RNA-Seq Reveals Age- and Species Differences of CAR-targeted Drug-Processing
Genes in Liver
Sunny Lihua Cheng, Theo K. Bammler, and Julia Yue Cui
Drug Metabolism and Disposition
Figure legends for supplemental figures
Supplemental Figure 1. Serum ALT quantification in WT, CAR-null and hCAR-TG mice treated with vehicle or a species appropriate CAR ligand at 5- and 60-days of age. The
Pointe Scientific Inc. Liquid ALT kit was used per the manufacturer’s protocol (Canton,
MI). Data are expressed as mean ± standard error of mean (S.E.M). Asterisks represent statistically significant differences as compared to vehicle-treated mice of the same age and genotype.
Supplemental Figure 2. RT-qPCR quantification of mCAR (A) and the prototypical
CAR-target gene Cyp2b10 (B) in livers of WT, CAR-null and hCAR-TG mice treated with corn oil or a species appropriate CAR (n=5 per group). A dose-response was performed for CAR ligand-treated groups at 5-days of age as described in MATERIALS AND
METHODS. Data were normalized to the expression of the housekeeping gene β-actin and are presented as mean ± S.E.M. Asterisks (*) indicate statistically significant differences as compared to vehicle-treated groups of the same age in WT mice. Pounds
(#) indicate statistically significant differences as compared to vehicle-treated groups of the same age in hCAR-TG mice.
Supplemental Figure 3. RT-qPCR quantification of the mRNAs of selected DPGs in livers of WT, CAR-null, and hCAR-TG mice treated with vehicle or a species-appropriate CAR ligand at 5-days of age. A dose-response was performed for CAR ligand-treated groups at 5-days of age as described in MATERIALS AND METHODS. Data were normalized to the expression of the housekeeping gene β-actin and are presented as mean ± S.E.M. Asterisks (*) indicate statistically significant differences as compared to vehicle-treated groups of the same age in WT mice. Pounds (#) indicate statistically significant differences as compared to vehicle-treated groups of the same age in hCAR-
TG mice.
Table legends for supplemental Tables
Supplemental Table 1.
Gene symbols and descriptions of drug-processing genes to be considered in the present study.
Supplemental Table 2.
Average FPKM values, standard errors, and FDR-BH (q values) of drug processing genes.
Supplemental Table 3.
Primer sequences for RT-qPCR experiments.
D5 Corn Oil D5 Low dose D5 Medium dose D5 High dose Supplemental Figure 1 D60 Corn Oil D60 High dose
50 40 * 30 * 20
ALT (U/L) ALT 10 0 WT CAR-null hCAR-TG
D5 Corn Oil D5 Low dose D5 Medium dose D5 High dose D60 Corn Oil D60 High dose D5 Corn Oil D5 Low dose D5 Medium dose D5 High dose Supplemental Figure 2 D60 Corn Oil D60 High dose
A 100
-actin) -actin) mCAR β 80 60 40 D5 Corn Oil 20 D5 Low dose *** * D5 Medium dose D5 High dose
mRNA Expression (% of Expression(%of mRNA 0 WT CAR-null hCAR-TG D60 Corn Oil D60 High dose
B 800 *
-actin) -actin) Cyp2b10 β 600 * 400 # ** 200 ## 0 mRNA Expression (% of Expression(%of mRNA WT CAR-null hCAR-TG
D5 Corn Oil D5 Low dose D5 Medium dose D5 High dose D60 Corn Oil D60 High dose Corn Oil Corn Oil CAR ligand Low Dose CAR ligand Low Dose CAR ligand Medium Dose CAR ligand Medium Dose CAR ligand High Dose CAR ligand High Dose
Corn Oil Corn Oil Supplemental Figure 3 CAR ligand Low Dose CAR ligand Low Dose CAR ligand Medium Dose CAR ligand Medium Dose CAR ligand High Dose CAR ligand High Dose 400 800 Cyp1a2 * Cyp3a11 300 # 600 200 * 400 ** * 100 200 Corn Oil # # Corn Oil CAR ligand Low Dose CAR ligand Low Dose CAR ligand Medium Dose CAR ligand Medium Dose 0 0 CAR ligand High Dose CAR ligand High Dose 4 6 Nqo1 Aldh1a1 3 * # 4
-actin) -actin) 2 ** β # 2 1 Corn Oil Corn Oil CAR ligand Low Dose CAR ligand Low Dose CAR ligand Medium Dose* # # CAR ligand Medium Dose 0 0 CAR ligand High Dose CAR ligand High Dose 40 600 Ugt2b35 Gstm1 30 * * * 400 * 20 # 200 10 Corn Oil # Corn Oil CAR ligand Low Dose CAR ligand Low Dose CAR ligand Medium Dose CAR ligand Medium Dose 0 0 CAR ligand High Dose CAR ligand High Dose 150 3 * Gstm3 Sult5a1 100 * 2 *
50 1
mRNA Expression (% of Expression(%of mRNA # # $ # 0 0 150 15 Mrp3 Mrp4 100 * 10 *
* * # # 50 # 5 # 0 0 WT CAR-null hCAR-TG WT CAR-null hCAR-TG
Corn Oil CAR ligand Low Dose CAR ligand Medium Dose CAR ligand High Dose Title: RNA-Seq Reveals Age- and Species Differences of CAR-targeted Drug-Processing Genes in Liver Authors: Sunny Lihua Cheng, Theo K. Bammler, and Julia Yue Cui Journal: Drug Metabolism and Disposition Supplemental Table 1 Official Symbol Common Synonyms Full names Category Functions Adh1 alcohol dehydrogenase 1 (class I) Phase I Alcohol deydrogenase Adh4 alcohol dehydrogenase 4 (class II) Phase I Alcohol deydrogenase Adh5 aldehyde dehydrogenase 5, testis Phase I Alcohol deydrogenase Adh6a Adh5a alcohol dehydrogenase 6A (class V) Phase I Alcohol deydrogenase Adh7 alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide Phase I Alcohol deydrogenase Adhfe1 alcohol dehydrogenase, iron containing, 1 Phase I Alcohol deydrogenase Aldh1a1 aldehyde dehydrogenase family 1, subfamily A1 Phase I Aldehyde dehydrogenase Aldh1a2 aldehyde dehydrogenase family 1, subfamily A2 Phase I Aldehyde dehydrogenase Aldh1a3 aldehyde dehydrogenase family 1, subfamily A3 Phase I Aldehyde dehydrogenase Aldh1a7 aldehyde dehydrogenase family 1, subfamily A7 Phase I Aldehyde dehydrogenase Aldh1b1 aldehyde dehydrogenase 1 family, member B1 Phase I Aldehyde dehydrogenase Aldh1l1 aldehyde dehydrogenase 1 family, member L1 Phase I Aldehyde dehydrogenase Aldh1l2 aldehyde dehydrogenase 1 family, member L2 Phase I Aldehyde dehydrogenase Aldh2 aldehyde dehydrogenase 2, mitochondrial Phase I Aldehyde dehydrogenase Aldh3a1 aldehyde dehydrogenase family 3, subfamily A1 Phase I Aldehyde dehydrogenase Aldh3a2 aldehyde dehydrogenase family 3, subfamily A2 Phase I Aldehyde dehydrogenase Aldh3b1 aldehyde dehydrogenase 3 family, member B1 Phase I Aldehyde dehydrogenase Aldh3b2 aldehyde dehydrogenase 3 family, member B2 Phase I Aldehyde dehydrogenase Aldh4a1 aldehyde dehydrogenase 4 family, member A1 Phase I Aldehyde dehydrogenase Aldh5a1 aldhehyde dehydrogenase family 5, subfamily A1 Phase I Aldehyde dehydrogenase Aldh6a1 aldehyde dehydrogenase family 6, subfamily A1 Phase I Aldehyde dehydrogenase Aldh7a1 aldehyde dehydrogenase family 7, member A1 Phase I Aldehyde dehydrogenase Aldh8a1 aldehyde dehydrogenase 8 family, member A1 Phase I Aldehyde dehydrogenase Aldh9a1 aldehyde dehydrogenase 9, subfamily A1 Phase I Aldehyde dehydrogenase Aldh16a1 aldehyde dehydrogenase 16 family, member A1 Phase I Aldehyde dehydrogenase Aldh18a1 aldehyde dehydrogenase 18 family, member A1 Phase I Aldehyde dehydrogenase Dhdh dihydrodiol dehydrogenase (dimeric) Phase I Dimeric dihydrodiol dehydrogenase Aox1 aldehyde oxidase 1 Phase I Molybdenum hydroxylases / Aldehyde oxidase Aox2 Aox3l1 aldehyde oxidase 2 Phase I Molybdenum hydroxylases / Aldehyde oxidase Aox3 aldehyde oxidase 3 Phase I Molybdenum hydroxylases / Aldehyde oxidase Aox4 aldehyde oxidase 4 Phase I Molybdenum hydroxylases / Aldehyde oxidase Xdh xanthine dehydrogenase Phase I Molybdenum hydroxylases / Xanthine oxidoreductase Suox sulfite oxidase Phase I Molybdenum hydroxylase Marc1 Mosc1 mitochondrial amidoxime reducing component 1 Phase I Molybdenum hydroxylases/mitochondrial amidoxime reducing component (mARC) *Note: not in the reference gtf file Marc2 Mosc2, mARC1 mitochondrial amidoxime reducing component 2 Phase I Molybdenum hydroxylases/mitochondrial amidoxime reducing component (mARC) *Note: not in the reference gtf file Gphn gephyrin Phase I cofactors for Molybdenum hydroxylases Mocos molybdenum cofactor sulfurase Phase I cofactors for Molybdenum hydroxylases Mocs1 molybdenum cofactor synthesis 1 Phase I cofactors for Molybdenum hydroxylases Mocs2 molybdenum cofactor synthesis 2 Phase I cofactors for Molybdenum hydroxylases Mocs3 molybdenum cofactor synthesis 3 Phase I cofactors for Molybdenum hydroxylases Maoa monoamine oxidase A Phase I Amide oxidase Maob monoamine oxidase B Phase I Amide oxidase Paox polyamine oxidase (exo-N4-amino) Phase I Amide oxidase Smox spermine oxidase Phase I Amide oxidase Lox lysyl oxidase Phase I Amide oxidase Dao D-amino acid oxidase Phase I Amide oxidase Aoc1 amine oxidase, copper-containing 1 Phase I Amide oxidase Aoc2 amine oxidase, copper containing 2 (retina-specific) Phase I Amide oxidase Aoc3 amine oxidase, copper containing 3 Phase I Amide oxidase Fmo1 flavin containing monooxygenase 1 Phase I Flavin monooxygenase Fmo2 flavin containing monooxygenase 2 Phase I Flavin monooxygenase Fmo3 flavin containing monooxygenase 3 Phase I Flavin monooxygenase Fmo4 flavin containing monooxygenase 4 Phase I Flavin monooxygenase Fmo5 flavin containing monooxygenase 5 Phase I Flavin monooxygenase Fmo6 flavin containing monooxygenase 6 Phase I Flavin monooxygenase Fmo9 flavin containing monooxygenase 9 Phase I Flavin monooxygenase Cyp1a1 cytochrome P450, family 1, subfamily a, polypeptide 1 Phase I Cytochrome P450 Cyp1a2 cytochrome P450, family 1, subfamily a, polypeptide 2 Phase I Cytochrome P450 Cyp1b1 cytochrome P450, family 1, subfamily b, polypeptide 1 Phase I Cytochrome P450 Cyp2a4 cytochrome P450, family 2, subfamily a, polypeptide 4 Phase I Cytochrome P450 Cyp2a5 cytochrome P450, family 2, subfamily a, polypeptide 5 Phase I Cytochrome P450 Cyp2a12 cytochrome P450, family 2, subfamily a, polypeptide 12 Phase I Cytochrome P450 Cyp2a22 cytochrome P450, family 2, subfamily a, polypeptide 22 Phase I Cytochrome P450 Cyp2ab1 cytochrome P450, family 2, subfamily ab, polypeptide 1 Phase I Cytochrome P450 Cyp2b9 cytochrome P450, family 2, subfamily b, polypeptide 9 Phase I Cytochrome P450 Cyp2b10 cytochrome P450, family 2, subfamily b, polypeptide 10 Phase I Cytochrome P450 Cyp2b13 cytochrome P450, family 2, subfamily b, polypeptide 13 Phase I Cytochrome P450 Cyp2b19 cytochrome P450, family 2, subfamily b, polypeptide 19 Phase I Cytochrome P450 Cyp2b23 cytochrome P450, family 2, subfamily b, polypeptide 23 Phase I Cytochrome P450 Cyp2c29 cytochrome P450, family 2, subfamily c, polypeptide 29 Phase I Cytochrome P450 Cyp2c37 cytochrome P450, family 2. subfamily c, polypeptide 37 Phase I Cytochrome P450 Cyp2c38 cytochrome P450, family 2, subfamily c, polypeptide 38 Phase I Cytochrome P450 Cyp2c39 cytochrome P450, family 2, subfamily c, polypeptide 39 Phase I Cytochrome P450 Cyp2c40 cytochrome P450, family 2, subfamily c, polypeptide 40 Phase I Cytochrome P450 Cyp2c44 cytochrome P450, family 2, subfamily c, polypeptide 44 Phase I Cytochrome P450 Cyp2c50 cytochrome P450, family 2, subfamily c, polypeptide 50 Phase I Cytochrome P450 Cyp2c54 cytochrome P450, family 2, subfamily c, polypeptide 54 Phase I Cytochrome P450 Cyp2c55 cytochrome P450, family 2, subfamily c, polypeptide 55 Phase I Cytochrome P450 Cyp2c65 cytochrome P450, family 2, subfamily c, polypeptide 65 Phase I Cytochrome P450 Cyp2c66 cytochrome P450, family 2, subfamily c, polypeptide 66 Phase I Cytochrome P450 Cyp2c67 cytochrome P450, family 2, subfamily c, polypeptide 67 Phase I Cytochrome P450 Cyp2c68 cytochrome P450, family 2, subfamily c, polypeptide 68 Phase I Cytochrome P450 Cyp2c69 cytochrome P450, family 2, subfamily c, polypeptide 69 Phase I Cytochrome P450 Cyp2c70 cytochrome P450, family 2, subfamily c, polypeptide 70 Phase I Cytochrome P450 Cyp2d9 cytochrome P450, family 2, subfamily d, polypeptide 9 Phase I Cytochrome P450 Cyp2d10 cytochrome P450, family 2, subfamily d, polypeptide 10 Phase I Cytochrome P450 Cyp2d11 cytochrome P450, family 2, subfamily d, polypeptide 11 Phase I Cytochrome P450 Cyp2d12 cytochrome P450, family 2, subfamily d, polypeptide 12 Phase I Cytochrome P450 Cyp2d13 cytochrome P450, family 2, subfamily d, polypeptide 13 Phase I Cytochrome P450 Cyp2d22 cytochrome P450, family 2, subfamily d, polypeptide 22 Phase I Cytochrome P450 Cyp2d26 cytochrome P450, family 2, subfamily d, polypeptide 26 Phase I Cytochrome P450 Cyp2d34 cytochrome P450, family 2, subfamily d, polypeptide 34 Phase I Cytochrome P450 Cyp2d40 cytochrome P450, family 2, subfamily d, polypeptide 40 Phase I Cytochrome P450 Cyp2e1 cytochrome P450, family 2, subfamily e, polypeptide 1 Phase I Cytochrome P450 Cyp2f2 cytochrome P450, family 2, subfamily f, polypeptide 2 Phase I Cytochrome P450 Cyp2g1 cytochrome P450, family 2, subfamily g, polypeptide 1 Phase I Cytochrome P450 Cyp2j5 cytochrome P450, family 2, subfamily j, polypeptide 5 Phase I Cytochrome P450 Cyp2j6 cytochrome P450, family 2, subfamily j, polypeptide 6 Phase I Cytochrome P450 Cyp2j7 cytochrome P450, family 2, subfamily j, polypeptide 7 Phase I Cytochrome P450 *Note: not in the reference gtf file Cyp2j8 cytochrome P450, family 2, subfamily j, polypeptide 8 Phase I Cytochrome P450 Cyp2j9 cytochrome P450, family 2, subfamily j, polypeptide 9 Phase I Cytochrome P450 Cyp2j11 cytochrome P450, family 2, subfamily j, polypeptide 11 Phase I Cytochrome P450 Cyp2j12 cytochrome P450, family 2, subfamily j, polypeptide 12 Phase I Cytochrome P450 Cyp2j13 cytochrome P450, family 2, subfamily j, polypeptide 13 Phase I Cytochrome P450 Cyp2r1 cytochrome P450, family 2, subfamily r, polypeptide 1 Phase I Cytochrome P450 Cyp2s1 cytochrome P450, family 2, subfamily s, polypeptide 1 Phase I Cytochrome P450 Cyp2t4 cytochrome P450, family 2, subfamily t, polypeptide 4 Phase I Cytochrome P450 Cyp2u1 cytochrome P450, family 2, subfamily u, polypeptide 1 Phase I Cytochrome P450 Cyp2w1 cytochrome P450, family 2, subfamily w, polypeptide 1 Phase I Cytochrome P450 Cyp3a11 cytochrome P450, family 3, subfamily a, polypeptide 11 Phase I Cytochrome P450 Cyp3a13 cytochrome P450, family 3, subfamily a, polypeptide 13 Phase I Cytochrome P450 Cyp3a16 cytochrome P450, family 3, subfamily a, polypeptide 16 Phase I Cytochrome P450 Cyp3a25 cytochrome P450, family 3, subfamily a, polypeptide 25 Phase I Cytochrome P450 Cyp3a41a cytochrome P450, family 3, subfamily a, polypeptide 41A Phase I Cytochrome P450 Cyp3a41b cytochrome P450, family 3, subfamily a, polypeptide 41B Phase I Cytochrome P450 Cyp3a44 cytochrome P450, family 3, subfamily a, polypeptide 44 Phase I Cytochrome P450 Cyp3a57 cytochrome P450, family 3, subfamily a, polypeptide 57 Phase I Cytochrome P450 Cyp3a59 cytochrome P450, family 3, subfamily a, polypeptide 59 Phase I Cytochrome P450 Cyp4a10 cytochrome P450, family 4, subfamily a, polypeptide 10 Phase I Cytochrome P450 Cyp4a12a cytochrome P450, family 4, subfamily a, polypeptide 12a Phase I Cytochrome P450 Cyp4a12b cytochrome P450, family 4, subfamily a, polypeptide 12B Phase I Cytochrome P450 Cyp4a14 cytochrome P450, family 4, subfamily a, polypeptide 14 Phase I Cytochrome P450 Cyp4a29 cytochrome P450, family 4, subfamily a, polypeptide 29 Phase I Cytochrome P450 Cyp4a30b cytochrome P450, family 4, subfamily a, polypeptide 30b Phase I Cytochrome P450 Cyp4a31 cytochrome P450, family 4, subfamily a, polypeptide 31 Phase I Cytochrome P450 Cyp4a32 cytochrome P450, family 4, subfamily a, polypeptide 32 Phase I Cytochrome P450 Cyp4b1 cytochrome P450, family 4, subfamily b, polypeptide 1 Phase I Cytochrome P450 Cyp4f13 cytochrome P450, family 4, subfamily f, polypeptide 13 Phase I Cytochrome P450 Cyp4f14 cytochrome P450, family 4, subfamily f, polypeptide 14 Phase I Cytochrome P450 Cyp4f15 cytochrome P450, family 4, subfamily f, polypeptide 15 Phase I Cytochrome P450 Cyp4f16 cytochrome P450, family 4, subfamily f, polypeptide 16 Phase I Cytochrome P450 Cyp4f17 cytochrome P450, family 4, subfamily f, polypeptide 17 Phase I Cytochrome P450 Cyp4f18 cytochrome P450, family 4, subfamily f, polypeptide 18 Phase I Cytochrome P450 Cyp4f37 cytochrome P450, family 4, subfamily f, polypeptide 37 Phase I Cytochrome P450 Cyp4f39 cytochrome P450, family 4, subfamily f, polypeptide 39 Phase I Cytochrome P450 Cyp4f40 cytochrome P450, family 