UvA-DARE (Digital Academic Repository)

Molecular, biochemical end clinical aspects of peroxisomes biogenesis disorders

Gootjes, J.

Publication date 2004 Document Version Final published version

Link to publication

Citation for published version (APA): Gootjes, J. (2004). Molecular, biochemical end clinical aspects of peroxisomes biogenesis disorders.

General rights It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).

Disclaimer/Complaints regulations If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible.

UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl)

Download date:11 Oct 2021 aii m

olecular,, biochemical and

o.. Q II clinical aspects off enesfridisorders s KlHNDII I -digilND i..££ <...... <...... MV.:

Bii fNDÏND ' TITND cellenn dood! Idem 31-1-86 —** A....™,.....* ; Henn dood I I 'Aanvragei i 19-5-91 1

gHff [ND 31-1-95 5 ïi""^|"'7" " '§-7-98'" " rnjnnnttiimjinmmitnjnmriivrrfrnjnnnttiimjinmmitnjnmriivrrf rrmrrmrrrrJiimnrmn rrrmrrrinirmmmrtvtrt iirtii

1r1.ri...f.).lfn(|||| uinutiuMtoteiuinutiuMtotei ii111111MmuwmiUMUM. ui* I UJU

rpaiMlVBijMiiw'Hii WÜMH— II ' MI—f n « nun * *l WHkMb '"'""""" | S&IH'HWIlBlC^WfWI'MWjMlilMMIIft 55 S5j iMfcM*M ! Ifijj'j ff?- —f." èwmumm* èwmumm* r^AarMVMM M WVJmWWWHH *WmWB^3^WH?Wa^7l W^W.'KWvkWtvhWrTyTO' RW I II 111)11 111IHI'flIMUHHffltf WWWWTWWlWWI

NDD pexl G843D-/-

11 !ND! fl -digi!ND ii T ND1II -digi! ND -- — Ête eï*\ï*\ i - i G blott afw 19-9-95 5 ift* * ND!! NCJ>arme t btee Gootjes Üf| !! T !NDp ND!ND ,, 1 ? | ï j ï ^ j G pexl l G843DD +/- blot afv noo 1 n i Molecular,, biochemical and clinicall aspects of peroxisomee biogenesis disorders Cover:: 'de start van mijn project' dee gebruikte namen zijn fictief Molecular,, biochemical and clinicall aspects of peroxisomee biogenesis disorders

ACADEMISCHH PROEFSCHRIFT

terr verkrijging van de graad van doctor aann de Universiteit van Amsterdam opp gezag van de Rector Magnificus prof.. mr. P.F. van der Heijden tenn overstaan van een door het collegee voor promoties ingestelde commissie, inn het openbaar te verdedigen in de Aula der Universiteit

opp donderdag 19 februari 2004, te 12.00 uur

door r

Jeannettee Gootjes

geborenn te Ens Promotiecommissie: :

Promotor: : Prof.. dr. R.J.A. Wanders

Co-promotor: : Dr.. H.R. Waterham

Overigee leden: Prof.. dr. J.M.F.G. Aerts Prof.. dr. H. van den Bosch Prof.. dr. H.S.A. Heymans Prof.. dr. C.J.F, van Noorden Dr.. B. Distel Dr.. F.A. Wijburg

Faculteitt der Geneeskunde

Thee work described in this thesis was carried out at the laboratory Genetic Metabolicc Diseases, departments of Clinical Chemistry and Pediatrics/Emma Children'ss Hospital, Academic Medical Center, University of Amsterdam, The Netherlandss and was supported financially by a grant from the Princess Beatrix Fund,, The Hague, The Netherlands.

Printedd by Ponsen & Looijen B.V. voorvoor oma

Contents s

Chapterr 1 Generall introduction

Chapterr 2 Biochemicall markers predicting survival in peroxisome biogenesiss disorders

Chapterr 3 Novell mutations in the PEX2 gene of four unrelated patientss with a peroxisome biogenesis disorder

Chapterr 4 Novell mutations in the PEX12 gene of patients with a peroxisomee biogenesis disorder

Chapterr 5 Identificationn of the molecular defect in patients with peroxisomall mosaicism using a novel method involvingg culturing of cells at 40°C: implications for ;-- otherr inborn errors of metabolism Chapterr 6 Reinvestigationn of trihydroxycholestanoic acidemia: a peroxisomee biogenesis disorder as true defect

|IIIIWIIIIII,'llrHIHIll)>> f.- ChaptejSfE E Rapidd diagnosis of peroxisomal biogenesis disorders byy means of immunofluorescence microscopy in lymphocytes s

Chapterr 8 Mutationall spectrum of peroxisome biogenesis disorders s

Summary y

Samenvatting g

Dankwoord d

CV V Abbreviations s

AAA A ATPasee associated with a various cellular activities AMACR R a-methylacyl-CoAA racemase BCOX X brartched-chainn acyl-CoA oxidase CG G complementationn group DBP P D-bifuncionall protein DHA A docosahexaenoicc acid DHAP P dihydroxyacetonephosphate e DHAPAT T dihydroxyacetonephosphateacyltransferase e DHCA A dihydroxycholestanoicc acid FCS S fetall calf serum HPLC C highh performance liquid chromatography IRD D infantilee Refsum disease MP P matrixx protein mPTS S membranee protein peroxisomal targeting signal NALD D neonatall adrenoleukodystrophy PAGE E polyacrylamidee gel electrophoresis PBD D peroxisomee biogenesis disorder PCR R polymerasee chain reaction PEG G polyethylenee glycol PEX X peroxin n PMP P peroxisomall membrane protein PP P pre-peroxisome e PTS S peroxisomall targeting signal PXMP3 3 peroxisomall membrane protein 3, PEX2 RCDP P rhizomelicc chondrodysplasia punctata SCOX X straight-chainn acyl-CoA oxidase SCPx x sterol-carrierr protein X SDS S sodiumm dodecyl sulfate THCA A trihydroxycholestanoicc acid TPR R tetratricopeptidee repeat VLCFA A very-longg chain fatty acid X-ALD D X-linkedd adrenoleukodystrophy ZS S Zellwegerr syndrome Chapterr 1

