First Case of Systemic Coronavirus Infection in a Domestic Ferret (Mustela Putorius Furo) in Peru
Total Page：16
File Type：pdf, Size：1020Kb
Transboundary and Emerging Diseases RAPID COMMUNICATION First Case of Systemic Coronavirus Infection in a Domestic Ferret (Mustela putorius furo) in Peru J. Lescano1, M. Quevedo1, O. Gonzales-Viera2, L. Luna3, M. K. Keel2 and F. Gregori3 1 Laboratory of Animal Anatomy and Wildlife, School of Veterinary Medicine, Universidad Nacional Mayor de San Marcos, Lima, Peru 2 Department of Pathology, Microbiology and Immunology, School of Veterinary Medicine, University of California, Davis, CA, USA 3 Department of Preventive Veterinary Medicine and Animal Health, School of Veterinary Medicine, Universidade de Sao~ Paulo, Sao~ Paulo, Brazil Keywords: Summary ferrets; Mustelidae; coronavirus; polymerase chain reaction A domestic ferret from Lima, Peru, died after ten days of non-specific clinical signs. Based on pathology, immunohistochemistry and molecular analysis, ferret Correspondence: systemic coronavirus (FRSCV)-associated disease was diagnosed for the first time J. Lescano. School of Veterinary Medicine, in South America. This report highlights the potential spread of pathogens by the Universidad Nacional Mayor de San Marcos, international pet trade. 2800 Circunvalacion Avenue, Lima 30, Peru. Tel.: (511) 619 7000 Ext. 5001; Fax: (511) 436 1027; E-mail: [email protected] Received for publication May 26, 2015 doi:10.1111/tbed.12407 Mayor de San Marcos (UNMSM), Lima, Peru. Five months Introduction prior to illness, the ferret had been legally imported from Since the beginning of the 21st century, ferrets have become Spain via Chile with seven other ferrets. The animal under- increasingly popular as pets in many countries (Johnson- went a 30-day quarantine period once in Chile and again in Delaney, 2010; Zaffarano, 2010). In 2004, a disease of Peru. The ferret was reportedly vaccinated for canine dis- ferrets characterized by clinical signs and lesions similar to temper virus and rabies virus. Prior to submission, the fer- those of feline infectious peritonitis (FIP) was first recog- ret reportedly experienced eight days of hypothermia and nized in Spain and has since been documented in the Uni- diarrhoea before the owners hospitalized it in a private vet- ted States, Europe and Asia (Martınez et al., 2006; Garner erinary clinic. Although antibiotic and supportive treat- et al., 2008; Perpin~an and Lopez, 2008; Laprie et al., 2009; ment was administered for 2 days at the private clinic, the Michimae et al., 2010; Murray et al., 2010; Terada et al., animal became anorexic and was referred to UNMSM. 2010; Wise et al., 2010). The disease was initially called fer- At the time of referral, the ferret weighed 360 g and had ret infectious peritonitis (Johnson-Delaney, 2010). A novel a rectal temperature of 37.8°C. The mucous membranes Alphacoronavirus, subsequently named ferret systemic were pale yellow. The ferret was in poor nutritional condi- coronavirus (FSCV or FRSCV), has been confirmed to be tion, with a body score of 2/5, and it was severely dehy- the aetiologic agent (Garner et al., 2008; Terada et al., drated. It was lethargic and the perineum was stained by 2010). Neither FRSCV nor FRSCV-associated disease has dark faeces. The ferret had hind limb paresis and a nervous been previously reported in South America. tic in forelimbs and eyelids. A haematological evaluation revealed severe anaemia and leukocytosis. Therapy with enrofloxacin, sodium chloride 0.9%, vitamin B complex, Materials and Methods vitamin C and hospitalization in a warm room (28–30°C) In February 2013, a seven-month-old male ferret was was initiated, but the animal died the next morning. received at the Wild and Exotic Animals’ Clinic at the Post-mortem examination was performed and paired tis- School of Veterinary Medicine, Universidad Nacional sue samples duodenum, brain, cerebellum, liver, kidney, © 2015 Blackwell Verlag GmbH • Transboundary and Emerging Diseases. 62 (2015) 581–585 581 Systemic Coronavirus Infection in a Ferret, Peru J. Lescano et al. spleen, jejunum, large intestine, mesenteric lymph nodules (a) and lungs were collected and stored in both 10% buffered formalin and frozen at À20°C, respectively. Formalin-fixed tissues were sectioned at 5 lm, stained with haematoxylin and eosin and examined by light microscopy. Immunohis- * tochemistry was performed with a monoclonal antibody that targets the conserved region of the N gene of feline coronavirus. Domestic cat tissues infected by FIP virus were used as a positive control. RNA extractions from tissue samples were conducted using TRIzol ReagentTM (Invitro- (b) gen, Carlsbad, CA, USA), following the manufacturer’s instructions. Reverse transcription was performed with M- MLV Reverse Transcriptase (Invitrogen) and random