DOCSLIB.ORG

Blueprint Genetics Bleeding Disorder/Coagulopathy Panel

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Blueprint Genetics Bleeding Disorder/Coagulopathy Panel Bleeding Disorder/Coagulopathy Panel Test code: HE1301 Is a 71 gene panel that includes assessment of non-coding variants. Is ideal for patients with a clinical suspicion of an inherited bleeding disorder. Is not recommended for patients with a suspicion of severe Hemophilia A if the common inversions are not excluded by previous testing. An intron 22 inversion of the F8 gene is identified in 43%-45% individuals with severe hemophilia A and intron 1 inversion in 2%-5% (GeneReviews NBK1404; PMID:8275087, 8490618, 29296726, 27292088, 22282501, 11756167). This test does not detect reliably these inversions. About Bleeding Disorder/Coagulopathy Bleeding disorder refers to a heterogenous group of diseases caused by deficiencies in platelet function or coagulation factors. The bleeding disorders can be categorized into three groups: 1) the common inherited bleeding disorders, hemophilia A, B, and von Willebrand disease (VWD); (2) the rare inherited coagulation factor deficiencies; and (3) inherited platelet disorders (PMID: 24124085). VWD is the most common inherited bleeding disorder, affecting up to 1% of the general population and occuring with equal frequency among men and women. The phenotypes that are covered by the panel include VWD, hemophilia A and B, rare bleeding disorders, Hermansky Pudlak syndrome, Wiskott-Aldrich syndrome, Bernard Soulier syndrome, Glanzmann disease, thrombocytopenia 2, familial platelet syndrome with predisposition to acute myelogenous leukemia and gray platelet syndrome. The molecular knowledge gained from genetic testing is currently routinely used in the clinical care of the patients with hereditary bleeding disorder. Availability 4 weeks Gene Set Description Genes in the Bleeding Disorder/Coagulopathy Panel and their clinical significance Gene Associated phenotypes Inheritance ClinVar HGMD ABCG5 Sitosterolemia AR 13 42 ABCG8 Sitosterolemia AR 18 44 ACTN1 Bleeding disorder, platelet- AD 7 25 ADAMTS13 Schulman-Upshaw syndrome, Thrombotic thrombocytopenic purpura, AR 30 183 familial ANKRD26 Thrombocytopenia AD 6 21 AP3B1 Hermansky-Pudlak syndrome AR 14 34 ARPC1B Platelet abnormalities with eosinophilia and immune-mediated AR 2 4 inflammatory disease BLOC1S3 Hermansky-Pudlak syndrome AR 2 4 BLOC1S6 Hermansky-Pudlak syndrome AR 1 2 CYCS* Thrombocytopenia AD 2 3 https://blueprintgenetics.com/ DTNBP1 Hermansky-Pudlak syndrome AR 2 3 EFL1 Shwachman-Diamond syndrome 3 2 ETV6 Thrombocytopenia 5 AD 10 38 F10 Factor X deficiency AR 15 155 F11 Factor XI deficiency AD/AR 77 271 F12 Angioedema, Factor XII deficiency AD/AR 7 53 F13A1 Factor XIIIA deficiency AR 20 180 F2 Thrombophilia due to thrombin defect, Prothrombin deficiency, AD/AR 14 66 congenital F5 Factor V deficiency, Thrombophilia due to activated protein C AD/AR 19 157 resistance F7 Factor VII deficiency AR 27 322 F8* Hemophilia A XL 296 3205 F9 Hemophilia B, Warfarin sensitivity, Thrombophilia, due to factor IX XL 117 1281 defect FGA Afibrinogenemia, congenital, Dysfibrinogenemia, congenital, AD/AR 10 144 Hypodysfibrinogenemia, congenital, Familial visceral amyloidosis FGB Afibrinogenemia, congenital, Dysfibrinogenemia, congenital, AD/AR 6 92 Hypodysfibrinogenemia, congenital FGG Afibrinogenemia, congenital, Hypodysfibrinogenemia, AD/AR 7 127 Dysfibrinogenemia, congenital, Hypodysfibrinogenemia, congenital FLI1 Thrombocytopenia, Paris-Trousseau type, Bleeding