Blueprint Genetics Bleeding Disorder/Coagulopathy Panel

Home , Coagulopathy, Dysfibrinogenemia, Gray platelet syndrome, MCFD2, Thrombocythemia, Thrombocytopenia

Bleeding Disorder/Coagulopathy Panel

Test code: HE1301

Is a 71 gene panel that includes assessment of non-coding variants.

Is ideal for patients with a clinical suspicion of an inherited bleeding disorder.

Is not recommended for patients with a suspicion of severe Hemophilia A if the common inversions are not excluded by previous testing. An intron 22 inversion of the F8 gene is identified in 43%-45% individuals with severe hemophilia A and intron 1 inversion in 2%-5% (GeneReviews NBK1404; PMID:8275087, 8490618, 29296726, 27292088, 22282501, 11756167). This test does not detect reliably these inversions.

About Bleeding Disorder/Coagulopathy

Bleeding disorder refers to a heterogenous group of diseases caused by deficiencies in platelet function or coagulation factors. The bleeding disorders can be categorized into three groups: 1) the common inherited bleeding disorders, hemophilia A, B, and von Willebrand disease (VWD); (2) the rare inherited coagulation factor deficiencies; and (3) inherited platelet disorders (PMID: 24124085). VWD is the most common inherited bleeding disorder, affecting up to 1% of the general population and occuring with equal frequency among men and women. The phenotypes that are covered by the panel include VWD, hemophilia A and B, rare bleeding disorders, Hermansky Pudlak syndrome, Wiskott-Aldrich syndrome, Bernard Soulier syndrome, Glanzmann disease, thrombocytopenia 2, familial platelet syndrome with predisposition to acute myelogenous leukemia and gray platelet syndrome. The molecular knowledge gained from genetic testing is currently routinely used in the clinical care of the patients with hereditary bleeding disorder.

Availability

4 weeks

Gene Set Description

Genes in the Bleeding Disorder/Coagulopathy Panel and their clinical significance Gene Associated phenotypes Inheritance ClinVar HGMD

ABCG5 Sitosterolemia AR 13 42

ABCG8 Sitosterolemia AR 18 44

ACTN1 Bleeding disorder, platelet- AD 7 25

ADAMTS13 Schulman-Upshaw syndrome, Thrombotic thrombocytopenic purpura, AR 30 183 familial

ANKRD26 Thrombocytopenia AD 6 21

AP3B1 Hermansky-Pudlak syndrome AR 14 34

ARPC1B Platelet abnormalities with eosinophilia and immune-mediated AR 2 4 inflammatory disease

BLOC1S3 Hermansky-Pudlak syndrome AR 2 4

BLOC1S6 Hermansky-Pudlak syndrome AR 1 2

CYCS* Thrombocytopenia AD 2 3

https://blueprintgenetics.com/ DTNBP1 Hermansky-Pudlak syndrome AR 2 3

EFL1 Shwachman-Diamond syndrome 3 2

ETV6 Thrombocytopenia 5 AD 10 38

F10 Factor X deficiency AR 15 155

F11 Factor XI deficiency AD/AR 77 271

F12 Angioedema, Factor XII deficiency AD/AR 7 53

F13A1 Factor XIIIA deficiency AR 20 180

F2 Thrombophilia due to thrombin defect, Prothrombin deficiency, AD/AR 14 66 congenital

F5 Factor V deficiency, Thrombophilia due to activated protein C AD/AR 19 157 resistance

F7 Factor VII deficiency AR 27 322

F8* Hemophilia A XL 296 3205

F9 Hemophilia B, Warfarin sensitivity, Thrombophilia, due to factor IX XL 117 1281 defect

FGA Afibrinogenemia, congenital, Dysfibrinogenemia, congenital, AD/AR 10 144 Hypodysfibrinogenemia, congenital, Familial visceral amyloidosis

FGB Afibrinogenemia, congenital, Dysfibrinogenemia, congenital, AD/AR 6 92 Hypodysfibrinogenemia, congenital

FGG Afibrinogenemia, congenital, Hypodysfibrinogenemia, AD/AR 7 127 Dysfibrinogenemia, congenital, Hypodysfibrinogenemia, congenital

