LETTERS Enteric protein by using primer pair 5′- TCCC 5′-AARRTTAATGAGTGTGTGMG CGCGGGGCTGGCAACGGACAA DTCA-3′ and 5′- CAACTCTYTTAA Coronavirus in CGTGT-3′ and 5′-CCCAAGCTTTTA GCCARTCAAGG-3′ clearly showed Ferrets, the GTTGACTAATAATTTCA-3′ . that these viruses are more closely Netherlands Phylogenetic analyses of 2 of the related to systemic FRCoVs than sequences obtained indicated a variant to FRECV (Figure). Amino acid To the Editor: Coronaviruses nucleocapsid that was similar to other alignment of 1 of these sequences (CoVs) are enveloped, positive-sense, FRCoVs described previously but (FRCoV-511c) with FRECV-MSU2 single-stranded RNA viruses that can that did not group with 1 of these demonstrated 78% identity and 89% cause acute and chronic respiratory, sequences directly (Figure). Amino similarity, and FRCoV-511c shows enteric, and central nervous system acid alignment of 1 of these sequences 86% identity and 92% similarity to disease in a variety of animal species (FRCoV-511c) with FRECV-MSU2 FRSCV-MSU1. (1). Recently, a novel ferret enteric demonstrated 91.8% identity and After identifi cation of severe CoV (FRECV) was indentifi ed 95.7% similarity, whereas this virus acute respiratory syndrome CoV in in domesticated ferrets (Mustela shows 89.3% identity and 95.2% humans in 2003 and related viruses putorius) in which epizootic catarrhal similarity to ferret systemic CoV in civet cats and bats, an increase in enteritis had been diagnosed; the (FRSCV-MSU1). CoV surveillance in different animal illness was characterized by foul- On the basis of obtained and species resulted in identifi cation and smelling green diarrhea with high published nucleocapsid sequences characterization of a broad range of mucus content, lethargy, anorexia, (2,4), we developed a TaqMan previously unrecognized CoVs (8). and vomiting (2). Another ferret CoV reverse transcription PCR to detect Here we report an enteric FRCoV emerged in ferrets for which systemic viral RNA using the following circulating in the Netherlands in a pyogranulomatous infl ammation, primers and degenerate probe: high percentage of asymptomatic resembling the clinical and pathologic forward,5′-TTGGAAAGAATG ferrets. The ferrets tested did not features of feline infectious peritonitis GTGCTAAAACTG-3′; reverse, 5′-CA have a previous record of foul- (FIP), was diagnosed (3–5). TTAGGCACGTTACCATCAAATT smelling green diarrhea described In 2010, we investigated the -3′; and probe, 5′-TAGGAACRCGT previously to be associated with prevalence of CoV antibodies in 85 GGCACCAACCAA-3′. Using this FRECV, a virus detected in the United asymptomatic ferrets obtained from more specifi c and sensitive assay, we States and further characterized 1 ferret farm in the Netherlands. detected viral RNA in 63% of the rectal in 2006 (2). On the basis of the Previous studies have shown that swabs tested; other CoVs including phylogenetic analysis of the spike antibodies against different members FIPV, severe acute respiratory sequences, FRECV-MSU2 might of the α-CoVs show broad cross- syndrome–CoV, and human CoV NL- have evolved through recombination reactivity (6). We used FIP virus 63, were not amplifi ed by this assay (data with some other unknown CoV. (FIPV)–infected cells to screen not shown). All samples that had tested Alternatively, the viruses isolated in for CoV antibodies in an indirect positive in the ORF1-CoV PCR were the Netherlands grouped more closely immunoperoxidase assay. Because confi rmed positive with this TaqMan with FRCoVs causing systemic 32% of the ferret serum had a titer >20 assay. To analyze FRCoV in ferrets disease (e.g., FRSCV-MSU1). Thus in this assay, we concluded that these from geographically distinct sites, we far, no evidence indicates that the animals most likely had been exposed tested fecal samples from 90 animals animals testing positive for the to a CoV. To test for a CoV in these without signs of disease (including enteric CoV showed clinical disease animals, we analyzed RNA extracted epizootic catarrhal enteritis) from 39 that pointed to pyogranulomatous from rectal swabs with a degenerate different locations in the Netherlands. infl ammation, necrosis with or set of primers to amplify a conserved FRCoV nucleocapsid TaqMan and without perivasculitis, and vasculitis region within open reading frame ORF1-CoV PCR demonstrated that in abdominal and visceral organs (ORF) 1 of CoVs (7). Remarkably, 61% of the fecal samples and 72% of associated with the systemic variant. 