disorder, platelet AD 7 7 type 21 FLNA Frontometaphyseal dysplasia, Osteodysplasty Melnick-Needles, XL 133 257 Otopalatodigital syndrome type 1, Otopalatodigital syndrome type 2, Terminal osseous dysplasia with pigmentary defects FYB Thrombocytopenia 3 AR 2 2 GATA1 Anemia, without thrombocytopenia, Thrombocytopenia with beta- XL 21 15 thalessemia,, Dyserythropoietic anemia with thrombocytopenia GBA* Gaucher disease AR 84 488 GFI1B Bleeding disorder, platelet-type, 17 AD 6 9 GGCX Pseudoxanthoma elasticum-like disorder with multiple coagulation AD/AR/Digenic 13 42 factor deficiency, Vitamin K-dependent clotting factors, combined deficiency GP1BA Pseudo-von Willebrand disease, Bernard-Soulier syndrome AD/AR 9 73 GP1BB Giant platelet disorder, isolated, Bernard-Soulier syndrome AD/AR 5 53 GP9 Bernard-Soulier syndrome AR 6 42 https://blueprintgenetics.com/ HOXA11 Radioulnar synostosis with amegakaryocytic thrombocytopenia AD 1 1 HPS1* Hermansky-Pudlak syndrome AR 28 55 HPS3* Hermansky-Pudlak syndrome AR 10 17 HPS4 Hermansky-Pudlak syndrome AR 16 22 HPS5 Hermansky-Pudlak syndrome AR 20 31 HPS6 Hermansky-Pudlak syndrome AR 13 37 ITGA2 Fetal and neonatal alloimmune thrombocytopenia AD/AR 5 ITGA2B Glanzmann thrombasthenia AD/AR 22 234 ITGB3 Bleeding disorder, platelet-, Thrombocytopenia, neonatal alloimmune, AD/AR 18 165 Glanzmann thrombasthenia LMAN1 Combined factor V and VIII deficiency AR 5 37 MASTL Thrombocytopenia AD 5 MCFD2 Factor V & Factor VIII, combined deficiency of AR 8 20 MECOM Radioulnar synostosis with amegakaryocytic thrombocytopenia 2 AD 3 27 MPL Thrombocythemia, Amegakaryocytic thrombocytopenia AD/AR 23 55 MYH9 Sebastian syndrome, May-Hegglin anomaly, Epstein syndrome, AD 25 117 Fechtner syndrome, Macrothrombocytopenia and progressive sensorineural deafness, Deafness, autosomal dominant 17 NBEAL2 Gray platelet syndrome AR 10 51 P2RY12 Bleeding disorder, platelet- AD/AR 4 13 PRKACG Bleeding disorder, platelet-type, 19 AR 1 1 PROC Thrombophilia, hereditary AD/AR 36 387 PROS1* Thrombophilia, hereditary AD/AR 23 416 RASGRP2 Bleeding disorder, platelet-type, 18 AR 3 20 RBM8A*,# Thrombocytopenia - absent radius AD/AR 5 12 RUNX1 Platelet disorder, familial, with associated myeloid malignancy AD 47 101 SERPINC1 Antithrombin III deficiency AD/AR 44 412 SERPINF2 Alpha-2-plasmin inhibitor deficiency AD/AR 4 8 SLFN14 Thrombocytopenia AD/AR 4 4 SRC Thrombocytopenia, autosomal dominant, 6 AD 2 1 SRP54 Shwachman-Diamond syndrome AD 3 TBXA2R Bleeding disorder, platelet- AD 1 6 https://blueprintgenetics.com/ THBD Thrombophilia due to thrombomodulin defect, Hemolytic uremic AD 5 28 syndrome, atypical THPO Thrombocythemia 1 AD 5 10 TUBB1 Macrothrombocytopenia AD 2 7 VKORC1 Drug metabolism, VKORC1-related, Vitamin K-dependent clotting AD/AR 4 27 factors, combined deficiency VWF* Von Willebrand disease AD/AR 57 1009 WAS Neutropenia, severe congenital, Thrombocytopenia, Wiskott-Aldrich XL 57 439 syndrome WIPF1 Wiskott-Aldrich syndrome 2 AR 2 3 *Some regions of the gene are duplicated in the genome. Read more. # The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads. The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests. Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases. Non-coding disease causing variants covered by the panel Gene Genomic HGVS RefSeq RS-number location HG19 ANKRD26 Chr10:27389371 c.-116C>G NM_014915.2 ANKRD26 Chr10:27389373 c.-118C>A NM_014915.2 ANKRD26 Chr10:27389374 c.-119C>A NM_014915.2 ANKRD26 Chr10:27389374 c.-119C>A/G NM_014915.2 ANKRD26 Chr10:27389376 c.-121A>C NM_014915.2 ANKRD26 Chr10:27389380 c.