DOCSLIB.ORG

Fused Five-Membered Aromatic Heterocycles Built on the Α-Pyrone Moiety

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Fused Five-Membered Aromatic Heterocycles Built on the Α-Pyrone Moiety molecules Review Synthetic Routes to Coumarin(Benzopyrone)-Fused Five-Membered Aromatic Heterocycles Built on the α-Pyrone Moiety. Part 1: Five-Membered Aromatic Rings with One Heteroatom Eslam Reda El-Sawy 1 , Ahmed Bakr Abdelwahab 2 and Gilbert Kirsch 3,* 1 National Research Centre, Chemistry of Natural Compounds Department, Dokki-Cairo 12622, Egypt; [email protected] 2 Plant Advanced Technologies (PAT), 54500 Vandoeuvre-les-Nancy, France; [email protected] 3 Laboratoire Lorrain de Chimie Moléculaire (L.2.C.M.), Université de Lorraine, 57050 Metz, France * Correspondence: [email protected]; Tel.: +33-03-72-74-92-00; Fax: +33-03-72-74-91-87 Abstract: This review gives an up-to-date overview of the different ways (routes) to the synthesis of coumarin(benzopyrone)-fused, five-membered aromatic heterocycles with one heteroatom, built on the pyrone moiety. Covering 1966 to 2020. Keywords: coumarins; benzopyrones; five-membered aromatic heterocycles; furan; pyrrole; thio- phene; selenophen Citation: El-Sawy, E.R.; Abdelwahab, A.B.; Kirsch, G. Synthetic Routes to 1. Introduction Coumarin(Benzopyrone)-Fused Five-Membered Aromatic Coumarins are a family of benzopyrones (1,2-benzopyrones or 2H-[1]benzopyran- Heterocycles Built on the α-Pyrone 2-ones), which represent an important family of oxygen-containing heterocycles, widely Moiety. Part 1: Five-Membered distributed in nature [1–4]. Coumarins display a broad range of biological and pharma- Aromatic Rings with One cological activities, [5,6] such as antiviral [7–10], anticancer [11–13], antimicrobial [14,15], Heteroatom. Molecules 2021, 26, 483. and antioxidant [16–18] activities. On the other hand, coumarin represents an ingredi- https://doi.org/10.3390/molecules26 ent in perfumes [19], cosmetics [20], and as industrial additives [21,22]. Furthermore, 020483 coumarins play a pivotal role in science and technology as fluorescent sensors, mainly due to their interesting light-emissive characteristics, which are often responsive to the Academic Editor: Maria João Matos environment [23–26]. The coumarin (benzopyrane)-fused, membered aromatic heterocy- Received: 26 December 2020 cles built on the α-pyrone moiety are an important scaffold. The only fused heterocycle Accepted: 13 January 2021 with an α-pyrone moiety of coumarin that can be found in nature is the furan ring. One ex- Published: 18 January 2021 ample is the naturally occurring furan 4H-furo[3,2-c]benzopyran-4-one, which provides the main core of many natural compounds of so-called coumestans. These comestans include Publisher’s Note: MDPI stays neutral coumestan, wedelolactone, and coumestrol. The coumestans are found in a variety of plant with regard to jurisdictionalMolecules claims 2021 in, 26, x FOR PEER REVIEW 2 of 22 species that are commonly used in traditional medicine [27]. published maps and institutional affil- iations. Copyright: © 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https:// creativecommons.org/licenses/by/ 4.0/). In order to enrich the limited versatility of the structures found in nature, synthesis of coumarin (benzopyrane)-fused, membered aromatic heterocycles has received con- siderable attention, including numerous reported routes. Molecules 2021, 26, 483. https://doi.org/10.3390/molecules26020483This review gives an up-to-datehttps://www.mdpi.com/journal/molecules overview of the different ways (routes) to the synthesis of benzopyrone-fused, five-membered aromatic heterocycles with one heteroatom, built on the pyrone moiety, from 1966 to 2020. Our main interest in this current work is to describe the components that have one heteroatom in an alicyclic-fused ring with