DOCSLIB.ORG

Enteric Coronavirus in Ferrets, the Netherlands

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Enteric Coronavirus in Ferrets, the Netherlands LETTERS Enteric protein by using primer pair 5′- TCCC 5′-AARRTTAATGAGTGTGTGMG CGCGGGGCTGGCAACGGACAA DTCA-3′ and 5′- CAACTCTYTTAA Coronavirus in CGTGT-3′ and 5′-CCCAAGCTTTTA GCCARTCAAGG-3′ clearly showed Ferrets, the GTTGACTAATAATTTCA-3′ . that these viruses are more closely Netherlands Phylogenetic analyses of 2 of the related to systemic FRCoVs than sequences obtained indicated a variant to FRECV (Figure). Amino acid To the Editor: Coronaviruses nucleocapsid that was similar to other alignment of 1 of these sequences (CoVs) are enveloped, positive-sense, FRCoVs described previously but (FRCoV-511c) with FRECV-MSU2 single-stranded RNA viruses that can that did not group with 1 of these demonstrated 78% identity and 89% cause acute and chronic respiratory, sequences directly (Figure). Amino similarity, and FRCoV-511c shows enteric, and central nervous system acid alignment of 1 of these sequences 86% identity and 92% similarity to disease in a variety of animal species (FRCoV-511c) with FRECV-MSU2 FRSCV-MSU1. (1). Recently, a novel ferret enteric demonstrated 91.8% identity and After identifi cation of severe CoV (FRECV) was indentifi ed 95.7% similarity, whereas this virus acute respiratory syndrome CoV in in domesticated ferrets (Mustela shows 89.3% identity and 95.2% humans in 2003 and related viruses putorius) in which epizootic catarrhal similarity to ferret systemic CoV in civet cats and bats, an increase in enteritis had been diagnosed; the (FRSCV-MSU1). CoV surveillance in different animal illness was characterized by foul- On the basis of obtained and species resulted in identifi cation and smelling green diarrhea with high published nucleocapsid sequences characterization of a broad range of mucus content, lethargy, anorexia, (2,4), we developed a TaqMan previously unrecognized CoVs (8). and vomiting (2). Another ferret CoV reverse transcription PCR to detect Here we report an enteric FRCoV emerged in ferrets for which systemic viral RNA using the following circulating in the Netherlands in a pyogranulomatous infl ammation, primers and degenerate probe: high percentage of asymptomatic resembling the clinical and pathologic forward,5′-TTGGAAAGAATG ferrets. The ferrets tested did not features of feline infectious peritonitis GTGCTAAAACTG-3′; reverse, 5′-CA have a previous record of foul- (FIP), was diagnosed (3–5). TTAGGCACGTTACCATCAAATT smelling green diarrhea described In 2010, we investigated the -3′; and probe, 5′-TAGGAACRCGT previously to be associated with prevalence of CoV antibodies in 85 GGCACCAACCAA-3′. Using this FRECV, a virus detected in the United asymptomatic ferrets obtained from more specifi c and sensitive assay, we States and further characterized 1 ferret farm in the Netherlands. detected viral RNA in 63% of the rectal in 2006 (2). On the basis of the Previous studies have shown that swabs tested; other CoVs including phylogenetic analysis of the spike antibodies against different members FIPV, severe acute respiratory sequences, FRECV-MSU2 might of the α-CoVs show broad cross- syndrome–CoV, and human CoV NL- have evolved through recombination reactivity (6). We used FIP virus 63, were not amplifi ed by this assay (data with some other unknown CoV. (FIPV)–infected cells to screen not shown). All samples that had tested Alternatively, the viruses isolated in for CoV antibodies in an indirect positive in the ORF1-CoV PCR were the Netherlands grouped more closely immunoperoxidase assay. Because confi rmed positive with this TaqMan with FRCoVs causing systemic 32% of the ferret serum had a titer >20 assay. To analyze FRCoV in ferrets disease (e.g., FRSCV-MSU1). Thus in this assay, we concluded that these from geographically distinct sites, we far, no evidence indicates that the animals most likely had been exposed tested fecal samples from 90 animals animals testing positive for the to a CoV. To test for a CoV in these without signs of disease (including enteric CoV showed clinical disease animals, we analyzed RNA extracted epizootic catarrhal enteritis) from 39 that pointed to pyogranulomatous from rectal swabs with a degenerate different locations in the Netherlands. infl ammation, necrosis with or set of primers to amplify a conserved FRCoV nucleocapsid TaqMan and without perivasculitis, and vasculitis region within open reading frame ORF1-CoV PCR demonstrated that in abdominal and visceral organs (ORF) 1 of CoVs (7). Remarkably, 61% of the fecal samples and 72% of associated with the systemic variant. 