-127_-126delAT NM_014915.2 ANKRD26 Chr10:27389381 c.-126T>C NM_014915.2 ANKRD26 Chr10:27389381 c.-126T>G NM_014915.2 ANKRD26 Chr10:27389382 c.-127A>G NM_014915.2 ANKRD26 Chr10:27389382 c.-127A>T NM_014915.2 ANKRD26 Chr10:27389383 c.-128G>T NM_014915.2 https://blueprintgenetics.com/ ANKRD26 Chr10:27389383 c.-128G>A NM_014915.2 ANKRD26 Chr10:27389383 c.-128G>C NM_014915.2 ANKRD26 Chr10:27389389 c.-134G>A NM_014915.2 rs863223318 F11 Chr4:187186995 c.-456G>A NM_000128.3 F11 Chr4:187197061 c.595+11A>G NM_000128.3 rs534170853 F11 Chr4:187205426 c.1304+12G>A NM_000128.3 rs116667976 F12 Chr5:176836590 NM_000505.3 rs187018744 F13A1 Chr6:6320800 c.-19_-19+19delGGTAAGCCACCGACCCTGCA NM_000129.3 F2 Chr11:46742048 c.241-25C>G NM_000506.3 F2 Chr11:46761055 c.*97G>A NM_000506.4 rs1799963 F2 Chr11:46761064 c.*106T>A NM_000506.3 F2 Chr11:46761066 c.*108C>T NM_000506.3 rs562369397 F5 Chr1:169494158 c.5717-12T>A NM_000130.4 F5 Chr1:169521527 c.1296+268A>G NM_000130.4 F5 Chr1:169521984 c.1119-12C>G NM_000130.4 F7 Chr13:113760060 c.-96C>T NM_000131.4 F7 Chr13:113760062 c.-94C>G NM_000131.4 F7 Chr13:113760091 c.-65G>C NM_000131.4 F7 Chr13:113760094 NM_000131.4 F7 Chr13:113760094 c.-62C>T NM_000131.4 F7 Chr13:113760095 c.-61T>G NM_000131.4 F7 Chr13:113760096 NM_000131.4 F7 Chr13:113760096 NM_000131.4 F7 Chr13:113760097 c.-59T>G NM_000131.4 F7 Chr13:113760099 c.-57C>T NM_000131.4 F7 Chr13:113760101 NM_000131.4 F7 Chr13:113760101 NM_000131.4 F7 Chr13:113760112 c.-44T>C NM_000131.4 rs577393666 F7 Chr13:113760117 c.-39A>G NM_000131.4 F7 Chr13:113760124 c.-32A>C NM_000131.4 rs761212787 F7 Chr13:113760126 c.-30A>C NM_000131.4 rs539578931 https://blueprintgenetics.com/ F7 Chr13:113764993 c.131-11G>A NM_000131.4
Load more

Recommended publications
  • Protein S Deficiency Presenting with Hemorrhage in a Term Neonate
    : Curre re nt a R C e Ayari et al., Health Care Current Reviews 2018, 6:1 h v t i l e a w DOI: 10.4172/2375-4273.1000219 e s H Health Care: Current Reviews ISSN: 2375-4273 Review Article Open Access Protein S Deficiency Presenting with Hemorrhage in a Term Neonate Fairouz Ayari*, Takoua Bensmail, Essid Latifa, Wiem Barbaria and Samia Kacem Neonatology Intensive Care Unit of the Maternity and Neonatology Center, Tunis, Tunisia Abstract Unexplained bleeding symptoms in otherwise healthy full-term usually present a diagnostic challenge for treating physicians requiring prompt and accurate laboratory investigations to ensure appropriate treatment and possibly avoid long-term morbidity. We report a case of a term neonate with severe protein S deficiency manifested by systemic hemorrhage and multiple organ failure at 9 days of age. We review how protein S influences the coagulation and the fibrinolytic pathways, discussing therapeutic approaches of neonates with purpura fulminans. Keywords: Protein S deficiency; Blood sample; Thrombophilic dis- resuscitation with 20 ml/kg bodyweight (BW) saline solution and, after order blood sampling, intravenous administration of 10 mg vitamin K, 20 ml/kg BW fresh frozen plasma, 20 ml/kg BW packed red blood cells Introduction (5 transfusion cycles), 20 mg/kg BW Phenobarbital and vasoactive Protein S (PS) is an antithrombotic plasma protein that acts mainly drugs. Cerebral ultrasound revealed intraventricular haemorrhage, as a cofactor of activated protein C (APC) anticoagulant activity in the abdominal ultrasound showed splenic hemorrhage and cardiac degradation of factor Va and activated factor VIII [1]. PS circulates in ultrasound showed a floating intracardiac thrombus.