the pyrone part of coumarin. The synthetic pathway of the investigated scaffold has provided systems containing oxygen, nitrogen, sulfur, and selenium in their core structure. The last heteroatom is less described in the output of the synthetic efforts. The fused heterocycles that contain more than one heteroatom will be detailed in the next part, which we intend to publish in the future. Many strategies have been developed for the synthesis of the fused, five-membered aromatic heterocycle-benzopyran-4-ones. There are two main approaches to constructing these skeletons: five-membered, aromatic heterocycle construction, and pyrone-ring construction. 2. Synthesis of Benzopyrone-Fused, Five-Membered Aromatic Heterocycles 2.1. Five-Membered Aromatic Rings with one Heteroatom 2.1.1. Furans Furobenzopyrone (or furocoumarins) comprises an important class of coumarins found in a wide variety of plants, particularly in the carrot (Apiaceae/Umbelliferae), legume (Fabaceae), and citrus families (Rutaceae) [27]. The chemical structure of furobenzopyrone (furocoumarins) consists of a furan ring fused with coumarin. The fusion of the furan ring to the α-pyrone moiety of coumarin forms the core structure of the three most common isomers, viz. 4H-furo[2,3-c]chromen(benzopyran)-4-one, 4H-furo[3,4-c]chromen(benzopyran)-4-one, and 4H-furo[3,2-c]chromen (benzopy- ran)-4-one (Figure 1). Figure 1. The three most common isomers of a furan ring fused to the α-pyrone moiety of coumarin. Molecules 2021, 26, x FOR PEER REVIEW 2 of 22 Molecules 2021, 26, 483 2 of 21 In order to enrich the limited versatility of the structures found in nature, synthesis of coumarin (benzopyrane)-fused,In order to enrich membered the limited aromatic versatility heterocycles of the structures has received found considerable in nature, synthesis attention, includingof coumarin numerous (benzopyrane)-fused, reported routes. membered aromatic heterocycles has received con- This reviewsiderable gives an attention, up-to-date including overview numerous of the differentreported routes. ways (routes) to the synthesis of benzopyrone-fused,This five-memberedreview gives an aromaticup-to-date heterocycles overview of with the different one heteroatom, ways (routes) built to the on the pyronesynthesis moiety, fromof benzopyrone-fused, 1966 to 2020. Our five-membered main interest inaromatic this current heterocycles work iswith to one describe the componentsheteroatom, thatbuilt haveon the one pyrone heteroatom moiety, from in an 1966 alicyclic-fused to 2020. Our ringmain with interest the in this current work is to describe the components that have one heteroatom in an pyrone part of coumarin. The synthetic pathway of the investigated scaffold has provided alicyclic-fused ring with the pyrone part of coumarin. The synthetic pathway of the systems containinginvestigated oxygen, scaffold nitrogen, has sulfur, provided and system seleniums containing in their core oxygen, structure. nitrogen, The sulfur, last and heteroatom is lessselenium described in their in core the outputstructure. of The the last synthetic heteroatom efforts. is less The described fused heterocycles in the output of the that contain moresynthetic than oneefforts. heteroatom The fused will heterocycles be detailed that in contain the next more part, than which one heteroatom we intend will be to publish in thedetailed future. in the next part, which we intend to publish in the future. Many strategiesMany have strategies been developed have been fordeveloped the synthesis for the ofsynthesis the fused, of the five-membered fused, five-membered aromatic heterocycle-benzopyran-4-ones.aromatic heterocycle-benzopyran-4-ones. There are two There main are approaches two main to construct-approaches to ing these skeletons:constructing five-membered, these skeletons: aromatic five-membere heterocycled, construction,aromatic heterocycle and pyrone-ring construction, and construction. pyrone-ring construction. 