4, subfamily f, polypeptide 40 Phase I Cytochrome P450 Cyp4v3 cytochrome P450, family 4, subfamily v, polypeptide 3 Phase I Cytochrome P450 Cyp4x1 cytochrome P450, family 4, subfamily x, polypeptide 1 Phase I Cytochrome P450 Por P450 (cytochrome) oxidoreductase Phase I facilitate Cyp functions Mpo myeloperoxidase Phase I Peroxidase-Dependent cooxidation Lpo lactoperoxidase Phase I Peroxidase-Dependent cooxidation Tpo thyroid peroxidase Phase I Peroxidase-Dependent cooxidation Ptgs1 prostaglandin-endoperoxide synthase 1 Phase I Peroxidase-Dependent cooxidation Ptgs2 prostaglandin-endoperoxide synthase 2 Phase I Peroxidase-Dependent cooxidation Akr1a1 Akr1a4 aldo-keto reductase family 1, member A1 Phase I aldo-keto reductase Akr1b3 aldo-keto reductase family 1, member B3 (aldose reductase) Phase I aldo-keto reductase Akr1b7 aldo-keto reductase family 1, member B7 Phase I aldo-keto reductase Akr1b8 aldo-keto reductase family 1, member B8 Phase I aldo-keto reductase Akr1b10 Akr1b16 aldo-keto reductase family 1, member B10 Phase I aldo-keto reductase Akr1c6 aldo-keto reductase family 1, member C6 Phase I aldo-keto reductase Akr1c12 aldo-keto reductase family 1, member C12 Phase I aldo-keto reductase Akr1c13 aldo-keto reductase family 1, member C13 Phase I aldo-keto reductase Akr1c14 aldo-keto reductase family 1, member C14 Phase I aldo-keto reductase Akr1c18 aldo-keto reductase family 1, member C21 Phase I aldo-keto reductase Akr1c19 aldo-keto reductase family 1, member C19 Phase I aldo-keto reductase Akr1c20 aldo-keto reductase family 1, member C20 Phase I aldo-keto reductase Akr1c21 aldo-keto reductase family 1, member C21 Phase I aldo-keto reductase Akr1d1 aldo-keto reductase family 1, member D1 Phase I aldo-keto reductase Akr1e1 Akr1e2 aldo-keto reductase family 1, member E1 Phase I aldo-keto reductase Akr7a5 aldo-keto reductase family 7, member A5 (aflatoxin aldehyde reductase) Phase I aldo-keto reductase Nqo1 NAD(P)H dehydrogenase, quinone 1 Phase I Quinone oxidoreductase Nqo2 NAD(P)H dehydrogenase, quinone 2 Phase I Quinone oxidoreductase Dpyd dihydropyrimidine dehydrogenase Phase I Dihydropyrimidine dehydrogenase Aadac arylacetamide deacetylase (esterase) Phase I Carboxyesterase Ces1a carboxylesterase 1A Phase I Carboxyesterase Ces1b carboxylesterase 1B Phase I Carboxyesterase Ces1c carboxylesterase 1C Phase I Carboxyesterase Ces1d carboxylesterase 1D Phase I Carboxyesterase Ces1e carboxylesterase 1E Phase I Carboxyesterase Ces1f carboxylesterase 1F Phase I Carboxyesterase Ces1g carboxylesterase 1G Phase I Carboxyesterase Ces1h carboxylesterase 1H Phase I Carboxyesterase *Note: not in the reference gtf file Ces2a carboxylesterase 2A Phase I Carboxyesterase Ces2b carboxyesterase 2B Phase I Carboxyesterase Ces2c carboxylesterase 2C Phase I Carboxyesterase Ces2e carboxylesterase 2E Phase I Carboxyesterase Ces2f carboxylesterase 2F Phase I Carboxyesterase Ces2g carboxylesterase 2G Phase I Carboxyesterase Ces2h carboxylesterase 2H Phase I Carboxyesterase Ces3a carboxylesterase 3A Phase I Carboxyesterase Ces3b carboxylesterase 3B Phase I Carboxyesterase Ces4a carboxylesterase 4A Phase I Carboxyesterase Ces5a carboxylesterase 5A Phase I Carboxyesterase Ache acetylcholinesterase Phase I cholinesterase Bche butyrylcholinesterase Phase I cholinesterase Pon1 paraoxonase 1 Phase I Paraoxonase Pon2 paraoxonase 2 Phase I Paraoxonase Pon3 paraoxonase 3 Phase I Paraoxonase Ephx1 epoxide hydrolase 1, microsomal Phase I Epoxide hydrolase Ephx2 epoxide hydrolase 2, microsomal Phase I Epoxide hydrolase Ephx3 epoxide hydrolase 3, microsomal Phase I Epoxide hydrolase Ephx4 epoxide hydrolase 4, microsomal Phase I Epoxide hydrolase Lta4h leukotriene A4 hydrolase Phase I Epoxide hydrolase Alpl Alkaline phosphatase, liver/bone/kidney Phase I Alkaline phosphatase Bphl biphenyl hydrolase-like (serine hydrolase, breast epithelial mucin-associated antigen) Phase I Alkaline phosphatase Erap1 endoplasmic reticulum aminopeptidase 1 Phase I peptidase Cpe carboxypeptidase E Phase I peptidase Cpb2 carboxypeptidase B2 Phase I peptidase Gusb glucuronidase, beta Phase I beta-glucuronidase Cbr1 carbonyl reductase 1 Phase I Carbonyl reduction Cbr2 carbonyl reductase 2 Phase I Carbonyl reduction Cbr3 carbonyl reductase 3 Phase I Carbonyl reduction Cbr4 carbonyl reductase 4 Phase I Carbonyl reduction Gsr glutathione reductase phaseI glutathione reductase Epx eosinophil peroxidase phaseI Peroxidase-Dependent cooxidation Gpx1 glutathione peroxidase 1 phaseI Peroxidase-Dependent cooxidation Gpx2 glutathione peroxidase 2 phaseI Peroxidase-Dependent cooxidation Gpx3 glutathione peroxidase 3 phaseI Peroxidase-Dependent cooxidation Gpx4 glutathione peroxidase 4 phaseI Peroxidase-Dependent cooxidation Gpx5 glutathione peroxidase 5 phaseI Peroxidase-Dependent cooxidation Gpx6 glutathione peroxidase 6 phaseI Peroxidase-Dependent cooxidation Gpx7 glutathione peroxidase 7 phaseI Peroxidase-Dependent cooxidation Gpx8 glutathione peroxidase 8 phaseI Peroxidase-Dependent cooxidation Prdx1 peroxiredoxin 1 phaseI Peroxiredoxin Prdx2 peroxiredoxin 2 phaseI Peroxiredoxin Prdx3 peroxiredoxin 3 phaseI Peroxiredoxin Prdx4 peroxiredoxin 4 phaseI Peroxiredoxin Prdx5 peroxiredoxin 5 phaseI Peroxiredoxin Prdx6 peroxiredoxin 6 phaseI Peroxiredoxin Dhrs1 dehydrogenase/reductase (SDR family) member 1 phaseI short-chain dehydrogenases/reductases Dhrs11 dehydrogenase/reductase (SDR family) member 11 phaseI short-chain dehydrogenases/reductases Dhrs13 dehydrogenase/reductase (SDR family) member 13 phaseI short-chain dehydrogenases/reductases Dhrs2 dehydrogenase/reductase (SDR family) member 2 phaseI short-chain dehydrogenases/reductases Dhrs3 dehydrogenase/reductase (SDR family) member 3 phaseI short-chain dehydrogenases/reductases Dhrs4 dehydrogenase/reductase (SDR family) member 4 phaseI short-chain dehydrogenases/reductases Dhrs7 dehydrogenase/reductase (SDR family) member 7 phaseI short-chain dehydrogenases/reductases Dhrs7b dehydrogenase/reductase (SDR family) member 7B phaseI short-chain dehydrogenases/reductases Dhrs7c dehydrogenase/reductase (SDR family) member 7C phaseI short-chain dehydrogenases/reductases Dhrs9 dehydrogenase/reductase (SDR family) member 9 phaseI short-chain dehydrogenases/reductases Dhrsx dehydrogenase/reductase (SDR family) X chromosome phaseI short-chain dehydrogenases/reductases Sdr16c5 short chain dehydrogenase/reductase family 16C, member 5 phaseI short-chain dehydrogenases/reductases Sdr16c6 short chain dehydrogenase/reductase family 16C, member 6 phaseI short-chain dehydrogenases/reductases Sdr39u1 short chain dehydrogenase/reductase family 39U, member 1 phaseI short-chain dehydrogenases/reductases Sdr42e1 short chain dehydrogenase/reductase family 42E, member 1 phaseI short-chain dehydrogenases/reductases Sdr9c7 4short chain dehydrogenase/reductase family 9C, member 7 phaseI short-chain dehydrogenases/reductases Glrx glutaredoxin phaseI glutaredoxin Glrx2 glutaredoxin2 phaseI glutaredoxin Txn1 thioredoxin 1 phaseI thioredoxin Txnrd1 thioredoxin reductase 1 phaseI thioredoxin reductase 1 Txnrd2 thioredoxin reductase 2 phaseI thioredoxin reductase 2 Txnrd3 thioredoxin reductase 3 phaseI thioredoxin reductase 3 Ugt1a1 UDP glucuronosyltransferase 1 family, polypeptide A1 PhaseII Glucuronidation Ugt1a2 UDP glucuronosyltransferase 1 family, polypeptide A2 PhaseII Glucuronidation Ugt1a5 UDP glucuronosyltransferase 1 family, polypeptide A5 PhaseII Glucuronidation Ugt1a6a UDP glucuronosyltransferase 1 family, polypeptide A6A PhaseII Glucuronidation Ugt1a6b UDP glucuronosyltransferase 1 family, polypeptide A6B PhaseII Glucuronidation Ugt1a7c UDP glucuronosyltransferase 1 family, polypeptide A7C PhaseII Glucuronidation Ugt1a9 UDP glucuronosyltransferase 1 family, polypeptide A9 PhaseII Glucuronidation Ugt1a10 UDP glucuronosyltransferase 1 family, polypeptide A10 PhaseII Glucuronidation Ugt2a1 UDP glucuronosyltransferase 2 family, polypeptide A1 PhaseII Glucuronidation Ugt2a2 UDP glucuronosyltransferase 2 family, polypeptide A2 PhaseII Glucuronidation Ugt2a3 UDP glucuronosyltransferase 2 family, polypeptide A3 PhaseII Glucuronidation Ugt2b1 UDP glucuronosyltransferase 2 family, polypeptide B1 PhaseII Glucuronidation Ugt2b5 UDP glucuronosyltransferase 2 family, polypeptide B5 PhaseII Glucuronidation Ugt2b34 UDP glucuronosyltransferase 2 family, polypeptide B34 PhaseII Glucuronidation Ugt2b35 UDP glucuronosyltransferase 2 family, polypeptide B35 PhaseII Glucuronidation Ugt2b36 UDP glucuronosyltransferase 2 family, polypeptide B36 PhaseII Glucuronidation Ugt2b37 UDP glucuronosyltransferase 2 family, polypeptide B37 PhaseII Glucuronidation Ugt2b38 UDP glucuronosyltransferase 2 family, polypeptide B38 PhaseII Glucuronidation Ugdh UDP-glucose dehydrogenase PhaseII Glucuronidation (cofactors) Ugp2 UDP-glucose pyrophosphorylase 2 PhaseII Glucuronidation (cofactors) Sult1a1 sulfotransferase family 1A, phenol-preferring, member 1 PhaseII Sulfation Sult1b1 sulfotransferase family 1B, member 1 PhaseII Sulfation Sult1c1 sulfotransferase family, cytosolic, 1C, member 1 PhaseII Sulfation Sult1c2 sulfotransferase family, cytosolic, 1C, member 2 PhaseII Sulfation Sult1d1 sulfotransferase family 1D, member 1 PhaseII Sulfation Sult1e1 sulfotransferase family 1E, member 1 PhaseII Sulfation Sult2a1 sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 1 PhaseII Sulfation Sult2a2 sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 2 PhaseII Sulfation Sult2a3 sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 3 PhaseII Sulfation Sult2a4 sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 4 PhaseII Sulfation Sult2a5 sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 5 PhaseII Sulfation Sult2a6 sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 6 PhaseII Sulfation Sult2a7 sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 7 PhaseII Sulfation Sult2b1 sulfotransferase family, cytosolic, 2B, member 1 PhaseII Sulfation Sult3a1 sulfotransferase family 3A, member 1 PhaseII Sulfation Sult4a1 sulfotransferase family 4A, member 1 PhaseII Sulfation Sult5a1 sulfotransferase family 5A, member 1 PhaseII Sulfation Sult6b1 sulfotransferase family, cytosolic, 6B, member 1 PhaseII Sulfation Papss1 3'-phosphoadenosine 5'-phosphosulfate synthase 1 PhaseII Sulfation (cofactors) Papss2 3'-phosphoadenosine 5'-phosphosulfate synthase 2 PhaseII Sulfation (cofactors) Gsta1 glutathione S-transferase, alpha 1 PhaseII GSH conjugation Gsta2 glutathione S-transferase, alpha 2 PhaseII GSH conjugation Gsta3 glutathione S-transferase, alpha 3 PhaseII GSH conjugation Gsta4 glutathione S-transferase, alpha 4 PhaseII GSH conjugation Gstk1 glutathione S-transferase kappa 1 PhaseII GSH conjugation Gstm1 glutathione S-transferase mu 1 PhaseII GSH conjugation Gstm2 glutathione S-transferase mu 2 PhaseII GSH conjugation Gstm3 glutathione S-transferase mu 3 PhaseII GSH conjugation Gstm4 glutathione S-transferase mu 4 PhaseII GSH conjugation Gstm5 glutathione S-transferase mu 5 PhaseII GSH conjugation Gstm6 glutathione S-transferase mu 6 PhaseII GSH conjugation Gstm7 glutathione S-transferase mu 7 PhaseII GSH conjugation Gsto1 glutathione S-transferase omega 1 PhaseII GSH conjugation Gsto2 glutathione S-transferase omega 2 PhaseII GSH conjugation Gstp1 glutathione S-transferase, pi 1 PhaseII GSH conjugation Gstp2 glutathione S-transferase, pi 2 PhaseII GSH conjugation Gstt1 glutathione S-transferase, theta 1 PhaseII GSH conjugation Gstt2 glutathione S-transferase, theta 2 PhaseII GSH conjugation Gstt3 glutathione S-transferase, theta 3 PhaseII GSH conjugation Gstt4 glutathione S-transferase, theta 4 PhaseII GSH conjugation Gstz1 glutathione transferase zeta 1 (maleylacetoacetate isomerase) PhaseII GSH conjugation Gstcd glutathione S-transferase, C-terminal domain containing PhaseII GSH conjugation Mgst1 microsomal glutathione S-transferase 1 PhaseII GSH conjugation Mgst2 microsomal glutathione S-transferase 2 PhaseII GSH conjugation Mgst3 microsomal glutathione S-transferase 3 PhaseII GSH conjugation Hpgds hematopoietic prostaglandin D synthase PhaseII GSH conjugation Ltc4s leukotriene C4 synthase PhaseII GSH conjugation Ptges prostaglandin E synthase PhaseII GSH conjugation Alox5ap arachidonate 5-lipoxygenase activating protein PhaseII GSH conjugation Gclc glutamate-cysteine ligase, catalytic subunit PhaseII Glutathione synthesis Gclm glutamate-cysteine ligase, modifier subunit PhaseII Glutathione synthesis Nat1 N-acetyl transferase 1 PhaseII Acetylation Nat2 N-acetyltransferase 2 PhaseII Acetylation Nat3 N-acetyltransferase 3 PhaseII Acetylation Nat6 N-acetyltransferase 6 PhaseII Acetylation Nat8 N-acetyltransferase 8 PhaseII Acetylation Nat8l N-acetyltransferase 8-like PhaseII Acetylation Nat9 N-acetyltransferase 9 PhaseII Acetylation Nat10 N-acetyltransferase 10 PhaseII Acetylation Nat14 N-acetyltransferase 14 PhaseII Acetylation Comt catechol-O-methyltransferase PhaseII Methylation (O-methylation) Gamt guanidinoacetate methyltransferase PhaseII Methylation (N-methylation) Gnmt glycine N-methyltransferase PhaseII Methylation (N-methylation) Hnmt histamine N-methyltransferase PhaseII Methylation (N-methylation) Inmt indolethylamine N-methyltransferase PhaseII Methylation (N-methylation) Nnmt nicotinamide N-methyltransferase PhaseII Methylation (N-methylation) Pemt phosphatidylethanolamine N-methyltransferase PhaseII Methylation (N-methylation) Pnmt phenylethanolamine-N-methyltransferase PhaseII Methylation (N-methylation) Tpmt thiopurine methyltransferase PhaseII Methylation (S-methylation) As3mt arsenic (+3 oxidation state) methyltransferase PhaseII Methylation (inorganic arsenic methylation) Acsm1 acyl-CoA synthetase medium-chain family member 1 PhaseII Amino acid conjugation (medium-chain CoA ligase) Acsm2 acyl-CoA synthetase medium-chain family member 2 PhaseII Amino acid conjugation (medium-chain CoA ligase) Acsm3 acyl-CoA synthetase medium-chain family member 3 PhaseII Amino acid conjugation (medium-chain CoA ligase) Acsm4 acyl-CoA synthetase medium-chain family member 4 PhaseII Amino acid conjugation (medium-chain CoA ligase) Acsm5 acyl-CoA synthetase medium-chain family member 5 PhaseII Amino acid conjugation (medium-chain CoA ligase) Glyat glycine-N-acyltransferase PhaseII Amino acid conjugation (acyl-CoA: glycine N-acyltransferase) Glyatl3 glycine-N-acyltransferase-like 3 PhaseII Amino acid conjugation (acyl-CoA: glycine N-acyltransferase) Sars seryl-aminoacyl-tRNA synthetase PhaseII Amino acid conjugation (seryl-tRNA synthetase) Sars2 seryl-aminoacyl-tRNA synthetase 2 PhaseII Amino acid conjugation (seryl-tRNA synthetase) Soat1 sterol O-acyltransferase 1 PhaseII fatty acid conjugation Soat2 sterol O-acyltransferase 2 PhaseII fatty acid conjugation Lcat lecithin cholesterol acyltransferase PhaseII fatty acid conjugation Lipa lysosomal acid lipase A PhaseII fatty acid conjugation Slco1a1 Oatp1a1 solute carrier organic anion transporter family, member 1a1 transporters Uptake transporter for organic anions including xenobiotics and certain endogneous chemicals Slco1a4 Oatp1a4 solute carrier organic anion transporter family, member 1a4 transporters Uptake transporter for organic anions including xenobiotics and certain endogneous chemicals Slco1a5 Oatp1a5 solute carrier organic anion transporter family, member 1a5 transporters Uptake transporter for organic anions including xenobiotics and certain endogneous chemicals Slco1a6 Oatp1a6 solute carrier organic anion transporter family, member 1a6 transporters Uptake transporter for organic anions including xenobiotics and certain endogneous chemicals Slco1b2 Oatp1b2 solute carrier organic anion transporter family, member 1b2 transporters Uptake transporter for organic anions including xenobiotics and certain endogneous chemicals Slco1c1 Oatp1c1 solute