    [Show full text]
  • Crofab Brochure
    Control With Confidence The only antivenom derived from native US pit vipers to treat envenomations from all species of North American pit vipers1 CroFab is the only antivenom Derived from geographically and clinically relevant US snakes for comprehensive coverage of all North American pit viper envenomations1 Designed with small, venom-specific protein (Fab) fragments for rapid neutralization of venom toxins throughout affected tissue1,2 With Level 1 evidence in the treatment of copperhead envenomation3 Manufactured to yield the highest level of quality, purity, and safety1 With a proven efficacy and safety profile, backed by >20 years of clinical experience1 Reliably supplied throughout the United States4 CroFab meets World Health Organization (WHO) guidelines for effective antivenom, utilizing venom from 4 clinically relevant pit viper species native to the United States.1,5 Indication CroFab® Crotalidae Polyvalent Immune Fab (Ovine) is a sheep-derived antivenin indicated for the management of adult and pediatric patients with North American crotalid envenomation. The term crotalid is used to describe the Crotalinae subfamily (formerly known as Crotalidae) of venomous snakes which includes rattlesnakes, copperheads and cottonmouths/water moccasins. Important Safety Information Contraindications Do not administer CroFab® to patients with a known history of hypersensitivity to any of its components, or to papaya or papain unless the benefits outweigh the risks and appropriate management for anaphylactic reactions is readily available. Warnings and Precautions Coagulopathy: In clinical trials, recurrent coagulopathy (the return of a coagulation abnormality after it has been successfully treated with antivenin), characterized by decreased fibrinogen, decreased platelets, and elevated prothrombin time, occurred in approximately half of the patients studied; one patient required re-hospitalization and additional antivenin administration.
    [Show full text]
  • MYH9-Related Platelet Disorders
    Reprinted with permission from Thieme Medical Publishers (Semin Thromb Hemost 2009;35:189-203) Homepage at www.thieme.com MYH9-Related Platelet Disorders Karina Althaus, M.D.,1 and Andreas Greinacher, M.D.1 ABSTRACT Myosin heavy chain 9 (MYH9)-related platelet disorders belong to the group of inherited thrombocytopenias. The MYH9 gene encodes the nonmuscle myosin heavy chain IIA (NMMHC-IIA), a cytoskeletal contractile protein. Several mutations in the MYH9 gene lead to premature release of platelets from the bone marrow, macro- thrombocytopenia, and cytoplasmic inclusion bodies within leukocytes. Four overlapping syndromes, known as May-Hegglin anomaly, Epstein syndrome, Fechtner syndrome, and Sebastian platelet syndrome, describe different clinical manifestations of MYH9 gene mutations. Macrothrombocytopenia is present in all affected individuals, whereas only some develop additional clinical manifestations such as renal failure, hearing loss, and presenile cataracts. The bleeding tendency is usually moderate, with menorrhagia and easy bruising being most frequent. The biggest risk for the individual is inappropriate treatment due to misdiagnosis of chronic autoimmune thrombocytopenia. To date, 31 mutations of the MYH9 gene leading to macrothrombocytopenia have been identified, of which the upstream mutations up to amino acid 1400 are more likely associated with syndromic manifestations than the downstream mutations. This review provides a short history of MYH9-related disorders, summarizes the clinical and laboratory character- istics, describes a diagnostic algorithm, presents recent results of animal models, and discusses aspects of therapeutic management. KEYWORDS: MYH9 gene, nonmuscle myosin IIA, May-Hegglin anomaly, Epstein syndrome, Fechtner syndrome, Sebastian platelet syndrome, macrothrombocytopenia The correct diagnosis of hereditary chronic as isolated platelet count reductions or as part of thrombocytopenias is important for planning appropri- more complex clinical syndromes.