2. Synthesis of2. Benzopyrone-Fused, Synthesis of Benzopyrone-Fused, Five-Membered Five-Membered Aromatic Aromatic Heterocycles Heterocycles 2.1. Five-Membered2.1. Five-Membered Aromatic Rings Aromatic with One Rings Heteroatom with one Heteroatom 2.1.1. Furans 2.1.1. Furans FurobenzopyroneFurobenzopyrone (or furocoumarins) (or furocoumarins) comprises comp an importantrises an important class of class coumarins of coumarins found in a widefound variety in a of wide plants, variety particularly of plants, particularly in the carrot in (theApiaceae/Umbelliferae carrot (Apiaceae/Umbelliferae), legume), legume (Fabaceae), and( citrusFabaceae families), and citrus (Rutaceae families)[27 (Rutaceae]. The chemical) [27]. The structurechemical structure of furobenzopyrone of furobenzopyrone (furocoumarins) consists of a furan ring fused with coumarin. The fusion of the furan (furocoumarins) consists of a furan ring fused with coumarin. The fusion of the furan ring ring to the α-pyrone moiety of coumarin forms the core structure of the three most to the α-pyrone moiety of coumarin forms the core structure of the three most common iso- common isomers, viz. 4H-furo[2,3-c]chromen(benzopyran)-4-one, mers, viz. 4H-furo[2,3-4H-furo[3,4-c]chromen(benzopyran)-4-one,c]chromen(benzopyran)-4-one, 4 H-furo[3,4-and 4Hc-furo[3,2-]chromen(benzopyran)-c]chromen (benzopy- 4-one, and 4H-furo[3,2-ran)-4-onec]chromen (Figure 1). (benzopyran)-4-one (Figure1). FigureFigure 1.1. The three most most common common isomers isomers of a of furan a furan ring ring fused fused to the to α the-pyroneα-pyrone moiety moiety of coumarin. of coumarin. 4H-Furo[2,3-c]benzopyran-4-one Furan Construction The basic building block for the formation of 4H-furo[2,3-c]benzopyran-4-one is the 3- hydroxycoumarin
Load more

Recommended publications
  • Recent Advances in the Synthesis of Five- and Six-Membered Selena
    290 RECENT ADVANCES IN THE SYNT HESIS OF FIVE - AND SIX - MEMBERED SELENA - HETEROCYCLES DOI: http://dx.medra.org/ 10.17374/targets.2021.24.290 D amiano Tanini * , Antonella Capperucci Department of Chemistry “Ugo Schiff ”, Università di Firenze , Via della Lastruccia 3 - 13, 50019 Sesto Fiorentino (Firenze ) , Italy (e - mail: [email protected] ) Abstract. Organoselenium compounds play an increasingly important role in chemistry and biochemistry. Amongst the wide variety of selenium - containing systems, selena - heterocycles are versatile derivatives with broad applications in organic synthesis, catalysis, medicinal chemistry, and biology. In this context, taking into account the poor stability of most selenylating reagents or intermediates , the developm ent of simple, mild and ver satile synthetic methodologies towards functionalised selena - heterocycles remains an attractive yet challenging topic . This chapter will be focusing on recent advances on the synthesis of different classes of selenium - containing five - and six - member ed ring systems. Contents 1. I ntroduction 2. S ynthesis of heterocyc lic systems containing selenium 3. S ynthesis of heterocyclic systems containing selenium and nitrogen 4. S ynthesis of heterocyclic systems containing selenium and other heteroatoms (O, S, P) 5. C onclusion s and future outlook Acknowledgement s References 1. I ntroduction Selenium - containing small molecules occupy a central position in chemical science , with different application s in organic synthesis, material sciences and polymer chemistry . 1,2,3 Organoselenides are often employed as synthetic intermediates, ligands, and catalysts. 4,5,6,7 Furthermore, owing to their antioxidant, enzyme modulator, and anticancer properties, selenium - containing organic molecules play an increasingly important role in medicinal chemistry and biology.