FLI1 Thrombocytopenia, Paris-Trousseau type, Bleeding disorder, platelet AD 7 7 type 21

FLNA Frontometaphyseal dysplasia, Osteodysplasty Melnick-Needles, XL 133 257 Otopalatodigital syndrome type 1, Otopalatodigital syndrome type 2, Terminal osseous dysplasia with pigmentary defects

FYB Thrombocytopenia 3 AR 2 2

GATA1 Anemia, without thrombocytopenia, Thrombocytopenia with beta- XL 21 15 thalessemia,, Dyserythropoietic anemia with thrombocytopenia

GBA* Gaucher disease AR 84 488

GFI1B Bleeding disorder, platelet-type, 17 AD 6 9

GGCX Pseudoxanthoma elasticum-like disorder with multiple coagulation AD/AR/Digenic 13 42 factor deficiency, Vitamin K-dependent clotting factors, combined deficiency

GP1BA Pseudo-von Willebrand disease, Bernard-Soulier syndrome AD/AR 9 73

GP1BB Giant platelet disorder, isolated, Bernard-Soulier syndrome AD/AR 5 53

GP9 Bernard-Soulier syndrome AR 6 42

https://blueprintgenetics.com/ HOXA11 Radioulnar synostosis with amegakaryocytic thrombocytopenia AD 1 1

HPS1* Hermansky-Pudlak syndrome AR 28 55

HPS3* Hermansky-Pudlak syndrome AR 10 17

HPS4 Hermansky-Pudlak syndrome AR 16 22

HPS5 Hermansky-Pudlak syndrome AR 20 31

HPS6 Hermansky-Pudlak syndrome AR 13 37

ITGA2 Fetal and neonatal alloimmune thrombocytopenia AD/AR 5

ITGA2B Glanzmann thrombasthenia AD/AR 22 234

ITGB3 Bleeding disorder, platelet-, Thrombocytopenia, neonatal alloimmune, AD/AR 18 165 Glanzmann thrombasthenia

LMAN1 Combined factor V and VIII deficiency AR 5 37

MASTL Thrombocytopenia AD 5

MCFD2 Factor V & Factor VIII, combined deficiency of AR 8 20

MECOM Radioulnar synostosis with amegakaryocytic thrombocytopenia 2 AD 3 27

MPL Thrombocythemia, Amegakaryocytic thrombocytopenia AD/AR 23 55

MYH9 Sebastian syndrome, May-Hegglin anomaly, Epstein syndrome, AD 25 117 Fechtner syndrome, Macrothrombocytopenia and progressive sensorineural deafness, Deafness, autosomal dominant 17

NBEAL2 Gray platelet syndrome AR 10 51

P2RY12 Bleeding disorder, platelet- AD/AR 4 13

PRKACG Bleeding disorder, platelet-type, 19 AR 1 1

PROC Thrombophilia, hereditary AD/AR 36 387

PROS1* Thrombophilia, hereditary AD/AR 23 416

RASGRP2 Bleeding disorder, platelet-type, 18 AR 3 20

RBM8A*,# Thrombocytopenia - absent radius AD/AR 5 12

RUNX1 Platelet disorder, familial, with associated myeloid malignancy AD 47 101

SERPINC1 Antithrombin III deficiency AD/AR 44 412

SERPINF2 Alpha-2-plasmin inhibitor deficiency AD/AR 4 8

SLFN14 Thrombocytopenia AD/AR 4 4

SRC Thrombocytopenia, autosomal dominant, 6 AD 2 1

SRP54 Shwachman-Diamond syndrome AD 3

TBXA2R Bleeding disorder, platelet- AD 1 6

https://blueprintgenetics.com/ THBD Thrombophilia due to thrombomodulin defect, Hemolytic uremic AD 5 28 syndrome, atypical

THPO Thrombocythemia 1 AD 5 10

TUBB1 Macrothrombocytopenia AD 2 7

VKORC1 Drug metabolism, VKORC1-related, Vitamin K-dependent clotting AD/AR 4 27 factors, combined deficiency

VWF* Von Willebrand disease AD/AR 57 1009

WAS Neutropenia, severe congenital, Thrombocytopenia, Wiskott-Aldrich XL 57 439 syndrome

WIPF1 Wiskott-Aldrich syndrome 2 AR 2 3

*Some regions of the gene are duplicated in the genome. Read more.

