Novel Infection System of Recombinant Bmbdv DNA Into Bmn Cells of Silkworm, Bombyx Mori

Curr Microbiol DOI 10.1007/s00284-016-1102-0

Novel Infection System of Recombinant BmBDV DNA into BmN Cells of Silkworm, Bombyx mori

1,2 2,3 2 2, Rui Guo • Guangli Cao • Yuexiong Zhu • Dhiraj Kumar • 2,3 2 2,3 2,3 Renyu Xue • Yahong Lu • Xiaolong Hu • Chengliang Gong

Received: 14 December 2015 / Accepted: 5 June 2016 Ó Springer Science+Business Media New York 2016

Abstract Bombyx mori bidensovirus (BmBDV) was pre- Baculiform and spherical virions were also observed in viously termed as Bombyx mori densovirus type 2 and later it infected cells by TEM, and two kinds of virions were sepa- was reclassified in the new genus bidensovirus of the new rated. However, results of molecular biological detection family Bidnaviridae. The genome of BmBDV Zhenjiang revealed that infectious sequence from BmBac-VD1 was isolate (BmBDV-Z) consists of two non-homologous single- packaged within spherical virion. Therefore, we suggested stranded linear DNA molecules VD1 and VD2 which are that vector inserted with BmBDV genomic DNA showed encapsidated into separate virion. To investigate the infec- infectivity, and BmBDV-like viral particles packaging tivity of BmBDV DNA, recombinant plasmids pGEM-VD1 recombinant DNA can be produced in the cultured BmN inserted with VD1 genome were transfected into the BmN cells. Outcome of our current research provided not only a cells of silkworm. Structural proteins of BmBDV were new method of infection to explore the gene function of detected with Western blot and immunofluorescence assay, BmBDV in vitro but also a protocol to facilitate development which indicates pGEM-VD1 replicated in the transfected of more effective new-type pesticides. BmN cells and viral proteins were also expressed. Through TEM observation, we identified about 20 nm BmBDV-like viral particles, which confirmed that BmBDV can be generated after transfection. Subsequently, a recombinant bac- Introduction ulovirus BmBac-VD1 inserted with VD1 genome was constructed. Results of Western blot and immunofluores- Single-stranded DNA (ss-DNA) viruses are enormously cence assay indicated that viral structural proteins of extensive and transmit severe diseases into different hosts BmBDV were expressed in the BmBac-VD1-infected cells. including many important pathogens. Densovirinae (DNV) containing ss-DNA generally infects invertebrates, belongs to virus family parvoviridae as similar to other parvovirus. Rui Guo and Guangli Cao have contributed equally to this work. Densoviruses (DNVs) are small icosahedral, non-en- veloped particles of 18–26 nm in diameter, and their gen- Electronic supplementary material The online version of this omes consist of 4–6.5 kb single-stranded linear DNA article (doi:10.1007/s00284-016-1102-0) contains supplementary material, which is available to authorized users. encapsidated with equal molecular in separate virions which differ genetically [4]. DNV is also categorized as the & Chengliang Gong smallest animal DNA virus; various animals such as Neu- [email protected] rotera, Lepidoptera, Diptera, Orthoptera, Odonata, 1 College of Bee Science, Fujian Agriculture and Forestry shrimps, and crabs are infected by DNV [5, 20]. Most of University, Fuzhou 350002, China DNVs have a narrow host range like Galleria mellonella 2 School of Biology and Basic Medical Science, Soochow densovirus only infects Galleria mellonella [20], whereas University, Suzhou 215123, China some DNVs such as Aedes aegypti DNV showed broad 3 National Engineering Laboratory for Modern Silk, Soochow host range, and not only infects invertebrates namely Aedes University, Suzhou, People’s Republic of China aegypti, Culex pipiens and Culiseta incidens, but also 123 R. Guo et al.: Novel Infection System of Recombinant BmBDV DNA into BmN Cells of Silkworm… infects vertebrates and cause pathological changes as well. Chinese Academy of Agricultural Sciences, China. BmN Heliothis zea DNV also infects Spodoptera littoralis, cells derived