    [Show full text]
  • Glossary of Terms
    Glossary of Terms Acceptable Daily Intake or Allowed Daily Intake (ADI) → Dose- Response Relationship/Curve Allergen The allergen is a material which triggers an allergic reaction. Allopathy The term allopathy was created by Christian Friedrich Samuel Hahnemann (1755– 1843) (from the Greek prefix άλλος, állos, “other”, “different” and the suffix πάϑος, páthos, “suffering”) in order to distinguish his technique (homeopathy) from the traditional medicine of his age. Today, allopathy means a medicine based on the principles of modern pharmacology. Anaphylactic shock Anaphylaxis (or an anaphylactic shock) is a whole-body, rapidly developing aller- gic reaction, which may lead to lethal respiratory and circulatory failure. Antibody Antibodies are proteins produced by the immune system to neutralize exogenous (external) substances. Chromatography, chromatogram Chromatography is the common name of different techniques used to separate mix- tures of compounds. HPLC stands for high-performance liquid chromatography. A chromatogram is the pattern of separated substances obtained by chromatography. Colloidal sol A colloidal sol is a suspension of very small solid particles in a continuous liquid medium. Colloidal sols are quite stable and show the Tyndall effect (light scatter- ing by particles in a colloid). They can be quite stable. Examples include blood, pigmented ink, and paint. Colloidal sols can change their viscosity quickly if they © Springer International Publishing Switzerland 2014 311 L. Kovács et al., 100 Chemical Myths, DOI 10.1007/978-3-319-08419-0 312 Glossary of Terms are thixotropic. Examples include quicksand and paint, both of which become more fluid under pressure. Concentrations: parts per notations In British/American practice, the parts-per notation is a set of pseudo-units to de- scribe concentrations smaller than thousandths: 1 ppm (parts per million, 10−6 parts) One out of 1 million, e.g.
    [Show full text]
  • Selenophene Transition Metal Complexes Carter James White Iowa State University
    Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations 1994 Selenophene transition metal complexes Carter James White Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/rtd Part of the Inorganic Chemistry Commons Recommended Citation White, Carter James, "Selenophene transition metal complexes " (1994). Retrospective Theses and Dissertations. 10521. https://lib.dr.iastate.edu/rtd/10521 This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. INFORMATION TO USERS This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer. The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if imauthorized copyright material had to be removed, a note will indicate the deletion. Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand corner and continuing from left to right in equal sections with small overlaps.
    [Show full text]
  • A New Coumestan Glucoside from Eclipta Prostrata
    Natural Product Sciences 26(4) : 289-294 (2020) https://doi.org/10.20307/nps.2020.26.4.289 A New Coumestan Glucoside from Eclipta prostrata Young Ju Seo†, Hyun Woo Kil†, Taewoong Rho, and Kee Dong Yoon* College of Pharmacy and Integrated Research Institute of Pharmaceutical Sciences, The Catholic University of Korea, Bucheon-si, Gyeonggi-do 14662, Korea Abstract Eclipta prostrata is an annual herb, belonging to Asteraceae family, and has been traditionally used to improve immunity and treat hepatitis and bacterial disease in Korea. In this study, a new coumestan glucoside (1) along with ten known compounds (2 – 11) was isolated from E. prostrata. The chemical structures of isolates were elucidated to be wedelolactone-9-O--D-glucopyranoside (1), wedelolactone (2), demethylwedelolactone (3), apigenin (4), apigenin-7-sulfate (5), luteolin (6), luteolin-7-sulfate (7), luteolin-7-O--D-glucopyranoside (8), pratensein-7-O--D-glucopyranoside (9), 3,4-di-O-caffeoylquinic acid (10) and 3,5-di-O-caffeoylquinic acid (11) based on the spectroscopic evidence. Keywords Eclipta prostrata, Asteraceae, Phenolic compounds, Wedelolactone-9-O--D-glucopyranoside Introduction infrared spectroscopy (FT-IR). Eclipta prostrata is an annual herb, belonging to Experimental Asteracea family, and distributed in the tropical and subtropical areas, especially Asia and Africa.1 Eclipta General experimental procedures – The preparative prostrata has been traditionally used to improve immunity HPLC was performed using a Gilson HPLC system and treat hepatitis and bacterial diseases in Korea.2 In (Middleton, WI, USA) composed of a binary pump, a India, E. prostrata has been used to treat body pain, fever, liquid handler, and a UV/Vis detector with a Luna C18(2) hair loss, jaundice, liver enlargement and skin diseases.3 (21.2 × 250 mm I.D., 5 μm, Phenomenex, Torrance, CA, Recent biological evidence revealed that the E.