Generall introduction Chapterr 1 Introduction n

Thee disorder currently known as Zellweger syndrome (ZS, MIM# 214100) was first describedd in 1964 in two sib pairs as a familial syndrome of multiple congenital defects.1 In thee following years, two more reports on similar patients were published23 in which the termm cerebro-hepato-renal syndrome was introduced. In 1969, Opitz et al. suggested the namee Zellweger syndrome.4 A major hallmark in the research on Zellweger syndrome was thee discovery by Goldfischer et al. that peroxisomes where absent in the liver and kidney tubuless of Zellweger patients.5 Later, peroxisomes were also found to be deficient in the twoo other disorders neonatal adrenoleukodystrophy (NALD, MIM# 202370) and infantile Refsumm disease (IRD, MIM# 266510). ZS, NALD and IRD together form a spectrum of disease severityy with ZS being the most, and IRD the least severe disorder. The disorders are collectivelyy called peroxisome biogenesis disorders (PBDs). They have an incidence of approximatelyy 1 per 50,000 births.6

Peroxisomes s

Peroxisomess are the last discovered true subcellular organelles. In the 1950s, Rhodin discoveredd these organelles in kidney cells of mice and named them microbodies.7 In 1966, dee Duve et al. found hydrogen peroxide producing as well as degrading enzymes in these microbodiess and therefore named them peroxisomes.8 The significance of peroxisomes remainedd unclear for a long time, until the observation of their absence in Zellweger syndrome.55 Peroxisomes are single-membrane bounded organelles with a diameter of 0.1- 1.00 urn. They are found in virtually all eukaryotes, ranging from microorganisms (except archaezoa)) to plants and animals. In humans, peroxisomes are present in every cell, except forr red blood cells. Human cells typically contain several hundred peroxisomes, and they aree most abundant in liver and kidney. They are usually round or oval vesicles, although theyy sometimes appear to form elongated, tubular structures,9 or reticula.10 Peroxisomes havee a very high matrix-protein concentration, sometimes leading to crystalline inclusions.1112 2

Peroxisomee biogenesis

Peroxisomee biogenesis disorders are due to a defect in peroxisome formation. Cell fusion complementationn studies using patient fibroblasts (described later) revealed the existence off 12 distinct genetic groups (complementation groups, CG), representing defects in differentt genes. Currently all of the corresponding PEX genes have been identified. These PEXPEX genes encode proteins involved in the biogenesis of peroxisomes, called peroxins (PEX).. Currently, 29 peroxins have been identified in various species, of which 14 orthologss have been described in humans. Earlyy studies of PBD cell lines demonstrated a deficiency in peroxisomal matrix protein import,, whereas peroxisomal membrane assembly was relatively normal.1314 In these cells, emptyy peroxisomal membrane remnants that still contain some peroxisomal membrane proteinss (PMPs), but lack most of their internal content, were present, which are called ghosts.. Later studies also reported patient cell lines in which these peroxisomal ghosts

10 0 Generall introduction weree absent,1516 which implied a segregation of peroxisomal matrix protein import and peroxisomall membrane biogenesis.

PeroxisomalPeroxisomal membrane biogenesis Theree has been much controversy on the question how peroxisomes are formed. Accordingg to the earliest model, formation of new peroxisomes occurred by vesicle buddingg from the ER. This hypothesis was based on the electron microscopy observations, showingg that peroxisomes were found in close proximity to the ER.17 Later studies providedd evidence against this postulate, and abundant evidence suggested that peroxisomess multiply by fission of pre-existing peroxisomes (reviewed in Lazarow and Fujiki18).. This model proposes that newly synthesized peroxisomal membrane and matrix proteinss are incorporated in pre-existing peroxisomes. When a certain size is obtained, a neww peroxisome buds off, and the process starts over again (figure 1).

Figuree 1 Overview of the different hypotheticall models of peroxisome biogenesis.. In the model of Lazarow and Fujiki188 new peroxisomes are formed by buddingg from pre-existing peroxisomes. Inn the model of South and Gould20 for the re-introductionn of peroxisomes in ghost- lesss PEX16 cell lines, PEX16, peroxisomal membranee proteins (PMPs) and matrix proteinss (MP) are inserted subsequently intoo pre-peroxisomes (pp) to form maturee peroxisomes. The model of Titorenko222 involves pre-peroxisomal vesicless (PI and P2) derived from the ER, whichh fuse into P3 vesicles that develop viaa P4 and P5 into mature peroxisomes.

Waterhamm et al. found that peroxisomes in temperature-sensitive mutants of H. polymporpha,polymporpha, in which peroxisomes were absent when grown at 43°C, but present at 35°C, re-emergedd after a shift from restrictive to permissive temperature.19 Furthermore, South andd Gould described the re-introduction of peroxisomes into cells of ghost-less PEX16 deficientt human cell lines.20 These results suggest that peroxisomes are not necessarily derivedd from pre-existing peroxisomes. South and Gould proposed a model involving the existencee of (ER independent) preperoxisomal structures into which PEX16 is inserted afterr complementation/transfection (figure 1). After the import of other PMPs this model convergess with the model by Lazarow and Fujiki. However, recent experiments in the yeastt Y. lipolytica by Titorenko et al. indicated a role for the ER in peroxisome biogenesis. Theyy provided experimental evidence indicating that peroxisomes develop in a multistep processs that starts with the formation of pre-peroxisomal vesicles, thought to arise from a subdomainn of the ER, containing components of coat protein II vesicles (figure l).21-22 Inhibitionn with COPI and COPII inhibitors, however, was found to have no effect on peroxisomee formation.2324 Electron microscopy, immunocytochemistry and three- dimensionall image reconstruction of peroxisomes and associated compartments in mouse dendriticc cells also support the involvement of the ER.25 Future studies will show if these resultss are species-specific, or if both models can converge into one hybrid model.