carrier organic anion transporter family, member 1c1 transporters Uptake transporter for organic anions including xenobiotics and certain endogneous chemicals Slco2a1 Oatp2a1 solute carrier organic anion transporter family, member 2a1 transporters Uptake transporter for organic anions including xenobiotics and certain endogneous chemicals Slco2b1 Oatp2b1 solute carrier organic anion transporter family, member 2b1 transporters Uptake transporter for organic anions including xenobiotics and certain endogneous chemicals Slco3a1 Oatp3a1 solute carrier organic anion transporter family, member 3a1 transporters Uptake transporter for organic anions including xenobiotics and certain endogneous chemicals Slco4a1 Oatp4a1 solute carrier organic anion transporter family, member 4a1 transporters Uptake transporter for organic anions including xenobiotics and certain endogneous chemicals Slco4c1 Oatp4c1 solute carrier organic anion transporter family, member 4C1 transporters Uptake transporter for organic anions including xenobiotics and certain endogneous chemicals Slco5a1 Oatp5a1 solute carrier organic anion transporter family, member 5A1 transporters Uptake transporter for organic anions including xenobiotics and certain endogneous chemicals Slco6b1 Oatp6b1 solute carrier organic anion transporter family, member 6b1 transporters Uptake transporter for organic anions including xenobiotics and certain endogneous chemicals Slco6c1 Oatp6c1 solute carrier organic anion transporter family, member 6c1 transporters Uptake transporter for organic anions including xenobiotics and certain endogneous chemicals Slco6d1 Oatp6d1 solute carrier organic anion transporter family, member 6d1 transporters Uptake transporter for organic anions including xenobiotics and certain endogneous chemicals Slc15a1 Pept1 Solute carrier family 15 (oligopeptide transporter), member 1 transporters Peptide transporter Slc15a2 Pept2 Solute carrier family 15 (oligopeptide transporter), member 2 transporters Peptide transporter Slc22a1 Oct1 solute carrier family 22 (organic cation transporter), member 1 transporters Organic cation transporter (uptake) Slc22a2 Oct2 solute carrier family 22 (organic cation transporter), member 2 transporters Organic cation transporter (uptake) Slc22a3 Oct3 solute carrier family 22 (organic cation transporter), member 3 transporters Organic cation transporter (uptake) Slc22a4 Octn1 solute carrier family 22 (organic cation transporter), member 4 transporters Organic cation/carnitine transporter Slc22a5 Octn2 solute carrier family 22 (organic cation transporter), member 5 transporters Organic cation/carnitine transporter Slc22a21 Octn3 solute carrier family 22 (organic cation transporter), member 21 transporters Organic cation/carnitine transporter Slc22a6 Oat1 solute carrier family 22 (organic anion transporter), member 6 transporters Organic anion transporter (basolateral uptake) Slc22a7 Oat2 solute carrier family 22 (organic anion transporter), member 7 transporters Organic anion transporter (basolateral uptake) Slc22a8 Oat3 solute carrier family 22 (organic anion transporter), member 8 transporters Organic anion transporter (basolateral uptake) Slc22a12 Urat1 solute carrier family 22 (organic anion/cation transporter), member 12 transporters Urate anion exchanger Slc28a1 Cnt1 solute carrier family 28 (sodium-coupled nucleoside transporter), member 1 transporters Concentrative nucleoside transporter Slc28a2 Cnt2 solute carrier family 28 (sodium-coupled nucleoside transporter), member 2 transporters Concentrative nucleoside transporter Slc28a3 Cnt3 solute carrier family 28 (sodium-coupled nucleoside transporter), member 3 transporters Concentrative nucleoside transporter Slc29a1 Ent1 solute carrier family 29 (nucleoside transporters), member 1 transporters Equilibrative nucleoside transporter (bi-directional) Slc29a2 Ent2 solute carrier family 29 (nucleoside transporters), member 2 transporters Equilibrative nucleoside transporter (bi-directional) Slc29a3 Ent3 solute carrier family 29 (nucleoside transporters), member 3 transporters Equilibrative nucleoside transporter (bi-directional) Slc29a4 Ent4 solute carrier family 29 (nucleoside transporters), member 4 transporters Equilibrative nucleoside transporter (bi-directional) Slc47a1 Mate1 solute carrier family 47, member 1 transporters Multidrug and toxin extrusion apical efflux transporter Slc47a2 Mate2 solute carrier family 47, member 2 transporters Multidrug and toxin extrusion apical efflux transporter Abca1 ATP-binding cassette, sub-family A (ABC1), member 1 transporters Cholesterol efflux transporter Abcb1a Mdr1a ATP-binding cassette, sub-family B (MDR/TAP), member 1A transporters xenobiotics efflux transporter Abcb1b Mdr1b ATP-binding cassette, sub-family B (MDR/TAP), member 1B transporters xenobiotics efflux transporter Abcc1 Mrp1 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 transporters xenobiotics efflux transporter Abcc2 Mrp2 ATP-binding cassette, sub-family C (CFTR/MRP), member 2 transporters xenobiotics efflux transporter Abcc3 Mrp3 ATP-binding cassette, sub-family C (CFTR/MRP), member 3 transporters xenobiotics efflux transporter Abcc4 Mrp4 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 transporters xenobiotics efflux transporter Abcc5 Mrp5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 transporters xenobiotics efflux transporter Abcc6 Mrp6 ATP-binding cassette, sub-family C (CFTR/MRP), member 6 transporters xenobiotics efflux transporter Abcc8 Mrp7 ATP-binding cassette, sub-family C (CFTR/MRP), member 8 transporters xenobiotics efflux transporter Abcc9 Mrp8 ATP-binding cassette, sub-family C (CFTR/MRP), member 9 transporters xenobiotics efflux transporter Abcc10 Mrp10 ATP-binding cassette, sub-family C (CFTR/MRP), member 10 transporters xenobiotics efflux transporter Abcc12 Mrp12 ATP-binding cassette, sub-family C (CFTR/MRP), member 12 transporters xenobiotics efflux transporter Abcg2 Bcrp ATP-binding cassette, sub-family G (WHITE), member 2 transporters xenobiotics efflux transporter Abcg5 ATP-binding cassette, sub-family G (WHITE), member 5 transporters sterol efflux transporter (part of a dimer) Abcg8 ATP-binding cassette, sub-family G (WHITE), member 8 transporters sterol efflux transporter (part of a dimer) Atp7b ATPase, Cu++ transporting, beta polypeptide transporters copper efflux transporter Title: RNA-Seq Reveals Age- and Species Differences of CAR-targeted Drug-Processing Genes in Liver Authors: Sunny Lihua Cheng, Theo K. Bammler, and Julia Yue Cui Journal: Drug Metabolism and Disposition Supplemental Table 2. Expression of hepatic DPGs in WT and hCAR-TG mice following treatment of vehicle or a species-appropriate CAR ligand Gene Symbol Category D5WTCO mean s.e. D5WTTCP mean s.e. q value (D5WTCOvsD5WTTCP) D60WTCO mean s.e. D60WTTCP mean s.e. q value (D60WTCOvsD60WTTCP) D5hCARTGCO mean s.e. D5hCARTGCITCO mean s.e. q value (D5hCARTGCOvshCARTGCITCO) D60hCARTGCO s.e. D60hCARTGCITCO s.e. q value (D60hCARTGCOvsD60hCARTGCITCO) Aadac Phase I 253.0273333 15.44850183 291.622 8.400036131 0.156424 332.4803333 15.00845986 241.0486667 11.50334104 0.00021793 241.255 9.544270166 221.2673333 5.542613232 0.572038 341.352 5.640508606 287.4516667 10.3672421 0.218385 Ache Phase I 1.02232 0.060581058 0.900922667 0.027315197 0.18577 0.101308467 0.016590872 0.1068851 0.024988469 1 1.835663333 0.157239232 1.558776667 0.09662281 0.540464 0.155652 0.012932694 0.152105667 0.019989098 1 Adh1 Phase I 477.5053333 8.921284704 803.6516667 23.25577358 0.000325724 1170.25 57.84055181 1508.376667 19.62294773 0.2512 458.8983333 44.4992399 348.2873333 11.15000168 0.0339553 1286.69 55.31192035 1429.413333 77.26984844 0.569972 Adh4 Phase I 3.91215 0.353216473 1.56682 0.102176183 0.000325724 105.7077667 7.300593037 31.5951 4.952690693 0.00021793 3.496796667 0.143924152 2.437776667 0.2024591 0.10746 119.4486667 7.13633735 104.0220667 11.25072063 0.402124 Adh5 Phase I 121.103 4.410045011 133.6073333 3.541282316 0.556593 183.7726667 2.889145914 171.2593333 8.416084468 0.105248 106.208 2.5064032 139.718 0.914131464 0.0686878 200.1506667 4.778563289 209.404 4.888525374 0.838589 Adh6a Phase I 0.006639333 0.006639333 0 0 1 0.0348685 0.006213518 0.026598733 0.016842415 1 0.051811233 0.021594457 0 0 1 0.012908633 0.006455962 0.035877933 0.019698608 1 Adh7 Phase I 0.924890667 0.079838232 1.493636667 0.052984114 0.00421794 2.978653333 0.053356572 2.0655 0.123627285 0.00519036 1.047741 0.080335652 0.969290667 0.093091298 0.813282 2.453796667 0.203585273 2.376073333 0.14184184 0.985906 Adhfe1 Phase I 23.37473333 0.766507241 18.76873333 0.430029233 0.00231118 27.61123333 0.354348465 38.28993333 0.506642847 0.0129746 21.58523333 0.952414522 27.03206667 0.242721612 0.208999 31.77223333 0.69931936 36.17703333 2.074031884 0.329273 Akr1a1 Phase I 210.9396667 7.111714124 313.576 16.68033744 0.000325724 210.3276667 3.915080005 279.59 3.342525542 0.0554203 202.5376667 10.26893109 214.284 2.950212591 0.926666 215.9836667 3.731861123 257.5793333 5.303256557 0.123965 Akr1b10 Phase I 4.406813333 0.171866015 6.179443333 0.155335658 0.0232862 1.079031 0.136539541 3.419053333 0.283449915 0.00021793 4.77659 0.33455273 3.918043333 0.308339713 0.378238 0.899655 0.039297959 1.282836667 0.071661912 0.206971 Akr1b3 Phase I 2.878126667 0.737123711 5.57867 0.421080096 0.000616315 1.348684 0.190077561 2.748916667 0.405940228 0.0338709 4.93394 0.334903474 2.726756667 0.354504959 0.0213163 2.143466667 0.313473637 1.019828333 0.304777797 0.187836 Akr1b7 Phase I 54.132 6.461028415 320.789 11.20750271 0.000325724 0.316097333 0.11692625 117.377 10.33888272 0.00021793 80.4087 17.63315418 116.3538 12.95358624 0.0116535 0.821634667 0.076140569 14.52713333 1.655213765 0.00104766 Akr1b8 Phase I 5.82265 0.082336748 6.6821 0.486760469 0.762231 2.326456667 0.217148538 2.895823333 0.104344429 0.797035 5.90243 0.379743419 5.69785 0.290244072 0.799064 1.734213333 0.105322678 1.96421 0.041374698 0.831892 Akr1c12 Phase I 29.4687 0.951595355 31.92473333 1.102769363 0.692133 56.48346667 0.842049168 46.77936667 1.823333661 0.000781746 25.96013333 0.788654741 24.57193333 0.839236725 0.767643 46.19 1.437418068 56.78566667 0.249022364 0.043896 Akr1c13 Phase I 34.357 1.121121824 38.59033333 0.709530226 0.38613 70.3808 2.718942288 66.39226667 2.082831554 0.0932539 31.76036667 2.221726896 24.53443333 1.126946709 0.0399897 61.65036667 0.533862162 78.8901 0.284111791 0.0104096 Akr1c14 Phase I 81.83956667 5.557769709 132.3301667 16.63989159 0.000325724 162.9886667 7.358931316 219.955 2.290851443 0.0450037 57.24243333 11.895057 102.8226667 0.335853308 0.00147961 118.326 6.210113391 181.1036667 2.246302171 0.00104766 Akr1c18 Phase I 71.777 7.171294345 19.48436667 3.639540093 0.000325724 0.1539277 0.062412162 0.157511467 0.077656174 1 66.76833333 6.710938599 45.95606667 6.098537955 0.00147961 0.099615467 0.01272975 0.0831166 0.016702425 1 Akr1c19 Phase I 9.61296 1.839246463 38.20073333 1.39937099 0.000325724 42.3753 2.192414743 76.73823333 1.462674895 0.00021793 16.238 1.879406345 15.52143333 0.435761928 0.770397 34.49936667 0.482430535 64.47246667 3.110550887 0.00104766 Akr1c20 Phase I 52.48103333 2.215678925 22.61876667 1.485757255 0.000325724 34.61923333 2.338502783 21.05853333 1.050517035 0.00021793 41.12513333 5.439204539 29.14246667 1.192425049 0.00271992 35.3873 0.33950974 29.05763333 0.471075261 0.133425 Akr1c21 Phase I 0.058696767 0.036081224 0.021737833 0.01245892 1 0.105023933 0.038162658 0.023530533 0.013244664 1 0.015268167 0.007701729 0.057231933 0.036444737 1 0.086544867 0.021803669 0.069924533 0.0331127 1 Akr1c6 Phase I 376.97 14.78751676 533.2666667 9.325846527 0.000325724 810.5856667 47.38042072 668.2096667 30.64370502 0.00814281 323.121 33.48356434 289.349 5.685028848 0.477226 777.054 42.30655392 719.9916667 14.4924892 0.80101 Akr1d1 Phase I 72.21113333 5.603380147 90.5511 7.464007591 0.00636691 65.83186667 4.067135165 208.8363333 5.145977113 0.00021793 66.0424 9.869970813 78.03683333 0.547302982 0.375882 74.9328 1.378946026 85.29096667 5.805315659 0.31802 Akr1e1 Phase I 19.12966667 1.188594578 14.44326667 0.406175173 0.00209839 18.7002 0.446284136 15.76036667 0.453055833 0.00318463 17.7341 0.718436017 13.08293333 0.176709011 0.0182361 19.22816667 0.452118953 17.6492 1.498057497 0.762883 Akr7a5 Phase I 38.271 1.716510274 60.65746667 2.857638388 0.000325724 60.214 1.5739611 63.532 0.701834197 0.729482 41.40876667 3.039515343 46.5586 0.919609635 0.683164 61.98353333 0.23018529 75.35023333 4.786821604 0.0677005 Aldh16a1 Phase I 14.83486667 0.544226477 15.13583333 0.504130328 0.843117 17.66163333 0.213736008 18.5601 0.507718337 0.741422 16.33843333 1.746228905 15.9115 0.189319844 0.871916 19.11936667 0.407547565 20.45046667 0.697161297 0.789301 Aldh18a1 Phase I 2.78513 0.187847556 2.739693333 0.176605188 0.197526 0.385565 0.015542801 1.012429 0.055506337 0.00021793 3.978506667 0.309485927 2.481643333 0.148078815 0.00147961 0.502744333 0.019593876 0.461409333 0.057520264 0.907362 Aldh1a1 Phase I 4.375003333 0.826242983 103.2040667 6.344509669 0.000325724 553.8426667 30.51468335 1549.613333 43.48070466 0.00021793 5.00342 1.130620681 29.81573333 2.346710624 0.00147961 602.1693333 6.465805166 1057.339 38.87913739 0.00104766 Aldh1a2 Phase I 0.542403 0.062278032 0.52387 0.070004255 0.392237 0.177727333 0.009113686 0.123224833 0.072592812 1 0.538841 0.119331752 0.531627333 0.066409473 0.942309 0.367903333 0.140470589 0.1409029 0.031192803 0.0175633 Aldh1a3 Phase I 0.588880667 0.04760388 0.64206 0.131171454 0.938974 0.130593 0.005399466 0.110764067 0.01843392 1 0.561369333 0.083607204 0.685377667 0.170747007 0.659382 0.162651667 0.02340421 0.206523 0.020175824 1 Aldh1a7 Phase I 5.00888 1.012505223 285.6406667 9.667847577 0.000325724 76.0536 2.498640491 438.7693333 9.360580063 0.00021793 5.710006667 0.963767817 42.05953333 1.257975257 0.00147961 112.999 6.300451121 207.9863333 14.20485589 0.00104766 Aldh1b1 Phase I 48.0761 8.172652398 71.82826667 4.063022072 0.000325724 21.29013333 2.530381688 31.5938 2.750465245 0.000604071 55.6748 2.83527452 58.2778 3.371940282 0.943354 33.98543333 2.426614892 37.45353333 0.953849921 0.518585 Aldh1l1 Phase I 135.8676667 1.266632061 121.901 7.350693233 0.0401055 316.2876667 15.0446651 265.7963333 9.507527567 0.0160125 127.9666667 5.300772438 139.062 2.65927252 0.812262 459.0466667 34.70844518 456.4883333 6.788832799 0.99147 Aldh1l2 Phase I 0.081433667 0.023422993 0.110989233 0.013195149 1 0.052748033 0.008069349 0.063832267 0.019504831 1 0.121678333 0.005321307 0.077034067 0.009102265 1 0.039735567 0.009726849 0.032141233 0.007062603 1 Aldh2 Phase I 199.4683333 7.535834224 160.0586667 5.932049683 0.000616315 452.7313333 5.852829297 340.0733333 4.131179506 0.000959549 201.3886667 9.163891356 190.5483333 4.414591122 0.731232 497.0756667 5.585394177 512.427 12.93002626 0.907616 Aldh3a1 Phase I 0.006364767 0.006364767 0.005350833 0.005350833 1 0.005692267 0.005692267 0.022641033 0.011395535 1 0.0105893 0.005302396 0.005074867 0.005074867 1 0.0181968 0.011283754 0.006194767 0.006194767 1 Aldh3a2 Phase I 85.4175 3.280023125 95.7833 2.555247139 0.603431 82.94853333 7.867877636 108.5283333 2.370452301 0.0891448 84.81933333 6.36199072 71.01466667 1.749299085 0.177114 60.72283333 2.795808654 60.10823333 2.54143529 0.997122 Aldh3b1 Phase I 3.4099 0.113319477 4.689986667 0.150227584 0.0302806 1.33456 0.028417344 3.268316667 0.2986311 0.00021793 4.120066667 0.463119635 3.146456667 0.179134 0.141635 1.101766667 0.060110508 1.9776 0.173727372 0.00104766 Aldh3b2 Phase I 0.061548367 0.002299517 0.040577967 0.016581029 1 0.01213979 0.010010803 0.033385867 0.007360323 1 0.051958567 0.010685391 0.046262767 0.007570775 1 0.032697267 0.01947069 0.01580726 0.007721177 1 Aldh4a1 Phase I 158.441 11.0312063 125.1813333 5.125477419 0.00618698 