DOCSLIB.ORG

Genetics and Genomics of Cholesterol and Polyunsaturated Fatty Acid Metabolism in Relation to Coronary Heart Disease Risk

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genetics and Genomics of Cholesterol and Polyunsaturated Fatty Acid Metabolism in Relation to Coronary Heart Disease Risk Genetics and genomics of cholesterol and polyunsaturated fatty acid metabolism in relation to coronary heart disease risk Yingchang (Kevin) Lu Thesis committee Thesis supervisor Prof. dr. E.J.M. Feskens Personal chair at the Division of Human Nutrition Wageningen University Prof. dr. M.R. Müller Professor of Nutrition, Metabolism & Genomics Wageningen University Thesis co-supervisor Dr. J.M.A. Boer Senior researcher, Centre for Nutrition and Health National Institute for Public Health and the Environment (RIVM), De Bilt Other members Prof. dr. M.A.M. Groenen, Wageningen University Prof. dr. J.M. Ordovas, Jean Mayer USDA HNRCA at Tufts University, Boston, USA Prof. dr. ir. R.P. Mensink, Maastricht University Medical Center Dr. ir. K. Willems van Dijk, Leiden University Medical Center (LUMC) This research was conducted under the auspices of the Graduate School VLAG Genetics and genomics of cholesterol and polyunsaturated fatty acid metabolism in relation to coronary heart disease risk Yingchang (Kevin) Lu Thesis submitted in fulfilment of the requirements for the degree of doctor at Wageningen University by the authority of the Rector Magnificus Prof. dr. M.J. Kropff in the presence of the Thesis Committee appointed by the Academic Board to be defended in public on Tuesday November 8 2011 at 1.30 p.m. in the Aula. Yingchang (Kevin) Lu Genetics and genomics of cholesterol and polyunsaturated fatty acid metabolism in relation to coronary heart disease risk, 216 pages. Thesis, Wageningen University, Wageningen, NL (2011) With references, with summaries in English and Dutch ISBN 978-94-6173-035-0 To my mother Abstract Background Coronary heart disease (CHD) continues to be a leading cause of morbidity and mortality among adults worldwide. Deregulated lipid metabolism (dyslipidemia) that manifests as hypercholesterolemia, hypertriglyceridemia, low high-density-lipoprotein (HDL) cholesterol levels or a combination of those, is an established risk factor for CHD among other established risk factors. Linoleic acid (LA, C18:2n-6) and alpha-linolenic acid (ALA, C18:3n-3) are polyunsaturated fatty acids (PUFAs) that cannot be synthesized de novo by human or animal cells, and therefore must be obtained from the diet. From these two PUFAs, two series of long-chain PUFAs are formed; the omega-6 series that are synthesized from LA, and the omega-3 series that are from ALA. Formation of these long- chain PUFAs involves a series of alternate desaturation and elongation processes. These PUFAs, especially, omega-3 PUFAs, have long been observed to reduce CHD risk. In contrast to the consistently observed cardiovascular protective effects of omega-3 PUFAs, accumulating evidence suggests a potential pro-atherogenic effects of omega-6 PUFAs, which is now still under debate. It has been estimated that genetic factors account for 26%-69% of inter-individual variation in CHD risk. These genetic factors are thought to influence CHD risk both directly and through effects on known CHD risk factors such as plasma lipid levels. The heritability of plasma lipid levels (total cholesterol, LDL cholesterol, HDL cholesterol, and triglycerides (TG)) is estimated to be about 50% (ranging from 28%-78%). With the success of recent genome-wide association studies (GWAS), many genetic variants underlying intermediate risk factors of CHD (including plasma lipid levels) and CHD itself have been identified. Whether this new genetic information could be used to improve CHD risk prediction is still marginally explored, and for some variants, the underlying mechanisms for their mediated effects on CHD risk are still unknown. The aim of this research is to investigate common genetic determinants of plasma lipid levels (cholesterol and polyunsaturated fatty acid levels) using a pathway-driven approach, and to explore whether such common genetic variants could be used to improve CHD prediction