11 1 Chapterr 1 Regardlesss of the way peroxisomes are formed, both models require that PMPs, which aree synthesized on free polyribosomes, are imported into the membrane, probably using a peroxisomall targeting sequence for membrane proteins (mPTS) to facilitate this. mPTSs havee been identified in several integral peroxins and other PMPs in different species (see referencess in Jones et al.26). Available evidence indicates that there is no apparent consensuss sequence. A hydrophilic peptide containing a group of positively charged aminoo acids adjacent to at least one hydrophobic patch or transmembrane domain was observedd several times, although there was no common amino acid sequence among them, andd any individual amino acid could be changed. Thee mPTSs need to be recognized in the cytosol, after which the PMPs are inserted into thee peroxisomal membrane. Based on the absence of peroxisomal ghosts in cell lines from patientss with defects in PEX3, PEX16 and PEX19,1516-27 it is assumed that the peroxins encodedd by these genes play a role in these processes. PEX199 is a farnesylated protein that is approximately 95% cytosolic and 5% peroxisomallyy associated.2829 It binds to an array of PMPs of diverse functions,282930313233 includingg peroxins (PEX3, 10, 11,12,13,14,16 and 17) and other PMPs. These results suggest aa role for PEX19 as a soluble mPTS receptor, which is supported by the finding of an overlapp between the regions of PMPs with which PEX19 binds and the mPTSs.28 However, otherss reported cases in which there was no overlap, and suggested a chaperone-like role forr PEX19.3134 Thee PEX3 gene encodes a 42- to 52- kDa membrane protein with its C-terminus facing thee cytosol. Opinions differ on whether the N-terminus is also cytosolic35 or intraperoxisomal.333 The exact function of PEX3 is unclear. It interacts with PEX19 via its C- 283335 36 terminall domain, not with its mPTS, - and many authors have suggested that PEX3 is requiredd for other membrane-bound peroxins to assemble in the peroxisome membrane (reviewedd in Purdue and Lazarow37) although there is no direct evidence. PEX166 has two putative membrane-spanning domains and exposes its C- and N- terminall domains to the cytosol.20 Its function is unknown, but it is likely to function upstreamm of PEX3.38 In contrast to PEX3 and PEX19, there is no S. cerevisiae PEX16 ortholog.. Besides humans, the only other organisms in which it has been reported, thus far,, are Y. lipolytica and Arabidopsis thaliana. In Y. lipolytica, PEX16 has different properties thann human ortholog, and plays no role in membrane assembly.39 In A. thaliana, PEX16 has aa role in protein and oil body biogenesis.40 Inn conclusion, there are still many uncertainties with respect to peroxisomal membrane biogenesis.. PEX19 is likely to serve as PMP receptor or chaperone, the functions of PEX3 andd PEX16 are less clear.

ImportImport of peroxisomal matrix enzymes Likee PMPs, the peroxisomal matrix proteins are synthesized on free polyribosomes in the cytosol,, and posttranslationally imported into the peroxisome. The peroxisomal import machineryy accepts folded proteins, oligomerized proteins and even gold particles fused to importt signals as substrates.4142 To reach their correct cellular location, the peroxisomal matrixx proteins contain specific peroxisomal targeting signals (PTS). More than 90% of all matrixx proteins contain a PTS1, a C-terminal tripeptide with a (S/A/C)-(K/R/H)-L consensuss sequence.43 Later studies found extended sequence lengths as well as species- dependentt ranges of possible conservative exchanges of the residues.44-47 A few matrix

12 2 Generall introduction proteinss are targeted by a PTS2, which is located near the N-terminus and has an (R/K)- (L/V/I)-(X)5-(H/Q)-(L/A)) consensus sequence.48 Recently a third PTS was identified in yeast:: PTS3.49 No human PTS3 proteins have been identified so far. Thee PTSs are bound by receptor proteins in the cytosol which target them to the peroxisomee (figure 2). PEX5 is the receptor for proteins containing a PTS1 or PTS3 and PEX77 is the receptor for proteins containing a PTS2. PEX5 has been described in a wide rangee of species. Mutations in PEX5 have been found as a cause of disease in PBD patients belongingg to CG2.50 PEX5 contains six tetratricopeptide repeats (TPRs) which together constitutee the binding site for the PTS1 of the cargo proteins,51-52 while highly conserved N- terminall pentapeptide repeats were shown to be essential for the interaction with the memberss of the docking complex.5354 The PTS2 receptor PEX7 contains six WD repeats, whichh are each approximately 40 amino acids long and contain a central tryptophan (W)- aspartatee (D) motif. To carry out its receptor function, PEX7 requires help from different species-specificc auxiliary proteins: PEX18 or PEX21 in S. cerevisiae,55 PEX20 in Y.lipolytica56 andd Neurospora crassa,57 or the longer of two splice isoforms of PEX5 (PEX5L) in mammals.58-599 These non-orthologous proteins possess a conserved sequence region that probablyy represents a common PEX7-binding site, suggesting the evolutionary conservationn of a functional module rather than an entire protein.56-58 PEX7 mutations are thee cause of disease in patients belonging to CG11.60 These patients are affected with rhizomelicc chondrodysplasia punctata (RCDP) type 1, a phenotype different from the Zellweger-spectrum.. These patients are only deficient in the few enzymes imported by the

pts2[C>> >7) |5G C{pts1

Figuree 2 Peroxisomal matrix protein import. PEX proteins (peroxins) are depicted as hexagons. Filledd hexagons represent human PEX proteins, open hexagons represent PEX proteins that havee not been identified in humans yet. Dashed arrows depict the extended shuttle model proposedd by Dammai and Subramani.7'1 The PTS2 protein/PEX7/PEX5L complex is imported comparablee to the PTS1 protein/PEX5 complex. See text for details.