from silkworm ovary were cultured in TC-100 Ostrinia nubilalis, Sesamia cretica, Pectinophora gossyp- medium supplemented with 10 % (v/v) fetal bovine serum iella and Chilo agamemnon [8]. (Gibco-BRL) at 26 °C[25]. BmN cells (1 9 107)were Bombyx mori parvo-like virus was named as Bombyx transfected with 2` ıg recombinant plasmids pGEM-VD1, mori bidensovirus (BmBDV) according to the latest forms inserted with BmBDV VD1 genome using 8` ıl of FuGENE of virus taxonomy [1]. It is a causing agent of densonu- HD (Roche Diagnostics, Mannheim, Germany) following cleosis disease of the silkworm, B. mori. Several BmBDV the manufacturer’s protocol, and detected under the inverted were isolated from the silkworms such as BmBDV-1 fluorescence microscope (TE2000U, Nikon, Japan). (isolated by FIRST and FAMILY NAME Ina), BmBDV-2 (isolated by FIRST and FAMILY NAME Saku and Construction of Recombinant Virus BmBacmid- Yamanashi), BmBDV-3 (isolated by FIRST and FAMILY VD1 NAME Zhenjiang, known as BmBDV-Z) and BmBDV-4 (isolated by FIRST and FAMILY NAME Kenchu) [13]. VD1 genome excised from the pGEM-VD1 with restriction Similar to BmBDV-2, genome of BmBDV-Z is composed endonucleases SphI and EcoRI was subcloned into pFast- of two different kinds of single-stranded DNA molecules BacTM Dual (Invitrogen, USA) to generate pFastBacTM VD1 (6543 nts) and VD2 (6022 nts) are encapsidated into Dual-VD1. E. coli DH10 containing B. mori nucleopoly- separate virions [27]. As a result, both BmBDV-Z and hedrovirus bacmid was transformed with pFastBacTM BmBDV-2 are a blend of two kinds of virus particles Dual-VD1 to generate a recombinant Bmbacmid-VD1 containing different DNA [13, 15, 16]. VD1 has four using the Bac-to-Bac baculovirus expression system (In- deduced ORFs, which encoded all structural proteins of vitrogen, USA). The construction steps of BmBac-VD1 virus particle, whereas, VD2 only has two deduced ORFs, were displayed in Fig. S1. The recombinant bacmid was which does not consist enough genetic information to screened on a LB agar medium containing kanamycin encode all structural proteins. It is speculated that VD1 and (50 lg/ml), gentamycin (7 lg/ml), tetracycline (10 lg/ml), VD2 have mutual supplementary role in the process of X-Gal (100 lg/ml), and IPTG (40 lg/ml). Subsequently, virus replication in the host cells [10]. Plasmid with the confirmed Bmbacmid-VD1 DNA was transfected into parvovirus genomic DNA replicates in the targeted cells, BmN cells using FuGENE HD transfection reagent to and infectious viral particles can be rescued from the generate the recombinant baculovirus BmBac-VD1. Virus recombinant plasmid [6, 14, 21]. A research team cloned from the properly infected and cultured cells was harvested the genomes of BmBDV-Z VD1 and VD2, subsequently to maintain P1 viral stock, and continuously proliferated infectious BmBDV viral particles were rescued from the through further infection in BmN cells until P3 viral stock recombinant plasmids pGEM-VD1 and pMD-VD2 in the was obtained, and stored at 4 °C in dark. silkworm, B. mori [10]. Presently, due to the lack of reverse genetics system for BmBDV and sensitive cell line Identification of Recombinant Baculovirus BmBac- to BmBDV in vitro, research on replication and gene VD1 function of BmBDV developed leisurely. In the present study, we constructed rescue system of infectious virions A pair of unique primers BmVD1-ns1 (GCGAATTCATG- from recombinant vectors inserted with BmBDV genomic GAATCGAAGTCAAATTTCCG) and BmVD1-ns2 (CCTC DNA in the BmN cells, and found that BmBDV-like viral TCGAGGAGCCAAGTACTCTACCC) was designed based particles packaging recombinant DNA can be produced in on VD1 sequence (GenBank accession number: EU623082). both transfected BmN cells with pGEM-VD1 and infected Genomic DNA was extracted from P3 viral stock and iden- BmN cells with baculovirus carrying VD1. Findings of our tified by PCR using primers BmVD1-ns1 and BmVD1-ns2. research provided a new method for studying the replication and gene function of BmBDV in vitro. Western Blot Analysis