# The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.

Non-coding disease causing variants covered by the panel

Gene Genomic HGVS RefSeq RS-number location HG19

ANKRD26 Chr10:27389371 c.-116C>G NM_014915.2

ANKRD26 Chr10:27389373 c.-118C>A NM_014915.2

ANKRD26 Chr10:27389374 c.-119C>A NM_014915.2

ANKRD26 Chr10:27389374 c.-119C>A/G NM_014915.2

ANKRD26 Chr10:27389376 c.-121A>C NM_014915.2

ANKRD26 Chr10:27389380 c.-127_-126delAT NM_014915.2

ANKRD26 Chr10:27389381 c.-126T>C NM_014915.2

ANKRD26 Chr10:27389381 c.-126T>G NM_014915.2

ANKRD26 Chr10:27389382 c.-127A>G NM_014915.2

ANKRD26 Chr10:27389382 c.-127A>T NM_014915.2

ANKRD26 Chr10:27389383 c.-128G>T NM_014915.2

https://blueprintgenetics.com/ ANKRD26 Chr10:27389383 c.-128G>A NM_014915.2

ANKRD26 Chr10:27389383 c.-128G>C NM_014915.2

ANKRD26 Chr10:27389389 c.-134G>A NM_014915.2 rs863223318

F11 Chr4:187186995 c.-456G>A NM_000128.3

F11 Chr4:187197061 c.595+11A>G NM_000128.3 rs534170853

F11 Chr4:187205426 c.1304+12G>A NM_000128.3 rs116667976

F12 Chr5:176836590 NM_000505.3 rs187018744

F13A1 Chr6:6320800 c.-19_-19+19delGGTAAGCCACCGACCCTGCA NM_000129.3

F2 Chr11:46742048 c.241-25C>G NM_000506.3

F2 Chr11:46761055 c.*97G>A NM_000506.4 rs1799963

F2 Chr11:46761064 c.*106T>A NM_000506.3

F2 Chr11:46761066 c.*108C>T NM_000506.3 rs562369397

F5 Chr1:169494158 c.5717-12T>A NM_000130.4

F5 Chr1:169521527 c.1296+268A>G NM_000130.4

F5 Chr1:169521984 c.1119-12C>G NM_000130.4

F7 Chr13:113760060 c.-96C>T NM_000131.4

F7 Chr13:113760062 c.-94C>G NM_000131.4

F7 Chr13:113760091 c.-65G>C NM_000131.4

F7 Chr13:113760094 NM_000131.4

F7 Chr13:113760094 c.-62C>T NM_000131.4

F7 Chr13:113760095 c.-61T>G NM_000131.4

F7 Chr13:113760096 NM_000131.4

F7 Chr13:113760097 c.-59T>G NM_000131.4

F7 Chr13:113760099 c.-57C>T NM_000131.4

F7 Chr13:113760101 NM_000131.4

F7 Chr13:113760112 c.-44T>C NM_000131.4 rs577393666

F7 Chr13:113760117 c.-39A>G NM_000131.4

F7 Chr13:113760124 c.-32A>C NM_000131.4 rs761212787

F7 Chr13:113760126 c.-30A>C NM_000131.4 rs539578931

https://blueprintgenetics.com/ F7 Chr13:113764993 c.131-11G>A NM_000131.4

F7 Chr13:113766228 c.291+1065delC NM_000131.4

F7 Chr13:113770192 c.571+78G>A NM_000131.4 rs764741909

F7 Chr13:113771068 c.572-12T>A NM_000131.4

F8 ChrX:154084603 c.6900+4104A>T NM_000132.3

F8 ChrX:154091516 c.6430-14A>G NM_000132.3

F8 ChrX:154130453 c.5999-11G>A NM_000132.3 rs782132907

F8 ChrX:154130463 c.5999-23_5999-22delCT NM_000132.3

F8 ChrX:154130464 c.5999-33_5999-22delGAAATAATTTCTinsATTC NM_000132.3

