Novel Infection System of Recombinant Bmbdv DNA Into Bmn Cells of Silkworm, Bombyx Mori
Total Page：16
File Type：pdf, Size：1020Kb
Curr Microbiol DOI 10.1007/s00284-016-1102-0 Novel Infection System of Recombinant BmBDV DNA into BmN Cells of Silkworm, Bombyx mori 1,2 2,3 2 2, Rui Guo • Guangli Cao • Yuexiong Zhu • Dhiraj Kumar • 2,3 2 2,3 2,3 Renyu Xue • Yahong Lu • Xiaolong Hu • Chengliang Gong Received: 14 December 2015 / Accepted: 5 June 2016 Ó Springer Science+Business Media New York 2016 Abstract Bombyx mori bidensovirus (BmBDV) was pre- Baculiform and spherical virions were also observed in viously termed as Bombyx mori densovirus type 2 and later it infected cells by TEM, and two kinds of virions were sepa- was reclassified in the new genus bidensovirus of the new rated. However, results of molecular biological detection family Bidnaviridae. The genome of BmBDV Zhenjiang revealed that infectious sequence from BmBac-VD1 was isolate (BmBDV-Z) consists of two non-homologous single- packaged within spherical virion. Therefore, we suggested stranded linear DNA molecules VD1 and VD2 which are that vector inserted with BmBDV genomic DNA showed encapsidated into separate virion. To investigate the infec- infectivity, and BmBDV-like viral particles packaging tivity of BmBDV DNA, recombinant plasmids pGEM-VD1 recombinant DNA can be produced in the cultured BmN inserted with VD1 genome were transfected into the BmN cells. Outcome of our current research provided not only a cells of silkworm. Structural proteins of BmBDV were new method of infection to explore the gene function of detected with Western blot and immunofluorescence assay, BmBDV in vitro but also a protocol to facilitate development which indicates pGEM-VD1 replicated in the transfected of more effective new-type pesticides. BmN cells and viral proteins were also expressed. Through TEM observation, we identified about 20 nm BmBDV-like viral particles, which confirmed that BmBDV can be gen- erated after transfection. Subsequently, a recombinant bac- Introduction ulovirus BmBac-VD1 inserted with VD1 genome was constructed. Results of Western blot and immunofluores- Single-stranded DNA (ss-DNA) viruses are enormously cence assay indicated that viral structural proteins of extensive and transmit severe diseases into different hosts BmBDV were expressed in the BmBac-VD1-infected cells. including many important pathogens. Densovirinae (DNV) containing ss-DNA generally infects invertebrates, belongs to virus family parvoviridae as similar to other parvovirus. Rui Guo and Guangli Cao have contributed equally to this work. Densoviruses (DNVs) are small icosahedral, non-en- veloped particles of 18–26 nm in diameter, and their gen- Electronic supplementary material The online version of this omes consist of 4–6.5 kb single-stranded linear DNA article (doi:10.1007/s00284-016-1102-0) contains supplementary material, which is available to authorized users. encapsidated with equal molecular in separate virions which differ genetically [4]. DNV is also categorized as the & Chengliang Gong smallest animal DNA virus; various animals such as Neu- [email protected] rotera, Lepidoptera, Diptera, Orthoptera, Odonata, 1 College of Bee Science, Fujian Agriculture and Forestry shrimps, and crabs are infected by DNV [5, 20]. Most of University, Fuzhou 350002, China DNVs have a narrow host range like Galleria mellonella 2 School of Biology and Basic Medical Science, Soochow densovirus only infects Galleria mellonella [20], whereas University, Suzhou 215123, China some DNVs such as Aedes aegypti DNV showed broad 3 National Engineering Laboratory for Modern Silk, Soochow host range, and not only infects invertebrates namely Aedes University, Suzhou, People’s Republic of China aegypti, Culex pipiens and Culiseta incidens, but also 123 R. Guo et al.: Novel Infection System of Recombinant BmBDV DNA into BmN Cells of Silkworm… infects vertebrates and cause pathological changes as well. Chinese Academy of Agricultural Sciences, China. BmN Heliothis zea DNV also infects Spodoptera littoralis, cells derived from silkworm ovary were cultured in TC-100 Ostrinia nubilalis, Sesamia cretica, Pectinophora gossyp- medium supplemented with 10 % (v/v) fetal bovine serum iella and Chilo agamemnon [8]. (Gibco-BRL) at 26 °C[25]. BmN cells (1 9 107)were Bombyx mori parvo-like virus was named as Bombyx transfected with 2` ıg recombinant plasmids pGEM-VD1, mori bidensovirus (BmBDV) according to the latest forms inserted with BmBDV VD1 genome using 8` ıl of FuGENE of virus taxonomy [1]. It is a causing agent of densonu- HD (Roche Diagnostics, Mannheim, Germany) following cleosis disease of the silkworm, B. mori. Several BmBDV the manufacturer’s protocol, and detected under the inverted were isolated from the silkworms such as BmBDV-1 fluorescence microscope (TE2000U, Nikon, Japan). (isolated by FIRST and FAMILY NAME Ina), BmBDV-2 (isolated by FIRST and FAMILY NAME Saku and Construction of Recombinant Virus BmBacmid- Yamanashi), BmBDV-3 (isolated by FIRST and FAMILY VD1 NAME Zhenjiang, known as BmBDV-Z) and BmBDV-4 (isolated by FIRST and FAMILY NAME Kenchu) [13]. VD1 genome excised from