Materials and Methods The BmN cells were collected at 96 h post transfection (hpt) with pGEM-VD1, and at 72 h post infection (hpi) Transfection of Recombinant Plasmids into BmN with P2 BmBac-VD1 viral stock to conduct SDS-PAGE Cells and Western blot using mouse anti-BmBDV VD1-ORF4 antibody (1:700, kindly provided by Prof. Keping Chen of The recombinant plasmid pGEM-VD1 was provided by Jiangsu University, China) and HRP-conjugated goat anti- Prof. Xijie Guo of the Sericultural Research Institute, mouse IgG (1:3000, Bioworld, America). 123 R. Guo et al.: Novel Infection System of Recombinant BmBDV DNA into BmN Cells of Silkworm…

Immunofluorescence Assay transfected BmN cells at 72 hpt were observed under a light microscope. To confirm the elimination of residual After 72 h of infection/transfection, BmN cells were col- baculovirus contamination, the Fraction B was subjected to lected for immunofluorescence assay. The cells were fixed SDS-PAGE followed by Western blot using rabbit anti- in 4 % paraformaldehyde and labeled first with rabbit anti- BmNPV-ODV-e25 polyclonal antibody as preliminary BmBDV polyclonal antibody (1:500) and combined with antibody (provided by Prof. Xiaofeng Wu of Zhejiang FITC-conjugated goat anti-rabbit IgG (1:200, Bioworld, University, China) and HRP-conjugated goat anti-rabbit America). All samples were observed under fluorescence IgG as a second antibody. microscope (TE2000U, Nikon, Japan) after removing the non-combined FITC-conjugated goat anti-rabbit IgG and staining with DAPI. Results

Transmission Electron Microscope (TEM) Infection of Recombinant Plasmids with BmBDV Genomic DNA to BmN Cells Cell culture supernatant containing pGEM-VD1 was collected at 144 hpt, centrifuged and stained with 2 % phos- To ensure the infection of recombinant plasmids inserted photungstic acid, and observed under TEM (HITACHI- with BmBDV genomic DNA, recombinant plasmid pGEM- H7650, Japan). VD1 was transfected into BmN cells, nuclei of the trans- At 120 hpi with P2 BmBac-VD1 viral stock, the col- fected cells were enlarged at 72 hpt, the cells changed into lected BmN cells were fixed in 2.5 % glutaraldehyde, circular shape, and suspended at 120 hpt (Fig. 1). It is rinsed for 6 h in 0.1 M sodium cacodylate, and then suggested that recombinant plasmids with BmBDV VD1 postfixed for 2 h in 1 % osmium acid. The specimens were genomic DNA has infectivity in the BmN cells. washed twice with 0.1 M sodium cacodylate, followed by Additionally, to identify the expression of specific pro- dehydration through a graded series of ethanol and teins of BmBDV, Western blot was carried out and three embedded in epoxy resin (Epon 812). Fine sections of signal bands of 53, 40, and 35 kDa were observed 50–60 nm thickness were prepared using a microtome (Fig. 2a). Moreover, green fluorescence was detected in the (Leica UC7, Germany), mounted on uncoated copper grids, transfected cells with recombinant plasmid pGEM-VD1 and stained with 2 % uranyl acetate and Reynolds’s lead using immunofluorescence assay with anti-BmBDV anti- citrate. Grids were observed under TEM. Cell culture body (Fig. 2b), indicating that viral proteins of BmBDV supernatant at 72 hpi with P2 BmBac-VD1 viral stock was were expressed in the transfected cells with plasmid centrifuged and stained with 2 % phosphotungstic acid and pGEM-VD1. images were detected by TEM. At 144 hpt with pGEM-VD1, most of the cells displayed pathological changes, the collected cell culture supernatant Separation of Baculovirus and BmBDV Spherical was centrifuged to remove cell debris. After staining with Virus-Like Particles phosphotungstic acid, supernatant was observed under TEM. BmBDV-like viral particles with a size of about Cell culture supernatant at 120 hpt with BmBac-VD1 was 20 nm were detected (Fig. 2c), which confirmed that centrifuged twice at 4000 and 10,0009g,at4°C for BmBDV was produced in the transfected BmN cells with 10 min and 1 h, respectively. The precipitates were dis- plasmid pGEM-VD1. solved in sterile water (Fraction A), and the remaining supernatant were transferred into new EP tubes and again Generation of BmBDV-Like Virion in Infected Cells centrifuged at 20,000 g, 4 °C for 5 h. The obtained pre- with Recombinant Baculovirus BmBac-VD1 cipitates were dissolved in sterile water (Fraction B), and Inserted with BmBDV VD1 Genome both Fractions A and B were observed under electron microscopy following negative staining. The recombinant plasmid pFastBacTM Dual-VD1 carrying BmBDV VD1 genome was transformed into E. coli DH10 Extraction of DNA Packaged within Spherical competent cells to generate a recombinant Bmbacmid-VD1 Particle-Like Virus and Transfection into BmN (Fig. S1). Recombinant baculovirus was generated by Cells transfection of Bmbacmid-VD1 DNA into BmN cells. After transfection of Bmbacmid-VD1 DNA into BmN The total DNA was extracted from the Fraction B after cells, the cells changed into spherical shape at 72 hpt being treated with DNaseI to remove possible contamina- (Fig. 3a-1), and most of the cells suspended at 120 hpt tion of DNA, and transfected into the BmN cells. The (Fig. 3a-2), which suggested that recombinant baculovirus 123 R. Guo et al.: Novel Infection System of Recombinant BmBDV DNA into BmN Cells of Silkworm…