36 (42%) of samples tested were PCR the locations were positive. Multiple Further genetic characterization of positive, suggesting excretion of a testing of fecal swabs at different times these enteric FRCoVs variants might CoV by a substantial proportion of and use of FRCoV-specifi c antibody show genetic differences that could ferrets tested. To corroborate that the assays would probably further increase explain the apparent pathotypes of CoV detected in the rectal swabs was the FRCoV prevalence rate. these 2 FRCoVs. FRCoVs might a ferret CoV (FRCoV), we amplifi ed Further partial sequence analysis evolve through mutation or deletion and sequenced the nucleocapsid of the spike gene by using primers into viruses that cause systemic 1570 Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 17, No. 8, August 2011 LETTERS 4. Wise AG, Kiupel M, Garner MM, Clark AK, Maes RK. Comparative sequence analysis of the distal one-third of the ge- nomes of a systemic and an enteric ferret coronavirus. Virus Res. 2010;149:42–50. doi:10.1016/j.virusres.2009.12.011 5. Martínez J, Reinacher M, Perpinan D, Ramis A. Identifi cation of group 1 coro- navirus antigen in multisystemic granulo- matous lesions in ferrets (Mustela puto- rius furo). J Comp Pathol. 2008;138:54–8. doi:10.1016/j.jcpa.2007.10.002 6. Vlasova AN, Zhang X, Hasoksuz M, Nagesha HS, Haynes LM, Fang Y, et al. Figure. Phylogenetic tree based on nucleotide sequences of the nucleocapsid (A) and spike Two-way antigenic cross-reactivity be- gene (B) of ferret coronaviruses (FRCoVs) 4E98 (GenBank accession nos. JF260916 and tween severe acute respiratory syndrome JF260914, respectively) and 511c (accession nos. JF260915 and JF260913, respectively) coronavirus (SARS-CoV) and group and other coronaviruses (CoVs). Partial nucleotide sequences were aligned by using 1 animal CoVs is mediated through an ClustalX (www.clustal.org) and a neighbor-joining Kimura 2-parameter model with 1,000 antigenic site in the N-terminal region bootstrap replicates; avian CoVs were used as outgroup sequences (p-distance; allowing of the SARS-CoV nucleoprotein. J Vi- gaps or missing data). Other CoVs shown (abbreviation, GenBank accession number): rol. 2007;81:13365–77. doi:10.1128/ ferret coronavirus (FRECV MSU2, GU338457); ferret systemic coronavirus (FRSCV JVI.01169-07 MSU1, GU338456); feline coronavirus (FCoV, DQ010921); canine coronavirus (CCoV, 7. Ksiazek TG, Erdman D, Goldsmith CS, AY342160); transmissible gastroenteritis virus (TGEV, AF104420); human coronavirus Zaki SR, Peret T, Emery S, et al. A novel (HCoV NL63, DQ445911); porcine epidemic diarrhea virus (PEDV, AF353511); severe coronavirus associated with severe acute acute respiratory syndrome coronavirus (SARS-HCoV, NC_004718); murine hepatitis virus respiratory syndrome. N Engl J Med. 2003;348:1953–66. doi:10.1056/NEJMoa (MHV, AY700211); bovine coronavirus (BCoV, U00735); infectious bronchitis virus (IBV, 030781 AY363968); and turkey coronavirus (TuCov, AF111997). Scale bars indicate nucleotide 8. Woo PC, Lau SK, Huang Y, Yuen substitutions per site. KY. Coronavirus diversity, phylog- eny and interspecies jumping. Exp Biol disease, or alternatively, different Author affi liations: Erasmus Medical Med (Maywood). 2009;234:1117–27. doi:10.3181/0903-MR-94 FRCoVs are circulating, analogous to Center, Rotterdam, the Netherlands 9. Vennema H, Poland A, Foley J, Ped- the hypotheses put forward to explain (L.B.V. Provacia, S.L. Smits, B.E. Martina, ersen NC. Feline infectious peritoni- the occurrence of FIP (9,10). Given V.S. Raj, P. v.d. Doel, G. v. Amerongen, tis viruses arise by mutation from en- the use of ferrets in testing effi cacy A.D.M.E. Osterhaus, B.L. Haagmans); demic feline enteric coronaviruses. Virology. 