobarg. 2010. A draft of the human septin interactome. PloS One. 5:e13799-e13799.

Nakazawa, K., K. Fujimori, A. Takanaka, and K. Inoue. 1990. An ATP-activated conductance in pheochromocytoma cells and its suppression by extracellular calcium. J.Physiol.(Lond.). 428:257-272.

Neufeld, T.P., and G.M. Rubin. 1994. The Drosophila peanut gene is required for cytokinesis and encodes a protein similar to yeast putative bud neck filament proteins. Cell. 77:371- 379.

Novick, P., C. Field, and R. Schekman. 1980. Identification of 23 complementation groups required for post-translational events in the yeast secretory pathway. Cell. 21:205-215.

Ohara-Imaizumi, M., T. Ohtsuka, S. Matsushima, Y. Akimoto, C. Nishiwaki, Y. Nakamichi, T. Kikuta, S. Nagai, H. Kawakami, T. Watanabe, and S. Nagamatsu. 2005. ELKS, a protein structurally related to the active zone-associated protein CAST, is expressed in pancreatic beta cells and functions in insulin exocytosis: interaction of ELKS with exocytotic machinery analyzed by total internal reflection fluorescence microscopy. Mol.Biol.Cell. 16:3289-3300.

Otto, H., P.I. Hanson, and R. Jahn. 1997. Assembly and disassembly of a ternary complex of synaptobrevin, syntaxin, and SNAP-25 in the membrane of synaptic vesicles. Proc.Natl.Acad.Sci.U.S.A. 94:6197-6201.

Oyler, G.A., G.A. Higgins, R.A. Hart, E. Battenberg, M. Billingsley, F.E. Bloom, and M.C. Wilson. 1989. The identification of a novel synaptosomal-associated protein, SNAP-25, differentially expressed by neuronal subpopulations. J.Cell Biol. 109:3039-3052.

Paglini, G., L. Peris, J. Diez-Guerra, S. Quiroga, and A. Cceres. 2001. The Cdk5-p35 kinase associates with the Golgi apparatus and regulates membrane traffic. EMBO Rep. 2:1139-1144.

Park, H., H. Park, S. Lee, J. Arevalo, Y. Park, S. Lee, K. Paik, M. Chao, and M. Chang. 2010. Ankyrin repeat-rich membrane spanning/Kidins220 protein interacts with mammalian Septin 5. Mol.Cells. 30:143-148.

Park, Y., and K. Kim. 2009. Short-term plasticity of small synaptic vesicle (SSV) and large dense-core vesicle (LDCV) exocytosis. Cell.Signal. 21:1465-1470.

Peng, X., Z. Jia, Y. Zhang, J. Ware, and W. Trimble. 2002. The septin CDCrel-1 is dispensable for normal development and neurotransmitter release. Mol.Cell.Biol. 22:378-387.

Peterson, E.A., and E.M. Petty. 2010. Conquering the complex world of human septins: implications for health and disease. Clin.Genet. 77:511-524.

Poo, M.M. 2001. Neurotrophins as synaptic modulators. Nature Reviews.Neuroscience. 2:24-32.

Ralevic, V., and G. Burnstock. 1998. Receptors for purines and pyrimidines. Pharmacol.Rev. 50:413-492.

Ravier, M., T. Tsuboi, and G. Rutter. 2008. Imaging a target of Ca2 signalling: dense core granule exocytosis viewed by total internal reflection fluorescence microscopy. Methods. 46:233-238.

Ryan, T. 2003. Kiss-and-run, fuse-pinch-and-linger, fuse-and-collapse: the life and times of a neurosecretory granule. Proc.Natl.Acad.Sci.U.S.A. 100:2171-2173.

Salaün, C., G. Gould, and L. Chamberlain. 2005. The SNARE proteins SNAP-25 and SNAP-23 display different affinities for lipid rafts in PC12 cells. Regulation by distinct cysteine- rich domains. J.Biol.Chem. 280:1236-1240.

Sanders, S.L., and C.M. Field. 1994. Cell division. Septins in common? Current Biology. 4:907- 910.

Scalettar, B. 2006. How neurosecretory vesicles release their cargo. Neuroscientist. 12:164-176.

Schmoranzer, J., M. Goulian, D. Axelrod, and S.M. Simon. 2000. Imaging constitutive exocytosis with total internal reflection fluorescence microscopy. J.Cell Biol. 149:23-32.

Schoch, S., and E. Gundelfinger. 2006. Molecular organization of the presynaptic active zone. Cell Tissue Research. 326:379-391.

Schubert, D., S. Heinemann, and Y. Kidokoro. 1977. Cholinergic metabolism and synapse formation by a rat nerve cell line. Proc.Natl.Acad.Sci.U.S.A. 74:2579-2583.