115.7053333 2.631264419 114.2883333 2.331008389 0.326673 154.6933333 11.12960626 147.9906667 0.168041992 0.748791 135.3143333 2.673997902 134.377 3.068840226 0.993883 Aldh5a1 Phase I 8.604886667 0.334477 8.08747 0.285930189 0.370401 12.2957 0.23806056 10.59326667 0.194599729 0.00929413 8.763873333 0.272566824 8.79108 0.240727126 0.939903 12.0993 0.248223911 12.27583333 0.320261593 0.948075 Aldh6a1 Phase I 83.26796667 2.342915315 57.0622 1.611019312 0.000325724 124.1546667 3.685489942 83.5652 2.950305302 0.00021793 73.94163333 3.472172103 82.3112 1.259725236 0.694931 118.588 1.829802539 127.2856667 3.063012805 0.704911 Aldh7a1 Phase I 55.89473333 3.356993928 80.33976667 3.100968599 0.000325724 137.6533333 4.676603088 143.0256667 1.411371595 0.627561 64.61576667 4.379273164 69.9899 3.275586156 0.849482 160.521 3.742338351 181.794 3.890186628 0.393213 Aldh8a1 Phase I 77.5483 2.802431502 97.7018 0.997527027 0.0172837 124.5483333 3.382263608 130.4596667 1.993741068 0.676128 71.7723 0.944886582 84.45696667 0.824318194 0.433932 128.5326667 2.090538554 139.9686667 2.749092598 0.605137 Aldh9a1 Phase I 57.00583333 1.144312496 71.88173333 2.995236168 0.0231545 79.55246667 2.507883347 83.2144 1.819978352 0.664507 57.07523333 3.404711469 55.23893333 0.163345772 0.798684 84.9065 0.762423329 77.09696667 2.294021893 0.673699 Alox5ap Phase I 9.93268 0.985932543 10.28669667 0.260690252 0.791969 2.560653333 0.245525088 2.517163333 0.1306494 0.504465 11.28783333 0.878537441 10.18556667 1.057994166 0.578355 3.135846667 0.238969405 2.73674 0.066968435 0.756838 Alpl Phase I 4.833536667 0.220510857 6.97911 0.273171966 0.000887381 3.93724 0.083591353 10.73739 1.166061025 0.00021793 7.348396667 0.35823857 7.25855 0.202368749 0.900476 4.55312 0.763973496 4.29763 0.579763142 0.91823 Aoc1 Phase I 0.127260867 0.042265866 0.166466667 0.025064834 1 0.012892947 0.008570229 0.02560235 0.008147808 1 0.380569333 0.085312952 0.091992467 0.012136496 0.00147961 0.016592967 0.008436718 0.043752667 0.015868336 1 Aoc2 Phase I 0.479396333 0.063541325 0.62064 0.046951035 0.547082 0.501111333 0.037733264 0.344526667 0.00285777 0.0106563 0.809036667 0.077009748 1.016952333 0.073422515 0.64086 0.496125333 0.072432162 0.326741333 0.00447666 0.296707 Aoc3 Phase I 0.277391667 0.068249625 0.27066 0.121108212 0.211535 0.040741733 0.008038361 0.0434759 0.008979891 1 0.321205 0.089754075 0.208249333 0.024520752 0.113579 0.299867 0.251359628 0.105075967 0.031543061 0.00104766 Aox1 Phase I 1.81309 0.071296867 7.33186 0.331972296 0.000325724 19.49966667 1.378260625 40.41236667 0.581196115 0.00021793 2.211716667 0.177802083 2.68111 0.116498303 0.411911 17.89436667 0.994795976 31.8167 0.891590023 0.00104766 Aox2 Phase I 0.005075067 0.002912632 0.009813957 0.00278184 1 0.003655577 0.001834432 0.008739847 0.00346562 1 0.006767017 0.001684455 0.008219327 0.001771508 1 0.007368527 0.003735965 0.001911513 0.001911513 1 Aox3 Phase I 26.68596667 2.216315175 48.35466667 1.718163394 0.000325724 177.5203333 16.25564005 54.59003333 0.31541577 0.00021793 29.77286667 1.754272862 37.26496667 0.612211253 0.184612 155.0636667 5.606551951 157.8213333 8.673549395 0.94799 Aox4 Phase I 0.003504363 0.001768735 0.004692467 0.002692555 1 0.001685143 0.001685143 0 0 1 0.01136381 0.001637753 0.0125755 0.004108066 1 0 0 0.0016122 0.0016122 1 Bche Phase I 20.45723333 0.712215067 9.65989 1.140106295 0.000325724 18.5781 1.272970119 17.9423 0.622595168 0.182598 18.41495667 4.345893143 19.1511 0.228306731 0.92855 16.3021 0.502832338 13.86023333 1.143893139 0.256967 Bphl Phase I 70.1705 4.126460336 95.74623333 2.444086934 0.000325724 91.6254 2.02380803 91.036 3.107450696 0.315774 71.30206667 1.844728533 62.53283333 1.144835607 0.354843 96.1646 2.873556447 109.977 3.93876787 0.290363 Cbr1 Phase I 81.5779 6.641804762 204.4186667 4.944955016 0.000325724 48.25596667 4.060506225 148.0896667 4.375606866 0.00021793 103.8560667 11.09660382 205.6223333 3.575232222 0.00147961 47.51183333 2.415491438 60.34053333 4.269096039 0.0192378 Cbr2 Phase I 0.292409933 0.158164153 0.250737433 0.094121729 0.0548063 0.07966 0.03809174 0.049500767 0.036451123 1 0.229242333 0.023895662 0.069832767 0.015959211 1 0.2630428 0.223490711 0.161635133 0.091049376 0.643331 Cbr3 Phase I 0.875072 0.069872411 2.97364 0.177098881 0.000325724 0.431762333 0.042770311 4.59553 0.094190125 0.00021793 1.384413333 0.204611859 2.22758 0.135126295 0.216558 0.456874333 0.094938235 0.636869667 0.052356915 0.577794 Cbr4 Phase I 20.69213333 0.663955009 18.52843333 0.589369653 0.170696 14.36403333 0.4764656 15.7527 0.395026345 0.990601 18.66833333 1.229438383 19.63326667 0.185777325 0.930792 14.2805 0.282906492 15.28813333 0.443672407 0.760295 Ces1a Phase I 1.343203333 0.037491458 2.278683333 0.130316625 0.0259308 1.401216667 0.179667412 1.3046 0.099198469 0.539527 1.149913333 0.058938178 1.35994 0.027950583 1 1.06353 0.019089505 1.751483333 0.148911755 1 Ces1b Phase I 39.7717 1.747301168 56.8044 5.811975232 0.000325724 55.8604 3.534360297 44.36733333 2.407088367 0.00021793 39.8174 2.066195529 40.33856667 1.530646949 0.00271992 56.81876667 1.263284268 67.12676667 4.548939242 0.958364 Ces1c Phase I 1298.06 38.00964921 2390.1 142.4600549 0.000325724 1297.28 91.86204494 1361.58 32.11733696 0.626447 1124.076667 25.40993004 1453.213333 64.32626896 0.120749 1255.866667 27.59564841 1706.073333 84.04197014 0.00286989 Ces1d Phase I 221.918 11.26586601 453.261 7.909836303 0.000325724 297.507 19.66925622 444.8816667 20.73303696 0.00179544 235.9476667 6.886178919 355.3883333 10.84817345 0.00385914 328.0203333 14.83803485 608.0013333 10.23081074 0.00104766 Ces1e Phase I 20.4361 0.908057818 40.4617 1.297179336 0.000325724 58.10626667 1.606376556 48.20573333 3.396737872 0.00021793 24.5514 1.852107519 33.428 1.385145021 0.149743 65.77386667 2.145536942 75.0887 2.644737269 0.585175 Ces1f Phase I 4.2301 0.293466689 1.291273333 0.103879648 0.000325724 180.642 9.271702325 119.617 7.839769406 0.00021793 9.501996667 1.040209916 5.665606667 1.104459104 0.00147961 189.6083333 5.666271976 222.2263333 6.389603857 0.180112 Ces1g Phase I 26.14643333 4.605187899 118.915 6.054251977 0.000325724 84.50996667 3.91505764 121.3886667 1.033647479 0.00405297 28.83153333 3.75779181 120.2016667 4.724299466 0.00147961 124.1306667 4.200547041 210.951 15.27462042 0.00104766 Ces2a Phase I 74.6526 1.777192174 1416.263333 69.00641524 0.000325724 246.1486667 3.709732081 2997.363333 149.3529016 0.00021793 62.2673 10.01496148 182.7683333 11.18245406 0.00147961 215.1506667 6.832326723 773.091 9.407928908 0.00104766 Ces2b Phase I 0.595662667 0.057571404 5.083113333 0.394734158 0.115403 3.177366667 1.258443851 10.61751333 0.824940845 0.00021793 0.625039667 0.052200348 0.765959667 0.035522973 0.0302918 1.365786667 0.04706663 2.85209 0.110703855 0.901038 Ces2c Phase I 2.081573333 0.381655453 13.4778 0.548646237 0.000325724 34.16543333 6.161053593 126.254 5.560956423 0.00021793 2.694476667 0.099822833 2.76669 0.142045515 0.74523 34.00273333 3.253898595 60.79163333 1.921008836 0.00104766 Ces2e Phase I 133.478 5.884154088 102.8648667 5.980950393 0.000325724 70.094 4.506412352 122.388 1.991681701 0.0281857 111.0348667 11.73934418 89.24873333 2.540302424 0.058574 89.561 3.049449667 97.68516667 5.032446426 0.887746 Ces2f Phase I 0.02978008 0.015509663 0.490368667 0.080069586 0.397469 0.045325667 0.009591072 1.081573333 0.158198962 0.088653 0.041399833 0.0027596 0.072054767 0.015472502 1 0.082456267 0.011016995 0.266356667 0.018589606 1 Ces2g Phase I 10.34072333 0.310870262 13.96496667 1.014920641 0.00657173 16.04836667 1.195466756 44.41183333 1.371145157 0.00021793 9.957183333 0.848633868 9.096196667 0.301913434 0.586764 21.80523333 0.33291803 24.9629 0.143033469 0.344583 Ces2h Phase I 0.329300333 0.073544944 0.469800667 0.054082158 1 0.321979333 0.052291107 1.403063333 0.093311779 0.00021793 0.383532 0.084357541 0.227084 0.005000464 1 0.583428333 0.037627878 0.610434 0.054930248 1 Ces3a Phase I 29.4905 3.025528113 19.90606667 2.608836696 0.000325724 1048.074333 105.3483385 317.732 47.68678329 0.00021793 65.48613333 5.896580217 36.60743333 3.632327919 0.00147961 864.934 19.90360232 833.1 18.48648605 0.979427 Ces3b Phase I 1.678926667 0.121430446 1.170453333 0.180196641 1 316.6583333 19.99743621 91.2623 9.362472401 0.00021793 3.655313333 0.40328545 2.02548 0.229202396 1 287.929 18.56642228 269.399 8.434540118 0.863504 Ces4a Phase I 0.014349933 0.003139586 0.003362933 0.003362933 1 2.464363333 0.887550942 0.108424967 0.035721844 0.00021793 0.01724402 0.006844747 0.0035678 0.0035678 1 1.081384333 0.167250043 0.307158333 0.067258355 0.00104766 Ces5a Phase I 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 0.004345733 0.004345733 0 0 1 Cpb2 Phase I 139.9086667 10.00593231 152.158 2.355012597 0.713409 237.767 7.572638202 191.9106667 8.197093333 0.00979919 140.0413333 5.13172831 145.6463333 0.084715865 0.969172 231.8313333 5.035401352 226.9753333 2.781545394 0.986693 Cpe Phase I 6.54218 1.018480568 3.4391 0.216710813 0.000325724 0.765514333 0.080638496 0.601969 0.084322571 0.052022 4.4437 0.095758202 4.567913333 0.702556185 0.996213 1.697687 0.618910123 0.755545667 0.304361236 0.00104766 Cyp1a1 Phase I 0.129731333 0.02517765 0.607871333 0.012842513 1 0.884978667 0.087009947 2.74095 0.022891257 0.00021793 0.098865733 0.016716378 2.328356667 0.023058555 0.00147961 1.031997333 0.056803214 1.422686667 0.057562516 0.00104766 Cyp1a2 Phase I 60.68903333 8.606101909 346.9783333 16.6020366 0.000325724 320.947 18.13346634 929.1453333 25.51084421 0.00021793 59.93923333 4.262534732 388.4393333 5.194755764 0.00147961 403.004 11.42198714 802.2696667 10.38071116 0.00104766 Cyp1b1 Phase I 0.139194233 0.04990155 0.086860367 0.023891908 1 0.146108667 0.020018592 0.088668767 0.010419893 1 0.105757333 0.015390702 0.132140067 0.029300715 1 0.295579 0.162922703 0.136671333 0.019558833 0.00515795 Cyp2a12 Phase I 160.0606667 13.48614183 463.262 15.25650007 0.000325724 326.924 16.98633422 498.019 25.98542178 0.0016329 197.2066667 8.786436903 278.642 16.5485246 0.00924814 314.2456667 6.102592573 372.2866667 2.430069295 0.162556 Cyp2a22 Phase I 67.70633333 4.592920168 77.2842 5.408729404 0.197526 11.57468 1.30353312 22.36073333 2.019284462 0.00021793 64.27803333 2.480231355 68.27343333 1.447386887 0.993945 10.52767 0.581495208 11.64523333 0.163091532 0.924847 Cyp2a4 Phase I 3.356043333 0.424373215 26.80726667 1.633986989 0.000325724 16.61063333 4.908206845 93.237 3.855205512 0.00021793 4.552863333 1.210644636 2.983086667 0.098677309 0.00147961 10.51549 0.731546936 29.41953333 0.500777377 0.133857 Cyp2a5 Phase I 7.535026667 1.113452814 190.6236667 14.10038215 0.000325724 188.4106667 46.22689961 1004.825333 26.62252578 0.00021793 12.2312 1.170673585 14.2806 1.337531343 0.586833 145.2913333 8.682773258 417.4343333 7.827051751 0.00104766 Cyp2ab1 Phase I 0.039604233 0.019940985 0.020710273 0.005988727 1 0.028789967 0.004827521 0 0 1 0.033868553 0.016050628 0.00912156 0.005459831 1 0.018371233 0.00447691 0.022761333 0.00347132 1 Cyp2b10 Phase I 4.26184 0.679793333 1693.886667 47.58082819 0.000325724 12.88425667 2.39946234 2596.416667 103.8166593 0.00021793 2.810273333 1.22720438 435.407 16.15796947 0.00147961 225.31 9.502684691 1226.34 17.91457879 0.00104766 Cyp2b13 Phase I 15.69146667 1.193899829 87.6774 3.190604813 0.000325724 1.002801667 0.521821427 103.9636667 0.864622525 0.00021793 16.093 1.302442832 30.3684 0.913304934 0.250439 6.579216667 0.377445948 37.45336667 0.62870969 0.0164783 Cyp2b19 Phase I 0.005066723 0.003068086 0.115285133 0.01030772 1 0 0 0.123459933 0.026469354 1 0.009557307 0.005664041 0.030857967 0.009170937 1 0.002921237 0.002921237 0.0484117 0.007033018 1 Cyp2b23 Phase I 0.013654033 0.008549313 0.233598667 0.042181871 1 0.0159029 0.010459954 0.32178 0.098524578 0.088653 0.026288417 0.013024709 0.076410833 0.015534638 1 0.0347338 0.010465507 0.152356 0.024417929 1 Cyp2b9 Phase I 141.774 10.15914491 121.9756667 7.781509586 0.0220275 10.69121633 6.255546999 88.9478 8.87408493 0.00021793 149.3706667 19.21558076 141.788 2.476195738 0.748791 1.266863333 0.050256231 1.7324 0.065387229 0.00104766 Cyp2c29 Phase I 29.84966667 9.753392456 6436.496667 47.37193344 0.000325724 945.653 87.19802218 6596.61 187.9332356 0.00021793 5.534103333 1.804915142 409.4613333 42.71934313 0.00147961 2422.903333 99.94746792 4444.83 222.4682765 0.00104766 Cyp2c37 Phase I 148.8223333 23.47120551 1188.14 38.22188684 0.000325724 224.3936667 32.34121716 917.4606667 26.26219473 0.00021793 75.49976667 22.22791839 329.5916667 14.10404997 0.00147961 253.6723333 13.96352021 547.1533333 29.20600276 0.00104766 Cyp2c38 Phase I 0.032027633 0.002876901 0.644683667 0.124667438 0.000887381 14.32410333 4.384949164 4.79438 0.381112014 0.00021793 0.011828033 0.00673378 0.0566493 0.008354085 1 5.847756667 0.391061504 5.110843333 0.25630214 0.523991 Cyp2c39 Phase I 0.0827696 0.035637768 5.947373333 0.287781077 0.000325724 2.0771 0.341275503 7.737156667 0.391117667 0.00021793 0.0847637 0.017751004 0.488587 0.074576366 1 2.72581 0.067355728 4.638203333 0.242823984 0.445854 Cyp2c40 Phase I 51.7386 0.386547039 67.78076667 3.08718172 0.0153952 89.37896667 6.283561297 17.70656667 1.298466912 0.00021793 57.07353333 3.667084745 50.61786667 0.541623351 0.0319213 35.48953333 2.336190829 18.16503333 1.058025983 0.00104766 Cyp2c44 Phase I 80.13903333 1.757964535 63.31266667 0.827998054 0.000325724 150.0973333 17.21739684 37.5717 3.900753279 0.00021793 92.69133333 0.147888858 86.4608 2.92137187 0.648307 136.3223333 9.249198025 143.1403333 10.33451441 0.819521 Cyp2c50 Phase I 54.99473333 8.371439839 1846.706667 57.90009624 0.000325724 500.7783333 42.7591584 2373.06 26.33175459 0.00021793 21.95012667 8.399383593 501.3373333 40.08878231 0.00147961 707.9126667 31.21868305 1465.603333 79.1304388 0.00104766 Cyp2c54 Phase I 17.15924 3.944698816 603.2613333 26.88797635 0.000325724 213.1366667 32.62289597 993.2873333 48.9350381 0.00021793 7.261146667 2.667567272 150.549 14.9587396 0.00147961 300.572 15.46752832 614.2813333 29.3596252 0.00104766 Cyp2c55 Phase I 1.66503 0.313304951 473.1756667 16.1738499 0.000325724 6.220213333 0.657005495 771.3963333 33.61147737 0.00021793 3.911173333 0.63250168 31.21353333 1.949708881 0.00147961 12.62096667 1.327519093 177.289 12.35838106 0.00104766 Cyp2c65 Phase I 0.037869867 0.024617542 0.332182 0.025512564 0.00750399 0.005599967 0.002936666 0.783777333 0.08914487 0.00021793 0.320950167 0.121692966 0.013072067 0.007128012 0.34617 0.0892654 0.041102611 0.873065667 0.189785268 0.00104766 Cyp2c66 Phase I 0.002071057 0.002071057 0.066305333 0.026992198 1 0.008794007 0.005215114 0.201026633 0.071677361 1 0.025946833 0.013486038 0.000988957 0.000988957 1 0.051543733 0.012700012 0.302289967 0.172517761 1 Cyp2c67 Phase I 30.8025 1.899279808 38.47373333 2.526889192 0.98044 145.706 3.949024225 24.4715 2.372659723 0.00021793 33.81236667 3.024563487 33.13066667 0.581603136 0.974919 91.68246667 6.079343419 48.24096667 0.665781747 0.00104766 Cyp2c68 Phase I 144.5636667 0.485570569 163.1686667 6.997579113 0.802103 157.4166667 10.05392654 74.83796667 3.050802147 0.00021793 124.6386667 3.695698055 133.7386667 0.889285543 0.852308 82.64453333 4.019420143 53.96806667 3.845062311 0.00104766 Cyp2c69 Phase I 39.31866667 3.353112386 52.54866667 1.965311377 0.0391756 51.05516667 5.21393985 9.242506667 0.507997645 0.00021793 53.98676667 6.314676088 44.12763333 1.140267374 0.0434038 18.59026667 0.330434791 10.25684333 0.66599586 0.00104766 Cyp2c70 Phase I 136.971 16.57692785 173.5576667 4.868898997 0.735108 338.7303333 26.1588803 231.142 9.373709565 0.00021793 117.0212667 15.92806269 81.0964 1.974146095 0.00147961 329.21 28.08847609 260.46 17.46542299 0.0529885 Cyp2d10 Phase I 146.686 6.862835881 245.6653333 5.899018826 0.000325724 428.8763333 5.213248326 583.5213333 4.339044915 0.0660213 