using a population based genetic approach. An additional aim was to explore the underlying mechanisms of cardiovascular protective effects of PUFAs using a genomic approach. Methods In order to explore whether common genetic variants are involved in determining plasma cholesterol levels, we used data from 3575 men and women from the Doetinchem cohort, which was examined thrice over 11 years. They were genotyped on 384 single nucleotide polymorphisms (SNPs) across 251 genes in regulatory pathways that control fatty acid, glucose, cholesterol and bile salt homeostasis. In order to explore whether common genetic variants could be used to predict future CHD risk, we used the data from CAREMA cohort that involved 15,236 middle-aged subjects and was followed up for a median of 12.1 years. 179 SNPs associated with CHD or its risk factors in GWAS published up to May 2, 2011 were genotyped in the 2221 subcohort members and 742 incident CHD cases. In addition, fatty acids from plasma cholesteryl esters were quantified in 1323 subcohort members and 537 CHD cases. They were used to explore whether δ-5 and δ-6 desaturase activities were associated with CHD risk. In order to perform a comparative analysis of the effects of fenofibrate and fish oil at transcriptome and metabolome level, 34 mice were randomized by weight-matching into three groups (n = 10 in control group, and n = 12 in fenofibrate or fish oil intervention group), and fed a research diet supplemented with sunflower oil (containing 81.3% oleic acid, 7% energy intake) in control group, sunflower oil (7% energy intake) and fenofibrate (0.03% w/w) in fenofibrate group, and fish oil (Marinol C-38 fish oil: 23.1% EPA and 21.1% DHA, 7% energy intake) in fish oil group for 2 weeks. At the end of treatment, mice were fasted with drinking water available, and were subsequently sacrificed by cervical dislocation under isoflurane anesthesia. Blood was collected via orbital puncture. Livers were dissected, directly frozen in liquid nitrogen and stored at−80°C until further analysis. Microarray analysis was performed on individual mouse livers. The LC-MS method was used for measuring plasma lipids and non-esterified free fatty acids, and the GC-MS method was used for measuring a broad range of metabolites. Results In chapter 2, 3, and 4, common genetic variants in the genes along known cholesterol metabolic pathways, such as bile acid and bile metabolic pathways, the HDL cholesterol metabolic pathway, and the plasma total cholesterol metabolic pathway, are involved in determining plasma cholesterol levels. The modest effect associated with each individual variant, however, caused the amount of heritability explained by them in aggregate to be relatively small: 13 single nucleotide polymorphisms (SNPs) explained 4% of inter- individual variation in HDL cholesterol levels (Chapter 3), whereas 12 SNPs explained 6.9% of inter-individual variation in total cholesterol levels (Chapter 4). In chapter 5, we found that genetic variants in the FADS1 gene potentially interact with dietary PUFA intake to affect plasma cholesterol levels. A high intake of omega-3 PUFAs was associated with increased plasma non-HDL cholesterol levels, consistent with increased plasma LDL cholesterol levels observed in fish oil intervention studies. Increased LDL cholesterol levels could be due to hepatic downregulation of the LDL receptor gene (LDLR) in subjects with high omega-3 PUFA intakes. This is further confirmed by the findings described in Chapter 6 that the hepatic LDLR gene was significantly downregulated in fish oil treated mice. This study also confirmed PUFAs to be weak PPAR ligands. The increased plasma HDL cholesterol levels in the subjects with high PUFA intakes in Chapter 5 could be due to PPARs-mediated genes that are directly involved in HDL lipoprotein metabolism. All these may explain the changes in blood cholesterol levels upon PUFA intake observed in human studies. In Chapter 6, we found that not only downregulation in the hepatic lipogenic pathway but also upregulation in hepatic fatty acid oxidation pathways are involved in lowering plasma TG levels upon fish oil treatment. The striking parallel between fenofibrate