13 3 Chapterr 1 PTS22 pathway, and present with proximal shortening of the limbs, periarticular calcifications,, microcephaly, coronal vertebral clefting, dwarfing, congenital cataract, ichthyosiss and severe mental retardation.6 Afterr binding their ligands, PEX5 and PEX7 bind to the components of the docking machineryy (figure 2). The transmembrane proteins PEX13 and PEX14, have been establishedd as members of the docking complex (reviewed in Holroyd and Erdmannftl). PEX133 and PEX14 both provide binding sites for PEX5 and PEX7. It is believed that PEX14 representss the initial docking site for both receptor proteins, because PEX14 has a higher affinityy for cargo-loaded PEX5, whereas PEX13 has a higher affinity for PEX5 alone.62 Moreover,, PEX13 and PEX14 form a complex with cargo-loaded PEX5, but dissociate in thee presence of unloaded PEX5.53 Mutations in PEX13 have been shown to cause the diseasee in CGI3 patients.63 PEX17 has been identified as a peripheral protein in Y. lipolyticalipolyticaMM and S. cerevisiae65 and as an integral membrane protein in P. pastoris.32 Although theree has been some controversy about PEX17 being involved in PMP import,32 most evidencee suggests PEX17 to be involved in matrix import only. The protein interacts with PEX14,655 but its exact function is unknown. No human PEX17 has been identified thus far. Afterr docking of the receptor-cargo complexes, the matrix proteins need to be translocatedd over the peroxisomal membrane (figure 2). The three peroxins PEX2, PEX10 andd PEX12 have been implicated in this process. Mutations in these genes are causing the diseasee in CG10,66 CG767-68 and CG3,69 respectively. All three belong to the family of RING zincc finger proteins, and have been identified in different yeast species and mammals. Theyy are all integral peroxisomal membrane proteins and have a cytosolic carboxy- terminall zinc-binding domain, which is thought to mediate protein-protein interactions. PEX100 and PEX12 interact with each other, and both proteins can also directly bind the PTS11 receptor PEX5.70"72 Moreover, PEX2, PEX5, PEX12 and PEX14 were found in a complexx in rat liver peroxisomes.73 PEX13 is also present in these complexes, but in non- stochiometricc amounts. Cells lacking one of these zinc-binding proteins accumulate PEX5 att the peroxisomal membrane, which suggests these proteins to act downstream of receptorr docking. How the translocation occurs mechanistically, and how the machinery cann accommodate folded and oligomerized proteins is unknown. PEX8 is an intra- peroxisomall peroxin, first identified in H. polymorpha74 and so far cloned in several yeast speciess only. It behaves like a peripheral peroxisomal membrane protein in P. pastoris/5 Y. HpolyticaHpolyticaMM and S. cerevisiae,76 whereas it is localized in the peroxisomal matrix in H. polymorpha.polymorpha.7474 All orthologs contain a PTS1 at the carboxy-terminus; H. poJymorpha PEX8 alsoo contains a PTS2. PEX8 directly interacts with PEX5, independent of its PTS1,76 althoughh it has not been shown if this interaction takes place inside the peroxisome. Since PEX88 contains a PTS1 and in H. polymorpha also a PTS2, it has been suggested to be involvedd in the dissociation of the cargo from the PTS receptors or in the subsequent recyclingg of the receptors,76 although others have implicated PEX8 in the association of the dockingg complex with the translocation complex.77 Initially,, the general model for peroxisomal matrix protein import proposed that the PTSS receptors recycle right back into the cytosol after dropping their cargo at the docking site.788 However, recent experiments indicate that PEX5 enters human peroxisomes during thee course of its function, and then re-emerges into the cytosol to carry out another round off import: the extended shuttle model (figure 2).79 Dammai and Subramani elegantly demonstratedd the proteolytic cleavage of a PEX5 fusion protein within peroxisomes and

14 4 Generall introduction detectedd the processed PEX5 in the cytosol. These experiments, however, cannot exclude thatt the fusion protein has only been inserted into the membrane with its amino-terminal sitee accessible to the protease, without actual transport across the membrane. Moreover, thee complete translocation of PEX5 would imply the presence of a, yet unknown, PEX5 exportt machinery. Afterr translocation of the cargo proteins, the PTS receptors PEX5 and PEX7 need to recyclee back to the cytosol for another cycle of protein import (figure 2). PEX1 and PEX6 havee been implicated in this recycling, and are both members of the AAA protein family (ATPasess associated with a various cellular activities). These proteins contain highly conservedd AAA domains of 230 amino acids, which contain Walker ATP binding sequencess and have ATP activity. Mutations in the genes encoding these proteins are disease-causingg in CGI8081 and CG4,82 respectively. Both proteins were found to interact withh each other.83 Localization studies have shown remarkable differences between variouss organisms. The proteins have been found peroxisomally associated and/or cytosolic,, and also present in vesicles distinct from mature peroxisomes.22-83'87 Cell lines defectivee in PEX1 and PEX6 have a defect in the import of matrix proteins.88 They are both importantt for the stability of PEX5,78-84 and they function in the terminal steps of the matrix proteinss import pathway.89 However, because other members of the AAA family are involvedd in membrane fusion processes90 and in some organisms PEX1 and PEX6 were foundd present in vesicles distinct from mature peroxisomes, they were also suggested to bee involved in the fusion of these small vesicles, leading to the maturation of peroxisomes.22833 Very recently, two proteins interacting with PEX1 and PEX6 have been reported.. In S. cerevisiae, PEX15 was described as an integral membrane protein that binds PEX66 in an ATP-dependent manner.91 In humans, the transmembrane protein PEX26 was discoveredd to cause the disease in PBD patients of CG8.92 This protein was shown to anchorr PEX6 and PEX1 to the peroxisomal membrane, in a PEX6-dependent manner. Later studiess showed that in human cell lines defective of PEX26, catalase and PTS2 protein importt was disturbed but PTS1 protein was normal,93 which makes the role of PEX26 and thee moment of action of PEX1 and PEX6 unclear. PEX44 is a peripherally associated peroxisomal membrane protein, located at the cytosolicc face of the peroxisome. The protein is kept at the peroxisomal membrane via interactionn with PEX22, an integral peroxisomal membrane protein.94 In cell lines defective inn these proteins, PEX5 protein level was severely decreased.89 Both PEX4 and PEX22 are involvedd in the import of peroxisomal matrix proteins,9495 and act in the final step, after PEX11 and PEX6,89 suggesting a role in receptor recycling. Their exact functions, however, aree still unclear. No human PEX4 and PEX22 have been identified so far.

