sign in sign up
<<
Home , Cosmiomma, Pookode, Rhipicephalus

Int.J.Curr.Microbiol.App.Sci (2017) 6(8): 2304-2309

International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 6 Number 8 (2017) pp. 2304-2309 Journal homepage: http://www.ijcmas.com

Original Research Article https://doi.org/10.20546/ijcmas.2017.608.271

Molecular Confirmation of haemaphysaloides Infesting Ruminants in Wayanad, ,

Murikoli Nimisha1, Reghu Ravindran1*, Pradeep R. Kariyappa1, B. Mallappa Amrutha1, Prashant Somalingappa Kurbet1, Karapparambu Gopalan Ajith Kumar1, Anju Varghese1, Chundayil Kalarikkal Deepa1 and Sanis Juliet2

1Department of Veterinary Parasitology, College of Veterinary and Sciences, Pookode, Lakkidi, P.O., Wayanad-673576, Kerala, India 2Department of Veterinary Pharmacology and Toxicology, College of Veterinary and Animal Sciences, Pookode, Lakkidi, P.O., Wayanad-673576, Kerala, India *Corresponding author

ABSTRACT

Rhipicephalus haemaphysaloides is a prevalent multi host species with

K e yw or ds high vector potential in south India. There are several reports based on morphological identification of the tick species from various parts of the Rhipicephalus country. However, there were limited attempts for molecular confirmation haemaphysaloides , PCR, Phylogeny, of this tick species. In the present study, the presence of R. Wayanad, Kerala. haemaphysaloides in Wayanad, Kerala was confirmed by polymerase chain

Article Info reaction based on amplification of mitochondrial 16S rRNA gene and V4

region of 18S rRNA gene. Two tick samples, one engorged on a bovine Accepted: male calf of Pookode, Wayanad and other engorged on a sambar deer in 21 June 2017 Available Online: were used for the study. Phylogeny based on 16S rRNA and 18S 10 August 2017 rRNA of R. haemaphysaloides revealed genetic relatedness with Chinese

isolates of the tick species.

Introduction

Parasitic diseases are one of the major La Fuente et al., 2008). Tick infestation obstacles for the health of the , results in direct damages like reduction in thereby causing severe economic constraints milk yield and live weight and indirect effects globally are the obligate due to pathogen transmission and toxicosis haematophagousecto parasites of both resulting in paralysis, irritation and allergy livestock and humans. They were rank second (Aktas, 2014). after mosquitoes as vectors of human diseases. Ticks play an important role in the The direct injuries due to ixodid ticks are transmission of various pathogens like severe in tropical climate (Ghosh and Nagar, bacteria, viruses, protozoa and helminths, 2014). There is a recent surge in studies many of which have zoonotic significance (de regarding tick and tick borne diseases due to