and fish oil in hepatic downregulation of blood coagulation and fibrinolysis pathways suggest that hepatic activation of PPARα is potentially one of the mechanisms responsible for anticoagulation effects of fish oil treatment observed in humans. In Chapter 7, with confirmed effects of rs174547 in FADS1 on PUFA levels and δ-5 desaturase activities and also protective effects of DHA on CHD, we observed a reduced CHD risk of increased δ-5 desaturase activity. Increased δ-5 desaturase activity could contribute to the intracellular increase of EPA and especially arachidonic acid (C20:4n-6) levels. Despite the potential pro-coagulant and pro-inflammatory effects of increased exposures of arachidonic acid and its derived eicosanoid metabolites, there is no evidence of increased CHD risk with increased habitual arachidonic acid intake so far. Some of the oxygenated metabolites of arachidonic acid were found to have anti-inflammatory and pro- resolving actions. High dietary n-6 PUFA intakes or high plasma n-6 PUFA levels are associated with increased blood HDL cholesterol levels and reduced TG (or VLDL particle) levels. All these point to a potential cardiovascular protective effect of n-6 PUFAs. The fact that increased EPA and/or DHA levels associated with increased δ-5 desaturase activity protect against CHD is consistent with the current established cardiovascular protective effect of increased n-3 PUFA exposure, especially EPA and DHA. In Chapter 8, the current known common genetic variants associated with CHD risk factors (blood pressure, obesity, blood lipid levels, and type 2 diabetes) and CHD itself from published GWAS are examined to see whether they provide additional value in CHD risk prediction beyond established traditional CHD risk factors. We constructed several gene risk scores (GRS) for CHD that consisted of SNPs directly associated with CHD or intermediate CHD risk factors in GWAS, and tested their relationship to incident CHD and their potential to improve risk prediction. The weighted GRS based on 29 CHD SNPs predicted future CHD independently from established traditional risk factors.
Load more

Recommended publications
  • Impaired Hepatic Drug and Steroid Metabolism in Congenital Adrenal
    European Journal of Endocrinology (2010) 163 919–924 ISSN 0804-4643 CLINICAL STUDY Impaired hepatic drug and steroid metabolism in congenital adrenal hyperplasia due to P450 oxidoreductase deficiency Dorota Tomalik-Scharte1, Dominique Maiter2, Julia Kirchheiner3, Hannah E Ivison, Uwe Fuhr1 and Wiebke Arlt School of Clinical and Experimental Medicine, Centre for Endocrinology, Diabetes and Metabolism (CEDAM), University of Birmingham, Birmingham B15 2TT, UK, 1Department of Pharmacology, University Hospital, University of Cologne, 50931 Cologne, Germany, 2Department of Endocrinology, University Hospital Saint Luc, 1200 Brussels, Belgium and 3Department of Pharmacology of Natural Products and Clinical Pharmacology, University of Ulm, 89019 Ulm, Germany (Correspondence should be addressed to W Arlt; Email: [email protected]) Abstract Objective: Patients with congenital adrenal hyperplasia due to P450 oxidoreductase (POR) deficiency (ORD) present with disordered sex development and glucocorticoid deficiency. This is due to disruption of electron transfer from mutant POR to microsomal cytochrome P450 (CYP) enzymes that play a key role in glucocorticoid and sex steroid synthesis. POR also transfers electrons to all major drug- metabolizing CYP enzymes, including CYP3A4 that inactivates glucocorticoid and oestrogens. However, whether ORD results in impairment of in vivo drug metabolism has never been studied. Design: We studied an adult patient with ORD due to homozygous POR A287P, the most frequent POR mutation in Caucasians, and her clinically unaffected, heterozygous mother. The patient had received standard dose oestrogen replacement from 17 until 37 years of age when it was stopped after she developed breast cancer. Methods: Both subjects underwent in vivo cocktail phenotyping comprising the oral administration of caffeine, tolbutamide, omeprazole, dextromethorphan hydrobromide and midazolam to assess the five major drug-metabolizing CYP enzymes.