Fig. 1 Pathological changes of BmN cells after being transfected with recombinant plasmid inserted with BmBDV VD1 genomic DNA. a Normal BmN cells. b BmN cells at 120 hpt with pGEM-VD1

Fig. 2 Identification of BmBDV viral proteins in the infected/trans- transfected BmN cells with immunofluorescence assay. 1, 2, and 3 fected BmN cells. a Detection of BmBDV viral proteins in the cells transfected with pGEM-VD1. 1 cells labeled with polyclonal infected/transfected BmN cells by Western blot. M protein marker. antiserum against BmBDV followed by FITC-conjugated secondary Lanes 1 cells infected with P2 BmBac-VD1 viral stock, 2 cells antibodies, 2 nucleus of transfected cell was stained with DAPI, 3 transfected with pGEM-VD1, 3 normal BmN cell. Antibodies were overlapping with 1 and 2. c TEM observation of BmBDV-like viral mouse anti-BmBDV VD1-ORF4 and HRP-conjugated goat anti- particles in the transfected cells culture supernatant with pGEM-VD1. mouse IgG. b Identification of BmBDV viral proteins in the The arrows indicate BmBDV-like viral particles replicated in the BmN cells. Similar result was observed and expected recombinant baculovirus BmBac-VD1 was when the BmN cells were infected with P2 recombinant obtained. baculovirus (Fig. 3a-3, 4). To confirm the recombinant Western blot of the infected BmN cells with P2 BmBac- baculovirus, DNA extracted from the P3 viral stock was VD1 viral stock showed three signal bands of 53, 40, and identified by PCR (Fig. 3b), a specific PCR product rep- 35 kDa (Fig. 2a). Moreover, green fluorescence was resenting partial sequence of VD1 was amplified from the detected in the infected cells with BmBac-VD1 using P3 BmBac-VD1 DNA. It confirmed that BmBDV VD1 has immunofluorescence assay with anti-BmBDV antibody been successfully inserted into the genome of baculovirus, (Fig. 3c), further indicating BmBDV VD1 was integrated