1998;243:150–7. doi:10.1006/ of infl uenza virus vaccines and the and Ferret Clinic Brouwhuis, Helmond, the viro.1998.9045 propensity of CoVs to cross species Netherlands (H. Moorman-Roest) 10. Brown MA, Troyer JL, Pecon-Slattery barriers, further surveillance and J, Roelke ME, O’Brien SJ. Genetics and DOI: 10.3201/eid1708.110115 investigation of the biology of these pathogenesis of feline infectious peritoni- tis virus. Emerg Infect Dis. 2009;15:1445– emerging FRCoVs is warranted. References 52. doi:10.3201/eid1509.081573 1. Weiss SR, Navas-Martin S. Corona- Address for correspondence: Bart L. This work was funded by the virus pathogenesis and the emerging Haagmans, Department of Virology, Erasmus European Community’s Seventh pathogen severe acute respiratory syn- Medical Center, dr Molewaterplein, 50, 3000 Framework Programme (FP7/2007–2013) drome coronavirus. Microbiol Mol Biol CA, Rotterdam, the Netherlands; email: under the project “European Management Rev. 2005;69:635–64. doi:10.1128/ MMBR.69.4.635-664.2005 [email protected] Platform for Emerging and Re-emerging 2. Wise AG, Kiupel M, Maes RK. Molecular Infectious Disease Entities” European characterization of a novel coronavirus as- Commission grant agreement no. 223498. sociated with epizootic catarrhal enteritis (ECE) in ferrets. Virology. 2006;349:164– 74. doi:10.1016/j.virol.2006.01.031 Lisette B.V. Provacia, 3. Garner MM, Ramsell K, Morera N, Juan- Saskia L. Smits, Salles C, Jimenez J, Ardiaca M, et al. Byron E. Martina, Clinicopathologic features of a systemic coronavirus-associated disease resem- V. Stalin Raj, Petra v.d. Doel, bling feline infectious peritonitis in the Geert v. Amerongen, domestic ferret (Mustela putorius). Vet Hanneke Moorman-Roest, Pathol. 2008;45:236–46. doi:10.1354/ Albert D.M.E. Osterhaus, vp.45-2-236 and Bart L. Haagmans Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 17, No.
Load more

Recommended publications
  • Killed Whole-Genome Reduced-Bacteria Surface-Expressed Coronavirus Fusion Peptide Vaccines Protect Against Disease in a Porcine Model
    Killed whole-genome reduced-bacteria surface-expressed coronavirus fusion peptide vaccines protect against disease in a porcine model Denicar Lina Nascimento Fabris Maedaa,b,c,1, Debin Tiand,e,1, Hanna Yua,b,c, Nakul Dara,b,c, Vignesh Rajasekarana,b,c, Sarah Menga,b,c, Hassan M. Mahsoubd,e, Harini Sooryanaraind,e, Bo Wangd,e, C. Lynn Heffrond,e, Anna Hassebroekd,e, Tanya LeRoithd,e, Xiang-Jin Mengd,e,2, and Steven L. Zeichnera,b,c,f,2 aDepartment of Pediatrics, University of Virginia, Charlottesville, VA 22908-0386; bPendleton Pediatric Infectious Disease Laboratory, University of Virginia, Charlottesville, VA 22908-0386; cChild Health Research Center, University of Virginia, Charlottesville, VA 22908-0386; dDepartment of Biomedical Sciences and Pathobiology, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061-0913; eCenter for Emerging, Zoonotic, and Arthropod-borne Pathogens, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061-0913; and fDepartment of Microbiology, Immunology, and Cancer Biology, University of Virginia, Charlottesville, VA 22908-0386 Contributed by Xiang-Jin Meng, February 14, 2021 (sent for review December 13, 2020; reviewed by Diego Diel and Qiuhong Wang) As the coronavirus disease 2019 (COVID-19) pandemic rages on, it Vaccination specifically with conserved E. coli antigens did not is important to explore new evolution-resistant vaccine antigens alter the gastrointestinal (GI) microbiome (6, 9). In human stud- and new vaccine platforms that can produce readily scalable, in- ies, volunteers were immunized orally with a KWCV against expensive vaccines with easier storage and transport. We report ETEC (10) with no adverse effects. An ETEC oral KWCV along here a synthetic biology-based vaccine platform that employs an with a cholera B toxin subunit adjuvant was studied in children expression vector with an inducible gram-negative autotransporter and found to be safe (11).