2304

Int.J.Curr.Microbiol.App.Sci (2017) 6(8): 2304-2309 the changes in tick distribution mainly template for the polymerase chain reaction contributed by the changes in climate (PCR). Molecular confirmation of tick species (Jaensonet al., 2009). According to Burger et was done by PCR amplification of al., (2014), 904 tick species were identified mitochondrial 16S rRNA gene and V4 region globally. Almost 80 per cent of the tick of 18S rRNA gene (Crampton et al., 1996; species comes under the family or Kumar et al., 2011). The primer sequences for hard ticks (705 species). Family or PCR amplification are mentioned in table 1. soft ticks contain 198 species and one under the family Nuttalliellidae. Amplified PCR products were analyzed by gel electrophoresis using 1.5 per cent agarose India is home for approximately 109 tick gel. PCR amplified products were sequenced species, under 12 genera (Ghosh et al., at Sci. Genome Pvt. Ltd., Cochin and the 2007).The climatic conditions in India are sequence data were BLAST analyzed. highly favorable for the propagation of ticks. Most predominant tick species identified in Phylogenetic analysis was performed for both India belong to the Rhipicephalus and 16S rRNA and 18S rRNA genesby Neighbor- (Ghosh et al., 2007). joining tree method using Mega 7. Nucleotide sequences were aligned by Clustal W for The prevalence of Rhipicephalus analysis. Akaike information criterion haemaphysaloides based on morphological implemented in MEGA 7.0 was used to identification was recorded from various parts determine the best fitting models. The of India including Kerala (Geevarghese and evolutionary distances were computed using Dhanda, 1995; Rajendran and Hafeez, 2003; Tamura 3-parameter method and Jukes- Prakasan and Ramani, 2007; Soundararajan et Cantor method for 16S rRNA and 18S rRNA al., 2014). However, they were no studies respectively. regarding the molecular confirmation of the tick species. In the present study, molecular Results and Discussion confirmation of R. haemaphysaloides was performed using ticks collected from Tick isolates from Pookode and Meppadi Wayanad, a northern district of Kerala. were morphologically identified as R. haemaphysaloides. Molecular analysis of tick Materials and Methods mitochondrial16S rRNA gene of Pookode and Meppadi isolates revealed 95 per cent and 93 Tick samples were collected froma bovine per cent identity respectively with R. male Calffrom College of Veterinary and haemaphysaloides (AY972534) from China. Animal Sciences, Pookode, Wayanad. Another isolate was collected from a sambar BLAST analysis of 18S rRNA sequence of deer from Meppadi, Wayanad. Ticks were Pookode and Meppadi isolate showed 96 per morphologically identified (Arthur, 1960) and cent and 100 per cent identity respectively stored in -80°C until RNA extractionwas with R. haemaphysaloides (DQ839552) from performed. RNA extraction was done using China. The sequences were submitted to Gen RNeasy Mini Kit (Qiagen, Netherlands) based Bankto obtain accession numbers. Pookode on the manufacture’s protocols. Synthesis of isolate was assigned with accession numbers, cDNA was performed by Revert Aid H minus KU895511 and KU895510 for 16S rRNA and First strand cDNA synthesis kit (Thermo 18S rRNA respectively. Similarly, Meppadi Scientific, USA). This cDNA was used as isolate was assigned with accession numbers

2305

Int.J.Curr.Microbiol.App.Sci (2017) 6(8): 2304-2309

MF351994 and MF351848 for 16S rRNA and haemaphysaloidesis usually prevalent in 18S rRNA respectively. Oriental, Australasian and Palearctic zoogeographic regions with wide host range. Phylogenetic analysis of mitochondrial16S The usual hosts of these ticks are birds and rRNA revealed that both Pookode and mammals including humans (Guglielmone et Meppadi isolates of ticks were genetically al., 2014). R. haemaphysaloides is one of the closely related. Also, both shared identity most abundant cattle ticks in Sri Lanka (Diyes with Chinese and Thailand isolates of R. and Rajakaruna, 2015). Rajendran and Hafeez haemaphysaloides. Based on evolutionary (2003) reported a prevalence of 3.29 per cent analysis of 18S rRNA, Pookode isolate of R. for R. haemaphysaloides among crossbred haemaphysaloides was more ancestral to both cattle of Andhra Pradesh. Soundararajan et Meppadi and Chinese isolates (Figs. 1 and 2). al., (2014) recorded a prevalence of 3.13 per cent in goats of Tamil Nadu. Prakasan and In the present study, the presence of R. Ramani (2007) reported R. haemaphysaloides haemaphysaloides in Wayanad was from cattle, buffalo, goat and pigs in Kerala. confirmed by molecular techniques. R.

Fig.1 Molecular phylogeny based on 16S r RNA. The evolutionary history was inferred using the Neighbor-Joining method. The optimal tree with the sum of branch length = 0.56035004 is shown. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) is shown next to the branches. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Tamura 3-parameter method and are in the units of the number of base substitutions per site. The rate variation among sites was modeled with a gamma distribution (shape parameter = 1). The analysis involved 14 nucleotide sequences

100 KU895511 R. haemaphysaloides 16S rRNA Pookode isolate India

93 MF351994 R. haemaphysaloides 16S rRNA Meppadi isolate India KU664522 R. haemaphysaloides 16S rRNA China 97 100 KC170743 R. haemaphysaloides 16S rRNA Thailand KC170744 R. sanguineus 16S rRNA Thailand

42 KY069269 R. turanicus 16S rRNA China 100 KU183524 R. turanicus 16S rRNA China

100 KP210048 H. anatolicum excavatum 16S rRNA Haryana India KP210065 H. detritum detritum 16S rRNA Haryana India

49 KP210050 R. sanguineus 16S rRNA Haryana India

100 HM536970 R. microplus 16S rRNA Punjab India 52 GU323288 R. microplus 16S rRNA UP India KY458970 H. bispinosa 16S rRNA India 100 KC853420 H. bispinosa 16S rRNA India