145.3413333 9.798980514 160.411 3.549656087 0.812644 406.1623333 4.816303435 486.4763333 18.33889398 0.0992639 Cyp2d11 Phase I 11.1522 0.512404518 17.70446667 0.503899237 0.13882 36.9215 0.058583018 49.3137 0.560893433 0.808111 12.2211 1.0593824 13.43233333 0.298303321 0.763195 35.12683333 0.819440391 41.48393333 1.644470641 0.360096 Cyp2d12 Phase I 3.97626 0.251422116 5.70609 0.170105011 0.169232 46.101 4.859059466 61.20756667 5.33902024 0.000781746 6.767116667 1.092791769 8.368956667 0.222481598 0.310069 40.1346 2.622298944 59.34936667 3.679689714 0.00104766 Cyp2d13 Phase I 10.77949 0.901362723 8.812173333 0.207287698 0.000325724 127.0196667 6.552678977 81.8833 5.380012574 0.00021793 12.4712 0.715533719 11.89463333 0.789765324 0.548939 101.1390333 2.541123249 112.1546667 3.987371746 0.483537 Cyp2d22 Phase I 40.74523333 1.723700777 64.5446 4.417404588 0.000325724 82.25986667 2.632623919 90.08903333 1.999867483 0.843151 39.70603333 2.90023648 46.4942 0.820337408 0.231409 90.16803333 1.583554809 109.524 2.32616186 0.0628041 Cyp2d26 Phase I 526.765 10.17943648 462.344 13.80555109 0.0430135 420.4236667 28.22513959 251.7906667 9.006275892 0.00021793 536.7286667 29.12962261 488.9653333 6.021157594 0.545127 409.7436667 6.817293362 408.4366667 20.95081388 0.998864 Cyp2d34 Phase I 5.03683 0.096828587 5.80022 0.339143687 1 9.175426667 0.2708249 10.15176 0.291060208 0.197212 4.864823333 0.26765227 4.99265 0.059841827 1 9.05021 0.052946812 9.818473333 0.408768326 1 Cyp2d40 Phase I 12.8843 0.942306173 9.37895 0.469587334 0.000325724 66.7127 2.778564029 33.62353333 1.065768643 0.00021793 13.74776667 1.084780531 11.7724 0.190200035 0.223986 56.92006667 0.624574365 49.43346667 5.166416073 0.00368605 Cyp2d9 Phase I 58.0031 1.462497304 82.01956667 4.202706699 0.000325724 669.496 77.79348772 886.8733333 76.26295613 0.123597 100.5063333 18.11679831 125.4703333 6.371836217 0.235724 591.177 27.25477927 880.4173333 45.31443218 0.00104766 Cyp2e1 Phase I 1299.89 24.81035335 1928.766667 101.495578 0.000325724 3146.466667 339.8206603 944.7076667 59.96502443 0.00021793 1154.1 42.39054258 1060.123333 8.122668554 0.589671 2466.156667 142.3582056 2837.15 92.41735605 0.447547 Cyp2f2 Phase I 23.16316667 2.081374038 47.23113333 0.78217923 0.000325724 796.0716667 21.10730525 544.1423333 31.7102615 0.00021793 64.7607 10.99747928 49.56633333 4.727534965 0.0270687 690.5046667 42.48260167 736.631 50.41635404 0.747298 Cyp2g1 Phase I 1.20682 0.077514244 1.82142 0.130867623 0.00862056 0.584921 0.156920579 1.019916667 0.055898427 0.00405297 1.408476667 0.237826516 1.21708 0.083120371 0.711081 0.276608333 0.033897186 0.789676 0.179002086 0.00104766 Cyp2j11 Phase I 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 Cyp2j12 Phase I 0 0 0.004294533 0.004294533 1 0.003147537 0.001579715 0.001416307 0.001416307 1 0 0 0.001357153 0.001357153 1 0.002878133 0.002878133 0.004367267 0.004367267 1 Cyp2j13 Phase I 0.003919153 0.000201791 0.005984127 0.002161247 1 0.009815903 0.000875932 0.0109992 0.0024124 1 0.005000843 0.001765648 0.004090043 0.001477454 1 0.0128545 0.000222866 0.009919747 0.002068099 1 Cyp2j5 Phase I 35.30293333 3.861654463 51.3638 2.444266525 0.000325724 153.0303333 5.658532859 106.9622667 4.517064741 0.00021793 33.63276667 3.204714149 42.73153333 0.648556691 0.13646 148.2103333 2.310702947 170.0916667 6.944297357 0.295878 Cyp2j6 Phase I 8.127316667 0.291391854 8.500243333 0.610244171 0.579939 17.6121 0.42008229 12.2556 0.238685735 0.00021793 7.46762 0.283234804 7.381376667 0.073442293 0.904032 19.53363333 0.616124904 16.712 0.746999337 0.316097 Cyp2j8 Phase I 0.0441961 0.019996594 0.082375367 0.015319001 1 0.170420667 0.04339778 0.100304733 0.006447613 1 0.029726267 0.009145667 0.056291367 0.015292624 1 0.188706667 0.03315707 0.233242 0.040083779 1 Cyp2j9 Phase I 1.75038 0.361636472 2.658723333 0.306978001 0.148747 3.832323333 0.115774676 3.133866667 0.360115825 0.00774719 1.254140333 0.226439617 4.696973333 0.275574182 0.00147961 3.254203333 0.160232153 4.456303333 0.386377755 0.0203707 Cyp2r1 Phase I 2.569423333 0.262453432 5.28706 0.209519342 0.000325724 7.82947 0.288158809 16.67553333 0.165129458 0.00021793 2.628706667 0.371831394 2.844516667 0.026053145 0.896155 8.81017 0.33724653 9.78139 0.181252543 0.612364 Cyp2s1 Phase I 0.739456333 0.109737135 0.582603 0.055202875 0.0106881 0.211109333 0.036825094 0.162720433 0.057915816 1 0.985944 0.405627031 0.970336 0.012375915 0.901407 0.322839 0.077310665 0.251492333 0.133199564 0.687358 Cyp2t4 Phase I 0.030089233 0.004909395 0.0397668 0.020488209 1 0.006540233 0.006540233 0 0 1 0.028468867 0.010293487 0.012052633 0.012052633 1 0.023989233 0.014920183 0 0 1 Cyp2u1 Phase I 0.391741 0.041972812 0.206356 0.018734849 0.0252065 6.154216667 1.366764078 1.968253333 0.083437279 0.00021793 0.804946333 0.07165283 0.510280333 0.066704813 0.0943141 3.6039 0.202718139 2.00333 0.193383789 0.00104766 Cyp2w1 Phase I 0 0 0 0 1 0 0 0 0 1 0.005448433 0.005448433 0 0 1 0 0 0 0 1 Cyp3a11 Phase I 368.555 34.40232466 3495.476667 103.2469881 0.000325724 3367.56 139.7045802 13579.53333 646.6925192 0.00021793 331.5083333 32.10502908 1404.463333 51.83578376 0.00147961 2740.383333 66.58679457 10973.63333 516.7788835 0.00104766 Cyp3a13 Phase I 24.85583333 2.370725466 130.2063333 8.22081566 0.000325724 58.4854 7.667321629 142.9163333 3.15675637 0.00021793 28.02973333 1.442896844 41.45686667 0.570036871 0.00271992 58.63676667 0.800527456 99.47913333 3.509153215 0.00104766 Cyp3a16 Phase I 145.197 4.887876533 154.319 2.96352026 0.000325724 90.3902 7.046246001 435.9096667 32.31334583 0.00021793 156.41 24.18138438 145.0106667 3.188061341 0.00582348 73.6684 4.202762475 340.018 29.96149536 0.00104766 Cyp3a25 Phase I 71.1205 3.801343231 189.8373333 8.681202995 0.000325724 415.2686667 9.627225376 576.4183333 4.281137479 0.0413233 59.60886667 4.224845911 124.708 4.40336466 0.00147961 248.114 15.35470522 328.932 4.174252787 0.00515795 Cyp3a41a Phase I 42.93043333 8.73009223 82.64616667 4.638495924 0.0195439 63.1029 2.640873428 291.104 20.46341108 0.00021793 78.29403333 13.76077798 83.6602 2.552107169 0.384562 50.45123333 6.816375527 224.6383333 23.31675567 0.00104766 Cyp3a41b Phase I 49.22106667 9.019176515 94.44056667 2.887826349 0.0195439 72.40556667 2.789519268 291.5566667 16.601108 0.00021793 86.62123333 13.97185834 93.65313333 2.553227658 0.384562 56.50863333 4.87284391 239.6623333 12.36636341 0.00104766 Cyp3a44 Phase I 100.3002 8.490920767 238.4563333 2.014906477 0.000325724 86.02133333 4.951174883 363.5766667 25.03891007 0.00021793 118.8623333 5.898786806 130.3403333 2.827766747 0.1907 77.57833333 5.00789867 280.6146667 12.8723638 0.00104766 Cyp3a57 Phase I 0.451335 0.065502226 0.498089333 0.054998988 0.0142646 0.862576333 0.135377068 1.305643333 0.128697055 1 0.604824333 0.083469456 0.521302 0.035759877 0.329855 0.460297667 0.113193342 0.325889333 0.046830612 1 Cyp3a59 Phase I 18.20303333 0.592805354 50.35326667 2.28874872 0.000325724 74.93423333 7.339820878 102.8035 3.110278779 0.0418914 16.0111 0.763507415 26.35266667 1.200217927 0.00147961 26.23416667 0.310333677 32.39806667 0.503134079 0.0858566 Cyp4a10 Phase I 101.4434333 22.89315435 51.95876667 4.010421794 0.000325724 220.0673333 58.6938018 26.8369 2.928388622 0.00021793 164.6703333 41.99048599 218.7203333 15.17719041 0.170373 133.4616667 3.621369922 38.14866667 7.862510567 0.00104766 Cyp4a12a Phase I 0.036082743 0.02174696 0.027472967 0.006567283 1 84.70573333 21.68614035 66.9123 4.65983177 0.0057319 0.0641117 0.011380453 0.0606125 0.025290431 1 99.80726667 3.951051381 147.4776667 15.44840124 0.00104766 Cyp4a12b Phase I 0.01720632 0.004522913 0.013049033 0.002884773 1 42.62683333 10.77611168 20.2519 1.326328098 0.00021793 0.029140267 0.006342159 0.044350533 0.008971706 1 64.57436667 2.151828501 75.96376667 5.2905422 0.976362 Cyp4a14 Phase I 185.2826667 17.81498514 137.1863333 7.783774841 0.000325724 157.8253 62.59956807 20.14073333 3.714707031 0.00021793 270.3973333 59.8051757 498.8033333 11.25090006 0.00147961 63.6414 10.04448314 24.50076667 7.917073614 0.00104766 Cyp4a29 Phase I 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 Cyp4a30b Phase I 0 0 0.005613933 0.005613933 1 0 0 0 0 1 0.004168333 0.004168333 0 0 1 0.002821453 0.002821453 0.004060047 0.002758268 1 Cyp4a31 Phase I 74.0425 9.88830153 94.64086667 1.408868272 0.289266 10.01558333 2.27706368 9.852783333 0.277862862 0.000781746 70.83436667 11.73142778 103.5923333 1.851919485 0.00489876 5.598136667 0.232001709 3.236563333 0.584893108 0.354992 Cyp4a32 Phase I 26.21843333 5.74818498 26.2782 1.967152117 0.000325724 53.83483333 11.91514869 10.26259 0.1500008 0.00021793 34.519 9.096098856 50.05266667 3.309920266 0.00147961 35.6942 1.289370825 16.3788 2.297057947 0.00650311 Cyp4b1 Phase I 5.0805 0.473776555 4.63694 0.115245782 0.814707 8.974196667 0.674975725 5.780466667 0.09468208 0.00021793 6.82977 0.554600627 3.916303333 0.159288683 0.00147961 7.237626667 0.411007244 6.900573333 0.121640286 0.843545 Cyp4f13 Phase I 9.990926667 0.512891441 11.38456667 0.415492937 0.839431 30.13296667 0.66557156 19.8153 0.62048859 0.00021793 11.89696667 1.491213906 8.133656667 0.325137897 0.00489876 25.547 0.279752587 27.6776 0.603449462 0.659929 Cyp4f14 Phase I 4.039823333 1.040306112 1.313703333 0.231324843 0.000325724 109.3263333 5.305645117 38.4457 4.953480856 0.00021793 10.78629 1.631912308 4.46238 0.428579031 0.00147961 113.1966667 0.97808901 94.8322 3.227070167 0.185473 Cyp4f15 Phase I 25.33466667 0.837966838 79.6028 4.514658138 0.000325724 49.34563333 3.75429255 93.0371 2.024621631 0.00021793 24.53636667 1.923731711 36.75526667 0.625366499 0.00582348 52.32976667 0.308907464 74.13006667 1.961973352 0.00104766 Cyp4f16 Phase I 3.606203333 0.059480933 4.874196667 0.275751154 0.0685786 0.791593 0.107884515 1.941726667 0.102043552 0.00021793 3.86007 0.253331607 3.748766667 0.03752214 0.832317 0.974195333 0.017461868 1.025162667 0.028839647 0.975551 Cyp4f17 Phase I 2.46766 0.328018132 2.2239 0.177373159 0.789742 5.483613333 0.169596853 3.898786667 0.02990099 0.00021793 2.737603333 0.219636721 2.904103333 0.139558834 0.952086 5.569393333 0.387399203 4.578686667 0.223812269 0.360032 Cyp4f18 Phase I 1.273256 0.247037606 1.379496667 0.213350849 0.292102 0.280925667 0.047165819 0.319809 0.022704707 0.898609 1.134775333 0.185315916 0.870555333 0.134778433 0.375398 0.242277 0.016444085 0.252669 0.033122169 0.974692 Cyp4f37 Phase I 0.358794667 0.019906684 0.60425 0.061677082 1 0.252984333 0.026386783 0.404643 0.016355982 1 0.407560667 0.029019169 0.452144333 0.005357886 1 0.228888667 0.029064334 0.288057667 0.012157242 1 Cyp4f39 Phase I 0.336343 0.049261336 0.080240467 0.012154859 0.000325724 0.139478667 0.016415984 0.277955667 0.032858198 0.0147202 0.445489333 0.019008493 0.474413667 0.016536768 0.957847 0.199201 0.065815937 0.12962 0.014558176 1 Cyp4f40 Phase I 0.029041167 0.008318392 0.0134597 0.002738547 1 0.022772267 0.004936445 0.016803833 0.009292812 1 0.049615533 0.012325363 0.0225005 0.00477477 1 0.066607633 0.004183128 0.0384271 0.011138058 1 Cyp4v3 Phase I 27.97893333 1.795470423 28.80876667 0.69294434 0.830814 158.5123333 8.82543992 61.74843333 3.134603487 0.00021793 22.3332 0.657473911 27.63956667 1.12020558 0.235977 137.2993333 4.63207604 150.6396667 2.442706172 0.562107 Cyp4x1 Phase I 0 0 0 0 1 0 0 0 0 1 0.018281367 0.010866537 0.022624833 0.011365415 1 0 0 0 0 1 Dao Phase I 0.004910267 0.004910267 0 0 1 0 0 0.004764233 0.004764233 1 0.004621167 0.004621167 0.0047837 0.0047837 1 0 0 0 0 1 Dhdh Phase I 13.9207 0.943735155 11.4941 0.29600862 0.503725 42.5317 2.012637678 30.08983333 0.229104644 0.0057319 13.81403333 0.904909945 16.7859 0.801755301 0.767124 40.2008 0.665274628 40.77956667 0.975658727 0.974464 Dhrs1 Phase I 73.56476667 2.264086868 56.18813333 1.996921493 0.000325724 65.008 1.967562134 44.63043333 1.213923404 0.00021793 67.7845 1.290718757 52.94156667 1.33040331 0.0437484 61.1919 1.13061345 61.20426667 3.939910244 0.980222 Dhrs11 Phase I 7.953626667 0.354069028 7.768353333 0.341116259 0.745251 13.1596 0.886984241 8.161126667 0.197121867 0.00021793 11.309 0.486675172 10.84163333 0.214238818 0.796646 13.4225 0.362164286 13.69153333 0.715779096 0.935441 Dhrs13 Phase I 3.864356667 0.068158058 5.85412 0.305216343 0.00139416 1.734336667 0.080594466 2.44021 0.155623402 0.0582561 4.261366667 0.250026341 3.781326667 0.108785977 0.564412 1.654833333 0.030381719 2.06921 0.00895768 0.348613 Dhrs2 Phase I 0 0 0 0 1 0 0 0 0 1 0.007062 0.007062 0 0 1 0 0 0 0 1 Dhrs3 Phase I 40.48726667 1.794777983 64.15163333 2.688502806 0.000325724 78.0694 4.111920844 71.89703333 2.844116571 0.0661788 40.49413333 1.717921176 38.87293333 0.311865849 0.784625 91.75633333 0.158762657 92.6645 2.497330957 0.957078 Dhrs4 Phase I 78.105 2.19796198 248.9253333 7.149724105 0.000325724 75.3677 2.4091702 153.4126667 9.408216415 0.00021793 88.48786667 2.843776088 115.7053333 1.323736421 0.0956636 80.16406667 0.429609421 96.173 2.265248764 0.0924765 Dhrs7 Phase I 17.46786667 1.726269587 24.8598 1.18886802 0.000325724 13.1241 1.807350086 29.90013333 0.80477131 0.00021793 19.86016667 0.672634 14.26593333 0.590491311 0.0132414 12.36196667 0.12834306 15.01603333 0.620044733 0.159166 Dhrs7b Phase I 8.11474 0.311252477 10.64656667 0.196725666 0.037439 9.291313333 0.350745379 13.59356667 0.38864981 0.0033356 7.3783 0.399286484 7.182873333 0.191471374 0.856843 9.620583333 0.35755688 10.46632667 0.468958651 0.69044 Dhrs7c Phase I 0.008265567 0.008265567 0.016006533 0.008003283 1 0 0 0 0 1 0.007677567 0.007677567 0.0084913 0.0084913 1 0 0 0 0 1 Dhrs9 Phase I 0.364625333 0.051145347 2.605686667 0.237856786 0.000325724 1.654043333 0.333412246 4.190273333 0.362753952 0.00021793 0.574813333 0.102196543 0.518755667 0.021604584 0.770344 2.07937 0.327460354 2.99644 0.592962456 0.00445703 Dhrsx Phase I 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 Dpyd Phase I 40.25103333 3.064228073 29.50606667 0.733092228 0.000325724 120.7786667 1.338142535 50.89476667 2.505043867 0.00021793 41.78783333 5.368078035 54.589 1.041103141 0.0851707 114.2026667 2.912645323 101.4805333 4.367732228 0.556794 Ephx1 Phase I 67.5123 1.339633877 429.737 19.20007031 0.000325724 181.8226667 5.130800598 909.4613333 43.06578192 0.00021793 85.32666667 6.150668673 168.1016667 5.307375068 0.00147961 153.3103333 3.175696319 426.0016667 22.51977639 0.00104766 Ephx2 Phase I 139.0613333 6.844491029 121.108 5.332939558 0.0654696 313.5733333 13.89022268 157.5786667 9.141869618 0.00021793 162.9963333 18.38059628 155.647 0.527610652 0.717546 260.8303333 3.066412145 223.2873333 3.916648071 0.314022 Ephx3 Phase I 0.0709326 0.02981116 0.0440539 0.023719665 1 0.028998667 0.009217458 0.035240967 0.014377829 1 0.067957833 0.024153712 0.026913307 0.008825028 1 0.065985267 0.010666207 0.040271167 0.005747015 1 Ephx4 Phase I 0.045357567 0.012512505 0.020755833 0.011897004 1 0.015315767 0.007687957 0.029001067 0.006244916 1 0.065434 0.022313811 0.062116133 0.011751146 1 0.068422267 0.017414762 0.068762367 0.023003293 1 Epx Phase I 7.954866667 2.630274958 10.70528333 1.581293915 0.000887381 0.003212933 0.003212933 0 0 1 5.28477 2.503617964 4.276026667 2.042016343 0.177344 0 0 0.003341 0.003341 1 Erap1 Phase I 18.04603333 0.484694049 20.20083333 1.108427308 0.516205 19.92703333 0.373249364 19.2676 0.226002633 0.180495 18.0376 2.467297203 18.1958 0.164120779 0.973726 19.95956667 0.693360715 22.41366667 0.864047665 0.409636 Fmo1 Phase I 67.5151 4.652757187 62.5946 1.280110667 0.507465 69.00606667 3.851408804 66.82763333 0.628750147 0.197362 72.4846 1.537379359 46.97023333 0.887686999 0.00147961 69.4462 1.569262095 75.01366667 2.081071756 0.666162 Fmo2 Phase I 6.290166667 0.462421976 2.58061 0.163628253 0.000325724 2.190463333 0.096359085 1.380436 0.269474648 0.00021793 2.430166667 0.242149358 2.091046667 0.109292014 0.45868 