123 R. Guo et al.: Novel Infection System of Recombinant BmBDV DNA into BmN Cells of Silkworm…

Fig. 3 Identification of recombinant BmBac-VD1 through PCR ns2. M DNA marker. Lanes 1 the template was recombinant plasmid amplification and immunofluorescence assay. a Pathological changes pGEM-VD1, 2 the template was DNA extracted from the P3 of BmN cells after transfection of recombinant BmBacmid-VD1 recombinant BmBac-VD1, 3 the template was sterile water. c Iden- DNA and infection of P2 BmBac-VD1. 1 cells at 72 hpt with tification of BmBDV viral proteins in the infected BmN cells by recombinant Bmbacmid-VD1 DNA, 2 cells at 120 hpt with recom- immunofluorescence. 1 BmN cells at 72 hpi with P2 BmBac-VD1 binant Bmbacmid-VD1 DNA, 3 cells at 72 hpi with P2 BmBac-VD1, were labeled with polyclonal antiserum against BmBDV followed by 4 cells at 120 hpi with P2 BmBac-VD1. b PCR identification of P3 FITC-conjugated secondary antibodies, 2 nucleus of infected cells recombinant BmBac-VD1 with primers BmVD1-ns1 and BmVD1- were stained with DAPI. 3 Overlapping with 1 and 2 into the genome of baculovirus and BmBDV’s proteins was baculovirus BmBac-VD1 was packed in BmBDV-like expressed in the infected cells. viral particles.

Infectious Sequence from BmBac-VD1 DNA Could be Packaged in BmBDV-Like Viral Particles Discussion

At 72 hpi with P2 BmBac-VD1 viral stock, cell culture Insect viruses, particularly baculoviruses, have been supernatants were centrifuged to remove cell debris and established as the most signiﬁcant and versatile eukaryotic stained with phosphotungstic acid. Baculovirus and expression vectors [11]. However, densovirus has smaller spherical BmBDV-like viral particles were observed in the genomes in comparison with baculovirus, which facilitates cell culture supernatants (Fig. 4a, b) under TEM. Addi- the cloning and transfection [7]. To date, several cloned tionally, two kinds of virions were also observed in the densovirus genomes had been rescued from recombinant infected cells with BmBac-VD1 (Fig. 4c). plasmids and replicated as wild-type virus after transfec- To separate BmBDV-like viral particles and recom- tion into eukaryotic cells [16, 29]. Plasmids inserted with binant baculovirus, the infected cells culture supernatant infectious sequence from Junonia coenia densovirus wascentrifugedtwicetogetFractionAandB.Incaseof (JcDNV) or Aedes aegypti densovirus (AeDNV) genomes Fraction B, only BmBDV-like viral particles were showed the ability of densoviruses as expression vectors observed by TEM (Fig. 4b). Additionally, Fraction A [2, 12]. VD1 and VD2 having a mutual supplementary role and B were examined by Western blot with anti- in the process of virus replication in host cells was spec- BmNPV-ODV-e25 antibody, a special signal band of ulated; however, infectious BmBDV particles may be 25 kDa representing ODV-e25 could be detected in rescued from recombinant plasmids inserted with BmBDV- Fraction A, but was not observed in Fraction B (Fig. 5a); Z VD1 genomes in silkworm midguts [10]. In the present therefore, the results conﬁrmed that there was no bac- study, we found that infectious BmBDV particles can be ulovirus contamination in Fraction B. DNA extracted rescued by the transfection of recombinant plasmid pGEM- from Fraction B was transfected into BmN cells showed VD1 into the BmN cells, suggesting that recombinant obvious pathological changes at 120 hpt (Fig. 5b), plasmids inserted with VD1 genome only have enough indicating infectious sequence from recombinant genetic information to rescue infectious BmBDV.

123 R. Guo et al.: Novel Infection System of Recombinant BmBDV DNA into BmN Cells of Silkworm…

Fig. 4 TEM observation of baculovirus and BmBDV-like viral particles. a Culture supernatant of infected cells with P2 BmBac-VD1. b BmBDV-like viral particles separated by differential centrifugation. c Cells infected with P2 BmBac-VD1