PeroxisomePeroxisome proliferation PEX111 has been postulated to play a regulatory role in peroxisome proliferation, based on thee finding that cells lacking PEX11 contain few giant peroxisomes and appear to be unablee to segregate the giant peroxisomes to daughter cells.96 When PEX11 is overexpressed,, hyperproliferation occurs.9798 However, PEX11 was also found to play a metabolicc role in peroxisomal B-oxidation in S. cerevisiae." These authors suggested the rolee of PEX11 in peroxisome division to be secondary due to ongoing B-oxidation. Recently,, both the dynamin-like protein Vsplp (DLP1 in humans)100101 and the newly identifiedd PEX25 and PEX27102104 in S. cerevisiae were shown to be involved in peroxisome

15 5 Chapterr 1 proliferation.. Cells lacking these proteins had fewer and larger peroxisomes. The C- terminii of PEX25 and PEX27 are similar to the entire PEX11.104 Some of the cells lacking PEX255 had no peroxisomes detectable with immunofluorescence with antibodies against PTS1-- or PTS2-containing matrix proteins.102 Yeast two-hybrid analyses showed that PEX277 interacts with PEX25 and itself, PEX25 interacts with PEX27 and itself, and PEX11 interactss only with itself.103 Furthermore, in cells deleted for two other peroxins in S. cerevisiae,cerevisiae, PEX28 and PEX29, peroxisomes are increased in number, exhibit extensive clustering,, are smaller in area than peroxisomes of wild-type cells, and often exhibit membranee thickening between adjacent peroxisomes in a cluster.105 This implies a role for thesee two peroxins in peroxisome dynamics. Thus, PEX11, PEX25, PEX27, PEX28, PEX29 andd Vpslp/DLPl are candidates for a role in the regulation of peroxisome number, size, andd distribution. The underlying mechanisms, however, are still unclear.

Peroxisomall functions

Peroxisomess are involved in a number of essential metabolic functions in humans. The majorr functions are:

P-oxidationP-oxidation of fatty acids and fatty acid derivatives Thee peroxisome handles the p-oxidation of many substrates. These include very-long chainn fatty acids (VLCFAs), notably C26:0, the branched chain fatty acids, such as pristanic acid,, the bile acid intermediates di- and trihydroxycholestanoic acid (DHCA and THCA), somee long chain fatty acids and long chain dicarboxylic acids (products of ©-oxidation), andd the side chains of eicosanoids.106 Furthermore, it has become clear that the peroxisomall p-oxidation system is also involved in the last step of the biosynthesis of the poly-unsaturatedd fatty acid docosahexaenoic acid (DHA).107

PhytanicPhytanic acid a-oxidation Phytanicc acid and other 3-methyl-branched fatty acids are taken up from the diet with dairyy products, meat and fish being the most important sources. These compounds cannot bee degraded by the normal peroxisomal p-oxidation pathway, because of the methyl groupp on the C3 position. Therefore, they are broken down by the peroxisomal a-oxidation system.1088 Phytanic acid is thereby broken down to pristanic acid, which can be degraded by P-oxidation.. The deficiency in the second enzyme of phytanic acid a-oxidation: phytanoyl- CoAA hydroxylase, leads to Refsum disease [MIM# 266500].

Ether-phospholipidsEther-phospholipids biosynthesis Thee first two steps in the ether-phospholipid biosynthesis, catalyzed by the enzymes dihydroxyacetonephosphatee acyltransf erase (DHAPAT) and alkyl- dihydroxyacetonephosphate-synthasee (alkyl-DHAP-synthase), take place in the peroxisomes.. Deficiencies in these two enzymes in humans lead to RCDP type 2 [MIM# 222765]] and RCDP type 3 [MIM# 600121], respectively. In mammals, the main end- productss of the ether-phospholipid biosynthetic pathway are the plasmalogens, which are characterizedd by the presence of an alkenyl group at the sn-1 position of the glycerol backbone.. Plasmalogens are components of cellular membranes, make up approximately halff of the heart's phospholipids, but are most abundant in nervous tissue. They make up

16 6 Generall introduction approximatelyy 80 to 90% of the ethanolamine phospholipid class in myelin. Furthermore, plasmalogenss are decreased in the affected areas of the brain of Alzheimer's patients.109 However,, the functional significance of plasmalogens is unknown.

OtherOther peroxisomal functions Otherr metabolic pathways that take place inside peroxisomes, at least partly, are L- pipecolicc acid oxidation, glyoxylate metabolism, D-amino acid metabolism, hydrogen peroxidee metabolism, purine metabolism and fatty acid chain elongation. Although the involvementt of peroxisomes in the biosynthesis of isoprenoid/cholesterol biosynthesis was generallyy accepted for many years,110 recent data strongly suggest that peroxisomes are not involvedd inhuman isoprenoid/cholesterol biosynthesis.111112

PBDD Phenotypes

Ass described in the introduction, the peroxisome biogenesis disorders form a disease spectrumm comprising of the three disorders Zellweger syndrome, neonatal adrenoleukodystrophyy and infantile Refsum disease.

ZellwegerZellweger syndrome Thee cerebro-hepato-renal syndrome of Zellweger is the most severe PBD, and is characterizedd by the complete absence of functional peroxisomes and peroxisomal functions.. Patients display a characteristic facial appearance with a large anterior fontanel, highh forehead, hypoplastic supraorbital ridges, epicanthal folds and a broad nasal bridge. Ocularr abnormalities include cateracts, glaucoma, corneal clouding, Brushfield spots, pigmentaryy retinopathy and optic nerve dysplasia. Sensorineural deafness is often present andd patients are mentally retarded. Additionally, there is severe hypotonia, weakness and neonatall seizures. The development of internal organs (brain, liver, kidney) and the skeletonn is disturbed. Radiologic examination reveals abnormal punctuate calcifications in thee patella and epiphyses of the long bones. Renal cysts are common. Most patients die withinn the first year of life.6

NeonatalNeonatal adrenoleukodystropy NALDD was first described by Ulrich et al. as connatal ALD in a boy who presented at birth withh hypotonia, convulsions, absent grasp reflex, slight Moro response, and little spontaneouss movements.113 He showed all signs diagnostic of ALD, including the characteristicc demyelination of the central nervous system white matter, atrophy of the adrenall cortex, ballooned adrenocortical cells and splinter-like lamellar elements composedd of electron-dense leaflets separated by a clear space. NALD should not be confusedd with X-linked adrenoleukodystrophy (X-ALD, MIM# 300100), which is not a peroxisomee biogenesis disorder, but a defect in the ABCD1 gene resulting in a deficiency inn the peroxisomal B-oxidation and accumulation of VLCFAs. To distinguish between ZS andd NALD, Kelley et al. defined criteria to distinguish between the two disorders.114 Althoughh many cases could be classified by these criteria, a number of patients remained withh symptoms of both disorders. However, since it is now firmly established that the PBDss form a disease continuum, NALD is now defined as a less severe form of ZS,

17 7 Chapterr 1 involvingg progressive white matter disease, with patients surviving from several months off life up until their mid-teens.