    [Show full text]
  • Variants of Lipid-Related Genes in Adult Japanese Patients with Severe Hypertriglyceridemia Akira Matsunaga1, Mariko Nagashima1, Hideko Yamagishi1 and Keijiro Saku2
    The official journal of the Japan Atherosclerosis Society and the Asian Pacific Society of Atherosclerosis and Vascular Diseases Original Article J Atheroscler Thromb, 2020; 27: 1264-1277. http://doi.org/10.5551/jat.51540 Variants of Lipid-Related Genes in Adult Japanese Patients with Severe Hypertriglyceridemia Akira Matsunaga1, Mariko Nagashima1, Hideko Yamagishi1 and Keijiro Saku2 1Department of Laboratory Medicine, Fukuoka University School of Medicine, Fukuoka, Japan 2Department of Cardiology, Fukuoka University School of Medicine, Fukuoka, Japan Aim: Hypertriglyceridemia is a type of dyslipidemia that contributes to atherosclerosis and coronary heart dis- ease. Variants in lipoprotein lipase (LPL), apolipoprotein CII (APOC2), apolipoprotein AV (APOA5), glyco- sylphosphatidylinositol-anchored high-density lipoprotein-binding protein 1 (GPIHBP1), lipase maturation fac- tor 1 (LMF1), and glucokinase regulator (GCKR) are responsible for hypertriglyceridemia. We investigated the molecular basis of severe hypertriglyceridemia in adult patients referred to the Clinical Laboratory at Fukuoka University Hospital. Methods: Twenty-three adult patients with severe hypertriglyceridemia (＞1,000 mg/dL, 11.29 mmol/L) were selected. The coding regions of candidate genes were sequenced by next-generation sequencing. Forty-nine genes reportedly associated with hypertriglyceridemia were analyzed. Results: In the 23 patients, we detected 70 variants: 28 rare and 42 common ones. Among the 28 rare variants with ＜1% allele frequency, p.I4533L in APOB,
    [Show full text]
  • Silencing of Phosphoinositide-Specific
    ANTICANCER RESEARCH 34: 4069-4076 (2014) Silencing of Phosphoinositide-specific Phospholipase C ε Remodulates the Expression of the Phosphoinositide Signal Transduction Pathway in Human Osteosarcoma Cell Lines VINCENZA RITA LO VASCO1, MARTINA LEOPIZZI2, DANIELA STOPPOLONI3 and CARLO DELLA ROCCA2 Departments of 1Sense Organs , 2Medicine and Surgery Sciences and Biotechnologies and 3Biochemistry Sciences “A. Rossi Fanelli”, Sapienza University, Rome, Italy Abstract. Background: Ezrin, a member of the signal transduction pathway (5). The reduction of PIP2 ezrin–radixin–moesin family, is involved in the metastatic induces ezrin dissociation from the plasma membrane (6). spread of osteosarcoma. Ezrin binds phosphatydil inositol-4,5- The levels of PIP2 are regulated by the PI-specific bisphosphate (PIP2), a crucial molecule of the phospholipase C (PI-PLC) family (7), constituting thirteen phosphoinositide signal transduction pathway. PIP2 levels are enzymes divided into six sub-families on the basis of amino regulated by phosphoinositide-specific phospholipase C (PI- acid sequence, domain structure, mechanism of recruitment PLC) enzymes. PI-PLCε isoform, a well-characterized direct and tissue distribution (7-15). PI-PLCε, a direct effector of effector of rat sarcoma (RAS), is at a unique convergence RAS (14-15), might be the point of convergence for the point for the broad range of signaling pathways that promote broad range of signalling pathways that promote the RAS GTPase-mediated signalling. Materials and Methods. By RASGTPase-mediated signalling (16). using molecular biology methods and microscopic analyses, In previous studies, we suggested a relationship between we analyzed the expression of ezrin and PLC genes after PI-PLC expression and ezrin (17-18).