    [Show full text]
  • The Rare Coagulation Disorders
    Treatment OF HEMOPHILIA April 2006 · No. 39 THE RARE COAGULATION DISORDERS Paula HB Bolton-Maggs Department of Haematology Manchester Royal Infirmary Manchester, United Kingdom Published by the World Federation of Hemophilia (WFH) © World Federation of Hemophilia, 2006 The WFH encourages redistribution of its publications for educational purposes by not-for-profit hemophilia organizations. In order to obtain permission to reprint, redistribute, or translate this publication, please contact the Communications Department at the address below. This publication is accessible from the World Federation of Hemophilia’s web site at www.wfh.org. Additional copies are also available from the WFH at: World Federation of Hemophilia 1425 René Lévesque Boulevard West, Suite 1010 Montréal, Québec H3G 1T7 CANADA Tel. : (514) 875-7944 Fax : (514) 875-8916 E-mail: [email protected] Internet: www.wfh.org The Treatment of Hemophilia series is intended to provide general information on the treatment and management of hemophilia. The World Federation of Hemophilia does not engage in the practice of medicine and under no circumstances recommends particular treatment for specific individuals. Dose schedules and other treatment regimes are continually revised and new side effects recognized. WFH makes no representation, express or implied, that drug doses or other treatment recommendations in this publication are correct. For these reasons it is strongly recommended that individuals seek the advice of a medical adviser and/or to consult printed instructions provided by the pharmaceutical company before administering any of the drugs referred to in this monograph. Statements and opinions expressed here do not necessarily represent the opinions, policies, or recommendations of the World Federation of Hemophilia, its Executive Committee, or its staff.
    [Show full text]
  • The Impact of Thrombophilia in the Management Of
    S6 MPN III – Abstracts of the 8th International Hematology Expert Meeting / Leukemia Research 44 S1 (2016) S1–S12 Figure 1. Possible new treatment algorithm in polycythemia vera and essential thrombocythemia (CVR = cardiovascular risk factors). Adapted from: Tefferi A, Barbui T. Am J Hematol 2015;90(8):683–5 MPN III the Czech part of the international registry (“Registry”) of anagrelide (Thromboreductin®)-treated patients. The impact of thrombophilia in the management of MPN The recent analysis of the “Registry” [6] included altogether 1179 patients having MPD-T – either ET, PV or PMF according to PVSG criteria. In 812 J. Schwarz patients, the WHO/CZEMP diagnosis could be established: ET – 445 CZEMP (Czech Group for Ph– Myeloproliferative Disorders), Prague, Czech (54.8%), PMF – 206 (25.4%), PV – 107 (13.2%), and other (mostly MPN- Republic unclassifiable) – 54 (6.7%) cases. The M/F ratio was 2:3, the median age of The overall thrombotic risk in a normal healthy population is always based patients was 52 years (6–91 years) at diagnosis. The incidence of vascular on a combination of multiple risk factors present in one individual. The events was compared in the history (before entering the Registry) and risk parameters for arterial and venous events differ. MPD-T represents during follow-up (on anagrelide treatment). History and follow-up a situation in which the specific MPD-related risks (such as the JAK2 represented 4149 and 4742 patient-years, respectively. For arterial events, mutation) are combined with other risk factors present in the general there was a decrease in the incidence of events from 5.04 to 2.74 per 100 population.