    [Show full text]
  • Canine Coronaviruses: Emerging and Re-Emerging Pathogens of Dogs
    1 Berliner und Münchener Tierärztliche Wochenschrift 2021 (134) Institute of Animal Hygiene and Veterinary Public Health, University Leipzig, Open Access Leipzig, Germany Berl Münch Tierärztl Wochenschr (134) 1–6 (2021) Canine coronaviruses: emerging and DOI 10.2376/1439-0299-2021-1 re-emerging pathogens of dogs © 2021 Schlütersche Fachmedien GmbH Ein Unternehmen der Schlüterschen Canine Coronaviren: Neu und erneut auftretende Pathogene Mediengruppe des Hundes ISSN 1439-0299 Korrespondenzadresse: Ahmed Abd El Wahed, Uwe Truyen [email protected] Eingegangen: 08.01.2021 Angenommen: 01.04.2021 Veröffentlicht: 29.04.2021 https://www.vetline.de/berliner-und- muenchener-tieraerztliche-wochenschrift- open-access Summary Canine coronavirus (CCoV) and canine respiratory coronavirus (CRCoV) are highly infectious viruses of dogs classified as Alphacoronavirus and Betacoronavirus, respectively. Both are examples for viruses causing emerging diseases since CCoV originated from a Feline coronavirus-like Alphacoronavirus and CRCoV from a Bovine coronavirus-like Betacoronavirus. In this review article, differences in the genetic organization of CCoV and CRCoV as well as their relation to other coronaviruses are discussed. Clinical pictures varying from an asymptomatic or mild unspecific disease, to respiratory or even an acute generalized illness are reported. The possible role of dogs in the spread of the Betacoronavirus severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is crucial to study as ani- mal always played the role of establishing zoonotic diseases in the community. Keywords: canine coronavirus, canine respiratory coronavirus, SARS-CoV-2, genetics, infectious diseases Zusammenfassung Das canine Coronavirus (CCoV) und das canine respiratorische Coronavirus (CRCoV) sind hochinfektiöse Viren von Hunden, die als Alphacoronavirus bzw.
    [Show full text]
  • Exposure of Humans Or Animals to Sars-Cov-2 from Wild, Livestock, Companion and Aquatic Animals Qualitative Exposure Assessment
    ISSN 0254-6019 Exposure of humans or animals to SARS-CoV-2 from wild, livestock, companion and aquatic animals Qualitative exposure assessment FAO ANIMAL PRODUCTION AND HEALTH / PAPER 181 FAO ANIMAL PRODUCTION AND HEALTH / PAPER 181 Exposure of humans or animals to SARS-CoV-2 from wild, livestock, companion and aquatic animals Qualitative exposure assessment Authors Ihab El Masry, Sophie von Dobschuetz, Ludovic Plee, Fairouz Larfaoui, Zhen Yang, Junxia Song, Wantanee Kalpravidh, Keith Sumption Food and Agriculture Organization for the United Nations (FAO), Rome, Italy Dirk Pfeiffer City University of Hong Kong, Hong Kong SAR, China Sharon Calvin Canadian Food Inspection Agency (CFIA), Science Branch, Animal Health Risk Assessment Unit, Ottawa, Canada Helen Roberts Department for Environment, Food and Rural Affairs (Defra), Equines, Pets and New and Emerging Diseases, Exotic Disease Control Team, London, United Kingdom of Great Britain and Northern Ireland Alessio Lorusso Istituto Zooprofilattico dell’Abruzzo e Molise, Teramo, Italy Casey Barton-Behravesh Centers for Disease Control and Prevention (CDC), One Health Office, National Center for Emerging and Zoonotic Infectious Diseases, Atlanta, United States of America Zengren Zheng China Animal Health and Epidemiology Centre (CAHEC), China Animal Health Risk Analysis Commission, Qingdao City, China Food and Agriculture Organization of the United Nations Rome, 2020 Required citation: El Masry, I., von Dobschuetz, S., Plee, L., Larfaoui, F., Yang, Z., Song, J., Pfeiffer, D., Calvin, S., Roberts, H., Lorusso, A., Barton-Behravesh, C., Zheng, Z., Kalpravidh, W. & Sumption, K. 2020. Exposure of humans or animals to SARS-CoV-2 from wild, livestock, companion and aquatic animals: Qualitative exposure assessment. FAO animal production and health, Paper 181.