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Synonymous Single Nucleotide Polymorphisms in Human Cytochrome
    DMD Fast Forward. Published on February 9, 2009 as doi:10.1124/dmd.108.026047 DMD #26047 TITLE PAGE: A BIOINFORMATICS APPROACH FOR THE PHENOTYPE PREDICTION OF NON- SYNONYMOUS SINGLE NUCLEOTIDE POLYMORPHISMS IN HUMAN CYTOCHROME P450S LIN-LIN WANG, YONG LI, SHU-FENG ZHOU Department of Nutrition and Food Hygiene, School of Public Health, Peking University, Beijing 100191, P. R. China (LL Wang & Y Li) Discipline of Chinese Medicine, School of Health Sciences, RMIT University, Bundoora, Victoria 3083, Australia (LL Wang & SF Zhou). 1 Copyright 2009 by the American Society for Pharmacology and Experimental Therapeutics. DMD #26047 RUNNING TITLE PAGE: a) Running title: Prediction of phenotype of human CYPs. b) Author for correspondence: A/Prof. Shu-Feng Zhou, MD, PhD Discipline of Chinese Medicine, School of Health Sciences, RMIT University, WHO Collaborating Center for Traditional Medicine, Bundoora, Victoria 3083, Australia. Tel: + 61 3 9925 7794; fax: +61 3 9925 7178. Email: [email protected] c) Number of text pages: 21 Number of tables: 10 Number of figures: 2 Number of references: 40 Number of words in Abstract: 249 Number of words in Introduction: 749 Number of words in Discussion: 1459 d) Non-standard abbreviations: CYP, cytochrome P450; nsSNP, non-synonymous single nucleotide polymorphism. 2 DMD #26047 ABSTRACT Non-synonymous single nucleotide polymorphisms (nsSNPs) in coding regions that can lead to amino acid changes may cause alteration of protein function and account for susceptivity to disease. Identification of deleterious nsSNPs from tolerant nsSNPs is important for characterizing the genetic basis of human disease, assessing individual susceptibility to disease, understanding the pathogenesis of disease, identifying molecular targets for drug treatment and conducting individualized pharmacotherapy.
    [Show full text]
  • Apoa5genetic Variants Are Markers for Classic Hyperlipoproteinemia
    CLINICAL RESEARCH CLINICAL RESEARCH www.nature.com/clinicalpractice/cardio APOA5 genetic variants are markers for classic hyperlipoproteinemia phenotypes and hypertriglyceridemia 1 1 1 2 2 1 1 Jian Wang , Matthew R Ban , Brooke A Kennedy , Sonia Anand , Salim Yusuf , Murray W Huff , Rebecca L Pollex and Robert A Hegele1* SUMMARY INTRODUCTION Hypertriglyceridemia is a common biochemical Background Several known candidate gene variants are useful markers for diagnosing hyperlipoproteinemia. In an attempt to identify phenotype that is observed in up to 5% of adults. other useful variants, we evaluated the association of two common A plasma triglyceride concentration above APOA5 single-nucleotide polymorphisms across the range of classic 1.7 mmol/l is a defining component of the meta­ 1 hyperlipoproteinemia phenotypes. bolic syndrome and is associated with several comorbidities, including increased risk of cardio­ Methods We assessed plasma lipoprotein profiles and APOA5 S19W and vascular disease2 and pancreatitis.3,4 Factors, –1131T>C genotypes in 678 adults from a single tertiary referral lipid such as an imbalance between caloric intake and clinic and in 373 normolipidemic controls matched for age and sex, all of expenditure, excessive alcohol intake, diabetes, European ancestry. and use of certain medications, are associated Results We observed significant stepwise relationships between APOA5 with hypertriglyceridemia; however, genetic minor allele carrier frequencies and plasma triglyceride quartiles. The factors are also important.5,6 odds ratios for hyperlipoproteinemia types 2B, 3, 4 and 5 in APOA5 S19W Complex traits, such as plasma triglyceride carriers were 3.11 (95% CI 1.63−5.95), 4.76 (2.25−10.1), 2.89 (1.17−7.18) levels, usually do not follow Mendelian patterns of and 6.16 (3.66−10.3), respectively.