Fig. 5 Identiﬁcation of BmBDV-like viral particles and recombinant M protein marker. Lanes 1 Fraction A, 2 Fraction B. The ﬁrst baculovirus. a Western blot of BmBDV-like viral particles and antibody was rabbit anti-BmNPV-ODV-e25 antibody, the second was recombinant baculovirus. Cell culture supernatant at 120 hpt with HRP-conjugated goat anti-rabbit IgG. The arrow indicates the BmBac-VD1 was centrifuged twice at 4000 and 10,0009g,4°C for BmNPV-ODV-e25 protein. b Pathological changes of BmN cells 10 min and 1 h, respectively. The precipitates was dissolved in sterile after transfection of extracted DNA from BmBDV-like viral particles. water (Fraction A), and the remaining supernatant were transferred 1 normal BmN cells, 2 transfected cells with extracted DNA from into new EP tubes and again centrifuged at 20,0009g,4°C for 5 h. BmBDV-like viral particles The obtained precipitates were dissolved in sterile water (Fraction B).

Reverse genetics system of BmBDV and sensitive cell gene can be expressed in the transfected BmN cells with line to BmBDV in vitro are not well established; therefore, recombinant BmBDV genomic DNA inserted with target research of replication and gene function of BmBDV was gene. developing leisurely. It was indicated that the inverted The BmBDV VD1-ORF4 is 3318 bp encodes a putative terminal repeats of JcDNV DNA were essential to rescue protein of 1105 amino acids with a predicted size of infectious virus and JcDNV DNA replication, because viral 127 kDa. Previous study showed that three different pro- infection could not be initiated when the inverted terminal teins with molecular weight of about 110, 70, and 53 kDa repeats of JcDNV DNA was deleted [16]. In this study, we were detected in the midguts of BmBDV-infected silk- found that the BmBDV genome rescued from the recom- worm by Western blot using polyclonal antibodies against binant plasmid pGEM-VD1 by transfection of pGEM-VD1 VD1-ORF4 [17]; moreover, a larger protein with molecular into insensitive BmN cells, implying the replication and weight of about 127 kDa was found in BmBDV-infected gene function of BmBDV could be further studied by the midguts using each of six antibodies against different transfection of recombinant plasmid with a mutated geno- epitope of VD1-ORF4, and four smaller proteins (about 70, mic DNA of BmBDV into BmN cells. The genome of 60, 53, and 42 kDa) were also detected using the mono- AeDNV can be utilized as a vector for delivery and clonal antibodies against the epitope contained between expression of exogenous genes within the cultured mos- amino acids 977 and 988 [18]. In our experiments, three quito cells. The b-galactosidase (b-gal) gene was expres- signal bands with molecular weight of about 53, 40, and sed successfully when the recombinant AeDNV genomic 35 kDa were observed, among them speciﬁc bands of 53 DNA containing b-gal gene was transfected into Aedes and 40 kDa were similar with the result of Li’s research albopictus C6/36 cells [3], thus, we deduced that foreign [18]. The bioinformatic results uncovered that these