    [Show full text]
  • Viroreal® Kit Bovine Coronavirus
    Manual ViroReal® Kit Bovine Coronavirus Manual For use with the • ABI PRISM® 7500 (Fast) • LightCycler® 480 • Mx3005P® For veterinary use only DVEV00911, DVEV00913 100 DVEV00951, DVEV00953 50 ingenetix GmbH Arsenalstraße 11 1030 Vienna, Austria T +43(0)1 36 198 0 198 F +43(0)1 36 198 0 199 [email protected] www.ingenetix.com ingenetix GmbH ViroReal® Kit Bovine Coronavirus Manual June 2018 v1.5e Page 1 of 9 Manual Index 1. Product description ............................................................................................................................................. 3 2. Pathogen information .......................................................................................................................................... 3 3. Principle of real-time PCR ................................................................................................................................... 3 4. General Precautions ........................................................................................................................................... 3 5. Contents of the Kit ............................................................................................................................................... 4 5.1. ViroReal® Kit Bovine Coronavirus order no. DVEV00911 or DVEV00951 .................................................. 4 5.2. ViroReal® Kit Bovine Coronavirus order no. DVEV00913 or DVEV00953 .................................................. 4 6. Additionally required materials and devices .......................................................................................................
    [Show full text]
  • Coronaviruses: a Review of Their Properties and Diversity
    Properties and diversity of coronaviruses Afr. J. Clin. Exper. Microbiol. 2020; 21 (4): 258-271 Joseph and Fagbami. Afr. J. Clin. Exper. Microbiol. 2020; 21 (4): 258 - 271 https://www.afrjcem.org African Journal of Clinical and Experimental Microbiology. ISSN 1595-689X Oct 2020; Vol.21 No.4 AJCEM/2038. https://www.ajol.info/index.php/ajcem Copyright AJCEM 2020: https://doi.org/10.4314/ajcem.v21i4.2 Review Article Open Access Coronaviruses: a review of their properties and diversity Joseph, A. A., and *Fagbami, A. H. Department of Microbial Pathology, Faculty of Basic Clinical Sciences, University of Medical Sciences, Ondo, Nigeria *Correspondence to: [email protected] Abstract: Human coronaviruses, which hitherto were causative agents of mild respiratory diseases of man, have recently become one of the most important groups of pathogens of humans the world over. In less than two decades, three members of the group, severe acute respiratory syndrome (SARS) coronavirus (CoV), Middle East respiratory syndrome (MERS)-CoV, and SARS-COV-2, have emerged causing disease outbreaks that affected millions and claimed the lives of thousands of people. In 2017, another coronavirus, the swine acute diarrhea syndrome (SADS) coronavirus (SADS-CoV) emerged in animals killing over 24,000 piglets in China. Because of the medical and veterinary importance of coronaviruses, we carried out a review of available literature and summarized the current information on their properties and diversity. Coronaviruses are single-stranded RNA viruses with some unique characteristics such as the possession of a very large nucleic acid, high infidelity of the RNA-dependent polymerase, and high rate of mutation and recombination in the genome.