    [Show full text]
  • This Article Was Originally Published in Hormones, Brain and Behavior 2Nd
    This article was originally published in Hormones, Brain and Behavior 2nd edition, published by Elsevier, and the attached copy is provided by Elsevier for the author's benefit and for the benefit of the author's institution, for non- commercial research and educational use including without limitation use in instruction at your institution, sending it to specific colleagues who you know, and providing a copy to your institution’s administrator. All other uses, reproduction and distribution, including without limitation commercial reprints, selling or licensing copies or access, or posting on open internet sites, your personal or institution’s website or repository, are prohibited. For exceptions, permission may be sought for such use through Elsevier's permissions site at: http://www.elsevier.com/locate/permissionusematerial Gore A C and Crews D Environmental Endocrine Disruption of Brain and Behavior. In: Donald W. Pfaff, Arthur P. Arnold, Anne M. Etgen, Susan E. Fahrbach and Robert T. Rubin, editors. Hormones, Brain and Behavior, 2nd edition, Vol 3. San Diego: Academic Press; 2009. pp. 1789-1816. Author's personal copy 56 Environmental Endocrine Disruption of Brain and Behavior A C Gore and D Crews, University of Texas at Austin, Austin, TX, USA ß 2009 Elsevier Inc. All rights reserved. Chapter Outline 56.1 Introduction to Endocrine Disruption 1790 56.1.1 Critical Issues about Endocrine Disruption 1791 56.1.1.1 Life stage and timing 1791 56.1.1.2 Latency of effects 1791 56.1.1.3 Sensitivity to EDCs 1792 56.1.1.4 Degradation and metabolism,
    [Show full text]
  • Supplementary Material Hydrogen-Rich Water-Alleviated
    10.1071/FP15204_AC © CSIRO 2015 Supplementary Material: Functional Plant Biology, 42(12), 1141–1157. Supplementary Material Hydrogen-rich water-alleviated ultraviolet-B-triggered oxidative damage is partially associated with the manipulation of the metabolism of (iso)flavonoids and antioxidant defence in Medicago sativa Yanjie XieA, Wei ZhangA, Xingliang DuanA, Chen DaiA, Yihua ZhangA, Weiti CuiA, Ren WangB and Wenbiao ShenA,C ACollege of Life Sciences, Laboratory Center of Life Sciences, Nanjing Agricultural University, Nanjing 210095, China. BInstitute of Botany, Jiangsu Province and the Chinese Academy of Sciences, Nanjing 210014, China. CCorresponding author. Email: [email protected] 1 Table S1. The sequences of primers for real-time RT-PCR M. truncatula tentative consensus Primer name or accession number Sequences Forward: CTTGATGAGGTGAAGCGTAT PAL X58180 Reverse: ACCGTAACTGTCCGTGCC Forward: TGTTTGTGAATACATGGCACCTT CHS AW776018 Reverse: TGACTTTGGTTGACCCCATTCT Forward: TACTTGAGACCCTTGACTT CHI KF765782 Reverse: GGTGATTGCCTGTAGAAA Forward: CTTGATGAGGTGAAGCGTAT FLS XM_003601032 Reverse: ACCGTAACTGTCCGTGCC Forward: AATGGAGAAATCATAGAGGGCGAGCAG IFS AY167424 Reverse: GTTGATGAGCTCTGCCAAAGTCCATTC Forward: ACATGGAAAGCCTATGACTGTTC 6IOMT DQ419913 Reverse: ACACAACTCCAGTCCCACCTG Forward: TAATTGCTGATGCCAACG Cu/Zn-SOD AF056621 Reverse: ACCACAGGCTAATC TTCCAC Forward: TGTCATCAGCG GCGTA ATCAT Mn-SOD AY145894 Reverse: GGGCTTCCTTTGGTGGTTCA Forward: TCAATCGTACGTGGTGTGCT POD 1A X90692 Reverse: TGCACTTTGCTCGCTCACTA Forward: AGCTGCATTTGCTGCTCAAG POD 1B X90693
    [Show full text]
  • Structures of Two New Flavonoids and Effects of Licorice Phenolics on Vancomycin-Resistant Enterococcus Species