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name phospholipase C, delta 3 Gene Symbol PLCD3 Organism Human Gene Summary This gene encodes a member of the phospholipase C family which catalyze the hydrolysis of phosphatidylinositol 45-bisphosphate to generate the second messengers diacylglycerol and inositol 145-trisphosphate (IP3). Diacylglycerol and IP3 mediate a variety of cellular responses to extracellular stimuli by inducing protein kinase C and increasing cytosolic Ca(2+) concentrations. This enzyme localizes to the plasma membrane and requires calcium for activation. Its activity is inhibited by spermine sphingosine and several phospholipids. Gene Aliases MGC71172 RefSeq Accession No. NC_000017.10, NT_010783.15 UniGene ID Hs.380094 Ensembl Gene ID ENSG00000161714 Entrez Gene ID 113026 Assay Information Unique Assay ID qHsaCED0002601 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000539433, ENST00000322765 Amplicon Context Sequence TGTTGAGCACGTAGTCAGTCTCCTGCCGGGCACAGTCTGCGGGCACCCCATGG ATCTCAATGCGCACCAGGGGGTCCACAATGGAGTGTGGCTTCTCGGCATTCAGC TTGGGCAGCTGCTGTGC Amplicon Length (bp) 94 Chromosome Location 17:43190493-43190616 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 100 R2 1 cDNA Cq 21.75 cDNA Tm (Celsius) 86.5 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq 23.62 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report PLCD3, Human Amplification Plot Amplification of cDNA generated from
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2003/0082511 A1 Brown Et Al
    US 20030082511A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2003/0082511 A1 Brown et al. (43) Pub. Date: May 1, 2003 (54) IDENTIFICATION OF MODULATORY Publication Classification MOLECULES USING INDUCIBLE PROMOTERS (51) Int. Cl." ............................... C12O 1/00; C12O 1/68 (52) U.S. Cl. ..................................................... 435/4; 435/6 (76) Inventors: Steven J. Brown, San Diego, CA (US); Damien J. Dunnington, San Diego, CA (US); Imran Clark, San Diego, CA (57) ABSTRACT (US) Correspondence Address: Methods for identifying an ion channel modulator, a target David B. Waller & Associates membrane receptor modulator molecule, and other modula 5677 Oberlin Drive tory molecules are disclosed, as well as cells and vectors for Suit 214 use in those methods. A polynucleotide encoding target is San Diego, CA 92121 (US) provided in a cell under control of an inducible promoter, and candidate modulatory molecules are contacted with the (21) Appl. No.: 09/965,201 cell after induction of the promoter to ascertain whether a change in a measurable physiological parameter occurs as a (22) Filed: Sep. 25, 2001 result of the candidate modulatory molecule. Patent Application Publication May 1, 2003 Sheet 1 of 8 US 2003/0082511 A1 KCNC1 cDNA F.G. 1 Patent Application Publication May 1, 2003 Sheet 2 of 8 US 2003/0082511 A1 49 - -9 G C EH H EH N t R M h so as se W M M MP N FIG.2 Patent Application Publication May 1, 2003 Sheet 3 of 8 US 2003/0082511 A1 FG. 3 Patent Application Publication May 1, 2003 Sheet 4 of 8 US 2003/0082511 A1 KCNC1 ITREXCHO KC 150 mM KC 2000000 so 100 mM induced Uninduced Steady state O 100 200 300 400 500 600 700 Time (seconds) FIG.
    [Show full text]
  • Transcriptomic Uniqueness and Commonality of the Ion Channels and Transporters in the Four Heart Chambers Sanda Iacobas1, Bogdan Amuzescu2 & Dumitru A
    www.nature.com/scientificreports OPEN Transcriptomic uniqueness and commonality of the ion channels and transporters in the four heart chambers Sanda Iacobas1, Bogdan Amuzescu2 & Dumitru A. Iacobas3,4* Myocardium transcriptomes of left and right atria and ventricles from four adult male C57Bl/6j mice were profled with Agilent microarrays to identify the diferences responsible for the distinct functional roles of the four heart chambers. Female mice were not investigated owing to their transcriptome dependence on the estrous cycle phase. Out of the quantifed 16,886 unigenes, 15.76% on the left side and 16.5% on the right side exhibited diferential expression between the atrium and the ventricle, while 5.8% of genes were diferently expressed between the two atria and only 1.2% between the two ventricles. The study revealed also chamber diferences in gene expression control and coordination. We analyzed ion channels and transporters, and genes within the cardiac muscle contraction, oxidative phosphorylation, glycolysis/gluconeogenesis, calcium and adrenergic signaling pathways. Interestingly, while expression of Ank2 oscillates in phase with all 27 quantifed binding partners in the left ventricle, the percentage of in-phase oscillating partners of Ank2 is 15% and 37% in the left and right atria and 74% in the right ventricle. The analysis indicated high interventricular synchrony of the ion channels expressions and the substantially lower synchrony between the two atria and between the atrium and the ventricle from the same side. Starting with crocodilians, the heart pumps the blood through the pulmonary circulation and the systemic cir- culation by the coordinated rhythmic contractions of its upper lef and right atria (LA, RA) and lower lef and right ventricles (LV, RV).