InfantileInfantile Refsum disease IRDD is the mildest phenotype of the PBDs. It was first described by Scotto and co-workers inn three cases of young children presenting with several neurological abnormalities and hepatomegaly.1155 Initially, IRD was thought to be a variant of Refsum disease, a single enzymee defect, in which phytanic acid accumulates. However, later studies revealed the presencee of a general peroxisomal dysfunction,116 which was confirmed by the absence of peroxisomess in liver.117 Patients with IRD have external features reminiscent of ZS, but no neuronall migration disorder, and no progressive white matter disease. Their cognitive and motorr development varies between severe global handicap and moderate learning disorderr with deafness and visual impairment due to retinopathy. Their survival is variable.. Most patients with IRD reach childhood and some even reach adulthood.

Diagnosiss of PBDs

BiochemicalBiochemical analysis Thee laboratory diagnosis of a PBD starts with the analysis of various parameters in plasma (concentrationss of VLCFAs, pristanic acid, phytanic acid, bile acid intermediates, poly- unsaturatedd fatty acids and L-pipecolic acid) and erythrocytes (plasmalogens and poly- unsaturatedd fatty acids).118 When a PBD is suspected, this is followed by the measurement off various parameters in cultured skin fibroblasts (VLCFA concentration, C26:0 and pristanicc acid p-oxidation, phytanic acid a-oxidation, DHAPAT activity and immunoblot analysiss to assess the peroxisomal processing of the P-oxidation enzymes straight chain acyl-CoAA oxidase and 3-ketoacyl-CoA thiolase). The diagnosis is completed by immunofluorescencee microscopy with antibodies against the peroxisomal enzyme catalase,, to confirm the absence of peroxisomes, and with antibodies against the peroxisomall membrane protein ALDP to reveal the presence or absence of peroxisomal ghosts. .

noo complementation: CG

CG11 CG? -* li#v-\ complementation: repeatt with other CGs Figuree 3 Complementation analysis. Cells from a new patient are fused with cells from a patient belongingg to a known complementation group (CG). When no complementation occurs, the defectivee genes in both patients are the same. Otherwise, the procedure is repeated with other CGs. .

ComplementationComplementation analysis Whenn the diagnosis of a PBD is established, cell fusion complementation analysis is performed,, to identify the defective PEX gene.119 In this technique, fibroblasts from a new

18 8 Generall introduction patientt are fused with cells from a patient belonging to a known complementation group, therebyy combining the genetic information of both patients (figure 3). When the cells do nott complement each other and there is no restoration of peroxisome formation, the defectivee genes in both patients are the same. If peroxisomes are formed, the defective genee in both patients is different. Peroxisome formation is assayed by catalase immunofluorescencee microscopy. InIn our laboratory, so far, 246 PBD patients have been assigned to the 12 different complementationn groups (table 1). The percentages in this table are comparable to the data inn literature.6 Most complementation groups are associated with more than one clinical phenotype.1200 The large majority of the patients belong to CGI, caused by mutations in the PEX1PEX1 gene. The second most common CG is CG4, in which PEX6 is defective. Together, defectss in these two AAA-ATPases account for more than 70% of the PBD patients.

Tablee 1 Complementation groups in Amsterdam Complementationn Group KKI' ' Gifub b Gene e Patients s %« « 1 1 E E PEX1 1 174 4 59 9 2 2 PEX5 5 5 5 2 2 3 3 PEX12 2 16 6 6 6 4 4 C C PEX6 6 31 1 12 2 7 7 B B PEX10 0 3 3 1 1 8 8 A A PEX26 6 4 4 2 2 9 9 D D PEX16 6 2 2 1 1 10 0 F F PEX2 2 7 7 3 3 11 1 R R PEX7 7 n.i. . n.i. . 12 2 G G PEX3 3 0 0 0 0 13 3 H H PEX13 3 2 2 1 1 14 4 J J PEX19 9 2 2 1 1 aa Kennedy Krieger institute, Baltimore, USA, b Gifu univeristy,, Gifu, Japan, ' % of cell lines complemented withh this CG, CG11 was excluded, n.i. not included

MutationsMutations in the PEX genes Mutationn analysis has been performed in all of the complementation groups.6 Only for twoo mutations in CGI (PEX1) a high allele frequency has been found. The first mutation is aa point mutation 2528G>A causing the missense mutation G843D.8081 This mutation attenuatess the activity of the protein and is associated with the mild IRD phenotype. It reducess the binding ability between PEX1 and PEX6.121 The G843D allele frequency ranges fromm 25% to 37% in the different cohorts.80122-126 The second mutation is the insertion 2097- 2098insT,, which results in a frameshift and low steady state PEX1 mRNA levels.122125 At thee protein level it leads to truncation of the PEX1 protein within the protein's second AAAA domain, abolishing its PEX1 activity. It is associated with the severe ZS phenotype. Thiss mutation has an allele frequency of around 30%.122125126 Together, these mutations accountt for around 60% of all PEX1 alleles, which is about 40% of all PBD alleles. Furthermore,, in the Japanese population, a common mutation in PEX10 has been found, duee to a founder effect.127 This 2-bp deletion 814-815delCT is present in a homozygous formm in all 11 Japanese PEX10 patients. Most of the other mutations found in the PEX geness are unique to one patient or family.