    Molecules 2014, 19, 3883-3897; doi:10.3390/molecules19043883 OPEN ACCESS molecules ISSN 1420-3049 www.mdpi.com/journal/molecules Article Structures of Two New Flavonoids and Effects of Licorice Phenolics on Vancomycin-Resistant Enterococcus Species Eerdunbayaer 1, Mohamed A. A. Orabi 1,2, Hiroe Aoyama 1, Teruo Kuroda 3 and Tsutomu Hatano 1,* 1 Department of Natural Product Chemistry, Okayama University, Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Tsushima-naka, Kita-ku, Okayama 700-8530, Japan; E-Mails: [email protected] (E.); [email protected] (M.A.A.O.); [email protected] (H.A.) 2 Faculty of Pharmacy, Al-Azhar University, Assiut 71524, Egypt 3 Drug Discovery Technology Center, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Tsushima-naka, Kita-ku, Okayama 700-8530, Japan; E-Mail: [email protected] * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +81-86-251-7936; Fax: +81-86-251-7926. Received: 28 February 2014; in revised form: 17 March 2014 / Accepted: 21 March 2014 / Published: 28 March 2014 Abstract: Since our previous study revealed that several licorice phenolics have antibacterial effects on methicillin-resistant Staphylococcus aureus (MRSA), and suppressive effects on the oxacillin resistance of MRSA, we further investigated effectiveness of licorice constituents on vancomycin-resistant Enterococcus (VRE) bacteria, and purified 32 phenolic compounds. Two flavonoids among them were characterized structurally, and identified their structures as demethylglycyrol (31) and 5,7-di-O-methylluteone (32), respectively. Examination of antibacterial effects of licorice phenolics showed that 3-arylcoumarins such as licoarylcoumarin (9) and glycycoumarin (26), and 2-arylcoumarones such as gancaonin I (17), have moderate to potent antibacterial effects on the VRE strains used in this study.
    [Show full text]
  • Antioxidant, Cytotoxic, and Antimicrobial Activities of Glycyrrhiza Glabra L., Paeonia Lactiflora Pall., and Eriobotrya Japonica (Thunb.) Lindl
    Medicines 2019, 6, 43; doi:10.3390/medicines6020043 S1 of S35 Supplementary Materials: Antioxidant, Cytotoxic, and Antimicrobial Activities of Glycyrrhiza glabra L., Paeonia lactiflora Pall., and Eriobotrya japonica (Thunb.) Lindl. Extracts Jun-Xian Zhou, Markus Santhosh Braun, Pille Wetterauer, Bernhard Wetterauer and Michael Wink T r o lo x G a llic a c id F e S O 0 .6 4 1 .5 2 .0 e e c c 0 .4 1 .5 1 .0 e n n c a a n b b a r r b o o r 1 .0 s s o b b 0 .2 s 0 .5 b A A A 0 .5 0 .0 0 .0 0 .0 0 5 1 0 1 5 2 0 2 5 0 5 0 1 0 0 1 5 0 2 0 0 0 1 0 2 0 3 0 4 0 5 0 C o n c e n tr a tio n ( M ) C o n c e n tr a tio n ( M ) C o n c e n tr a tio n ( g /m l) Figure S1. The standard curves in the TEAC, FRAP and Folin-Ciocateu assays shown as absorption vs. concentration. Results are expressed as the mean ± SD from at least three independent experiments. Table S1. Secondary metabolites in Glycyrrhiza glabra. Part Class Plant Secondary Metabolites References Root Glycyrrhizic acid 1-6 Glabric acid 7 Liquoric acid 8 Betulinic acid 9 18α-Glycyrrhetinic acid 2,3,5,10-12 Triterpenes 18β-Glycyrrhetinic acid Ammonium glycyrrhinate 10 Isoglabrolide 13 21α-Hydroxyisoglabrolide 13 Glabrolide 13 11-Deoxyglabrolide 13 Deoxyglabrolide 13 Glycyrrhetol 13 24-Hydroxyliquiritic acid 13 Liquiridiolic acid 13 28-Hydroxygiycyrrhetinic acid 13 18α-Hydroxyglycyrrhetinic acid 13 Olean-11,13(18)-dien-3β-ol-30-oic acid and 3β-acetoxy-30-methyl ester 13 Liquiritic acid 13 Olean-12-en-3β-ol-30-oic acid 13 24-Hydroxyglycyrrhetinic acid 13 11-Deoxyglycyrrhetinic acid 5,13 24-Hydroxy-11-deoxyglycyirhetinic
    [Show full text]
  • Phytoestrogens in Foods in the Nordic Market