    [Show full text]
  • Porcine Respiratory Coronavirus
    PORCINE RESPIRATORY CORONAVIRUS Prepared for the Swine Health Information Center By the Center for Food Security and Public Health, College of Veterinary Medicine, Iowa State University August 2016 SUMMARY Etiology • Porcine respiratory coronavirus (PRCV) is a single-stranded, negative-sense, RNA virus in the family Coronaviridae. It was first identified in Belgium in 1984. PRCV is a deletion mutant of the enteric coronavirus transmissible gastroenteritis virus (TGEV) and is also closely related to feline enteric coronavirus and canine coronavirus. • Since it was first identified, various strains of PRCV have been described, many arising independently. Broadly, most strains are categorized as originating in the U.S. or Europe although Japanese strains have been described. Cleaning and Disinfection • Survival of PRCV in the environment is unclear. In PRCV endemic herds, virus can be isolated from pigs throughout the year. In other herds, PRCV temporarily disappears during summer months. PRCV may be highly stable when frozen, as is TGEV. • Given the close relation of PRCV to TGEV, disinfection procedures may be extrapolated. TGEV is susceptible to iodides, quaternary ammonium compounds, phenols, phenol plus aldehyde, beta- propiolactone, ethylenamine, formalin, sodium hydroxide, and sodium hypochlorite. Alcohols and accelerated hydrogen peroxides reduce TGEV titers by 3 and 4 logs, respectively. A pH higher than 8.0 reduces the half-life of TGEV to 3.5 hours at 37°C (98.6°F) in cell culture. Like TGEV, PRCV may be inactivated by sunlight or ultraviolet light. Epidemiology • PRCV has been identified in Europe, the U.S., Canada, Croatia, Japan, and Korea. Current PRCV prevalence is unknown as PRCV is generally considered to cause mild disease and is most important for its potential to confound diagnosis of TGEV.
    [Show full text]
  • Animal Coronaviruses and SARS-COV-2 in Animals, What Do We Actually Know?
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 4 January 2021 doi:10.20944/preprints202101.0002.v1 Type of the Paper (Review) Animal Coronaviruses and SARS-COV-2 in animals, what do we actually know? Paolo Bonilauri 1, Gianluca Rugna 1 1 Experimental Institute for Zooprophylaxis in Lombardy and Emilia Romagna – IZSLER, via Bianchi, 9 Brescia - Italy * Correspondence: [email protected]; Abstract: Coronaviruses (CoVs) are a well-known group of viruses in veterinary medicine. We currently know four genera of Coronavirus, alfa, beta, gamma and delta. Wild, farmed and pet animals are infected with CoVs belonging to all four genera. Seven human respiratory coronaviruses have still been identified, four of which cause upper respiratory tract diseases, specifically, the common cold, and the last three that have emerged cause severe acute respiratory syndromes, SARS-CoV-1, MERS-CoV and SARS-CoV-2. In this review we briefly describe animal coronaviruses and what we actually know about SARS-CoV-2 infection in farm and domestic animals. 1. Introduction The Coronaviridae, with a single-stranded, positive-sense RNA genome is a well-known and studied family of viruses in veterinary medicine. Virtually every pet, bred, or companion animal and every wild animal can be said to have dealt with at least one virus from this family in its life. Coronaviruses (CoVs) are currently divided in four genera: Alpha-, Beta-, Gamma- and Deltacoronavirus, and all genera are of interest as etiologic agent of enteric, respiratory or systemic diseases in animals. The most common wild animal host of coronaviruses is bat and it has commonly accepted that a family of virus associated to severe respiratory syndrome (SARS), named SARSr-CoV is mainly found in bats and it has been expected that a future disease outbreak would come from this family of viruses [1,2].
    [Show full text]
  • The Polypeptide Structure of Canine Coronavirus and Its Relationship to Porcine Transmissible Gastroenteritis Virus
    J. gen. ViroL (1981), 52, 153-157 153 Printed in Great Britain The Polypeptide Structure of Canine Coronavirus and its Relationship to Porcine Transmissible Gastroenteritis Virus (Accepted 21 July 1980) SUMMARY Canine coronavirus (CCV) isolate 1-71 was grown in secondary dog kidney cells and purified by rate zonal centrifugation. Polyacrylamide gel electrophoresis revealed four major structural polypeptides with apparent tool. wt. of 203 800 (gp204), 49 800 (p50), 31800 (gp32) and 21600 (gp22). Incorporation of 3H-glucosamine into gp204, gp32 and gp22 indicated that these were glycopolypeptides. Comparison of the structural polypeptides of CCV and porcine transmissible gastroenteritis virus (TGEV) by co-electrophoresis demonstrated that TGEV polypeptides corresponded closely, but not identically, with gp204, p50 and gp32 of CCV and confirmed that gp22 was a major structural component only in the canine virus. The close similarities in structure of the two coronaviruses augments the relationship established by serology. The first suggestion that a virus antigenically related to porcine transmissible gastro- enteritis virus (TGEV) was capable of infecting dogs came from Norman et al. (1970). Their survey of canine sera revealed antibody to TGEV in American dogs that had never been in contact with pigs and would not have been infected with TGEV. A subsequent report from the U.K. (Cartwright & Lucas, 1972) identified rising titres of antibody to TGEV in a kennel of 40 dogs in which an outbreak of vomiting and diarrhoea had occurred. Once again there was no known contact of the dogs with pigs. The possibility that TGEV-neutralizing antibodies resulted from exposure of dogs to TGEV, with transmission from dog to dog, could not be excluded, however, since Haelterman (1962) had clearly demonstrated that dogs and foxes could be infected with the porcine virus.