F8 ChrX:154130469 c.5999-33_5999-28delGAAATA NM_000132.3

F8 ChrX:154130719 c.5999-277G>A NM_000132.3

F8 ChrX:154131240 c.5999-798G>A NM_000132.3

F8 ChrX:154132376 c.5816-14_5816-13delGTinsTA NM_000132.3

F8 ChrX:154132397 c.5816-34A>T NM_000132.3 rs782301004

F8 ChrX:154132892 c.5587-93C>T NM_000132.3

F8 ChrX:154134863 c.5220-16_5220-15insA NM_000132.3

F8 ChrX:154174820 c.2113+1152delA NM_000132.3

F8 ChrX:154175961 c.2113+12T>A NM_000132.3

F8 ChrX:154176219 c.1904-37G>A NM_000132.3 rs367615232

F8 ChrX:154185464 c.1538-18G>A NM_000132.3

F8 ChrX:154189025 c.1537+325A>G NM_000132.3

F8 ChrX:154189458 c.1444-15C>A NM_000132.3

F8 ChrX:154197841 c.788-14T>G NM_000132.3

F8 ChrX:154213089 c.671-11T>C NM_000132.3

F8 ChrX:154215591 c.602-11T>G NM_000132.3

F8 ChrX:154215612 c.602-32A>G NM_000132.3

F8 ChrX:154219579 c.601+1632G>A NM_000132.3 rs387906429

F8 ChrX:154221439 c.389-16T>G NM_000132.3

F8 ChrX:154227886 c.144-11T>G NM_000132.3

F8 ChrX:154227901 c.144-26A>T NM_000132.3

F8 ChrX:154238632 c.144-10758_144-10757insTATA NM_000132.3

https://blueprintgenetics.com/ F8 ChrX:154249118 c.143+1567A>G NM_000132.3

F8 ChrX:154250939 c.-112G>A NM_000132.3 rs1317271565

F8 ChrX:154251045 c.-218T>C NM_000132.3

F8 ChrX:154251045 NM_000132.3

F8 ChrX:154251046 c.-219C>T NM_000132.3

F8 ChrX:154251048 c.-221T>A NM_000132.3

F8 ChrX:154251082 c.-255A>G NM_000132.3

F8 ChrX:154251084 c.-257T>C/G NM_000132.3

F8 ChrX:154251084 NM_000132.3

F8 ChrX:154251687 c.-860A>G NM_000132.3

F8 ChrX:154251793 c.-966G>T NM_000132.3

F9 ChrX:138612869 c.-55G>A/C/T NM_000133.3

F9 ChrX:138612869 NM_000133.3

F9 ChrX:138612871 c.-53A>G NM_000133.3

F9 ChrX:138612871 NM_000133.3

F9 ChrX:138612872 c.-52C>G/T NM_000133.3

F9 ChrX:138612872 NM_000133.3

F9 ChrX:138612874 c.-50T>C/G NM_000133.3

F9 ChrX:138612874 NM_000133.3

F9 ChrX:138612875 c.-49T>A/C NM_000133.3

F9 ChrX:138612875 NM_000133.3

F9 ChrX:138612875 NM_000133.3 rs1178811105

F9 ChrX:138612876 c.-48G>C NM_000133.3

F9 ChrX:138612886 c.-38A>G NM_000133.3

F9 ChrX:138612889 c.-35G>A/C NM_000133.3

F9 ChrX:138612889 NM_000133.3 rs1166164399

https://blueprintgenetics.com/ F9 ChrX:138612889 NM_000133.3

F9 ChrX:138612890 c.-34A>G/T NM_000133.3

F9 ChrX:138612890 NM_000133.3

F9 ChrX:138612899 c.-22delT NM_000133.3

F9 ChrX:138612900 c.-24T>A NM_000133.3

F9 ChrX:138612901 c.-23T>C NM_000133.3

F9 ChrX:138612902 c.-22T>C NM_000133.3

F9 ChrX:138612903 c.-21C>G NM_000133.3

F9 ChrX:138612905 c.-19C>G NM_000133.3

F9 ChrX:138612905 c.-17delA NM_000133.3

F9 ChrX:138612906 c.-18A>G/T NM_000133.3