36 (42%) of samples tested were PCR the locations were positive. Multiple Further genetic characterization of positive, suggesting excretion of a testing of fecal swabs at different times these enteric FRCoVs variants might CoV by a substantial proportion of and use of FRCoV-specifi c antibody show genetic differences that could ferrets tested. To corroborate that the assays would probably further increase explain the apparent pathotypes of CoV detected in the rectal swabs was the FRCoV prevalence rate. these 2 FRCoVs. FRCoVs might a ferret CoV (FRCoV), we amplifi ed Further partial sequence analysis evolve through mutation or deletion and sequenced the nucleocapsid of the spike gene by using primers into viruses that cause systemic 1570 Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 17, No. 8, August 2011 LETTERS 4. Wise AG, Kiupel M, Garner MM, Clark AK, Maes RK. Comparative sequence analysis of the distal one-third of the ge- nomes of a systemic and an enteric ferret coronavirus. Virus Res. 2010;149:42–50. doi:10.1016/j.virusres.2009.12.011 5. Martínez J, Reinacher M, Perpinan D, Ramis A. Identifi cation of group 1 coro- navirus antigen in multisystemic granulo- matous lesions in ferrets (Mustela puto- rius furo). J Comp Pathol. 2008;138:54–8. doi:10.1016/j.jcpa.2007.10.002 6. Vlasova AN, Zhang X, Hasoksuz M, Nagesha HS, Haynes LM, Fang Y, et al. Figure. Phylogenetic tree based on nucleotide sequences of the nucleocapsid (A) and spike Two-way antigenic cross-reactivity be- gene (B) of ferret coronaviruses (FRCoVs) 4E98 (GenBank accession nos. JF260916 and tween severe acute respiratory syndrome JF260914, respectively) and 511c (accession nos. JF260915 and JF260913, respectively) coronavirus (SARS-CoV) and group and other coronaviruses (CoVs). Partial nucleotide sequences were aligned by using 1 animal CoVs is mediated through an ClustalX (www.clustal.org) and a neighbor-joining Kimura 2-parameter model with 1,000 antigenic site in the N-terminal region bootstrap replicates; avian CoVs were used as outgroup sequences (p-distance; allowing of the SARS-CoV nucleoprotein. J Vi- gaps or missing data). Other CoVs shown (abbreviation, GenBank accession number): rol. 2007;81:13365–77. doi:10.1128/ ferret coronavirus (FRECV MSU2, GU338457); ferret systemic coronavirus (FRSCV JVI.01169-07 MSU1, GU338456); feline coronavirus (FCoV, DQ010921); canine coronavirus (CCoV, 7. Ksiazek TG, Erdman D, Goldsmith CS, AY342160); transmissible gastroenteritis virus (TGEV, AF104420); human coronavirus Zaki SR, Peret T, Emery S, et al. A novel (HCoV NL63, DQ445911); porcine epidemic diarrhea virus (PEDV, AF353511); severe coronavirus associated with severe acute acute respiratory syndrome coronavirus (SARS-HCoV, NC_004718); murine hepatitis virus respiratory syndrome. N Engl J Med. 2003;348:1953–66. doi:10.1056/NEJMoa (MHV, AY700211); bovine coronavirus (BCoV, U00735); infectious bronchitis virus (IBV, 030781 AY363968); and turkey coronavirus (TuCov, AF111997). Scale bars indicate nucleotide 8. Woo PC, Lau SK, Huang Y, Yuen substitutions per site. KY. Coronavirus diversity, phylog- eny and interspecies jumping. Exp Biol disease, or alternatively, different Author affi liations: Erasmus Medical Med (Maywood). 2009;234:1117–27. doi:10.3181/0903-MR-94 FRCoVs are circulating, analogous to Center, Rotterdam, the Netherlands 9. Vennema H, Poland A, Foley J, Ped- the hypotheses put forward to explain (L.B.V. Provacia, S.L. Smits, B.E. Martina, ersen NC. Feline infectious peritoni- the occurrence of FIP (9,10). Given V.S. Raj, P. v.d. Doel, G. v. Amerongen, tis viruses arise by mutation from en- the use of ferrets in testing effi cacy A.D.M.E. Osterhaus, B.L. Haagmans); demic feline enteric coronaviruses. Virology. 1998;243:150–7. doi:10.1006/ of infl uenza virus vaccines and the and Ferret Clinic Brouwhuis, Helmond, the viro.1998.9045 propensity of CoVs to cross species Netherlands (H. Moorman-Roest) 10. Brown MA, Troyer JL, Pecon-Slattery barriers, further surveillance and J, Roelke ME, O’Brien SJ. Genetics and DOI: 10.3201/eid1708.110115 investigation of the biology of these pathogenesis of feline infectious peritoni- tis virus. Emerg Infect Dis. 2009;15:1445– emerging FRCoVs is warranted. References 52. doi:10.3201/eid1509.081573 1. Weiss SR, Navas-Martin S. Corona- Address for correspondence: Bart L. This work was funded by the virus pathogenesis and the emerging Haagmans, Department of Virology, Erasmus European Community’s Seventh pathogen severe acute respiratory syn- Medical Center, dr Molewaterplein, 50, 3000 Framework Programme (FP7/2007–2013) drome coronavirus. Microbiol Mol Biol CA, Rotterdam, the Netherlands; email: under the project “European Management Rev. 2005;69:635–64. doi:10.1128/ MMBR.69.4.635-664.2005 [email protected] Platform for Emerging and Re-emerging 2. Wise AG, Kiupel M, Maes RK. Molecular Infectious Disease Entities” European characterization of a novel coronavirus as- Commission grant agreement no. 223498. sociated with epizootic catarrhal enteritis (ECE) in ferrets. Virology. 2006;349:164– 74. doi:10.1016/j.virol.2006.01.031 Lisette B.V. Provacia, 3. Garner MM, Ramsell K, Morera N, Juan- Saskia L. Smits, Salles C, Jimenez J, Ardiaca M, et al. Byron E. Martina, Clinicopathologic features of a systemic coronavirus-associated disease resem- V. Stalin Raj, Petra v.d. Doel, bling feline infectious peritonitis in the Geert v. Amerongen, domestic ferret (Mustela putorius). Vet Hanneke Moorman-Roest, Pathol. 2008;45:236–46. doi:10.1354/ Albert D.M.E. Osterhaus, vp.45-2-236 and Bart L. Haagmans Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 17, No.