the pGEM-VD1 with restriction Similar to BmBDV-2, genome of BmBDV-Z is composed endonucleases SphI and EcoRI was subcloned into pFast- of two different kinds of single-stranded DNA molecules BacTM Dual (Invitrogen, USA) to generate pFastBacTM VD1 (6543 nts) and VD2 (6022 nts) are encapsidated into Dual-VD1. E. coli DH10 containing B. mori nucleopoly- separate virions [27]. As a result, both BmBDV-Z and hedrovirus bacmid was transformed with pFastBacTM BmBDV-2 are a blend of two kinds of virus particles Dual-VD1 to generate a recombinant Bmbacmid-VD1 containing different DNA [13, 15, 16]. VD1 has four using the Bac-to-Bac baculovirus expression system (In- deduced ORFs, which encoded all structural proteins of vitrogen, USA). The construction steps of BmBac-VD1 virus particle, whereas, VD2 only has two deduced ORFs, were displayed in Fig. S1. The recombinant bacmid was which does not consist enough genetic information to screened on a LB agar medium containing kanamycin encode all structural proteins. It is speculated that VD1 and (50 lg/ml), gentamycin (7 lg/ml), tetracycline (10 lg/ml), VD2 have mutual supplementary role in the process of X-Gal (100 lg/ml), and IPTG (40 lg/ml). Subsequently, virus replication in the host cells [10]. Plasmid with the confirmed Bmbacmid-VD1 DNA was transfected into parvovirus genomic DNA replicates in the targeted cells, BmN cells using FuGENE HD transfection reagent to and infectious viral particles can be rescued from the generate the recombinant baculovirus BmBac-VD1. Virus recombinant plasmid [6, 14, 21]. A research team cloned from the properly infected and cultured cells was harvested the genomes of BmBDV-Z VD1 and VD2, subsequently to maintain P1 viral stock, and continuously proliferated infectious BmBDV viral particles were rescued from the through further infection in BmN cells until P3 viral stock recombinant plasmids pGEM-VD1 and pMD-VD2 in the was obtained, and stored at 4 °C in dark. silkworm, B. mori [10]. Presently, due to the lack of reverse genetics system for BmBDV and sensitive cell line Identification of Recombinant Baculovirus BmBac- to BmBDV in vitro, research on replication and gene VD1 function of BmBDV developed leisurely. In the present study, we constructed rescue system of infectious virions A pair of unique primers BmVD1-ns1 (GCGAATTCATG- from recombinant vectors inserted with BmBDV genomic GAATCGAAGTCAAATTTCCG) and BmVD1-ns2 (CCTC DNA in the BmN cells, and found that BmBDV-like viral TCGAGGAGCCAAGTACTCTACCC) was designed based particles packaging recombinant DNA can be produced in on VD1 sequence (GenBank accession number: EU623082). both transfected BmN cells with pGEM-VD1 and infected Genomic DNA was extracted from P3 viral stock and iden- BmN cells with baculovirus carrying VD1. Findings of our tified by PCR using primers BmVD1-ns1 and BmVD1-ns2. research provided a new method for studying the replica- tion and gene function of BmBDV in vitro. Western Blot Analysis Materials and Methods The BmN cells were collected at 96 h post transfection (hpt) with pGEM-VD1, and at 72 h post infection (hpi) Transfection of Recombinant Plasmids into BmN with P2 BmBac-VD1 viral stock to conduct SDS-PAGE Cells and Western blot using mouse anti-BmBDV VD1-ORF4 antibody (1:700, kindly provided by Prof. Keping Chen of The recombinant plasmid pGEM-VD1 was provided by Jiangsu University, China) and HRP-conjugated goat anti- Prof. Xijie Guo of the Sericultural Research Institute, mouse IgG (1:3000, Bioworld, America). 123 R. Guo et al.: Novel Infection System of Recombinant BmBDV DNA into BmN Cells of Silkworm… Immunofluorescence Assay transfected BmN cells at 72 hpt were observed under a light microscope. To confirm the elimination of residual After 72 h of infection/transfection, BmN cells were col- baculovirus contamination, the Fraction B was subjected to lected for immunofluorescence assay. The cells were fixed SDS-PAGE followed by Western blot using rabbit anti- in 4 % paraformaldehyde and labeled first with rabbit anti- BmNPV-ODV-e25 polyclonal antibody as preliminary BmBDV polyclonal antibody (1:500) and combined with antibody (provided by Prof. Xiaofeng Wu of Zhejiang FITC-conjugated goat anti-rabbit IgG (1:200, Bioworld, University, China) and HRP-conjugated goat anti-rabbit America). All samples were observed under fluorescence IgG as a second antibody. microscope (TE2000U, Nikon, Japan) after removing the non-combined FITC-conjugated goat anti-rabbit IgG and staining with DAPI. Results Transmission Electron Microscope (TEM) Infection of Recombinant Plasmids with BmBDV Genomic DNA to BmN Cells Cell culture supernatant containing pGEM-VD1 was col- lected at 144 hpt, centrifuged and stained with 2 % phos- To ensure the infection of recombinant plasmids inserted photungstic acid, and observed under TEM (HITACHI- with BmBDV genomic DNA, recombinant plasmid pGEM- H7650, Japan). VD1 was transfected into BmN cells, nuclei of the trans- At 120 hpi with P2 BmBac-VD1 viral stock, the col- fected cells were enlarged at 72 hpt, the cells changed into lected BmN cells were fixed in 2.5 % glutaraldehyde, circular shape, and suspended at 120 hpt (Fig.