F9 ChrX:138612906 c.-18A>T NM_000133.3

F9 ChrX:138612906 c.-18A>G NM_000133.3

F9 ChrX:138612907 c.-17A>C/G NM_000133.3

F9 ChrX:138612907 c.-17A>C NM_000133.3

F9 ChrX:138612907 c.-17A>G NM_000133.3

F9 ChrX:138619496 c.253-25A>G/T NM_000133.3

F9 ChrX:138619496 c.253-25A>T NM_000133.3

F9 ChrX:138619496 c.253-25A>G NM_000133.3 rs1201753038

F9 ChrX:138619501 c.253-19_253-16delCTTC NM_000133.3

F9 ChrX:138619502 c.253-16_253-12delCTTTT NM_000133.3

F9 ChrX:138623222 c.278-13A>G NM_000133.3

F9 ChrX:138623223 c.278-12C>G/T NM_000133.3

F9 ChrX:138623223 c.278-12C>G NM_000133.3

F9 ChrX:138623223 c.278-12C>T NM_000133.3 rs1475223858

F9 ChrX:138630499 c.392-22_392-21delCT NM_000133.3

F9 ChrX:138630663 c.520+13A>G NM_000133.3

F9 ChrX:138633441 c.723+18T>A NM_000133.3

F9 ChrX:138645387 c.*1157A>G NM_000133.3

F9 ChrX:138645598 c.*1368A>G NM_000133.3

https://blueprintgenetics.com/ FGB Chr4:155486360 c.115-600A>G NM_005141.4

FGB Chr4:155490472 c.958+13C>T NM_005141.4 rs606231223

FGG Chr4:155527225 c.1129+632A>G NM_021870.2 rs2066862

FGG Chr4:155527787 c.1129+66_1129+69delAATA NM_021870.2 rs139788771

FGG Chr4:155530122 c.667-320A>T NM_021870.2

FLNA ChrX:153581587 c.6023-27_6023-16delTGACTGACAGCC NM_001110556.1

GATA1 ChrX:48649496 c.-19-2A>G NM_002049.3

GBA Chr1:155205646 c.1225-14_1225-11delTGTCinsAGT NM_000157.3

GBA Chr1:155208109 c.589-12C>G NM_000157.3

GBA Chr1:155211053 c.-150A>G NM_000157.3 rs1232943445

GP1BB Chr22:19710933 c.-160C>G NM_000407.4 rs730882059

HPS3 Chr3:148888270 c.2888-1612G>A NM_032383.3 rs281865096

ITGA2B Chr17:42449567 c.*165T>C NM_000419.3

ITGA2B Chr17:42455177 c.2095-19T>A NM_000419.3

ITGA2B Chr17:42458507 c.1211-78A>G NM_000419.3

ITGA2B Chr17:42463181 c.408+11C>A NM_000419.3

ITGA2B Chr17:42470923 c.-4082G>A NM_000419.3

LMAN1 Chr18:57014710 c.822+34_822+35insGTTG NM_005570.3

PROC Chr2:128175983 c.-107A>G NM_000312.3

PROC Chr2:128175984 c.-106A>G NM_000312.3

PROC Chr2:128175988 c.-102T>A NM_000312.3

PROC Chr2:128175991 NM_000312.3

PROC Chr2:128175994 c.-96T>G NM_000312.3

PROC Chr2:128176001 c.-89T>C NM_000312.3

PROC Chr2:128176005 c.-85C>T NM_000312.3

PROC Chr2:128176047 c.-43A>C NM_000312.3

PROC Chr2:128176058 c.-32G>A NM_000312.3 rs912629007

PROC Chr2:128179040 c.237+15G>A NM_000312.3 rs528055589

PROC Chr2:128180582 c.263-28T>G NM_000312.3

PROC Chr2:128180823 c.401-18_401-3delGCCCTCCCCTGCCCGC NM_000312.3

PROC Chr2:128183562 c.536-99C>G NM_000312.3

https://blueprintgenetics.com/ PROC Chr2:128186595 c.*73C>T NM_000312.3 rs199469473