19 9 Chapterr 1 TemperatureTemperature sensitivity Studiess in fibroblasts of patients with milder forms of PBDs (IRD and some NALD patients)) have shown temperature sensitivity of biochemical parameters.128 In these cells, a (partial)) restoration of peroxisome formation and peroxisome function was observed, whenn cells were cultured at 30°C instead of 37°C. This phenomenon has been reported for patientss belonging to CGI (PEX1),12-3 CG4 (PEX6),129 CG8 (PEX26),130 CG10 (PEX2),128 and CG133 (PEX13)131 and is associated with specific (point-)mutations.

Therapy y

Becausee the peroxisome biogenesis disorders have a genetic origin, and multiple malformationss and neocortical alterations in the brain originate prenatally, treatment of patientss is limited, but there are possibilities for treatment of symptoms, especially for patientss with milder phenotypes. The treatment strategies can be divided into two groups: correctionn of biochemical deficiencies or accumulations, and pharmacological induction of peroxisomes. . Too correct plasmalogen levels, ether lipids have been administered orally, which resultedd in a partial normalization of red blood cell plasmalogen levels.132 The high VLCFA couldd be (partially) corrected by a diet also used in the treatment of X-ALD,133 which also normalizedd phytanic acid levels.6 To correct DHA levels, cholic and chenodeoxycholic acidss have been administered, which resulted in improved liver function and improvementt in neurologic status.134 Another approach to correct DHA levels was by administeringg DHA ethyl ester,135 which resulted in a normalization of DHA levels and liverr function, improvement of vision and muscle tone, as well as improvement of myelinationn as studied by MRI.136 The effect was the largest in patients who started the treatmentt before 6 months of age. In addition to the DHA correction, VLCFA levels decreasedd and plasmalogen levels increased. The decreased levels of a-tocopherol that are foundd in many patients can be corrected by oral vitamin E suppletion. Inductionn of peroxisomes has been tried by the administration of the peroxisomal proliferatorr clofibrate. Although this did have effects in rodents, it did not have any result inn humans.137138 The peroxisome proliferator sodium 4-phenylbutyrate has only been testedd in human fibroblasts yet, but did show promising results.139 After treatment of PBD fibroblasts,, an approximate two-fold increase in peroxisome number was observed. In NALDD and IRD fibroblasts there was an increase in very-long-chain fatty acid p-oxidation andd plasmalogen concentrations, and a decrease in very-long-chain fatty acid concentrations.. No clinical studies with this compound have been performed yet. Inn conclusion, although many defects in PBD patients originate prenatally, symptomaticc treatment was found to be beneficial in patients, and new strategies like the administrationn of 4-phenylbutyrate, are being investigated that might result in the upregulationn of peroxisomes in patients.

Outlinee of this thesis

Itt is evident that our knowledge of peroxisome biogenesis, peroxisomal functions and the peroxisomee biogenesis disorders has expanded enormously since the discovery of peroxisomess in the 1950s. Many peroxins, indispensable for peroxisome formation, have

20 0 Generall introduction beenn identified and a 'corner of the veil has been lifted' about how these peroxins function. Muchh has been learned about the metabolic pathways that function inside the peroxisomes.. Furthermore, many PBD patients have been described, and the initial idea of threee or more separate peroxisomal disorders had been abandoned, and it is now clear thatt the disorders form a disease spectrum and originate from defects in the same genes, whichh is why they are now collectively called the peroxisome biogenesis disorders. Thiss marked genetic heterogeneity and the presence of many unique mutations among patientss with a PBD are causing complications in genotype-phenotype studies. Therefore, in chapterr two propose to use a different approach to predict the life expectancy of the patients: byy examining the effects of the defective genes on peroxisome function, rather that the mutationss themselves. Therefore we conducted a search for suitable biochemical parameters, whichh would be best in predicting the severity of patients. In chapter three and four, we reportt novel mutations in the PEX2 and PEX12 genes of PBD patients, shedding new light onn the differences in importance of the zinc-binding domains in the proteins encoded by thesee genes. Chapter five describes eight PBD patients with a very unusual biochemical phenotype,, characterized by abnormal peroxisomal plasma metabolites, but normal to veryy mildly abnormal parameters in cultured skin fibroblasts, including a mosaic catalase immunofluorescencee pattern, which so far made complementation analysis impossible. Wee developed a novel complementation technique and characterized the patients. In chapterr six the reinvestigation of a unique patient is described, who was reported with a presumedd deficiency in THCA-CoA oxidase, but instead was found to be suffering from a mildd PBD, although peroxisomes in fibroblasts appeared normal. Chapter seven describes a rapid,, non-invasive alternative technique to determine the presence of peroxisomes in patientt cells: immunofluorescence microscopy analysis in lymphocytes, which can be isolatedd from the same blood samples as used for metabolite analyses. In chapter eight, we reportt all mutations in the different PEX genes that have been determined in our laboratoryy so far, combined with those reported in literature.

References s

1.. Bowen P., Lee C.S.N., Zellweger H. and Lindenberg R. (1964) A familial sndrome of multiple congenital anomalies.. Bull Johns Hopkins Hosp 114: 402-414. 2.. Smith D.W., Opitz J.M and Inhorn S.L. (1965) A syndrome of multiple developmental defects including polycysticc kidneys and intrahepatic biliary dysgenesis in 2 siblings. J.Pediatr. 67: 617-624. 3.. Passarge E. and McAdams AJ. (1967) Cerebro-hepato-renal syndrome. A newly recognized hereditary disorderr of multiple congenital defects, including sudanophilic leukodystrophy, cirrhosis of the liver, andd polycystic kidneys. J.Pediatr, 71: 691-702. 4.. Opitz J.M., ZuRhein G.M., Vitale L., Shahidi NT., Howe J., Chon S., Shanklin D., Sybers Hv Dood A. andd Gerritsen T. (1969) The Zellweger syndrome (cerebrohepatorenal syndrome). Birth Defects 5: 144- 158. . 5.. Goldfischer S., Moore C.L., Johnson A.B., Spiro AJ., Valsamis M.P., Wisniewski H.K., Ritch R.H., Nortonn W.T., Rapin I. and Gartner L.M. (1973) Peroxisomal and mitochondrial defects in the cerebro- hepato-renall syndrome. Science 182: 62-64. 6.. Gould S.J., Raymond G.V. and Valle D. (2001) The peroxisome biogenesis disorders. In: Scriver C.R., Beaudett A.L., Valle D. and Sly W.S. (eds.) The metabolic and molecular bases of inherited disease. McGraw-Hill,, New York, 3181-3217. 7.. Rhodin J. (1954) Correlation of ultrastructural organisation and function in normal and experimentally changedd proximal convoluted tubule eels of the mouse kidney. 8.. de Duve C. and Baudhuin P. (1966) Peroxisomes (microbodies and related particles). Physiol Rev. 46: 323-357. .