    TemaNord 2017:541 Phytoestrogens in foods on the Nordic market the Nordic on foods in 2017:541 Phytoestrogens TemaNord Nordic Council of Ministers Nordens Hus Ved Stranden 18 DK-1061 Copenhagen K www.norden.org Phytoestrogens in foods on the Nordic market Phytoestrogens are plant-derived compounds that may bind to estrogen receptors, but with less affinity than the natural ligand estradiol. They may be biologically active as such or after metabolization in our body. To investigate the occurrence and level of phytoestrogens, scientific literature was screened for data on isoflavones, lignans, stilbenes and coumestans in raw and processed foods of plant origin. The review presents data based both on analytical methods hydrolysing glucosides and non-destructive methods. Many phytoestrogens are phytoalexins. Their production is induced when plants are exposed to abiotic and/or biotic stress. This could explain the rather different levels reported in plants by various investigators, and indicates that many samples are required to describe the levels generally occurring in foodstuffs. The influence of food processing was also considered. Phytoestrogens in foods on the Nordic market A literature review on occurrence and levels Phytoestrogens in foods on the Nordic market A literature review on occurrence and levels Linus Carlsson Forslund and Hans Christer Andersson TemaNord 2017:541 Phytoestrogens in foods on the Nordic market A literature review on occurrence and levels Linus Carlsson Forslund and Hans Christer Andersson ISBN 978-92-893-5046-4 (PRINT) ISBN 978-92-893-5047-1 (PDF) ISBN 978-92-893-5048-8 (EPUB) http://dx.doi.org/10.6027/TN2017-541 TemaNord 2017:541 ISSN 0908-6692 Standard: PDF/UA-1 ISO 14289-1 © Nordic Council of Ministers 2017 Cover photo: Unsplash.com Print: Rosendahls Printed in Denmark Although the Nordic Council of Ministers funded this publication, the contents do not necessarily reflect its views, policies or recommendations.
    [Show full text]
  • Supporting Document 1
    Supporting document 1 Safety assessment – Application A1085 Food derived from Reduced Lignin Lucerne Line KK179 Summary and conclusions Background A genetically modified (GM) lucerne line, KK179, has been developed that has reduced biosynthesis of guaiacyl lignin (G lignin), a major subunit of lignin. Lignin is a non- carbohydrate phenolic polymer deposited in plant cell walls, particularly in the vascular tissue, and is a contributor to the quality of forage eaten by grazing animals. The Applicants claim that growers will have the option of being able to harvest KK179 several days later than conventional lucerne without appreciable loss of forage quality typical in conventional lucerne at the same growth stage. The reduced level of lignin in lucerne KK179 has been achieved through the introduction of a partial caffeoyl CoA 3-O-methyltransferase (CCOMT) gene sequence derived from lucerne (Medicago sativa). The gene transcript acts, via suppression of the endogenous CCOMT gene, to reduce the lignin level. It is not intended that KK179 enter the food supply. However, a food approval is sought in case this inadvertently occurs. In conducting a safety assessment of food derived from lucerne line KK179, a number of criteria have been addressed including: a characterisation of the transferred genetic material and its origin, function and stability in the lucerne genome; compositional analyses; and evaluation of intended and unintended changes. This safety assessment report addresses only food safety and nutritional issues associated with the GM line. It therefore does not address: environmental risks related to the environmental release of GM plants used in food production the safety of animal feed or animals fed with feed derived from GM plants the safety per se of food derived from the non-GM (conventional) plant.