2.08252 0.523999391 2.695833333 0.092814027 0.0701491 Fmo3 Phase I 0.726344 0.04874451 0.045450833 0.021969113 0.000887381 0.548955433 0.329527082 0 0 0.00021793 0.030502 0.012670416 0 0 1 0.276469667 0.040249956 0.160044533 0.044083774 0.306361 Fmo4 Phase I 5.1844 0.161875076 4.31855 0.269960815 0.0753884 1.846553333 0.101448337 5.787743333 0.382827194 0.00021793 5.10598 0.150601579 4.432556667 0.167796347 0.471831 2.447396667 0.109275311 2.792586667 0.144925919 0.602885 Fmo5 Phase I 30.44893333 2.368732044 168.3186667 2.987583713 0.000325724 102.7986667 2.006587678 417.959 7.968310005 0.00021793 36.79813333 4.623479113 67.71916667 2.688483926 0.00147961 150.9353333 18.04549969 209.118 11.61709246 0.00104766 Fmo6 Phase I 0.009204567 0.004602712 0 0 1 0 0 0.004433 0.004433 1 0 0 0 0 1 0 0 0 0 1 Fmo9 Phase I 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 Glrx Phase I 20.5965 1.053399302 45.78273333 2.585112831 0.000325724 25.87933333 0.82736264 47.54696667 0.463935342 0.00021793 24.35703333 0.107463627 32.52356667 0.336979823 0.058574 24.41426667 0.791584151 26.14573333 0.689685127 0.851772 Glrx2 Phase I 3.89429 0.109856781 3.794396667 0.281917563 0.381796 4.814646667 0.108607711 3.761126667 0.097227689 0.000416378 3.812343333 0.255518333 4.447113333 0.185926381 0.552772 4.69328 0.092444286 4.73314 0.107696797 0.965632 Gphn Phase I 9.622576667 0.31612946 9.186983333 0.438179776 0.441011 23.8007 0.327018226 17.23543333 0.283830174 0.00021793 9.457396667 0.907835351 8.762936667 0.237800997 0.65694 21.4885 0.33164392 20.546 0.645518778 0.919325 Gpx1 Phase I 386.5136667 75.05230353 691.3536667 21.23767731 0.000325724 1240.376667 29.74341234 969.887 12.73385654 0.00211759 487.993 32.89208487 491.3093333 11.93459512 0.9539 1105.25 44.33448019 1258.77 58.75243768 0.365864 Gpx2 Phase I 0.138600667 0.07499871 0.485447667 0.058414709 0.0194052 0.032258267 0.011990915 0.403946667 0.111997138 0.00801149 0.776508667 0.349007238 0.0582293 0.034838605 0.0274612 0.076709767 0.012832921 0.183106533 0.086803866 1 Gpx3 Phase I 7.801706667 0.150263966 10.4873 0.322604045 0.04214 2.393233333 0.142593912 2.373286667 0.15238865 0.477226 7.165026667 1.123070992 7.128003333 0.515649788 0.905859 3.34271 1.44097211 1.934473333 0.342998871 0.00368605 Gpx4 Phase I 82.47986667 3.974578825 189.3226667 11.17353863 0.166277 123.397 2.449271797 295.0553333 6.880448855 0.165198 106.6480667 11.12527763 116.6763333 1.588989651 0.987148 131.4806667 5.216659606 171.1163333 8.548372815 0.863504 Gpx5 Phase I 0.010646733 0.010646733 0 0 1 0.005559767 0.005559767 0.016816367 0.009465866 1 0 0 0.0049579 0.0049579 1 0.011451733 0.005819793 0 0 1 Gpx6 Phase I 0.299148333 0.02147519 0.186967633 0.051795501 0.139692 0.547487 0.063263385 0.0656491 0.011529798 0.0157688 0.122505667 0.014469861 0.204680667 0.026555464 1 0.967953 0.161863713 0.560395 0.071920712 0.105141 Gpx7 Phase I 7.017153333 0.84522934 13.89493333 0.327656845 0.000325724 0.695426667 0.019371887 9.982043333 0.767439728 0.00021793 8.946256667 1.036964 7.179803333 0.454486683 0.201322 0.996985 0.031104845 1.412026667 0.033392183 0.23114 Gpx8 Phase I 2.68147 0.19484081 2.081303333 0.304851082 0.213913 0.401695 0.048238261 0.731579333 0.037753938 0.0364495 2.643303333 0.097587471 2.023523333 0.21466693 0.334665 1.052501 0.464861577 0.640585333 0.053593516 0.203779 Gsr Phase I 13.0647 0.624677519 24.7834 2.029557368 0.000325724 19.98736667 0.79698261 39.6645 1.621897458 0.00021793 16.5298 0.738172082 19.63096667 0.503137378 0.407342 19.6652 0.229792522 25.3525 0.442010102 0.00790365 Gusb Phase I 15.74846667 0.26920789 21.8149 0.183212181 0.000887381 10.7562 0.192286306 19.54613333 0.604110201 0.00021793 19.16673333 0.455382924 19.92043333 0.302828446 0.968902 10.57126667 0.281961028 13.7348 0.247050083 0.00985284 Lox Phase I 1.612586667 0.110978716 1.41329 0.188007996 0.291169 0.106229533 0.006393801 0.203008333 0.026864201 1 1.55079 0.146456328 2.1555 0.121786993 0.089345 0.260316733 0.152019219 0.175267333 0.060064258 0.292041 Lpo Phase I 0 0 0.002708107 0.002708107 1 0 0 0 0 1 0.010756653 0.006971157 0 0 1 0 0 0 0 1 Lta4h Phase I 15.20456667 0.739556832 17.5953 0.139518685 0.308231 13.63626667 0.400393828 15.03823333 0.142891664 0.972751 15.88263333 1.242408752 13.5086 0.53967421 0.248672 13.23326667 0.650338323 12.28353333 1.089060103 0.816273 Maoa Phase I 1.604033333 0.033847826 1.570666667 0.147905835 0.615043 1.70452 0.101201964 2.146136667 0.16142103 0.235791 2.39714 0.158519563 1.670053333 0.037854741 0.0232236 1.59645 0.102287207 1.772 0.056902362 0.664896 Maob Phase I 80.4219 6.233163703 83.03083333 1.564335601 0.822734 70.3326 8.061249973 64.54043333 1.094688958 0.0559391 73.06766667 3.107054241 67.8058 1.581622134 0.629006 71.92156667 2.922531155 74.06216667 3.585022931 0.899483 Mocos Phase I 4.1205 0.315941482 9.885063333 0.221616784 0.000325724 19.6831 0.616813427 25.01163333 0.34805732 0.12656 5.200096667 0.279215344 5.978053333 0.177771017 0.618409 26.1095 0.777678837 28.43953333 1.326866653 0.602879 Mocs1 Phase I 24.31213333 1.552016057 24.02233333 1.102591599 0.985833 39.917 0.637727954 33.80453333 0.473737851 0.00242887 29.79966667 0.982964017 34.5974 0.182517323 0.524135 41.80616667 0.557350322 48.0359 1.014397971 0.269846 Mocs2 Phase I 44.81233333 0.809094721 49.65886667 1.220681523 0.562684 40.65826667 1.284616384 54.29883333 0.267476007 0.0324539 38.43856667 2.912869202 53.9533 0.154106814 0.00924814 44.77386667 2.32256625 48.52603333 1.804665444 0.654106 Mocs3 Phase I 2.425016667 0.057713587 2.459216667 0.104994099 0.698308 1.874916667 0.187215056 2.298923333 0.091546689 0.445683 2.188173333 0.187434085 2.43054 0.060043045 0.859901 2.105593333 0.236721733 2.3151 0.189884311 0.78394 Mpo Phase I 2.994786667 0.769592752 3.616203333 0.439340505 0.0446936 0.0033565 0.0033565 0.007267267 0.007267267 1 12.11022333 4.032503408 7.22196 0.713032935 0.00147961 0.00712728 0.003611921 0.0137747 0.002895508 1 Nqo1 Phase I 4.397913333 0.783896725 15.29153333 0.713772826 0.000325724 2.2345 0.442741247 10.81656 1.015726055 0.00890916 5.232296667 0.10309769 14.46383333 0.726547049 0.0366755 3.08421 0.315576677 5.651676667 0.126767088 0.343847 Nqo2 Phase I 14.0717 1.224323676 28.52776667 1.135324832 0.000325724 24.6135 2.056290287 44.3715 0.715387282 0.00021793 14.06866667 1.011845545 20.9537 0.464864758 0.0505947 28.46736667 0.918138193 38.2101 0.633603301 0.00104766 Paox Phase I 5.823336667 0.081867614 6.92451 0.400539962 0.32371 12.33203333 0.605894766 10.20285667 0.585728905 0.000781746 6.50857 0.132879902 5.5864 0.25742297 0.502859 15.8171 0.732281328 13.2469 0.957754302 0.0880234 Pon1 Phase I 571.7353333 11.16842647 532.542 15.11462944 0.089913 447.598 32.88666213 365.413 1.535188696 0.00391372 469.7706667 17.30222191 471.7766667 6.563457862 0.943535 420.0876667 15.80352024 443.8463333 16.57371897 0.803664 Pon2 Phase I 22.51716667 0.645137583 20.9625 1.256220335 0.0628478 23.77016667 0.491229086 23.22116667 0.660054706 0.222112 21.47553333 0.89943575 20.95776667 0.299520129 0.857501 19.0484 0.539844228 20.95123333 1.063460548 0.578011 Pon3 Phase I 25.51216667 0.099768688 27.9943 2.036319447 0.853926 37.5214 0.847539789 45.297 0.603622865 0.348442 22.83686667 2.097563433 21.9567 0.333988283 0.813074 35.13576667 0.509365266 41.9578 1.095588702 0.115874 Por Phase I 105.7853333 4.160804263 458.9213333 23.20285018 0.000325724 60.24766667 7.762057619 389.2023333 13.42135077 0.00021793 114.7209 18.43531239 188.4106667 5.066654397 0.00147961 60.01423333 0.024159769 265.4483333 14.29011855 0.00104766 Prdx1 Phase I 645.188 37.17438292 977.1353333 16.84389461 0.000325724 511.5143333 17.0128487 788.9393333 11.08617622 0.00113239 650.536 14.57097472 665.155 7.947642732 0.989365 492.7416667 10.45656531 540.0533333 11.7499766 0.579657 Prdx2 Phase I 95.3105 7.062063957 126.434 4.710542892 0.000325724 80.88186667 0.784047501 81.59606667 1.152505713 0.395567 133.1476667 13.14529398 115.0266667 1.518361544 0.26929 82.014 2.823130109 90.1955 1.618068974 0.516055 Prdx3 Phase I 60.3745 1.570379034 76.37113333 0.56245375 0.0737716 61.78746667 0.915594274 112.262 2.239882809 0.00021793 66.08356667 2.577739528 66.78833333 1.796807317 0.956882 70.80496667 1.26656618 74.87413333 2.607524779 0.777005 Prdx4 Phase I 159.0796667 4.927643938 177.681 4.938483674 0.724455 70.55223333 2.28322673 90.7071 2.036691458 0.091658 145.1923333 11.68605357 122.3616667 3.371528058 0.195407 66.50906667 1.985977926 68.75033333 2.230099054 0.893165 Prdx5 Phase I 99.637 5.449545877 120.8486667 2.814221996 0.0353362 195.6163333 6.68990803 162.1096667 3.677850384 0.0012947 115.8696667 6.529806335 106.7073333 0.604981634 0.572792 209.4566667 3.262273713 200.215 3.743183716 0.917717 Prdx6 Phase I 100.5201 7.224459969 152.289 2.007924633 0.000325724 163.285 3.727073964 242.2933333 1.44790335 0.00288964 96.4523 1.734715315 121.6156667 0.246677477 0.16997 165.17 1.014864687 183.3453333 5.804920336 0.516055 Ptgs1 Phase I 17.77043333 0.732075694 19.2718 1.598314917 0.79082 5.8887 0.223827425 5.914633333 0.171896294 0.401433 17.30916667 0.981355937 16.07613333 0.588994415 0.635936 5.751593333 0.242460886 6.090833333 0.27608832 0.815572 Ptgs2 Phase I 0.0038977 0.0038977 0 0 1 0.00629372 0.003531631 0.00597861 0.003304168 1 0.007693997 0.00519156 0.00384832 0.001932723 1 0.011288473 0.008561782 0.002215383 0.002215383 1 Sdr16c5 Phase I 0.012859233 0.012859233 0 0 1 0.036262333 0.036262333 0.019018833 0.010781642 1 0.050950033 0.016309969 0.005975233 0.005975233 1 0.043849233 0.022705282 0.014287633 0.007149445 1 Sdr16c6 Phase I 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 Sdr39u1 Phase I 13.21593333 0.796296788 18.0624 0.416548681 0.0206755 11.9364 0.501143702 12.8549 0.246046913 0.863967 12.57083333 0.47900435 14.38126667 0.322206819 0.661988 12.52026667 0.624253368 11.14713333 0.304388515 0.666162 Sdr42e1 Phase I 13.20306667 0.933618884 11.69976667 0.382975823 0.161963 39.18873333 2.546635282 19.20513333 1.248494112 0.00021793 12.37926667 0.510429885 12.68803333 0.353667256 0.994627 37.95423333 1.053208758 35.32193333 4.542441327 0.795625 Sdr9c7 Phase I 0.456362 0.081127015 0.290192333 0.060769193 0.145518 18.0638 1.926477615 6.465636667 0.49240737 0.00021793 0.224610333 0.045017535 0.200848667 0.021447219 1 11.8905 0.461370263 8.827446667 0.795794533 0.00790365 Smox Phase I 5.638943333 0.06748432 4.887573333 0.115320164 0.695435 0.948407 0.083943049 3.570213333 0.288606926 0.136664 7.955566667 0.591720123 5.956783333 0.210293504 0.727239 1.296166667 0.079316354 1.135053333 0.039554411 0.982082 Suox Phase I 32.23843333 2.454717156 23.3759 0.880382339 0.000325724 44.37193333 1.204894404 26.80326667 2.428471999 0.00021793 30.813 1.209588948 42.05753333 1.715869653 0.0328666 49.26546667 2.916620438 45.3286 0.468751644 0.746488 Tpo Phase I 0.002490327 0.002490327 0 0 1 0.00283495 0.00283495 0 0 1 0 0 0 0 1 0.008956733 0.008956733 0 0 1 Txn1 Phase I 87.61126667 3.768971152 135.315 2.964075291 0.000325724 126.0003333 2.623147622 227.141 2.704053685 0.00021793 89.1629 1.372304675 97.84033333 2.347935642 0.763121 124.572 2.212501525 156.9843333 4.872583241 0.0219513 Txnrd1 Phase I 22.88853333 0.711712864 27.84766667 0.614362828 0.107629 35.59013333 1.191598761 44.95416667 2.058719887 0.152172 27.66206667 2.202578641 28.07873333 0.25072301 0.98535 35.97626667 0.787686345 36.1368 1.712236854 0.975318 Txnrd2 Phase I 13.18143333 0.374850345 15.22816667 0.630469482 0.700417 12.62133333 0.785312257 15.79343333 0.750714292 0.833915 14.2895 2.25514502 11.91943333 0.065799249 0.763121 11.57136667 0.277212099 12.4118 0.272537086 0.980222 Txnrd3 Phase I 1.46673 0.084831978 1.995896667 0.07075287 0.109245 2.13974 0.127975106 2.181866667 0.04866075 0.566001 1.396096667 0.043133622 2.010676667 0.159773443 0.116569 2.044283333 0.121366593 2.397326667 0.154437443 0.430512 Xdh Phase I 8.038596667 0.576327984 15.7839 0.749713074 0.000325724 34.32556667 0.440152263 46.1527 1.651370376 0.0324539 9.27386 0.327151261 8.898153333 0.073446018 0.787537 33.0578 2.179889624 38.00686667 0.43962748 0.273188 Acsm1 Phase II 70.81973333 3.548086154 109.8656667 3.936163798 0.000325724 150.5783333 1.841023025 166.8246667 2.247367151 0.921125 88.6586 1.407073857 70.72203333 0.494571742 0.0762211 158.181 1.832788677 180.8216667 8.929565617 0.318382 Acsm2 Phase II 0.00652646 0.001452196 0.0177302 0.006976751 1 0.574600333 0.082409967 0.570689333 0.071042589 0.5058 0.016172097 0.004697872 0.006962867 0.001858051 1 0.489300667 0.019979326 0.766403667 0.115910063 0.00368605 Acsm3 Phase II 23.4391 0.727898393 19.88496667 0.582269503 0.0226115 36.60726667 1.185790825 20.82203333 0.618651114 0.00021793 21.4355 0.523136085 25.5768 0.369600924 0.439489 36.98093333 0.851771997 39.55193333 1.803395039 0.728793 Acsm4 Phase II 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 Acsm5 Phase II 16.7148 1.72549941 15.72306667 1.41153 0.843402 46.15073333 0.890060478 31.06586667 1.306338183 0.00021793 17.0239 0.415155999 15.677 0.76950642 0.613023 39.52656667 0.626515872 47.29 0.933307304 0.104592 As3mt Phase II 10.57492333 0.579223957 12.65666667 1.031248053 0.586261 15.31886667 0.929684825 21.4338 0.173965293 0.00878119 11.59566667 0.553502154 11.88013333 0.147009403 0.993945 16.1723 0.635963372 15.56586667 0.204302899 0.95136 Comt Phase II 71.59423333 5.417105139 57.81663333 0.994155978 0.0738474 390.5493333 29.10593554 158.764 8.065699618 0.00021793 68.8474 2.547194097 67.4837 1.436724236 0.891346 374.984 8.30900002 334.5056667 6.645412862 0.606686 Gamt Phase II 180.746 5.195557942 104.2681 3.387409188 0.17942 98.6782 2.514825409 97.4027 4.137317959 0.897933 155.2233333 4.738907059 109.009 1.555490598 0.750871 119.8696667 2.756263251 121.798 6.622998591 0.994797 Gclc Phase II 67.39056667 3.908031008 64.68853333 0.892228746 0.731026 96.64813333 7.820169734 93.93186667 4.513231548 0.247663 62.36443333 6.721042125 63.48246667 1.187414818 0.993945 94.43776667 4.303892705 108.6453333 7.736176539 0.279594 Gclm Phase II 53.15773333 3.894976924 70.84496667 1.872050126 0.000325724 55.50146667 1.604729444 78.4031 1.382417268 0.00670561 59.62896667 1.765571007 53.7756 0.657262089 0.48986 53.17116667 0.948535674 71.34746667 0.94205608 0.00286989 Glyat Phase II 69.96243333 4.433949489 150.801 4.882828825 0.000325724 158.8213333 3.061089639 176.7986667 5.093965264 0.919159 57.08566667 4.810458005 71.37756667 1.065350462 0.222803 138.548 1.362234317 161.2696667 1.472122542 0.207183 Glyatl3 Phase II 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 Gnmt Phase II 141.3876667 13.19110951 227.0523333 25.90761354 0.000325724 1112.146667 34.05655607 837.1286667 67.5327995 0.000604071 154.2476667 17.9336023 353.1306667 24.14827213 0.00147961 1263.86 21.05265779 1258.28 12.8944523 0.993901 Gsta1 Phase II 0.206639333 0.05713387 24.394 1.092093743 0.370401 6.85835 1.659872333 1172.286667 66.78632952 0.00021793 0.392749667 0.092998421 1.706083333 0.209542204 1 8.956973333 1.310667229 184.9516667 6.645809716 0.00104766 Gsta2 Phase II 0.861494667 0.088043914 6.109996667 0.480613846 0.000325724 26.3054 8.139234653 224.5933333 13.88121946 0.00021793 1.25288 0.125160521 5.91322 0.580657906 0.00147961 26.9546 5.420598241 137.196 3.512371136 0.00104766 Gsta3 Phase II 400.984 18.77475359 748.776 24.84015166 0.000325724 897.0863333 7.731698592 1329.636667 14.40152345 0.00878119 355.4413333 15.85445153 347.373 4.100347587 0.870256 901.399 28.85853471 1110.833333 27.74927406 0.0668937 Gsta4 Phase II 36.7526 1.390525286 110.5153333 4.295086896 0.000325724 45.4087 5.881957792 256.897 19.03680452 0.00021793 46.03096667 5.065914297 50.5094 4.21658695 0.809473 57.6468 6.253918184 149.537 12.2709303 0.00104766 Gstcd Phase II 2.265483333 0.096501622 2.65432 0.100627475 0.763945 1.47704 0.1038729 2.55807 0.075068619 0.00021793 