2306

Int.J.Curr.Microbiol.App.Sci (2017) 6(8): 2304-2309

Fig.2 Molecular phylogeny based on 18S rRNA. The evolutionary history was inferred using the Neighbor-Joining method. The optimal tree with the sum of branch length = 1.67598566 is shown. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) is shown next to the branches. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Jukes-Cantor method and are in the units of the number of base substitutions per site. The analysis involved 11 nucleotide sequences

KC769615 R. microplus 18S rRNA Cambodia

JX051044 H. anatolicum 18S rRNA China

42 KC769619 R. microplus 18S rRNA Brazil

DQ839552 R. haemaphysaloides 18S rRNA China 30

MF351848 R. haemaphysaloides 18S rRNA Meppadi isolate India

40 KU895510 R. haemaphysaloides 18S rRNA Pookode isolate India

KU198407 R. sanguineus 18S rRNA Egypt 20

50 JX051052 H. anatolicum 18S rRNA China

JQ346681 H. longicornis 18S rRNA China

JQ346680 H. longicornis 18S rRNA China

KY799085 R. sanguineus 18S rRNA Nigeria

Table.1 Primers used for amplification of 16S r RNA and 18 S rRNA from ticks Sl. Gene Primers Amplicon Reference No. length Ticks 16S ribosomal Forward-5’ Kumar et RNA gene TIR CCGGTCTGAACTCAGATCAAGT 3’ 450bp al., (2011) Reverse- 5’ GCTCAATGATTTTTTAAATTGCTG3’ Ticks V4 region of 18S Forward- 5’ Crampon ribosomal RNA GGAGGGCAAGTCTGGTGC 3’ 338bp et al., gene TV4 Reverse- 5’ (1996) CCATACAAATGCCCCCGTCTG 3’

2307

Int.J.Curr.Microbiol.App.Sci (2017) 6(8): 2304-2309

R. haemaphysaloides is having both medical Kyasanur Forest disease virus by and veterinary significance as they can act as Rhipicephalus haemaphysaloides ticks. vector for various pathogens. Laboratory ActaVirol, 22: 241-244. studies revealed their role in the transmission Burger, T. D., Shao, R., Labruna, M. B. and of Rickettsia (Hsu et al., 2011). Tsui et al., Barker, S. C. 2014. Molecular (2007) detected spotted fever group rickettsial phylogeny of soft ticks (Ixodida: organism in R. haemaphysaloides using Argasidae) inferred from mitochondrial molecular methods in Taiwan. Experimental genome and nuclear rRNA sequences. transtadial transmission of Babesia microti Ticks Tick Borne Dis., 5:195-207. through R. haemaphysaloides in southern Crampton, A., Mckay, I. and Barker, S. C. China was also reported (Li et al., 2016). Bhat 1996. Phylogeny of ticks (Ixodida) et al., (1978) confirmed the role of R. inferred from nuclear ribosomal DNA. haemaphysaloides for the transmission of Int. J. Parasitol., 26: 511-517. Kyasanur forest disease (KFD). Thus, the De La Fuente, J., Estrada-Pena, A., Venzal, presence of R. haemaphysaloides in Wayanad J.M., Kocan, K. M. andSonenshine, D. and its wide vector potential indicated the E. 2008. Overview: Ticks as vectors of increased risk for both animals and humans in pathogens that cause disease in humans the area. and animals. Front. Biosci, 13: 6938- 6946. Acknowledgement Diyes, G. C. P. and Rajakaruna, R. S. 2015. Diversity and distribution of tick Financial supports from Indian Council of species infesting goats with two new Agricultural Research through research host records from Sri Lanka. projects (NAIP/Com-4/C2066/2007-2008, J.Natn.Sci.Foundation Sri Lanka, 43 NFBSFARA/BSA-4004/2013-14, NASF/ (3): 225-234. ABA-6015/2016-17, No.7 (2)/‐ 2011‐ EPD), Geevarghese, G. and Dhanda, V. 1995. Ixodid Department of Animal Husbandry, Kerala ticks of Maharashtra state, (B2-8401/08/Plg) and Kerala State Council India.Acarologia, 36(4): 309-313. for Science, Technology and Environment Ghosh, S., Azhahianambi, P. and Yadav, M. (022/YIPB/ KBC/2013/CSTE, 010- P. 2007. Upcoming and future strategies 14/SARD/13/CSTE) are thankfully of tick control: a review. J. Vector acknowledged. Borne. Dis., 44: 79-89. Ghosh, S. and Nagar, G. 2014. Problem of References ticks and tick-borne diseases in India with special emphasis on progress in Arthur, D. R. 1960. Ticks: A monograph of tick control research: A review. J. the Ixodidae part V. On the genera Vector Borne Dis., 51: 259-270. , Anocentor, , Guglielmone, A. A., Robbins, R. G., Boophilusand Margaropus, Cambridge Apanaskevich, D. A., Petney, T. N., UniversityPress, London. 251pp. Estrada-Peña, A. and Horak, I. G. 2014. Aktas, M. 2014. A survey of ixodid tick The hard ticks of the world (: species and molecular identification of Ixodida:Ixodidae). Springer, 8: 738 pp. tick-borne pathogens. Vet. Parasitol, Hsu, Y. M., Lin, C. C., Chomel, B. B., Tsai, 200:276-283. K. H., Wu, W. J., Huang, C. G. and Bhat, H. R., Naik, S. V., Ilkal, M. A. and Chang, C. C. 2011. Identification of Banerjee, K. 1978. Transmission of Rickettsia felisin fleas but not ticks on