PROS1 Chr3:93593261 c.1871-20_1871-13delCTAATATT NM_000313.3

PROS1 Chr3:93593263 c.1871-14T>G NM_000313.3 rs754929347

PROS1 Chr3:93598175 c.1493-17T>C NM_000313.3 rs199469501

PROS1 Chr3:93605147 c.1323+33A>G NM_000313.3

PROS1 Chr3:93611983 c.966-17C>G NM_000313.3 rs199469490

PROS1 Chr3:93692761 c.-168C>T NM_000313.3 rs199469484

PROS1 Chr3:93692783 c.-190C>G NM_000313.3 rs149028936

RBM8A Chr1:145507646 c.-21G>A NM_005105.4

RBM8A Chr1:145507765 c.67+32G>C NM_005105.4 rs201779890

SERPINC1 Chr1:173876666 c.1154-14G>A NM_000488.3

SERPINC1 Chr1:173884075 c.42-18C>G NM_000488.3

SERPINC1 Chr1:173886568 c.-171C>G NM_000488.3

THBD Chr20:23030319 NM_000361.2

THBD Chr20:23030443 c.-302C>A NM_000361.2

VWF Chr12:6101204 c.6599-20A>T NM_000552.3 rs61750621

VWF Chr12:6125417 c.5312-19A>G NM_000552.3

VWF Chr12:6128923 c.3675-14G>A NM_000552.3

VWF Chr12:6233584 c.-1+3A>C NM_000552.3

VWF Chr12:6233714 c.-128G>A NM_000552.3 rs1300771136

VWF Chr12:6234258 c.-672C>T NM_000552.3 rs61750447

WAS ChrX:48547690 c.1339-19_1339-11delTGATCCCTGinsATCTGCAGACC NM_000377.2

Test Strengths

The strengths of this test include:

CAP accredited laboratory CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance Careful construction of clinically effective and scientifically justified gene panels Some of the panels include the whole mitochondrial genome (please see the Panel Content section) Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level Our publicly available analytic validation demonstrating complete details of test performance ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section) Our rigorous variant classification scheme

https://blueprintgenetics.com/ Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data Our comprehensive clinical statements

Test Limitations

This NGS-based analysis does not include analysis of the intron 1 and intron 22 inversions in F8-gene. The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: VKORC1 (NM_001311311:3). Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene’s target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not d etect the following:

Complex inversions Gene conversions Balanced translocations Some of the panels include the whole mitochondrial genome (please see the Panel Content section) Repeat expansion disorders unless specifically mentioned Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).

This test may not reliably detect the following:

Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability) Stretches of mononucleotide repeats Low level heteroplasmy in mtDNA (>90% are detected at 5% level) Indels larger than 50bp Single exon deletions or duplications Variants within pseudogene regions/duplicated segments Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section and see our Analytic Validation.

Test Performance

The genes on the panel have been carefully selected based on scientific literature, mutation databases and our experience.

Our panels are sectioned from our high-quality, clinical grade NGS assay. Please see our sequencing and detection performance table for details regarding our ability to detect different types of alterations (Table).

Assays have been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva and dry blood spots (filter cards). These sample types were selected in order to maximize the likelihood for high-quality DNA yield. The diagnostic yield varies depending on the assay used, referring healthcare professional, hospital and country. Plus analysis increases the likelihood of finding a genetic diagnosis for your patient, as large deletions and duplications cannot be detected using sequence analysis alone. Blueprint Genetics’ Plus Analysis is a combination of both sequencing and deletion/duplication (copy number variant (CNV)) analysis.

The performance metrics listed below are from an initial validation performed at our main laboratory in Finland. The performance metrics of our laboratory in Seattle, WA, are equivalent.

https://blueprintgenetics.com/ Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.