    [Show full text]
  • Describing Variability in Pig Genes Involved in Coronavirus Infections for a One Health Perspective in Conservation of Animal Ge
    www.nature.com/scientificreports OPEN Describing variability in pig genes involved in coronavirus infections for a One Health perspective in conservation of animal genetic resources Samuele Bovo1, Giuseppina Schiavo1, Anisa Ribani1, Valerio J. Utzeri1, Valeria Taurisano1, Mohamad Ballan1, Maria Muñoz2, Estefania Alves2, Jose P. Araujo3, Riccardo Bozzi4, Rui Charneca5, Federica Di Palma6, Ivona Djurkin Kušec7, Graham Etherington8, Ana I. Fernandez2, Fabián García2, Juan García‑Casco2, Danijel Karolyi9, Maurizio Gallo10, José Manuel Martins5, Marie‑José Mercat11, Yolanda Núñez2, Raquel Quintanilla12, Čedomir Radović13, Violeta Razmaite14, Juliette Riquet15, Radomir Savić16, Martin Škrlep17, Graziano Usai18, Christoph Zimmer19, Cristina Ovilo2 & Luca Fontanesi1* Coronaviruses silently circulate in human and animal populations, causing mild to severe diseases. Therefore, livestock are important components of a “One Health” perspective aimed to control these viral infections. However, at present there is no example that considers pig genetic resources in this context. In this study, we investigated the variability of four genes (ACE2, ANPEP and DPP4 encoding for host receptors of the viral spike proteins and TMPRSS2 encoding for a host proteinase) in 23 European (19 autochthonous and three commercial breeds and one wild boar population) and two Asian Sus scrofa populations. A total of 2229 variants were identifed in the four candidate genes: 26% of them were not previously described; 29 variants afected the protein sequence and might potentially interact with the infection mechanisms. The results coming from this work are a frst step towards a “One Health” perspective that should consider conservation programs of pig genetic resources with twofold objectives: (i) genetic resources could be reservoirs of host gene variability useful to design selection programs to increase resistance to coronaviruses; (ii) the described 1Department of Agricultural and Food Sciences, Division of Animal Sciences, University of Bologna, Viale Fanin 46, 40127 Bologna, Italy.
    [Show full text]
  • A New Coronavirus Associated with Human Respiratory Disease in China
    Article A new coronavirus associated with human respiratory disease in China https://doi.org/10.1038/s41586-020-2008-3 Fan Wu1,7, Su Zhao2,7, Bin Yu3,7, Yan-Mei Chen1,7, Wen Wang4,7, Zhi-Gang Song1,7, Yi Hu2,7, Zhao-Wu Tao2, Jun-Hua Tian3, Yuan-Yuan Pei1, Ming-Li Yuan2, Yu-Ling Zhang1, Fa-Hui Dai1, Received: 7 January 2020 Yi Liu1, Qi-Min Wang1, Jiao-Jiao Zheng1, Lin Xu1, Edward C. Holmes1,5 & Yong-Zhen Zhang1,4,6 ✉ Accepted: 28 January 2020 Published online: 3 February 2020 Emerging infectious diseases, such as severe acute respiratory syndrome (SARS) and Open access Zika virus disease, present a major threat to public health1–3. Despite intense research Check for updates eforts, how, when and where new diseases appear are still a source of considerable uncertainty. A severe respiratory disease was recently reported in Wuhan, Hubei province, China. As of 25 January 2020, at least 1,975 cases had been reported since the frst patient was hospitalized on 12 December 2019. Epidemiological investigations have suggested that the outbreak was associated with a seafood market in Wuhan. Here we study a single patient who was a worker at the market and who was admitted to the Central Hospital of Wuhan on 26 December 2019 while experiencing a severe respiratory syndrome that included fever, dizziness and a cough. Metagenomic RNA sequencing4 of a sample of bronchoalveolar lavage fuid from the patient identifed a new RNA virus strain from the family Coronaviridae, which is designated here ‘WH-Human 1’ coronavirus (and has also been referred to as ‘2019-nCoV’).