Selden, R.F., K.B. Howie, M.E. Rowe, H.M. Goodman, and D.D. Moore. 1986. Human growth hormone as a reporter gene in regulation studies employing transient gene expression. Mol.Cell.Biol. 6:3173-3179.

Shaner, N., R. Campbell, P. Steinbach, B.N.G. Giepmans, A. Palmer, and R. Tsien. 2004. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat.Biotechnol. 22:1567-1572.

Sheffield, P., C. Oliver, B. Kremer, S. Sheng, Z. Shao, and I. Macara. 2003. Borg/septin interactions and the assembly of mammalian septin heterodimers, trimers, and filaments. J.Biol.Chem. 278:3483-3488.

Shu, X., N. Shaner, C. Yarbrough, R. Tsien, and S.J. Remington. 2006. Novel chromophores and buried charges control color in mFruits. Biochemistry (N.Y.). 45:9639-9647.

Sirajuddin, M., M. Farkasovsky, F. Hauer, D. Khlmann, I. Macara, M. Weyand, H. Stark, and A. Wittinghofer. 2007. Structural insight into filament formation by mammalian septins. Nature. 449:311-315.

Söllner, T., S.W. Whiteheart, M. Brunner, H. Erdjument-Bromage, S. Geromanos, P. Tempst, and J.E. Rothman. 1993a. SNAP receptors implicated in vesicle targeting and fusion. Nature. 362:318-324.

Söllner, T., M.K. Bennett, S.W. Whiteheart, R.H. Scheller, and J.E. Rothman. 1993b. A protein assembly-disassembly pathway in vitro that may correspond to sequential steps of synaptic vesicle docking, activation, and fusion. Cell. 75:409-418.

Steels, J., M. Estey, C. Froese, D. Reynaud, C. Pace-Asciak, and W. Trimble. 2007. Sept12 is a component of the mammalian sperm tail annulus. Cell Motil.Cytoskeleton. 64:794-807.

Steyer, J.A., and W. Almers. 1999. Tracking single secretory granules in live chromaffin cells by evanescent-field fluorescence microscopy. Biophys.J. 76:2262-2271.

Steyer, J.A., H. Horstmann, and W. Almers. 1997. Transport, docking and exocytosis of single secretory granules in live chromaffin cells. Nature. 388:474-478.

Sugita, S. 2004. Human growth hormone co-transfection assay to study molecular mechanisms of neurosecretion in PC12 cells. Methods. 33:267-272.

Sugita, S., R. Janz, and T.C. Sdhof. 1999. Synaptogyrins regulate Ca2 dependent exocytosis in PC12 cells. J.Biol.Chem. 274:18893-18901.

Suh, B.C., C.O. Lee, and K.T. Kim. 1995. Signal flows from two phospholipase C-linked receptors are independent in PC12 cells. J.Neurochem. 64:1071-1079.

Sutton, R.B., D. Fasshauer, R. Jahn, and A.T. Brunger. 1998. Crystal structure of a SNARE complex involved in synaptic exocytosis at 2.4 A resolution. Nature. 395:347-353.

Suzuki, G., K. Harper, T. Hiramoto, T. Sawamura, M. Lee, G. Kang, K. Tanigaki, M. Buell, M. Geyer, W. Trimble, S. Agatsuma, and N. Hiroi. 2009. Sept5 deficiency exerts pleiotropic influence on affective behaviors and cognitive functions in mice. Hum.Mol.Genet. 18:1652-1660.

Tada, T., A. Simonetta, M. Batterton, M. Kinoshita, D. Edbauer, and M. Sheng. 2007. Role of Septin cytoskeleton in spine morphogenesis and dendrite development in neurons. Current Biology. 17:1752-1758.

Taniguchi, M., M. Taoka, M. Itakura, A. Asada, T. Saito, M. Kinoshita, M. Takahashi, T. Isobe, and S. Hisanaga. 2007. Phosphorylation of adult type Sept5 (CDCrel-1) by cyclin- dependent kinase 5 inhibits interaction with syntaxin-1. J.Biol.Chem. 282:7869-7876.

Taraska, J., D. Perrais, M. Ohara-Imaizumi, S. Nagamatsu, and W. Almers. 2003. Secretory granules are recaptured largely intact after stimulated exocytosis in cultured endocrine cells. Proc.Natl.Acad.Sci.U.S.A. 100:2070-2075.

TerBush, D.R., T. Maurice, D. Roth, and P. Novick. 1996. The Exocyst is a multiprotein complex required for exocytosis in Saccharomyces cerevisiae. EMBO J. 15:6483-6494.

Toda, S., Y. Kajii, M. Sato, and T. Nishikawa. 2000. Reciprocal expression of infant- and adult- preferring transcripts of CDCrel-1 septin gene in the rat neocortex. Biochem.Biophys.Res.Commun. 273:723-728.