    [Show full text]
  • Plant Coumestans: Recent Advances and Future Perspectives in Cancer Therapy
    Send Orders for Reprints to [email protected] Anti-Cancer Agents in Medicinal Chemistry, 2014, 14, 000-000 1 Plant Coumestans: Recent Advances and Future Perspectives in Cancer Therapy Tereza Nehybová1, Jan Šmarda1 and Petr Beneš1,2,* 1Department of Experimental Biology, Faculty of Science, Masaryk University, Brno, Czech Republic and Masaryk Memorial Cancer Institute, RECAMO, Žlutý kopec 7, 656 53 Brno, Czech Republic; 2International Clinical Research Center, Center for Biological and Cellular Engineering, St. Anne's University Hospital, Brno, Czech Republic Abstract: Natural products are often used in drug development due to their ability to form unique and diverse chemical structures. Coumestans are polycyclic aromatic plant secondary metabolites containing a coumestan moiety, which consists of a benzoxole fused to a chromen-2-one to form 1-Benzoxolo[3,2-c]chromen-6-one. These natural compounds are known for large number of biological activities. Many of their biological effects can be attributed to their action as phytoestrogens and polyphenols. In the last decade, anticancer effects of these compounds have been described in vitro but there is only limited number of studies based on models in vivo. More information concerning their in vivo bioavailability, stability, metabolism, toxicity, estrogenicity, cellular targets and drug interactions is therefore needed to proceed further to clinical studies. This review focuses on coumestans exhibiting anticancer properties and summarizes mechanisms of their toxicity to cancer cells. Moreover, the possible role of coumestans in cancer prevention is discussed. Keywords: Cancer, cellular target, coumestrol, coumestan, glycyrol, psoralidin, therapy, wedelolactone. INTRODUCTION also acts as antioxidant [18, 36] and prevents bone resorption by Natural products are often used in drug development due to inhibiting differentiation and function of osteoclasts and by their ability to form unique and diverse chemical structures.
    [Show full text]
  • Food Toxicology Food Toxicology Edited by William Helferich and Carl K
    Food Toxicology Food Toxicology Edited by William Helferich and Carl K. Winter CRC Press Boca Raton London New York Washington, D.C. 2760/frame/FM Page 4 Monday, July 3, 2000 4:23 PM Library of Congress Cataloging-in-Publication Data Food toxicology / edited by William Helferich and Carl K. Winter. p. cm. Includes bibliographical references and index. ISBN 0-8493-2760-1 (alk. paper) 1. Food—Toxicology. I. Helferich, William. II. Winter, Carl K. RA1258 .F665 2000 615.9′54—dc21 00-037851 CIP This book contains information obtained from authentic and highly regarded sources. Reprinted material is quoted with permission, and sources are indicated. A wide variety of references are listed. Reasonable efforts have been made to publish reliable data and information, but the author and the publisher cannot assume responsibility for the validity of all materials or for the consequences of their use. Neither this book nor any part may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, microfilming, and recording, or by any information storage or retrieval system, without prior permission in writing from the publisher. All rights reserved. Authorization to photocopy items for internal or personal use, or the personal or internal use of specific clients, may be granted by CRC Press LLC, provided that $.50 per page photocopied is paid directly to Copyright Clearance Center, 222 Rosewood Drive, Danvers, MA 01923 USA. The fee code for users of the Transactional Reporting Service is ISBN 0-8492-2760-1/00/$0.00+$.50. The fee is subject to change without notice.
    [Show full text]