Sensitivity % (TP/(TP+FN) Specificity %

Single nucleotide variants 99.89% (99,153/99,266) >99.9999%

Insertions, deletions and indels by sequence analysis

1-10 bps 99.2% (7,745/7,806) >99.9999%

11-50 bps 99.13% (2,524/2,546) >99.9999%

Copy number variants (exon level dels/dups)

1 exon level deletion (heterozygous) 100% (20/20) NA

1 exon level deletion (homozygous) 100% (5/5) NA

1 exon level deletion (het or homo) 100% (25/25) NA

2-7 exon level deletion (het or homo) 100% (44/44) NA

1-9 exon level duplication (het or homo) 75% (6/8) NA

Simulated CNV detection

5 exons level deletion/duplication 98.7% 100.00%

Microdeletion/-duplication sdrs (large CNVs, n=37))

Size range (0.1-47 Mb) 100% (25/25)

The performance presented above reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics

Mean sequencing depth 143X

Nucleotides with >20x sequencing coverage (%) 99.86%

Performance of Blueprint Genetics Mitochondrial Sequencing Assay.

Sensitivity % Specificity %

ANALYTIC VALIDATION (NA samples; n=4)

Single nucleotide variants

Heteroplasmic (45-100%) 100.0% (50/50) 100.0%

Heteroplasmic (35-45%) 100.0% (87/87) 100.0%

Heteroplasmic (25-35%) 100.0% (73/73) 100.0%

Heteroplasmic (15-25%) 100.0% (77/77) 100.0%

Heteroplasmic (10-15%) 100.0% (74/74) 100.0%

https://blueprintgenetics.com/ Heteroplasmic (5-10%) 100.0% (3/3) 100.0%

Heteroplasmic (<5%) 50.0% (2/4) 100.0%

CLINICAL VALIDATION (n=76 samples)

All types

Single nucleotide variants n=2026 SNVs

Heteroplasmic (45-100%) 100.0% (1940/1940) 100.0%

Heteroplasmic (35-45%) 100.0% (4/4) 100.0%

Heteroplasmic (25-35%) 100.0% (3/3) 100.0%

Heteroplasmic (15-25%) 100.0% (3/3) 100.0%

Heteroplasmic (10-15%) 100.0% (9/9) 100.0%

Heteroplasmic (5-10%) 92.3% (12/13) 99.98%

Heteroplasmic (<5%) 88.9% (48/54) 99.93%

Insertions and deletions by sequence analysis n=40 indels

Heteroplasmic (45-100%) 1-10bp 100.0% (32/32) 100.0%

Heteroplasmic (5-45%) 1-10bp 100.0% (3/3) 100.0%

Heteroplasmic (<5%) 1-10bp 100.0% (5/5) 99,997%

SIMULATION DATA /(mitomap mutations)

Insertions, and deletions 1-24 bps by sequence analysis; n=17

Homoplasmic (100%) 1-24bp 100.0% (17/17) 99.98%

Heteroplasmic (50%) 100.0% (17/17) 99.99%

Heteroplasmic (25%) 100.0% (17/17) 100.0%

Heteroplasmic (20%) 100.0% (17/17) 100.0%

Heteroplasmic (15%) 100.0% (17/17) 100.0%

Heteroplasmic (10%) 94.1% (16/17) 100.0%

Heteroplasmic (5%) 94.1% (16/17) 100.0%

Copy number variants (separate artifical mutations; n=1500)

Homoplasmic (100%) 500 bp, 1kb, 5 kb 100.0% 100.0%

Heteroplasmic (50%) 500 bp, 1kb, 5 kb 100.0% 100.0%

Heteroplasmic (30%) 500 bp, 1kb, 5 kb 100.0% 100.0%

Heteroplasmic (20%) 500 bp, 1kb, 5 kb 99.7% 100.0%

Heteroplasmic (10%) 500 bp, 1kb, 5 kb 99.0% 100.0%

https://blueprintgenetics.com/ The performance presented above reached by following coverage metrics at assay level (n=66)

Mean of medians Median of medians

Mean sequencing depth MQ0 (clinical) 18224X 17366X

Nucleotides with >1000x MQ0 sequencing coverage (%) (clinical) 100%

rho zero cell line (=no mtDNA), mean sequencing depth 12X

Bioinformatics

The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases such as, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as SIFT, PolyPhen, MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, the customer has an access to details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with inadequate coverage if present. This reflects our mission to build fully transparent diagnostics where customers have easy access to crucial details of the analysis process.