    [Show full text]
  • Familial Multiple Coagulation Factor Deficiencies
    Journal of Clinical Medicine Article Familial Multiple Coagulation Factor Deficiencies (FMCFDs) in a Large Cohort of Patients—A Single-Center Experience in Genetic Diagnosis Barbara Preisler 1,†, Behnaz Pezeshkpoor 1,† , Atanas Banchev 2 , Ronald Fischer 3, Barbara Zieger 4, Ute Scholz 5, Heiko Rühl 1, Bettina Kemkes-Matthes 6, Ursula Schmitt 7, Antje Redlich 8 , Sule Unal 9 , Hans-Jürgen Laws 10, Martin Olivieri 11 , Johannes Oldenburg 1 and Anna Pavlova 1,* 1 Institute of Experimental Hematology and Transfusion Medicine, University Clinic Bonn, 53127 Bonn, Germany; [email protected] (B.P.); [email protected] (B.P.); [email protected] (H.R.); [email protected] (J.O.) 2 Department of Paediatric Haematology and Oncology, University Hospital “Tzaritza Giovanna—ISUL”, 1527 Sofia, Bulgaria; [email protected] 3 Hemophilia Care Center, SRH Kurpfalzkrankenhaus Heidelberg, 69123 Heidelberg, Germany; ronald.fi[email protected] 4 Department of Pediatrics and Adolescent Medicine, University Medical Center–University of Freiburg, 79106 Freiburg, Germany; [email protected] 5 Center of Hemostasis, MVZ Labor Leipzig, 04289 Leipzig, Germany; [email protected] 6 Hemostasis Center, Justus Liebig University Giessen, 35392 Giessen, Germany; [email protected] 7 Center of Hemostasis Berlin, 10789 Berlin-Schöneberg, Germany; [email protected] 8 Pediatric Oncology Department, Otto von Guericke University Children’s Hospital Magdeburg, 39120 Magdeburg, Germany; [email protected] 9 Division of Pediatric Hematology Ankara, Hacettepe University, 06100 Ankara, Turkey; Citation: Preisler, B.; Pezeshkpoor, [email protected] B.; Banchev, A.; Fischer, R.; Zieger, B.; 10 Department of Pediatric Oncology, Hematology and Clinical Immunology, University of Duesseldorf, Scholz, U.; Rühl, H.; Kemkes-Matthes, 40225 Duesseldorf, Germany; [email protected] B.; Schmitt, U.; Redlich, A.; et al.
    [Show full text]
  • Alterations of Genetic Variants and Transcriptomic Features of Response to Tamoxifen in the Breast Cancer Cell Line
    Alterations of Genetic Variants and Transcriptomic Features of Response to Tamoxifen in the Breast Cancer Cell Line Mahnaz Nezamivand-Chegini Shiraz University Hamed Kharrati-Koopaee Shiraz University https://orcid.org/0000-0003-2345-6919 seyed taghi Heydari ( [email protected] ) Shiraz University of Medical Sciences https://orcid.org/0000-0001-7711-1137 Hasan Giahi Shiraz University Ali Dehshahri Shiraz University of Medical Sciences Mehdi Dianatpour Shiraz University of Medical Sciences Kamran Bagheri Lankarani Shiraz University of Medical Sciences Research Keywords: Tamoxifen, breast cancer, genetic variants, RNA-seq. Posted Date: August 17th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-783422/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/33 Abstract Background Breast cancer is one of the most important causes of mortality in the world, and Tamoxifen therapy is known as a medication strategy for estrogen receptor-positive breast cancer. In current study, two hypotheses of Tamoxifen consumption in breast cancer cell line (MCF7) were investigated. First, the effect of Tamoxifen on genes expression prole at transcriptome level was evaluated between the control and treated samples. Second, due to the fact that Tamoxifen is known as a mutagenic factor, there may be an association between the alterations of genetic variants and Tamoxifen treatment, which can impact on the drug response. Methods In current study, the whole-transcriptome (RNA-seq) dataset of four investigations (19 samples) were derived from European Bioinformatics Institute (EBI). At transcriptome level, the effect of Tamoxifen was investigated on gene expression prole between control and treatment samples.
    [Show full text]
  • Immune Thrombocytopenia and JAK2V617F Positive Essential Thrombocythemia: Literature Review and Case Report
    Hindawi Case Reports in Hematology Volume 2017, Article ID 3725089, 4 pages https://doi.org/10.1155/2017/3725089 Case Report Immune Thrombocytopenia and JAK2V617F Positive Essential Thrombocythemia: Literature Review and Case Report M. A. Sobas,1 T. Wróbel,1 K. Zduniak,2 M. Podolak-Dawidziak,1 J. Rybka,1 M. BiedroN,1 M. Sawicki,1 J. Dybko,1 and K. Kuliczkowski1 1 Department of Haematology, Blood Neoplasms and Bone Marrow Transplantation, Medical University of Wrocław, Wrocław, Poland 2Department of Pathology, Medical University of Wrocław, Wrocław, Poland Correspondence should be addressed to M. A. Sobas; [email protected] Received 27 March 2017; Revised 28 May 2017; Accepted 27 June 2017; Published 20 July 2017 Academic Editor: Eduardo Arellano-Rodrigo Copyright © 2017 M. A. Sobas et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. We present the case where immune thrombocytopenia (ITP) and essential thrombocythemia (ET) sequentially appeared in the space of twenty-one years of follow-up. Impaired platelet production is present in both diseases, but clinical presentation and treatment are different. On the basis of this case history a possible role of autoimmunity as a predisposing factorto myeloproliferation has been discussed. 1. Introduction but proved one with myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML) [6]. Primaryimmunethrombocytopeniapreviouslycalledidio- pathic thrombocytopenic purpura or immune thrombocy- Here we present a case report of a patient with ITP who topenic purpura (ITP) is characterized by autoimmune- was diagnosed with ET, after 21 years of follow-up.