2308

Int.J.Curr.Microbiol.App.Sci (2017) 6(8): 2304-2309

stray cats and dogs and the evidence of Zhou, X. 2016. Experimental Rickettsia rhipicephalionly in adult transmission of Babesiamicroti by stage of and Rhipicephalus haemaphysaloides. Rhipicephalus haemaphysaloides. Parasit. Vectors, 9: 231-236. Comp. Immunol. Microbiol. Infect. Dis., Prakasan, K. and Ramani, N. 2007. Tick 34: 513-518. parasites of domestic animals of Kerala, Jaenson, T. G., Eisen, L., Comstedt, P., South India. Asian J. Anim. Vet. Adv., Mejlon, H. A., Lindgren, E., Bergström, 2(2): 74-80. S. and Olsen, B. 2009. Risk indicators Soundararajan, C., Latha, B. R. and Pandian, for the tick Ixodesricinusand S. S. 2014. Prevalence of tick Borreliaburgdorferisensulato in infestation in goats under different Sweden. Med. Vet. Entomol, 23 (3): system of management. Int. J. Agric. 226-237. Sci. & Vet. Med., 2(3):4-9. Kumar, R., Paul, S., Kumar, S., Sharma, A. Rajendran, C. and Hafeez, M. D. 2003. K., Gupta, S., Rawat, A. K. S., Prevalence of ixodid ticks on crossbred Chaudhuri, P., Ray, D. D. and Ghosh, S. cattle in and around Tirupati. J. Vet. 2011. Detection of specific nucleotide Parasitol, 17: 147-149. changes in the hypervariable region of Tsui, P., Tsai, K., Weng, M., Hung, Y., Liu, 16S rDNA gene of Rhipicephalus Y., Hu, K., Lien, J., Lin, P., Shaio, M., (Boophilus) microplus and Hyalomma Wang, H. and Ji, D. 2007. Molecular analoticum anatolicum. Indian J. Anim. detection and characterization of spotted Sci., 81: 1204-1207. fever group Rickettsia in Taiwan. Am. J. Li, L., Zhu, D., Zhang, C., Zhang, Y. and Trop. Med. Hyg., 77(5): 883–890.

How to cite this article:

Murikoli Nimisha, Reghu Ravindran, Pradeep R. Kariyappa, B. Mallappa Amrutha, Prashant Somalingappa Kurbet, Karapparambu Gopalan Ajith Kumar, Anju Varghese, Chundayil Kalarikkal Deepa and Sanis Juliet. 2017. Molecular Confirmation of Rhipicephalus haemaphysaloides Infesting Ruminants in Wayanad, Kerala. Int.J.Curr.Microbiol.App.Sci. 6(8): 2304-2309. doi: https://doi.org/10.20546/ijcmas.2017.608.271

2309