2.879803333 0.323882309 2.416533333 0.109164697 0.398285 1.55219 0.01019624 1.39784 0.019437799 0.815562 Gstk1 Phase II 35.26613333 3.626229322 31.77383333 1.549852847 0.56733 94.80243333 4.707016053 60.69563333 0.730521057 0.00021793 35.2186 4.247507274 38.52773333 0.562539043 0.821537 86.06866667 2.565586104 78.52116667 0.903407625 0.713374 Gstm1 Phase II 143.922 6.242480997 1783.593333 73.64668273 0.000325724 819.652 57.95809298 10438.77667 408.6666276 0.00021793 175.7803333 13.87985113 360.6936667 15.75135444 0.00147961 993.8663333 44.67855144 4780.82 292.98012 0.00104766 Gstm2 Phase II 8.98388 0.855958607 71.96253333 6.684417168 0.000325724 41.08453333 2.350234599 966.308 28.50663723 0.00021793 13.212 0.989531083 19.7523 0.358251997 0.0160556 83.5255 3.004117558 200.712 18.79404172 0.00104766 Gstm3 Phase II 8.800116667 0.216578264 1126.133333 47.2789038 0.000325724 57.1338 3.054417441 10999.06 829.0510123 0.00021793 9.538456667 0.386008122 29.43723333 1.711264909 0.00147961 132.809 13.07542401 2132.746667 300.4589993 0.00104766 Gstm4 Phase II 12.9117 0.687421663 31.39686667 0.348427139 0.000325724 26.837 0.921418929 137.235 6.466240819 0.00021793 14.47513333 0.0859491 15.01143333 0.239842909 0.973789 36.7533 1.745215475 76.48126667 7.629277834 0.00104766 Gstm5 Phase II 12.96216667 0.466969743 24.29663333 0.420111419 0.000325724 6.50512 0.161178552 14.43843333 0.468700652 0.00021793 13.07616667 0.955484471 14.1218 0.273094752 0.904462 8.366853333 0.675382267 9.01674 0.502589631 0.846366 Gstm6 Phase II 15.0927 0.665090117 32.2179 1.139696593 0.000325724 64.647 3.660403262 116.9543333 1.613868678 0.224182 14.70153333 0.682254833 15.98926667 0.649177106 0.844808 95.89273333 4.304800239 140.5033333 4.060168196 0.00104766 Gstm7 Phase II 29.49796667 1.505915122 33.39263333 1.060053483 0.301651 32.59553333 0.671672046 35.9441 1.147817731 0.969674 26.83243333 1.742857241 29.45146667 0.636313042 0.797967 48.6579 1.579120363 44.86296667 1.679410017 0.767523 Gsto1 Phase II 33.72066667 1.912191765 51.21856667 1.641553347 0.000325724 74.45103333 3.341497595 65.65266667 1.409346015 0.0140347 53.67573333 8.740120149 50.64003333 0.64791499 0.672454 58.17826667 1.257087344 74.4232 5.702887322 0.0164783 Gsto2 Phase II 0.100324633 0.025523021 0.0695454 0.006434041 1 0.044151467 0.011921464 0.0299735 0.008674984 1 0.116045433 0.016141099 0.040587267 0.019493564 1 0.108647433 0.014064347 0.061931533 0.022114139 1 Gstp1 Phase II 144.1853333 7.173683859 306.8513333 23.47183429 0.000325724 1052.245667 249.5732265 1119.276667 37.46299567 0.830624 209.5036667 29.95092244 216.324 3.797112587 0.945909 876.7766667 28.50426992 1543.873333 125.0811412 0.00104766 Gstp2 Phase II 45.49636667 2.49227233 91.09736667 6.361671343 0.0204062 310.9226667 73.9156138 339.957 13.99953504 0.303469 62.1891 8.450530625 66.39976667 1.078787335 0.891694 265.9463333 4.359263597 436.143 38.56012199 0.850673 Gstt1 Phase II 106.3445667 5.282161299 334.128 18.16953139 0.000325724 179.753 17.86315488 728.9743333 32.4182879 0.00021793 101.0945 5.857899458 119.514 1.907519943 0.430189 221.7023333 10.01807337 340.9616667 10.50213295 0.00104766 Gstt2 Phase II 17.93113333 0.328366164 41.34396667 2.301527378 0.000325724 25.02826667 6.526440564 32.83243333 1.001628415 0.0698334 25.12016667 3.087693697 22.49736667 0.620884816 0.465416 26.16303333 2.117362204 29.38083333 2.244010938 0.432416 Gstt3 Phase II 4.440316667 0.425835144 191.6793333 11.20291278 0.000325724 33.98313333 10.07781791 287.9343333 7.203311977 0.00021793 5.26633 0.785059697 35.75503333 1.282831417 0.00147961 50.01033333 10.10648009 154.6766667 12.7458829 0.00104766 Gstt4 Phase II 0 0 0 0 1 0.0099089 0.0099089 0 0 1 0 0 0 0 1 0 0 0 0 1 Gstz1 Phase II 268.4876667 14.09633856 268.9273333 13.04041252 0.845504 327.9373333 4.163509591 278.4836667 5.533667691 0.0160125 238.897 3.5655777 247.873 2.419752122 0.971832 355.9563333 2.818152015 341.5826667 12.37619904 0.93417 Hnmt Phase II 0.802254 0.02870891 0.721423 0.172215843 0.499354 9.586016667 0.336394646 14.85603333 0.823073671 0.00021793 0.932081667 0.21294947 1.005331667 0.093225767 0.915059 10.87103333 0.439431152 13.15033333 0.59328879 0.119869 Hpgds Phase II 1.392703333 0.06278982 1.253693333 0.094710908 0.190584 0.269979 0.048798961 0.368942333 0.050680002 0.259764 1.255486667 0.337442937 1.794243333 0.026980082 0.107552 0.286177667 0.02854561 0.266427333 0.029644341 0.955994 Inmt Phase II 84.5545 7.946204141 567.7446667 53.06644546 0.000325724 462.5303333 22.66206834 980.7413333 33.41816944 0.00021793 67.7257 14.59804748 111.9752333 9.019294033 0.00147961 287.0536667 21.22874917 682.476 127.5862253 0.00104766 Lcat Phase II 291.588 6.611902096 271.6443333 13.22019708 0.200276 256.9853333 14.73191902 148.6236667 3.118655818 0.00021793 303.451 33.87793038 283.415 4.025163227 0.620021 222.2436667 2.736965006 224.8403333 5.798862887 0.956407 Lipa Phase II 103.8875333 6.887428196 124.2423333 1.526669833 0.0286717 72.46293333 2.381667927 130.8956667 0.779819709 0.00021793 107.4473333 2.259969715 108.9276667 1.801654548 0.97405 77.4155 2.564771593 86.15206667 0.710388369 0.465565 Ltc4s Phase II 0.617933333 0.34451849 0.52968 0.121609475 0.398691 0.657389333 0.121441971 0.694422667 0.072917475 0.909625 0.739680667 0.270760259 0.464287 0.089820428 0.401221 0.983253667 0.363216847 0.705720333 0.22734631 0.674734 Mgst1 Phase II 722.394 61.11117527 946.6116667 48.15247764 0.000325724 2834.693333 161.246655 3017 124.7499323 0.865283 766.336 26.53066398 889.4843333 29.45283673 0.484794 2862.853333 61.13447373 2873.676667 191.2494909 0.978777 Mgst2 Phase II 2.68802 0.414326313 4.796966667 0.257467602 0.0565353 0.059466767 0.035637287 0.076545067 0.022066782 1 5.21389 0.81332438 4.055763333 0.014821973 0.381713 0.035680133 0.017853896 0.159073 0.016342327 1 Mgst3 Phase II 25.7235 5.070985614 29.59856667 2.145033589 0.00582198 11.374 0.883567388 17.43626667 1.592363427 0.00113239 47.2705 5.888424611 34.02716667 0.908139463 0.00674878 13.07036667 1.03478623 17.04016667 1.609906625 0.0533754 Nat1 Phase II 0.153889333 0.007535023 0.090261733 0.013202235 1 0.773132333 0.033242711 0.560917333 0.067073147 0.0427987 0.246777667 0.035698999 0.153059567 0.08877034 0.477456 0.720007667 0.161103818 0.835344 0.014559894 0.817077 Nat10 Phase II 4.51534 0.259325737 4.29568 0.210802797 0.079912 5.368813333 0.425609752 4.66205 0.14051085 0.0109041 5.403773333 0.163086394 5.60089 0.198934814 0.971304 5.68223 0.173571885 4.484346667 0.228842379 0.0753618 Nat14 Phase II 0.220052 0.040954956 0.188808667 0.023325191 0.236504 0.265219333 0.034231041 0.0902698 0.018460303 0.00762312 0.196629333 0.061451929 0.124442 0.005538333 1 0.180668667 0.016303555 0.189172 0.042401764 1 Nat2 Phase II 3.723293333 0.301949134 3.45649 0.318820303 0.785928 8.929853333 0.514171469 8.267916667 0.391018011 0.0858394 2.816953333 0.371028026 4.443273333 0.078783824 0.0302918 8.870056667 0.543036718 9.656943333 0.581277111 0.726726 Nat3 Phase II 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 Nat6 Phase II 11.64566667 0.557367133 10.12154 0.503767652 0.0872087 21.88353333 0.81849648 13.3072 0.204889556 0.00021793 9.930963333 0.765365236 8.774966667 0.040189051 0.436849 22.56936667 1.82723908 21.2249 1.540143721 0.879449 Nat8 Phase II 0.577475667 0.097967475 1.544613333 0.194034411 0.223958 8.72231 0.658839253 3.649696667 0.257085801 0.00021793 0.729355333 0.061073286 0.519025333 0.130013681 1 15.89753333 0.545401349 17.18033333 1.714951986 0.690133 Nat8l Phase II 0.168295 0.019689948 0.148557667 0.009976988 1 0.0168439 0.003120205 0.0224579 0.00488234 1 0.182940667 0.021383077 0.171605667 0.008477217 1 0.0345906 0.011338033 0.023669167 0.005082419 1 Nat9 Phase II 10.8955 0.61859293 13.03003333 0.388520254 0.119541 13.63936667 0.556699756 13.7496 0.314751812 0.455825 10.34539667 0.717254376 10.90988 0.481039661 0.964236 14.9886 0.608661304 13.91353333 0.293393123 0.839524 Nnmt Phase II 0.787347667 0.179942079 1.353533333 0.122641729 0.00297677 77.42363333 6.845999455 39.42096667 3.955120099 0.00021793 1.597566667 0.306522988 3.732533333 0.519832433 0.00147961 85.6036 8.06272938 74.90013333 5.403104255 0.444325 Papss1 Phase II 6.373933333 0.299542022 6.774336667 0.321964091 0.682157 6.068196667 0.718865283 5.288543333 0.142316502 0.01756 7.112836667 0.453510368 6.106756667 0.309416712 0.359907 5.695623333 0.479544696 3.59532 0.153342931 0.00104766 Papss2 Phase II 41.41496667 3.312782851 94.45956667 7.068095522 0.000325724 54.5714 5.960923808 160.6933333 8.162197199 0.00021793 32.40793333 4.200771857 53.64206667 1.640321194 0.00147961 50.51323333 1.283532855 61.5241 3.865933224 0.0642642 Pemt Phase II 338.3696667 21.38825391 314.454 17.20895259 0.496761 224.8073333 4.957047654 183.8486667 2.511785841 0.0012947 359.1083333 37.0678781 303.0383333 7.119655711 0.183423 257.9463333 8.119073148 252.6863333 6.247355556 0.996019 Pnmt Phase II 1.162373333 1.162373333 0 0 0.000325724 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 Ptges Phase II 0.141973667 0.029344284 7.610886667 1.042291964 0.000325724 0.190739 0.04522314 8.19565 0.120284498 0.00021793 0.126517 0.015479029 0.472972 0.032037373 0.00147961 0.323299333 0.110034949 1.330522667 0.423658363 0.00104766 Sars Phase II 9.24241 0.025392291 12.15306667 0.532419839 0.0158759 11.89003333 0.24001246 13.7606 0.204038697 0.619691 10.49546333 0.708719777 9.185866667 0.118991571 0.349809 11.69313333 0.149748749 11.5843 0.336680249 0.997074 Sars2 Phase II 4.686406667 0.137178694 5.355436667 0.348395375 0.417519 4.192423333 0.053060513 4.7637 0.212006643 0.793231 5.064596667 0.044578888 5.09109 0.106853483 0.959807 4.793423333 0.095890803 4.311746667 0.293421425 0.741174 Soat1 Phase II 6.13619 0.147140489 5.227646667 0.24205449 0.00461562 1.059549667 0.038745452 0.933045 0.048670445 0.0618522 7.903376667 0.198281102 8.83563 0.171585501 0.706288 0.78629 0.033378849 0.951375333 0.072910156 0.368208 Soat2 Phase II 21.31493333 1.00123639 32.91643333 3.514050854 0.000325724 13.61436667 0.933845027 21.41143333 0.969094865 0.000416378 22.21393333 1.856436674 18.68166667 0.477409919 0.208999 13.8468 0.333893012 18.82223333 0.74065711 0.00286989 Sult1a1 Phase II 137.7893333 1.779099523 189.9726667 3.00596531 0.000616315 125.9549 21.11283097 171.8633333 11.26155018 0.0301837 123.1463333 6.024199928 145.3826667 1.681436919 0.446084 145.116 6.434272064 126.481 3.339274522 0.404946 Sult1b1 Phase II 3.933153333 0.269684008 3.797846667 0.011403897 0.899681 8.162456667 0.133518405 6.424753333 0.70201373 0.000604071 3.857066667 0.280091611 4.099066667 0.104786135 0.913963 10.46002667 0.53115511 11.33876 1.541157419 0.684373 Sult1c1 Phase II 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 Sult1c2 Phase II 17.67946667 0.688321711 63.52273333 1.807853542 0.000325724 1.681546667 0.238052402 22.6009 1.18923848 0.00021793 17.84483333 1.136282838 28.0794 1.208808723 0.00271992 2.067373333 0.123874391 6.773356667 0.633005382 0.00104766 Sult1d1 Phase II 33.55243333 1.208783764 85.18176667 14.35442737 0.000325724 37.65543333 2.827781287 108.0926667 1.14366725 0.00021793 23.06306667 4.945767743 46.06676667 0.886263825 0.00147961 45.7824 3.171416879 76.78736667 7.261501888 0.00104766 Sult1e1 Phase II 0.022587667 0.012415243 1.000943333 0.158739502 0.106981 0.138384867 0.039682881 54.82756667 13.08720482 0.00021793 0 0 0.0752372 0.004199281 1 0.269176 0.097444112 1.037873667 0.392328856 0.00104766 Sult2a1 Phase II 153.8656667 18.4419963 633.4123333 18.43910415 0.000325724 0.002311867 0.002311867 2.222226667 0.673749097 0.00021793 80.70483333 10.05122586 303.4573333 12.95546763 0.00147961 0.005817933 0.005817933 0.057613333 0.014708156 1 Sult2a2 Phase II 243.6856667 17.0437333 478.703 8.375628454 0.000325724 0.079405267 0.009137519 2.131123333 0.568049286 0.0887117 127.4173333 9.809789742 332.702 11.71580694 0.00147961 0.033493333 0.033493333 0.2176726 0.148526408 1 Sult2a3 Phase II 2.292093333 0.451068732 3.96965 0.421912847 0.305916 0 0 0.006345567 0.006345567 1 3.656556667 1.212289247 5.412636667 0.178377117 0.510963 0 0 0 0 1 Sult2a4 Phase II 6.4554 0.786063268 20.0604 0.841388937 0.847679 0 0 0.0718194 0.024935127 1 3.5913 0.314553854 11.11372 0.722991668 0.403108 0.0031142 0.0031142 0.0065146 0.0065146 1 Sult2a5 Phase II 35.76986667 0.900925599 131.496 3.130711474 0.000325724 0.00224721 0.00224721 0.213461 0.043530467 1 12.77340333 1.657941018 86.42646667 4.132660848 0.00147961 0.004368967 0.004368967 0.020206833 0.020206833 1 Sult2a6 Phase II 14.18603333 1.372273168 17.93693333 0.558821087 0.000325724 0 0 0.03144461 0.026650197 1 8.299613333 0.36411723 10.74232667 0.684697376 0.0153825 0 0 0.011084 0.011084 1 Sult2a7 Phase II 0.0107277 0.0107277 0.041575467 0.020791104 1 1.292356 0.502068003 2.55793 0.553894014 0.000781746 0 0 0.009904033 0.009904033 1 1.157868667 0.384416458 2.78943 0.77737998 0.00104766 Sult2b1 Phase II 0.134951 0.018390988 0.101929367 0.015458802 1 0.008412167 0.008412167 0.015981533 0.007999626 1 0.1717214 0.06174949 0.084864433 0.013753167 1 0.0346221 0.0111826 0.0343695 0.017295531 1 Sult3a1 Phase II 0 0 0.032841633 0.021880695 1 0.085391867 0.072624488 15.90016667 2.958905866 0.000416378 0 0 0 0 1 0.042730167 0.015917096 0.193230633 0.059019998 1 Sult4a1 Phase II 0.0146159 0.009178541 0 0 1 0.003661133 0.003661133 0.018139367 0.007188637 1 0.024095133 0.01429748 0.0174974 0.009540565 1 0.015156433 0.007703589 0 0 1 Sult5a1 Phase II 1.061772333 0.093775097 11.66166667 0.713130003 0.000325724 12.92136667 1.345247518 21.10836667 2.007564802 0.00021793 1.377727667 0.316711759 2.55642 0.177707053 0.0153825 15.70733333 1.676503148 21.9385 2.180471661 0.00104766 Sult6b1 Phase II 0.1127803 0.013872664 0.091965467 0.01013422 1 0.0534367 0.015188068 0.0671812 0.013941166 1 0.089642933 0.018158667 0.084384467 0.016842036 1 0.028103167 0.014540164 0.0363503 0.017334578 1 Tpmt Phase II 18.74796667 1.171974559 35.8059 1.191744251 0.000325724 13.87373333 0.780178521 38.9688 0.353589937 0.00021793 12.17513333 1.060633987 19.91263333 0.552950602 0.00147961 17.01826667 1.053321183 21.49913333 1.445079248 0.0245235 Ugdh Phase II 5.679446667 0.199165271 13.04103333 0.429586516 0.000325724 49.58743333 1.836195434 157.5436667 6.567809435 0.00021793 7.0155 0.163658631 8.907946667 0.269747944 0.20959 50.75103333 4.232055462 95.76936667 4.97693542 0.00104766 Ugp2 Phase II 86.08926667 2.76860363 67.83553333 4.879871028 0.00231118 97.5907 4.119684797 116.7273333 1.628287478 0.493114 78.6781 7.161598954 96.16326667 1.440621042 0.294192 92.97236667 5.240754023 102.555 7.059789232 0.585175 Ugt1a1 Phase II 154.8923333 10.07000075 358.571 7.229806452 0.000325724 158.0786667 17.94104331 387.2003333 15.02169048 0.00021793 137.6683333 6.334591445 162.0176667 2.413481326 0.500846 158.352 3.822524994 289.553 1.57980157 0.00104766 Ugt1a10 Phase II 0.079192867 0.010545725 0.167693 0.028011754 1 0.689679333 0.089043793 1.381686667 0.177913913 0.882697 0.112526167 0.050235855 0.261918667 0.051991925 1 0.721873 0.032562864 1.207382333 0.294038765 0.98811 Ugt1a2 Phase II 0.089011567 0.030945631 0.447107 0.192055367 1 1.189223 0.199563292 1.62936 0.107999921 0.918973 0.0366645 0.010513948 0.148313133 0.118773024 1 1.722353333 0.09907203 2.282313333 0.107098638 0.996317 Ugt1a5 Phase II 0.1983361 0.05775193 0.152377 0.017513658 0.734629 9.845913333 2.370527549 10.09075667 1.01050802 0.936014 0.143538667 0.015452191 0.162783367 0.035961376 1 13.0929 0.534000346 16.3773 1.285043102 0.904711 Ugt1a6a Phase II 9.814923333 0.259206262 17.80343333 0.966712757 0.269139 27.95393333 0.867185621 25.27683333 0.161388376 0.763319 12.75216667 1.10292052 13.59296667 0.149990114 0.975115 30.08766667 1.165270511 37.62856667 1.052188477 0.862402 Ugt1a6b Phase II 43.35193333 2.345187471 54.13173333 2.554819196 0.563024 80.06703333 