    [Show full text]
  • Genes Regulating Cholesterol Metabolism
    GENES REGULATING CHOLESTEROL METABOLISM Chau Vu Bio 118 FUNCTIONS OF CHOLESTEROL Maintain membrane fluidity, facilitate trafficking and signaling of membrane- associated proteins Precursor for important metabolites LDL = low density lipoprotein HDL = high density lipoprotein High LDL atherosclerosis SYNTHESIS OF CHOLESTEROL Occurs in cytoplasm and microsomes acetyl-CoA – starting material Less than half from biosynthesis de novo liver 10% intestines 15% 5 major steps SYNTHESIS OF CHOLESTEROL REGULATION OF CHOLESTEROL Synthesis and dietary intake: Normal Adult: produce1g/day; consume 0.3g/day Pathway 1: LDL binds to receptors; receptor- ligand complex absorbed by endocytosis Pathway 2: cholesterol synthesized when intra-cellular levels are low Pathway 3: reduce HMG CoA reductase activity; excess cholesterol transported to the liver Involve many transcription factors, binding proteins, enzymes and receptors REGULATION OF CHOLESTEROL SYNTHESIS GAPS IN OUR UNDERSTANDING OF CHOLESTEROL METABOLISM Heritability of human plasma cholesterol levels ~ 50% to 70%. Known common genetic factors linked to cholesterol explain 5 to 7% of heritability common polymorphisms that modulate plasma cholesterol levels account for small portion STUDY 1: CHANGES IN THE EXPRESSION OF CHOLESTEROL METABOLISM-ASSOCIATED GENES IN HCV-INFECTED LIVER real time PCR Results (SREBP)-2 expression unchanged transcription protein, induces production of sterols; negative feedback loop low density lipoprotein receptor expression reduced by 90% in HCV
    [Show full text]
  • Robert Foti to Cite This Version
    Characterization of xenobiotic substrates and inhibitors of CYP26A1, CYP26B1 and CYP26C1 using computational modeling and in vitro analyses Robert Foti To cite this version: Robert Foti. Characterization of xenobiotic substrates and inhibitors of CYP26A1, CYP26B1 and CYP26C1 using computational modeling and in vitro analyses. Agricultural sciences. Université Nice Sophia Antipolis, 2016. English. NNT : 2016NICE4033. tel-01376678 HAL Id: tel-01376678 https://tel.archives-ouvertes.fr/tel-01376678 Submitted on 5 Oct 2016 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Université de Nice-Sophia Antipolis Thèse pour obtenir le grade de DOCTEUR DE L’UNIVERSITE NICE SOPHIA ANTIPOLIS Spécialité : Interactions Moléculaires et Cellulaires Ecole Doctorale : Sciences de la Vie et de la Santé (SVS) Caractérisation des substrats xénobiotiques et des inhibiteurs des cytochromes CYP26A1, CYP26B1 et CYP26C1 par modélisation moléculaire et études in vitro présentée et soutenue publiquement par Robert S. Foti Le 4 Juillet 2016 Membres du jury Dr. Danièle Werck-Reichhart Rapporteur Dr. Philippe Roche Rapporteur Pr. Serge Antonczak Examinateur Dr. Philippe Breton Examinateur Pr. Philippe Diaz Examinateur Dr. Dominique Douguet Directrice de thèse 1 1. Table of Contents 1. Table of Contents ..............................................................................................................................
    [Show full text]