Tompkins, L., K. Nullmeyer, S. Murphy, C. Weber, and R. Lynch. 2002. Regulation of secretory granule pH in insulin-secreting cells. American Journal of Physiology.Cell Physiology. 283:C429-C437.

Toomre, D., J.A. Steyer, P. Keller, W. Almers, and K. Simons. 2000. Fusion of constitutive membrane traffic with the cell surface observed by evanescent wave microscopy. J.Cell Biol. 149:33-40.

Trimble, W.S. 1999. Septins: a highly conserved family of membrane-associated GTPases with functions in cell division and beyond. J.Membr.Biol. 169:75-81.

Trimble, W.S., D.M. Cowan, and R.H. Scheller. 1988. VAMP-1: a synaptic vesicle-associated integral membrane protein. Proc.Natl.Acad.Sci.U.S.A. 85:4538-4542.

Tsai, L.H., I. Delalle, V.S. Caviness, T. Chae, and E. Harlow. 1994. p35 is a neural-specific regulatory subunit of cyclin-dependent kinase 5. Nature. 371:419-423.

Tsang, C., M. Fedchyshyn, J. Harrison, H. Xie, J. Xue, P. Robinson, L. Wang, and W. Trimble. 2008. Superfluous role of mammalian septins 3 and 5 in neuronal development and synaptic transmission. Mol.Cell.Biol. 28:7012-7029.

Tsang, C. 2007. Septin GTPases in the central nervous system: an investigation into axon specification, formation and function. PhD Thesis, Department of Biochemistry, University of Toronto. 139-141.

Tsuboi, T., and M. Fukuda. 2007. Synaptotagmin VII modulates the kinetics of dense-core vesicle exocytosis in PC12 cells. Genes to Cells. 12:511-519.

Valtorta, F., J. Meldolesi, and R. Fesce. 2001. Synaptic vesicles: is kissing a matter of competence? Trends Cell Biol. 11:324-328.

Vega, I., and S. Hsu. 2003. The septin protein Nedd5 associates with both the exocyst complex and microtubules and disruption of its GTPase activity promotes aberrant neurite sprouting in PC12 cells. Neuroreport. 14:31-37.

Walch-Solimena, C., J. Blasi, L. Edelmann, E.R. Chapman, G.F. von Mollard, and R. Jahn. 1995. The t-SNAREs syntaxin 1 and SNAP-25 are present on organelles that participate in synaptic vesicle recycling. J.Cell Biol. 128:637-645.

Weber, T., B.V. Zemelman, J.A. McNew, B. Westermann, M. Gmachl, F. Parlati, T.H. Sllner, and J.E. Rothman. 1998. SNAREpins: minimal machinery for membrane fusion. Cell. 92:759-772.

Westerink, R.H.S., and A.G. Ewing. 2008. The PC12 cell as model for neurosecretion. Acta Physiologica. 192:273-285.

Wick, P.F., R.A. Senter, L.A. Parsels, M.D. Uhler, and R.W. Holz. 1993. Transient transfection studies of secretion in bovine chromaffin cells and PC12 cells. Generation of kainate- sensitive chromaffin cells. J.Biol.Chem. 268:10983-10989.

Xie, H., M. Surka, J. Howard, and W.S. Trimble. 1999. Characterization of the mammalian septin H5: distinct patterns of cytoskeletal and membrane association from other septin proteins. Cell Motil.Cytoskeleton. 43:52-62.

Xie, Y., J. Vessey, A. Konecna, R. Dahm, P. Macchi, and M. Kiebler. 2007. The GTP-binding protein Septin 7 is critical for dendrite branching and dendritic-spine morphology. Current Biology. 17:1746-1751.

Yang, F., L.G. Moss, and G.N. Phillips. 1996. The molecular structure of green fluorescent protein. Nat.Biotechnol. 14:1246-1251.

Yang, Y., M. Fedchyshyn, G. Grande, J. Aitoubah, C. Tsang, H. Xie, C. Ackerley, W. Trimble, and L. Wang. 2010. Septins regulate developmental switching from microdomain to nanodomain coupling of Ca(2+) influx to neurotransmitter release at a central synapse. Neuron. 67:100-115.

Zenisek, D., J.A. Steyer, and W. Almers. 2000. Transport, capture and exocytosis of single synaptic vesicles at active zones. Nature. 406:849-854.

Zhang, J., C. Kong, H. Xie, P.S. McPherson, S. Grinstein, and W.S. Trimble. 1999. Phosphatidylinositol polyphosphate binding to the mammalian septin H5 is modulated by GTP. Current Biology. 9:1458-1467.

Zhang, Y., J. Gao, K.K. Chung, H. Huang, V.L. Dawson, and T.M. Dawson. 2000. Parkin functions as an E2-dependent ubiquitin- protein ligase and promotes the degradation of the synaptic vesicle-associated protein, CDCrel-1. Proc.Natl.Acad.Sci.U.S.A. 97:13354- 13359.