pri- mers. Nested PCR was performed using generic primers, which amplify a 440-bp segment in the open reading frame * (ORF) 1b region, encoding RNA-dependent RNA poly- merase (RdRp) of viruses in the family Coronaviridae. The external primers were 50GGKTGGGAYTAYCCKAARTG 0 and 5 TGYTGTSWRCARAAYTCRTG (Chu et al., 2011) Fig. 1. Domestic ferret, abdominal cavity. (a) In situ observation of 0 and the internal primers were 5 GGTTGGGACTATCCT abdominal cavity, note the pale-yellowish nodules in the mesentery AAGTGTGA and 50 CCATCATCAGATAGAATCATCATA (arrow) and in the opaque omentum surrounding the spleen (asterisk). (Woo et al., 2005). Phylogenetic analysis was performed (b) Microscopy of the mesenteric nodules, observe the marked cellular using a 397-bp fragment. infiltration in the mesenteric fat tissue (asterisk) with the special patter surrounding blood vessels (arrow). HE, Bar = 100 lm. Inset, mesenteric nodules, positive cytoplasmic reaction for anti-feline coronavirus in Results macrophages. IHC, Bar = 50 lm. The main gross findings at necropsy were multiple white, soft, 1- to 4-mm-diameter nodules that were scattered was not detected in small and large intestine, liver, kidney, throughout the mesentery, omentum, peritoneum, dia- spleen, mesenteric lymph nodes and lungs. The coronavirus phragm, serosa surface of oesophagus, small intestine and sequence detected in this study belonged to the genus gall bladder, and capsule of liver, kidneys and spleen Alphacoronavirus, lineage 1a. The samples of the brain (Fig. 1a). Lymph nodes were generally enlarged. The cere- (GenBank accession no. KR758767) and cerebellum brum was moderately congested. (GenBank accession no. KR758768) had one SNP (single Microscopic findings included dense, primarily perivas- nucleotide polymorphism) in the amplified sequence. cular infiltrates of macrophages, lymphocytes and neu- Based on BLAST analysis (Altschul et al., 1990), the trophils beneath the peritoneum and within the mesentery. sequence from the Peruvian ferret was 93–95% similar to Multifocal to coalescing pyogranulomatous peritonitis was sequences from ferrets in Japan, 62% similar to feline coro- evident along serosal surfaces of the gastrointestinal tract, navirus, 62% similar to transmissible gastroenteritis virus gall bladder, kidneys, spleen, liver, peritoneum and mesen- (TGEV) and 78% similar to mink coronavirus (Fig. 2). tery (Fig. 1b). Additional lesions included moderate multi- focal histiocytic meningoencephalitis, severe multifocal to Discussion coalescing pyogranulomatous hepatitis with bile duct hyperplasia, moderate multifocal pyogranulomatous inter- Based on immunohistochemical and molecular findings, stitial nephritis, moderate diffuse lymphoplasmacytic inter- FRSCV infection was diagnosed in a ferret imported from stitial pneumonia, moderate focally extensive Spain to Peru. This is the first time systemic coronavirus granulomatous enteritis and mild focal histiocytic infection of ferrets has been described in Latin America. myocarditis. The ferret had haematological values and clinical signs sim- Immunohistochemistry revealed macrophages within ilar to those described for FRSCV-associated disease. How- inflammatory foci of meninges, lung, liver and kidney, and ever, these signs are relatively non-specific, and many other serosa of gastrointestinal tract, mesenteric lymph nodes, clinical signs associated with FRCSV were not observed, spleen and mesentery (Fig. 1b) had specific cytoplasmic including palpable intra-abdominal masses, splenomegaly, labelling for coronavirus antigen. Brain and cerebellum nephromegaly, bruxism, sneezing/nasal discharge, systolic were positive for coronavirus by PCR, but viral nucleic acid heart murmur, urine discoloration, dyspnoea, peripheral 582 © 2015 Blackwell Verlag GmbH • Transboundary and Emerging Diseases. 62 (2015) 581–585 J. Lescano et al. Systemic Coronavirus Infection in a Ferret, Peru AB812847 Ferret coronavirus strain: 28 AB812846 Ferret coronavirus strain: 31 AB812845 Ferret coronavirus strain: 13 27 AB812844 Ferret coronavirus strain: 35 AB812843 Ferret coronavirus strain: 5 58 AB812842 Ferret coronavirus strain: 34 37 AB812841 Ferret coronavirus strain: 27 96 AB812840 Ferret coronavirus strain: 40 AB812848 Ferret coronavirus strain: 36 98 99 Ferret/Brain/Lima-2014 1a 27 Ferret/cerebellum/Lima-2014 48 AB812849 Ferret coronavirus strain: 38 90 84 AB812851 Ferret coronavirus strain: 4 84 AB812850 Ferret coronavirus strain: 39 α 77 AB812852 Ferret coronavirus strain: 33 AB812853 Ferret coronavirus strain: 22 Mink coronavirus strain WD1127 90 62 Feline coronavirus isolate Black 73 Feline coronavirus UU54 Feline coronavirus strain Felis catus/NLD/UU88/2010 Feline infectious peritonitis virus isolate FCoVWSU791146_P50 100 96 Feline infectious peritonitis virus 100 99 TGEV virulent Purdue 94 TGEV Miller