    [Show full text]
  • Drawing Comparisons Between SARS-Cov-2 and the Animal Coronaviruses
    microorganisms Review Drawing Comparisons between SARS-CoV-2 and the Animal Coronaviruses Souvik Ghosh 1,* and Yashpal S. Malik 2 1 Department of Biomedical Sciences, Ross University School of Veterinary Medicine, Basseterre 334, Saint Kitts and Nevis 2 College of Animal Biotechnology, Guru Angad Dev Veterinary and Animal Science University, Ludhiana 141004, India; [email protected] * Correspondence: [email protected] or [email protected]; Tel.: +1-869-4654161 (ext. 401-1202) Received: 23 September 2020; Accepted: 19 November 2020; Published: 23 November 2020 Abstract: The COVID-19 pandemic, caused by a novel zoonotic coronavirus (CoV), SARS-CoV-2, has infected 46,182 million people, resulting in 1,197,026 deaths (as of 1 November 2020), with devastating and far-reaching impacts on economies and societies worldwide. The complex origin, extended human-to-human transmission, pathogenesis, host immune responses, and various clinical presentations of SARS-CoV-2 have presented serious challenges in understanding and combating the pandemic situation. Human CoVs gained attention only after the SARS-CoV outbreak of 2002–2003. On the other hand, animal CoVs have been studied extensively for many decades, providing a plethora of important information on their genetic diversity, transmission, tissue tropism and pathology, host immunity, and therapeutic and prophylactic strategies, some of which have striking resemblance to those seen with SARS-CoV-2. Moreover, the evolution of human CoVs, including SARS-CoV-2, is intermingled with those of animal CoVs. In this comprehensive review, attempts have been made to compare the current knowledge on evolution, transmission, pathogenesis, immunopathology, therapeutics, and prophylaxis of SARS-CoV-2 with those of various animal CoVs.
    [Show full text]
  • Canine Respiratory Coronavirus, Bovine Coronavirus, and Human Coronavirus OC43: Receptors and Attachment Factors
    viruses Article Canine Respiratory Coronavirus, Bovine Coronavirus, and Human Coronavirus OC43: Receptors and Attachment Factors Artur Szczepanski 1,2,† , Katarzyna Owczarek 1,2,† , Monika Bzowska 3, Katarzyna Gula 2, Inga Drebot 2, Marek Ochman 4, Beata Maksym 5, Zenon Rajfur 6, Judy A Mitchell 7 and Krzysztof Pyrc 2, * 1 Microbiology Department, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Krakow, Poland; [email protected] (A.S.); [email protected] (K.O.) 2 Virogenetics Laboratory of Virology, Malopolska Centre of Biotechnology, Jagiellonian University, Gronostajowa 7a, 30-387 Krakow, Poland; [email protected] (K.G.); [email protected] (I.D.) 3 Department of Cell Biochemistry, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Krakow, Poland; [email protected] 4 Department of Cardiac, Vascular and Endovascular Surgery and Transplantology, Medical University of Silesia in Katowice, Silesian Centre for Heart Diseases, Marii Curie Sklodowskiej 9, 41-800 Zabrze, Poland; [email protected] 5 Department of Pharmacology, School of Medicine with the Division of Dentistry in Zabrze, Medical University of Silesia in Katowice, ul. Jordana 19, 41-808 Zabrze, Poland; [email protected], 6 Institute of Physics, Faculty of Physics, Astronomy and Applied Computer Sciences, Jagiellonian University, Lojasiewicza 11, 30-348 Krakow, Poland; [email protected] 7 Department of Pathology and Pathogen Biology, The Royal Veterinary College, Hatfield, Hertfordshire AL9 7TA, UK; [email protected] * Correspondence: [email protected]; Tel.: +48-12-664-61-21; Fax: +48-12-664-69-02 † These authors contributed equally to this work.
    [Show full text]