    [Show full text]
  • Analysis of Newly Detected Mutations in the MCFD2 Gene Giving Rise to Combined Deficiency of Coagulation Factors V and VIII
    Haemophilia (2011), 1–5 DOI: 10.1111/j.1365-2516.2011.02529.x ORIGINAL ARTICLE Analysis of newly detected mutations in the MCFD2 gene giving rise to combined deficiency of coagulation factors V and VIII H. ELMAHMOUDI,*1 E. WIGREN, 1 A. LAATIRI,à A. JLIZI,* A. ELGAAIED,* E. GOUIDER§ and Y. LINDQVISTà *Laboratory of Genetics, Immunology and Human Pathologies, Tunis, Tunisia; Department of Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden; àDepartment of Hematology, Fattouma Bourguiba Hospital, Monastir, Tunisia; and §Hemophilia Treatment Center, Aziza Othmana Hospital, Tunis, Tunisia Summary. Combined deficiency of coagulation factor V uncharged asparagine. To elucidate the structural effect (FV) and factor VIII (FVIII) (F5F8D) is a rare autosomal of this mutation, we performed circular dichroism (CD) recessive disorder characterized by mild-to-moderate analysis of secondary structure and stability. In addi- bleeding and reduction in FV and FVIII levels in plasma. tion, CD analysis was performed on two missense F5F8D is caused by mutations in one of two different mutations found in previously reported F5F8D patients. genes, LMAN1 and MCFD2, which encode proteins Our results show that all analysed mutant variants that form a complex involved in the transport of FV and give rise to destabilized proteins and highlight the FVIII from the endoplasmic reticulum to the Golgi importance of a structurally intact and functional apparatus. Here, we report the identification of a novel MCFD2 for the efficient secretion of coagulation factors mutation Asp89Asn in the MCFD2 gene in a Tunisian V and VIII. patient. In the encoded protein, this mutation causes substitution of a negatively charged aspartate, involved Keywords: circular dichroism, combined FV and FVIII in several structurally important interactions, to an deficiency, LMAN1, MCFD2, mutations excessive bleeding during or after trauma, surgery, or Introduction labour.
    [Show full text]
  • Outcomes of Patients with Thrombocytopenia Evaluated at Hematology Subspecialty Clinics
    Henry Ford Health System Henry Ford Health System Scholarly Commons Hematology Oncology Articles Hematology-Oncology 2-11-2021 Outcomes of patients with thrombocytopenia evaluated at hematology subspecialty clinics Zaid H. Abdel Rahman Kevin C. Miller H Jabbour Yaser Alkhatib Vijayalakshmi Donthireddy Follow this and additional works at: https://scholarlycommons.henryford.com/ hematologyoncology_articles Hematol Oncol Stem Cell Ther xxx (xxxx) xxx Available at www.sciencedirect.com ScienceDirect journal homepage: www.elsevier.com/locate/hemonc Outcomes of patients with thrombocytopenia evaluated at hematology subspecialty clinics Zaid H. Abdel Rahman a,*, Kevin C. Miller b, Hiba Jabbour c, Yaser Alkhatib c, Vijaya Donthireddy c a Division of Hematology and Medical Oncology, Mayo Clinic, Jacksonville, FL, USA b Department of Medicine, Massachusetts General Hospital, Boston, MA, USA c Division of Hematology and Medical Oncology, Henry Ford Hospital, Detroit, MI, USA Received 6 October 2020; received in revised form 9 December 2020; accepted 15 January 2021 KEYWORDS Abstract Hematology; Background: Thrombocytopenia is a frequently encountered laboratory abnormality and a Malignancy; common reason for hematology referrals. Workup for thrombocytopenia is not standardized Platelets; and frequently does not follow an evidence-based algorithm. We conducted a systematic anal- Referrals; Thrombocytopenia ysis to evaluate the laboratory testing and outcomes of patients evaluated for thrombocytope- nia at hematology clinics in a tertiary referral center between 2013 and 2016. Patient and methods: We performed a comprehensive chart review for patients evaluated for thrombocytopenia during the study period. Patients were followed for 1 year from the initial hematology evaluation and assessed for the development of a hematologic malignancy, rheumatologic, or infectious diseases among other clinical outcomes.