123 R. Guo et al.: Novel Infection System of Recombinant BmBDV DNA into BmN Cells of Silkworm… smaller proteins were not generated via degradation of a implemented as a novel and advanced strategy for the large protein translated from the VD1-ORF4 mRNA [18]. development new-type pesticides in future. Some viruses are utilizing several strategies such as non- AUG initiation, reinitiation, stop-codon readthrough, leaky Acknowledgments Authors greatly acknowledge the financial support scanning, internal ribosome entry, ribosomal frameshifting, of the National Natural Science Foundation of China (31272500), State Key Laboratory of Silkworm Genome Biology (SKLSGB201200011), and ribosome shunting to translate multiple proteins from a the National Basic Research Program of China (973 Program, transcript [9]. Both the four capsid proteins of JcDNV and 2012CB114600), the Specialized Research Fund for the Doctoral the viral protein of GmDNV were generated using a leaky Program of Higher Education (20113201130002), and a project funded scanning mechanism [26, 28]. Whether these smaller pro- by the Priority Academic Program of Development of Jiangsu Higher Education Institutions. Thanks to Prof. Xijie Guo for providing plasmid teins detected in this study were translated from a VD1- pGEM-VD1, and to Prof. Keping Chen and Prof. Xiaofeng Wu for ORF4 mRNA by ribosomal leaky scanning or other providing antibodies. mechanisms? It is worth studying further in future. BmBDV only infects the columnar cells of the silkworm Compliance with Ethical Standard midgut. To date, there was no report noticed that BmBDV Conflict of Interest The authors have declared that no conflict of can infect the cultured cells. Therefore, the BmN cells interest exists. derived from the silkworm ovary were used for transfection of recombinant vector inserted with BmBDV genomic DNA or infection with recombinant baculovirus BmBac- VD1. A specific protein with molecular weight of about References 35 kDa, which was not detected in BmBDV-infected midguts, found in the transfected BmN cells with pGEM- 1. Adams MJ, Carstens EB (2012) Ratification vote on taxonomic proposals to the international committee on taxonomy of viruses. VD1 and in the infected BmN cells with recombinant Arch Virol 157:1411–1422 baculovirus BmBac-VD1, suggesting the expression strat- 2. Afanasiev BN, Carlson J (2000) Densovirinae as gene transfer egy of VD1-ORF4 in the cultured BmN cells may be dif- vehicles. Contrib Microbiol 4:33–58 ferent from that in silkworm midguts. 3. Afanasiev BN, Kozlov YV, Carlson JO, Beaty BJ (1994) Densovirus of Aedes aegypti as an expression vector in mosquito In the current investigation, baculovirus and spherical cells. Exp Parasitol 79(3):322–339 BmBDV-like viral particles were observed in the infected 4. Bergoin M, Tijssen P (2000) Molecular biology of Densovirinae. cells with BmBac-VD1, implying that baculovirus-based Contrib Microbiol 4:12–32 system could be used for studying gene function and 5. Bonami JR, Mari J, Poulos BT, Lightner DV (1995) Character- ization of hepatopancreatic parvo-likevirus, a second unusual assembly of BmBDV. In addition, an evidence of patho- parvovirus pathovirus pathogenic for penaeid shrimps. J Gen logical changes was documented when BmN cells were Virol 76(Pt4):813–817 transfected with extracted DNA from the BmBDV-like 6. Bossin H, Fournier P, Royer C, Barry P, Ce´rutti P, Gimenez S, viral particles. It indicates the infectious sequence from Couble P, Bergoin M (2003) Junonia coenia densovirus-based vectors for stable transgene expression in Sf9 cells: influence of recombinant baculovirus BmBac-VD1 was packaged in the densovirus sequences on genomic integration. J Virol BmBDV-like viral particles. In general, the viral genomic 77(20):11060–11071 DNA was packaged into virion via interaction between 7. Carter BJ (1990) Parvoviruses as vectors. In: Tijssen P (ed) specific viral proteins and viral genomic DNA. Four viral Handbook of parvoviruses, vol II. CRC Press, Boca Raton, pp 247–284 structural proteins were encoded by BmBDV VD1. Which 8. Fediere G (2004) Epidemiology and pathology of Densovirinae. viral proteins were involved in interaction with BmBDV Contrib Microbiol 4:1–11 VD1? It is still unknown in current state. The package 9. Firth AE, Brierley I (2012) Non-canonical translation in RNA mechanism of BmBDV is worth to study further. A viruses. J Gen Virol 93(Pt 7):1385–1409 10. Fu YH, Tang SM, Tan GX, Liu T, Guo XJ (2008) Cloning of the mechanism of rescue of JcDNV-cloned genome is involved Genome of Bombyx mori densovirus Zhenjiang strain and rescue in cleavage by a cellular endonuclease at the level of ter- of infectious virions from recombinant plasmids in the silkworm. minal repeats has been proposed [16]. A similar mecha- Sci Seric 24(3):453–458 nism possibly involved in the excision process of viral 11. Fuxa JR (2003) Ecology of insect nucleopolyhedroviruses. Agric Ecosyst Environ 103:27–43 insert and account for the infectious properties of the 12. Giraud C, Devauchelle G, Bergoin M (1992) The densovirus of cloned BmBDV-VD1 DNA was effectively applied. Junonia coenia (JcDNV) as an insect cell expression vector. Baculoviruses are widely accepted as significant and Virology 186:207–218 efficient biological pesticide [19, 22–24], and demonstrate 13. Hu Y, Zheng J, Iizuka T, Bando H (1994) A densovirus newly isolated from the smoky-brown cockroach Periplaneta fuliginosa. a flaw of low pesticide speed and narrow pesticide range. In Arch Virol 138:365–372 a nutshell, we concluded and recommended that cloning of 14. Hu L, Zhang L, Shen C, Lu J, Zhang J, Hu Y (2007) The other viral genomes into baculovirus genome could be densovirus of Periplaneta fuliginosa (PfDNV) as an insect vector