3.232983963 57.43173333 1.986938251 0.23793 43.7528 0.942619437 52.04956667 0.278277358 0.862621 95.8125 5.910807735 113.618 2.101694634 0.922289 Ugt1a7c Phase II 0.471190333 0.051745055 0.745042667 0.078681779 0.960115 0.328195667 0.074085779 0.361695333 0.147998436 1 0.886559667 0.174833808 0.579011 0.032250971 0.832305 0.389240533 0.22852806 0.252335333 0.015775282 0.962578 Ugt1a9 Phase II 3.469546667 0.21757252 22.9917 2.263204534 0.0150734 37.19336667 6.05280569 168.128 3.062553836 0.00021793 4.269436667 0.676813285 21.7421 1.314989697 0.0998311 30.54893333 3.234213996 81.41793333 6.744389841 0.00368605 Ugt2a1 Phase II 0.000527481 2.70428E-05 0.058245379 0.057763811 1 0.593643667 0.022447512 0.165161459 0.164626771 1 0.057833801 0.030556875 0.00047954 1.5352E-05 1 0.372521271 0.191826393 0.639155333 0.047826415 1 Ugt2a2 Phase II 0.079019133 0.002665141 0.090846143 0.046071249 1 0.004535693 0.002262787 0.345242606 0.172553646 1 0.021804105 0.021802447 0.069541933 0.014163536 1 0.203125253 0.201764448 0.001015104 0.000911298 1 Ugt2a3 Phase II 9.142546667 0.263794594 24.2383 0.797786446 0.000325724 109.1183333 0.87187926 63.11036667 2.842362447 0.00021793 9.74325 0.369597503 8.885333333 0.595019534 0.194255 97.39766667 1.646909957 98.16336667 3.246784656 0.998682 Ugt2b1 Phase II 42.05423333 1.032508126 83.40546667 6.370818488 0.000325724 307.7316667 36.10493004 332.9096667 22.77806375 0.932345 37.55423333 2.816529222 67.40846667 1.14940933 0.00147961 319.8836667 17.72007978 550.01 44.5743766 0.00104766 Ugt2b34 Phase II 94.854 7.265699782 332.3396667 27.47467693 0.000325724 179.2206667 7.593552755 606.794 5.576370953 0.00021793 95.75393333 15.7384087 145.1286667 1.265892351 0.00147961 164.487 6.655557602 291.1266667 6.568061138 0.00104766 Ugt2b35 Phase II 32.73766667 1.361146811 113.1003333 5.153584589 0.000325724 67.42396667 3.850229847 207.6003333 4.288289571 0.00021793 30.70086667 2.813553296 56.79696667 1.136255268 0.00147961 91.39106667 1.905952135 198.9526667 5.743684716 0.00104766 Ugt2b36 Phase II 100.9737667 6.087171742 369.5913333 17.40636384 0.000325724 289.0906667 9.540106871 562.1003333 0.687782023 0.00021793 88.36053333 8.187594685 135.5266667 3.058365704 0.00147961 262.1423333 6.927617732 407.8803333 3.634442293 0.00104766 Ugt2b37 Phase II 7.19697 0.131750282 7.78684 0.462730547 1 36.11853333 0.669026831 34.92416667 0.704800672 0.0130928 7.517906667 0.589823261 7.234486667 0.060618925 1 28.92723333 0.678645026 40.1035 0.933410587 0.868505 Ugt2b38 Phase II 14.1193 0.55158104 15.95923333 1.4957486 0.000325724 81.827 3.866664152 72.45976667 1.748451288 0.00021793 15.07933333 1.453226371 14.25603333 0.455966206 1 64.9314 2.331849721 87.23443333 4.365766774 0.00104766 Ugt2b5 Phase II 87.5399 3.7190649 97.6081 5.594073341 0.425879 407.0703333 13.89395918 392.573 7.716030996 0.214363 90.53786667 7.561141657 88.12733333 1.285506103 0.913963 348.272 7.275951095 479.5103333 8.522544892 0.00104766 Abca1 Transporters 29.1649 1.266678271 20.55353333 1.693098714 0.000325724 21.45093333 2.221071142 17.21973333 0.239265991 0.000959549 31.2279 5.034095495 29.53756667 0.106958876 0.747784 23.138 1.388389608 17.29546667 0.608151753 0.00445703 Abcb1a Transporters 2.6579 0.107680453 5.779523333 0.684253115 0.000325724 0.982996667 0.167251242 4.936846667 0.731275387 0.00021793 3.29818 0.18196247 2.616343333 0.198492767 0.0860093 1.027292 0.167974858 1.480703333 0.069660004 0.00104766 Abcb1b Transporters 0.55268 0.070629521 0.75478 0.076382155 1 0.493650333 0.02359617 0.833441667 0.07429443 1 0.542510333 0.030338955 0.556920333 0.034494886 1 0.524556667 0.038105946 0.432553667 0.031293829 0.2002 Abcc1 Transporters 1.161876667 0.077777088 1.43618 0.063396098 0.606477 0.486045667 0.040503102 0.504220333 0.072984719 0.717467 1.67619 0.140094056 1.276496667 0.114847036 0.104262 0.566353667 0.054005782 0.491125 0.026016859 0.721493 Abcc10 Transporters 1.595006667 0.231205767 1.575246667 0.194068335 0.279588 2.743573333 0.028517961 2.637326667 0.08134721 0.197362 1.70594 0.089275639 2.064556667 0.109974642 0.457585 2.414403333 0.070225996 2.84632 0.065307357 0.271658 Abcc12 Transporters 0.0726817 0.015082752 0.156667333 0.021234074 1 0.043775267 0.008928971 0.239640333 0.034847805 1 0.0919806 0.013225531 0.0870475 0.010332584 1 0.038767033 0.007094574 0.0959357 0.01498438 1 Abcc2 Transporters 49.003 1.877241565 130.0673333 3.720568609 0.000325724 91.0931 1.825169859 234.3463333 9.631545001 0.00021793 53.5183 1.85879446 67.43443333 0.928300832 0.174891 79.71826667 0.601194024 115.0863333 3.199471849 0.00104766 Abcc3 Transporters 8.82988 0.328110154 145.976 5.34653994 0.000325724 53.03326667 4.755080161 191.7413333 12.94863875 0.00021793 10.61534667 1.031646827 27.20313333 2.080216409 0.00147961 58.22406667 1.686109076 129.0493333 3.382574628 0.00104766 Abcc4 Transporters 0.885413333 0.054394574 18.6697 0.83168054 0.000325724 0.557323333 0.073141615 9.172936667 0.268559575 0.00021793 1.188563333 0.049060264 4.371883333 0.166591321 0.00147961 0.636272667 0.02300351 1.68424 0.152274141 0.00104766 Abcc5 Transporters 3.115873333 0.092618133 3.36127 0.123722761 0.958339 1.1717 0.046399599 1.27457 0.078343619 0.963775 3.711823333 0.172546749 3.298466667 0.050790369 0.649146 1.125118667 0.105040286 1.310056667 0.058847928 0.702846 Abcc6 Transporters 31.2575 1.375862508 31.34986667 2.396102769 0.456064 34.1974 1.397714471 28.5319 0.942373282 0.00195791 31.6342 0.899337536 32.34626667 0.632583571 0.990188 33.77013333 0.54948203 37.03343333 0.586642311 0.552211 Abcc8 Transporters 0.001619553 0.001619553 0.006331493 0.004212834 1 0 0 0 0 1 0.00851021 0.006362118 0.01972767 0.012968354 1 0.001602123 0.001602123 0.003682167 0.003682167 1 Abcc9 Transporters 6.533946667 0.213562028 5.562776667 0.136894826 0.0189456 3.5818 0.148379262 3.038846667 0.086149793 0.00462507 7.797626667 0.628826579 12.35076667 0.344486315 0.00147961 3.323746667 0.287447231 2.883513333 0.138716222 0.43728 Abcg2 Transporters 18.66993333 0.1103343 28.27143333 0.73334714 0.000325724 28.13116667 2.813321125 26.42286667 0.378722072 0.102471 18.24816667 1.784098245 25.91726667 0.320513444 0.0160556 29.0347 0.875176224 31.78236667 0.06099826 0.581879 Abcg5 Transporters 36.26113333 1.733032945 26.4951 1.917553883 0.001639 27.6194 4.325237484 15.04763333 0.395093282 0.00021793 29.14176667 0.695490355 38.90303333 0.229229015 0.315194 22.99736667 0.62315293 32.2368 2.322390467 0.0612726 Abcg8 Transporters 33.3401 2.438463394 18.30223333 1.391593926 0.000325724 24.72253333 3.993368813 14.7326 0.844910812 0.00021793 27.99296667 2.527308226 28.52743333 0.835253944 0.980207 22.61066667 1.529767798 33.51443333 1.348234808 0.00197343 Atp7b Transporters 6.32454 0.277822338 6.88994 0.15529728 0.511717 4.689303333 0.142568735 6.801846667 0.473601425 0.0022758 8.748743333 0.320956329 6.733576667 0.101474296 0.0399897 5.184983333 0.24981475 5.380563333 0.205502816 0.883254 Slc15a1 Transporters 0.005295047 0.002647819 0.038354033 0.007587961 1 0.011175763 0.002649726 0.016234223 0.004347969 1 0.021509043 0.007259546 0.012277933 0.008863175 1 0.005689497 0.002892005 0.008589517 0.005180296 1 Slc15a2 Transporters 0.248113333 0.071644279 0.318326 0.173707005 0.0806877 0.547699333 0.307628955 0.501257333 0.027284584 0.402504 0.707206667 0.114274508 0.136486567 0.04008279 0.00271992 0.616561 0.146798683 0.51474 0.086261412 0.630895 Slc22a1 Transporters 55.01143333 3.295134293 106.1352 4.100084996 0.000325724 152.9576667 4.088323264 213.9416667 1.258710495 0.016848 55.3676 2.239557564 50.24956667 2.391638363 0.496313 164.338 3.541274676 191.95 7.716124437 0.180112 Slc22a12 Transporters 0.003785667 0.003785667 0.007240367 0.003620696 1 0 0 0.015004833 0.009495798 1 0 0 0 0 1 0.003677067 0.003677067 0.007437533 0.007437533 1 Slc22a2 Transporters 0.185832667 0.01700795 0.518496667 0.056194689 1 0.779532667 0.08848909 1.261206667 0.026731646 1 0.231565333 0.006632159 0.331067 0.06419293 1 0.929277 0.157376625 0.653257333 0.050737882 1 Slc22a21 Transporters 0.436677333 0.048872131 0.530130667 0.031131817 1 0.627111 0.032169382 0.841121 0.065094167 1 0.478711 0.031456366 0.536931333 0.030406967 0.745645 0.498397667 0.034443287 0.64018 0.031967247 1 Slc22a3 Transporters 0.691378 0.055815249 0.254073 0.018578122 0.000325724 0.677456 0.097399515 0.324199667 0.051429325 0.00021793 0.522240667 0.06107015 1.023836333 0.059130418 0.00582348 1.063320333 0.070322969 0.812515333 0.057942939 0.239869 Slc22a4 Transporters 0.239975667 0.031592631 0.659374 0.093586447 0.000325724 1.39536 0.091448736 3.813376667 0.382965057 0.00021793 0.723716 0.121359647 0.747531333 0.015144126 0.987882 1.536183333 0.131196558 3.97934 0.426394201 0.00104766 Slc22a5 Transporters 3.988573333 0.114386264 4.698133333 0.079962093 0.129988 8.500916667 0.968595078 10.82338 0.572760181 0.130045 4.249393333 0.289363436 4.515723333 0.071029844 0.986824 5.228163333 0.156540865 6.744346667 0.199578963 0.0296242 Slc22a6 Transporters 0.002045023 0.002045023 0.007888067 0.003944034 1 0.00228969 0.00228969 0.019173433 0.007953143 1 0.002169097 0.002169097 0.003750633 0.003750633 1 0.001950497 0.001950497 0.012673583 0.00324583 1 Slc22a7 Transporters 30.4616 2.44461172 5.037613333 0.056000019 0.000325724 22.87173333 1.689010322 7.01107 0.643622368 0.00021793 15.33893333 1.870335087 20.02063333 0.593398439 0.107237 24.98043333 2.806423703 21.88003333 0.286424838 0.470945 Slc22a8 Transporters 0.957375333 0.185153361 0.289080333 0.042327614 0.000325724 0.002545997 0.002545997 0.035465733 0.005530672 1 0.589351333 0.075903062 0.443807333 0.055991398 0.344464 0.00244118 0.00244118 0.00795815 0.000297605 1 Slc28a1 Transporters 0.069507967 0.010415078 0.147158667 0.033184103 1 0.040379113 0.016108119 0.261023 0.051503771 0.00288964 0.184155667 0.052664052 0.181772 0.006666941 1 0.0679806 0.014644771 0.114583333 0.02909059 1 Slc28a2 Transporters 0.362102667 0.032786419 0.371859333 0.016399363 0.550569 0.289827333 0.036749176 0.26442 0.008097061 1 0.420566333 0.060239288 0.373858 0.039551497 0.85865 0.267738667 0.020555463 0.269928667 0.03572624 1 Slc28a3 Transporters 0.00769159 0.002355667 0.015570367 0.010802518 1 0.0109891 0.00549481 0.007233317 0.001548715 1 0.036593133 0.009098317 0.00348862 0.001751424 1 0.031922833 0.019039891 0.0212933 0.007634608 1 Slc29a1 Transporters 39.696 1.221728678 51.0589 1.754108757 0.0101698 81.4858 5.961639221 76.19226667 0.543705099 0.102471 39.5599 0.609844589 40.51993333 0.815289119 0.993233 85.03223333 3.22842611 75.64423333 1.691381684 0.56041 Slc29a2 Transporters 0.304899333 0.037680425 0.377675 0.020411741 0.278084 0.210100333 0.034888274 0.201339667 0.017757856 1 0.381825 0.06107373 0.41003 0.047885937 0.955496 0.224844667 0.035063612 0.232921 0.033176751 1 Slc29a3 Transporters 2.21355 0.09156835 2.034723333 0.074079799 0.0794255 1.232356667 0.05913775 1.100806667 0.013738813 0.0841136 2.19456 0.190019145 2.080926667 0.049632725 0.769231 1.192196667 0.038297995 1.08757 0.072261913 0.759776 Slc29a4 Transporters 0.100724833 0.031564888 0.0951123 0.012566641 1 0.00645861 0.00323799 0.00635142 0.003182779 1 0.062226833 0.009427048 0.078488433 0.023376645 1 0.007087533 0.007087533 0.0163771 0.00856951 1 Slc47a1 Transporters 31.68616667 1.254727078 23.58606667 1.705872631 0.000325724 30.25333333 0.330169635 30.2462 1.868544595 0.362507 31.1986 1.257314222 32.24796667 0.80693543 0.971707 31.73443333 0.683324892 28.62196667 1.82336803 0.639682 Slc47a2 Transporters 0.007087233 0.003543981 0.017113067 0.003384354 1 0.003611433 0.003611433 0.014366933 0.00308186 1 0.0142385 0.007172623 0.0175344 0.007696355 1 0.014467933 0.003028738 0.015008533 0.007551139 1 Slco1a1 Transporters 0.221110333 0.053929994 0.311677667 0.062654657 0.806813 108.1853667 13.13877298 5.94054 1.745561055 0.00021793 0.140942 0.023982772 0.280925 0.052486633 0.0665541 92.90763333 8.033639614 53.8655 4.557171466 0.00104766 Slco1a4 Transporters 4.872396667 0.7879007 18.0273 1.034118979 0.000325724 14.8591 1.347256963 29.95713333 2.178584766 0.00021793 1.827426667 0.351030458 5.225763333 0.537108675 0.00147961 7.482946667 0.572347659 9.321346667 1.867492881 0.0305683 Slco1a5 Transporters 0.050853 0.009011323 0.156490467 0.029879722 1 0.699592333 0.109850008 0.346459333 0.029787349 1 0.0213578 0.004060546 0.056195 0.012324218 1 0.552612 0.008667636 0.301202 0.018961822 1 Slco1a6 Transporters 0.013224537 0.005391829 0.022092543 0.00699596 1 0.0706019 0.004893781 0.038459367 0.012757487 1 0 0 0.002747397 0.001584296 1 0.046202533 0.009709345 0.0501591 0.019016417 1 Slco1b2 Transporters 170.6903333 13.93516459 168.3016667 17.20737928 0.128149 293.5283333 10.67089756 191.108 9.454104788 0.00021793 134.7837333 28.7289484 168.4673333 3.067332953 0.180561 243.9873333 10.6606122 281.6306667 8.413302192 0.297004 Slco1c1 Transporters 0.008664447 0.005246086 0.012510113 0.004919593 1 0.027465767 0.006854077 0.0160961 0.000632 1 0.00537154 0.002691608 0.015554047 0.008326431 1 0.022349067 0.011359353 0.025049967 0.005381895 1 Slco2a1 Transporters 11.7824 0.395202189 12.7373 0.175964779 0.852712 24.33703333 0.967522741 19.1664 0.529584982 0.00021793 14.20686667 0.581260511 15.3308 0.373985739 0.857501 21.19526667 0.958306543 23.5253 2.278109236 0.468864 Slco2b1 Transporters 1.106328667 0.149689683 0.424772 0.040073931 0.000325724 33.75066667 1.207691559 31.41203333 0.844355189 0.0891448 1.781365667 0.453725704 1.303533333 0.038603517 0.0950722 36.6309 0.845717863 36.46733333 1.556502779 0.99147 Slco3a1 Transporters 1.48134 0.037190327 1.402786667 0.10971537 0.567167 1.1305 0.042231216 1.101902333 0.100518865 0.41837 1.663703333 0.237454138 1.33068 0.114470069 0.323883 1.374923333 0.132404818 1.2902 0.076624302 0.922973 Slco4a1 Transporters 0.231524667 0.045759012 0.189102 0.022615275 1 0.050711967 0.008785263 0.0527972 0.01240906 1 0.167983333 0.039997216 0.156609967 0.036958533 1 0.043726933 0.017963157 0.040373233 0.008464975 1 Slco4c1 Transporters 0.0688001 0.034774725 0.061152333 0.015544691 1 0.007603667 0.003811778 0 0 1 0.127055767 0.022866513 0.139463333 0.01939645 1 0 0 0.007576133 0.007576133 1 Slco5a1 Transporters 0.00670953 0.001721463 0.008165407 0.002746997 1 0 0 0.0029079 0.000114908 1 0.011957787 0.001984607 0.006480583 0.003416269 1 0.00425722 0.003005663 0.00206353 0.001032548 1 Slco6b1 Transporters 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 Slco6c1 Transporters 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 Slco6d1 Transporters 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1
RNA-Seq Reveals Age- and Species Differences of CAR-targeted Drug-Processing Genes in Liver
Sunny Lihua Cheng, Theo K. Bammler, and Julia Yue Cui
Drug Metabolism and Disposition
Supplementary Table 3. Primer sequences
Gene Name Forward sequence (5,-3,) Reverse sequence (5,-3,)
mCAR CTCAAGGAAAGCAGGGTCAG AGTTCCTCGGCCCATATTCT
hCAR AATGGATGTCATCAATCTCAGG CTTAGGGAATTCAGGTATCGTG
hCAR-SV0 AGATGGAGCCCGTGTGGG GGTAACTCCAGGTCGGTCAGG
hCAR-SV1 GAAGATGGAGCCCGTGTATCTC GGTAACTCCAGGTCGGTCAGG
hCAR-SV2 AGATGGAGCCCGTGTGGG AACTCCAGGTCGGTCTGTAAGAT
hCAR-SV3 GAAGATGGAGCCCGTGTATCTC AACTCCAGGTCGGTCTGTAAGAT hCAR-SV4 AGATGGAGCCCGTGACCG TGCTGGCCCTTGATGTAGCT
Cyp2b10 AAGGAGAAGTCCAACCAGCA CTCTGCAACATGGGGGTACT
Cyp3a11 ACAAACAAGCAGGGATGGAC GGTAGAGGAGCACCAAGCTG
Cyp1a2 GACATGGCCTAACGTGCAG GGTCAGAAAGCCGTGGTTG
β-actin GGCCAACCGTGAAAAGATGA CAGCCTGGATGGCTACGTACA
Nqo1 TATCCTTCCGAGTCATCTCTAGCA TCTGCAGCTTCCAGCTTCTTG
Aldh1a1 CAAGGCCAATGTTGTGTCGC ACCACACTCCAGTTTGGCTC
Gstm1 CTCCCGACTTTGACAGAAGC TTGCTCTGGGTGATCTTGTG
Gstm3 AGAGGAGGAGAGGATCCGTG GGGACTGCAGCAGACTATCAT
Ugt2b35 GGCGCGAATGGACTCTATGA GCACTTTACAGGAAGGACTGC
Sult3a1 CCAAAATGCCATCACCTCGC ACTTTCTACAGTGTCTGGATTTTGA
Sult5a1 TCTTCGGCTCCTGGTTTGAC TGGACAGCAGGCTGTAGTTG
Mrp3 TGGTCATGCTGTCAGCTTTC AAGGACTGAGGGGAACGAAT
Mrp4 GCAAAGCCCATGTACCATCT ACCACGGCTAACAACTCACC