Clinical Interpretation

We provide customers with the most comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our PhD molecular geneticists, medical geneticists and clinical consultants prepare the clinical statement together by evaluating the identified variants in the context of the phenotypic information provided in the requisition form. Our goal is to provide clinically meaningful statements that are understandable for all medical professionals regardless of whether they have formal training in genetics.

Variant classification is the corner stone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015.

The final step in the analysis of sequence variants is confirmation of variants classified as pathogenic or likely pathogenic using bi-directional Sanger sequencing. Variant(s) fulfilling the following criteria are not Sanger confirmed: the variant quality score is above the internal threshold for a true positive call, and visual check-up of the variant at IGV is in-line with the variant call. Reported variants of uncertain significance are confirmed with bi-directional Sanger sequencing only if the quality score is below our internally defined quality score for true positive call. Reported copy number variations with a size <10 exons are confirmed by orthogonal methods such as qPCR if the specific CNV has been seen less than three times at Blueprint Genetics.

Our clinical statement includes tables for sequencing and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, OMIM phenotypes and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene and phenotype(s) including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts and detailed information about related phenotypes. We also provide links to the references used, congress abstracts and mutation variant databases used to help our customers further evaluate the reported findings if desired. The conclusion summarizes all of the existing information and provides our rationale for the classification of the variant.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification within the family. In the case of variants of uncertain significance (VUS), we do not recommend

https://blueprintgenetics.com/ family member risk stratification based on the VUS result. Furthermore, in the case of VUS, we do not recommend the use of genetic information in patient management or genetic counseling.

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Thus, our database, and our understanding of variants and related phenotypes, is growing by leaps and bounds. Our laboratory is therefore well positioned to re-classify previously reported variants as new information becomes available. If a variant previously reported by Blueprint Genetics is re-classified, our laboratory will issue a follow-up statement to the original ordering health care provider at no additional cost.

ICD Codes

Refer to the most current version of ICD-10-CM manual for a complete list of ICD-10 codes.

Sample Requirements

Blood (min. 1ml) in an EDTA tube Extracted DNA, min. 2 μg in TE buffer or equivalent Saliva (Please see Sample Requirements for accepted saliva kits)

Label the sample tube with your patient's name, date of birth and the date of sample collection.

We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.

Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.

Read more about our sample requirements here.

For Patients

Other

Bernard Soulier Syndrome Organization Bernard-Soulier Syndrome Organization Canadian Hemophilia Society Canadian Hemophilia Society GeneReviews - Hemophilia A GeneReviews - Hemophilia B GeneReviews - Hermansky-Pudlak Syndrome GeneReviews - MYH9-Related Disorders GeneReviews - Von Willebrand Disease GeneReviews - WAS-Related Disorders GeneReviews - Wiskott Aldrich Syndrome GeneReviews - von Willebrand Disease Glanzmann's Research Foundation Glanzmann’s Research Foundation Haemophilia Society - UK Haemophilia Society UK Hemophilia & Rare Bleeding Disorders Hemophilia & Rare Bleeding Disorders Hemophilia Federation of America Hermansky-Pudlak Syndrome Network

https://blueprintgenetics.com/ Immune Deficiency Foundation NORD - Bernard-Soulier Syndrome NORD - Factor XI Deficiency NORD - Glanzmann Thrombasthenia NORD - Hemophilia A NORD - Hemophilia B NORD - Hermansky Pudlak NORD - Hermansky-Pudlak Syndrome NORD - Von Willebrand Disease NORD - Wiskott Aldrich Syndrome NORD - Wiskott-Aldrich National Hemophilia Foundation National Organization for Albinism and Hypopigmentation Noris P et al. Hereditary thrombocytopenias: a growing list of disorders. Hematology Am Soc Hematol Educ Program. 2017 Dec 8;2017(1):385-399. Peyvandi F et al. Genetic sequence analysis of inherited bleeding diseases. Blood. 2013 Nov 14;122(20):3423-31 Platelet Disorder Support Association Wiskott-Aldrich Foundation World Federation of Hemophilia

https://blueprintgenetics.com/