    [Show full text]
  • Haemostatic Problems in Liver Disease
    Gut: first published as 10.1136/gut.27.3.339 on 1 March 1986. Downloaded from Gut, 1986, 27, 339-349 Progress report Haemostatic problems in liver disease The liver plays a major role in the control of coagulation and as a result haemostatic problems are detected in approximately 75% of patients with liver disease.1 The coagulation abnormalities are both complex and multifactorial and depend on the balance between hepatic synthesis and clearance of activated coagulation proteins and their inhibitors; the presence or absence of dysfibrinogenaemia; thrombocytopenia, abnormal platelet function, and disseminated intravascular coagulation. Some patients will present with petechiae, ecchymosis or epistaxis, but most patients are asymptomatic or only bleed after venepuncture or liver biopsy. Alternatively haemorrhage may be life threatening and patients may die from variceal bleeding or from disseminated intravascular coagulation. The reasons for this disparity are not yet clear, but after the introduction of newer techniques, in particular the development of immunological assays for the antigens of coagulation proteins, our understanding of these problems has improved. The normal coagulation and fibrinolytic systems are depicted in Figures 1 and 2 while the major .__Intrinsic___ _ pathwY http://gut.bmj.com/ Kallikrein.o- PK | HMWKq 8t XII -*xiiXIIa_4------- ATIII ~ ~ 'I L1HMWK - XI* Xla %' xC-a; --------- -- on September 28, 2021 by guest. Protected copyright. IX - IXa VII -e'VIIca Extrinsic pathway [X VIII a Ce X P'okin C ATIII Ca+ XIII Common mI ~V PL II a pathway I XIIIa Fibrinogen - Fibrin Fig. 1 The coagulation cascade. HMWK=high molecular weight Kinogen, PK=Pre-Kallikrein, A TIII=antithrornbin III, PL=platelets, Ca" = Calcium, TF=tissue factor, -t- =proteolytic activation, -+=conversion ofcoagulation protein, -- -+=inhibition by plasma inhibitors, tit =crosslinking, a=activated coagulation enzyme.
    [Show full text]
  • The Underrecognized Prothrombotic Vascular Disease of COVID-19
    Journal Articles 2020 The underrecognized prothrombotic vascular disease of COVID-19. KP Cohoon G Mahé AC Spyropoulos Zucker School of Medicine at Hofstra/Northwell, [email protected] Follow this and additional works at: https://academicworks.medicine.hofstra.edu/articles Part of the Internal Medicine Commons Recommended Citation Cohoon K, Mahé G, Spyropoulos A. The underrecognized prothrombotic vascular disease of COVID-19.. 2020 Jan 01; 4(5):Article 6487 [ p.]. Available from: https://academicworks.medicine.hofstra.edu/articles/ 6487. Free full text article. This Article is brought to you for free and open access by Donald and Barbara Zucker School of Medicine Academic Works. It has been accepted for inclusion in Journal Articles by an authorized administrator of Donald and Barbara Zucker School of Medicine Academic Works. For more information, please contact [email protected]. Received: 6 May 2020 | Revised: 16 May 2020 | Accepted: 21 May 2020 DOI: 10.1002/rth2.12396 LETTER TO THE EDITOR The underrecognized prothrombotic vascular disease of COVID-19 We have read with interest “COVID-19-associated coagulopathy around elevated markers of hypercoagulability, including D-dimer, and thromboembolic disease: Commentary on an interim expert tissue factor expression, fibrinogen levels, factor VIII levels, guidance” recently provided by Cannegieter and Klok.1 This com- short-activated partial thromboplastin time, platelet binding, and mentary exemplifies the importance that venous thromboembolism thrombin formation.8 Based on well-defined clinical and laboratory (VTE) and atheroembolism may be underrepresented and a cause parameters, a proposal for staging COVID-19 coagulopathy may for increased morbidity and mortality among coronavirus disease provide treatment algorithms stratified into 3 stages.9 However, 2019 (COVID-19) patients.
    [Show full text]