123 R. Guo et al.: Novel Infection System of Recombinant BmBDV DNA into BmN Cells of Silkworm…

for persistent foreign gene expression in vivo. Biochem Biophys 22. Moscardi F (1999) Assessment of the application of baculoviruses for Res Commun 358(4):976–982 control of Lepidoptera. Annu Rev Entomol 44:257–289 15. Iwashita Y, Chun CY (1982) The development of a densonu- 23. Moscardi F, Santos B (2005) Producao comercial de nucle- cleosis virus isolated from silkworm larvae, Bombys mori,of opoliedrosis de Anticarsia gemmatalis HUBNER (Lep.: Noctu- China. In: Akai H, King RC, Morohoshi S (eds) The ultrastruc- idae) em laboratorio. In: Proceedings of the IX Simposio de ture and functioning of insect Cell, p161–164 Controle Biologico, Recife, Brazil, p 42 16. Jourdan M, Jousset FX, Gervais M, Skory S, Bergoin M, Dumas 24. Moscardi F, Morales L, Santos B (2002) The successful use of B (1990) Cloning of the genome of a densovirus and rescue of AgMNPV for the control of velvet bean caterpillar, Anticarsia infectious virions from recombinant plasmid in the insect host gemmatalis, in soybean in Brazil. In: Proceedings of the VIII Spodoptera littoralis. Virology 179:403–409 international colloquium on invertebrate pathology and microbial 17. Li GH, Hu ZY, Guo XL, Li GT, Tang Q, Wang P, Chen KP, Yao control and XXXV annual meeting of the Society for Invertebrate Q (2013) Identiﬁcation of BmBDV VD1-ORF4 reveals a novel Pathology. Foz do Iguassu Brazil, pp 86–91 protein associated with viral structural component. Curr Micribiol 25. Summers MD, Smith GE (1987) A manual of methods for bac- 66(6):527–534 ulovirus vectors and insect cell culture procedures. Tex Agric 18. Li G, Zhou Q, Hu Z, Wang P, Tang Q, Chen K, Yao Q (2015) Exp Stat Bull 1555:1–57 Determination of the proteins encoded by BmBDV VD1-ORF4 26. Tijssen P, Li Y, El-Far M, Szelei J, Letarte M, Za´dori Z (2003) and their interacting proteins in BmBDV-infected midguts. Curr Organization and expression strategy of the ambisense genome of Microbiol 70(4):623–629 densonucleosis virus of Galleria mellonella. J Virol 19. Liu TX, Kang L (2005) Research on insectology-progress and 77(19):10357–10365 prospect: research and application of insect baculovirus on pest 27. Wang YJ, Yao Q, Chen KP, Wang Y, Lu J, Han X (2007) control. Science press, Beijin, pp 76–85 Characterization of the genome structure of Bombyx mori 20. Mari J, Bonami JR, Lighter DV (1993) Partial cloning of the densovirus (China isolate). Virus Genes 35:103–108 genome of infectious hypodermal and haemopoietic necrosis 28. Wang Y, Abd-Alla AM, Bossin H, Li Y, Bergoin M (2013) virus, an unusual parvovirus pathogenic for penaeid shrimps, Analysis of the transcription strategy of the Junonia coenia diagnosis of the disease using a speciﬁc probe. J Gen Virol densovirus (JcDNV) genome. Virus Res 174(1–2):101–107 74:2637–2643 29. Zhang XD, Zhang JM, Guo HT, Zhu LH, Hu YY (1999) Rescue 21. Maxwell IH, Terrell KL, Maxwell F, Maxwell F (2002) Auton- of infectious virions from recombinant plasmid with the genome omous parvovirus vectors. Methods 28(2):168–181 of Periplaneta fuliginosa densovirus. Virology 14:152–156

123