21 1 Chapterr 1

9.. Schrader ML, Burkhardt J.K., Baumgart E., Luers G., Spring Hv Volkl A. and Fahimi H.D. (1996) Interactionn of microtubules with peroxisomes. Tubular and spherical peroxisomes in HepG2 cells and theirr alterations induced by microtubule-active drugs. Eur.J.Cell Biol, 69: 24-35. 10.. Gorgas K. (1984) Peroxisomes in sebaceous glands. V. Complex peroxisomes in the mouse preputial gland:: serial sectioning and three-dimensional reconstruction studies. Anat.Embryol.(Berl) 169: 261-270. 11.. Veenhuis M., Harder W., van Dijken J.P. and Mayer F. (1981) Substructure of crystalline peroxisomes in methanol-grownn Hansenula polymorpha: evidence for an in vivo crystal of alcohol oxidase. Mol.Cell Biol.Biol. 1: 949-957. 12.. Goldfischer S. and Reddy J.K. (1984) Peroxisomes (microbodies) in cell pathology. Int.Rev.Exp.Pathol. 26: 45-84. . 13.. Santos M.J., Imanaka T., Shio H., Small G.M. and Lazarow P.B. (1988) Peroxisomal membrane ghosts in Zellwegerr syndrome-aberrant organelle assembly. Science 239: 1536-1538. 14.. Santos M.J., Imanaka T., Shio H. and Lazarow P.B. (1988) Peroxisomal integral membrane proteins in controll and Zellweger fibroblasts. J.Biol.Chem. 263:10502-10509. 15.. Honsho M., Tamura S., Shimozawa N., Suzuki Y., Kondo N. and Fujiki Y. (1998) Mutation in PEX16 is causall in the peroxisome-deficient Zellweger syndrome of complementation group D. Am.J.Hum.Genet. 63:: 1622-1630. 16.. Matsuzono Y., Kinoshita N., Tamura S„ Shimozawa N., Hamasaki M., Ghaedi K„ Wanders R.J., Suzuki Y.,, Kondo N. and Fujiki Y. (1999) Human PEX19: cDNA cloning by functional complementation, mutationn analysis in a patient with Zellweger syndrome, and potential role in peroxisomal membrane assembly.. Proc.Natl.Acad.Sci.U.S.A 96: 2116-2121. 17.. Novikoff A. and Shin W. (1964) The endoplasmic reticulum in the Golgi zone and its relations to microbodies,, Golgi-apparatus and autophagic vacuoles in rat liver cells. J.Microscopy 3: 187-206. 18.. Lazarow P.B. and Fujiki Y. (1985) Biogenesis of peroxisomes. Annu.Rev.Cell Biol. 1: 489-530. 19.. Waterham H.R., Titorenko V.I., Swaving G.J., Harder W. and Veenhuis M. (1993) Peroxisomes in the methylotrophicc yeast Hansenula polymorpha do not necessarily derive from pre-existing organelles. EMBOEMBO J. 12: 4785-4794. 20.. South S.T. and Gould S.J. (1999) Peroxisome synthesis in the absence of preexisting peroxisomes. J.Cell Biol.Biol. 144: 255-266. 21.. Titorenko V.I. and Rachubinski R.A. (2001) The life cycle of the peroxisome. Nat.Rev.Mol.Cell Biol. 2: 357- 368. . 22.. Titorenko V.I., Chan H. and Rachubinski R.A. (2000) Fusion of small peroxisomal vesicles in vitro reconstructss an early step in the in vivo multistep peroxisome assembly pathway of Yarrowia lipolytica. J.CellJ.Cell Biol. 148: 29-44. 23.. Voorn-Brouwer T., Kragt A., Tabak H.F. and Distel B. (2001) Peroxisomal membrane proteins are properlyy targeted to peroxisomes in the absence of. J.Cell Sci. 114: 2199-2204. 24.. South S.T., Sacksteder K.A., Li X., Liu Y. and Gould SJ. (2000) Inhibitors of COPI and COPII do not blockk PEX3-mediated peroxisome synthesis. J.Cell Biol. 149: 1345-1360. 25.. Geuze H.J., Murk J.L., Stroobants A.K., Griffith J.M., Kleijmeer M.J., Koster A.J., Verkleij A.]., Distel B. andd Tabak H.F. (2003) Involvement of the endoplasmic reticulum in peroxisome formation. Mol.Biol.Cell 14:: 2900-2907. 26.. Jones J.M., Morrell J.C. and Gould S.J. (2001) Multiple distinct targeting signals in integral peroxisomal membranee proteins. J.Cell Biol. 153:1141-1150. 27.. Shimozawa N., Suzuki Y., Zhang Z., Imamura A., Ghaedi K., Fujiki Y. and Kondo N. (2000) Identificationn of PEX3 as the gene mutated in a Zellweger syndrome patient lacking peroxisomal remnantt structures. Hum.Mol.Genet. 9: 1995-1999. 28.. Sacksteder K.A., Jones J.M., South S.T., Li X., Liu Y. and Gould S.J. (2000) PEX19 binds multiple peroxisomall membrane proteins, is predominantly cytoplasmic, and is required for peroxisome membranee synthesis. J.Cell Biol. 148: 931-944. 29.. Snyder W.B., Faber K.N., Wenzel T.J., Koller A., Luers G.H., Rangell L., Keller G.A. and Subramani S. (1999)) Pexl9p interacts with Pex3p and PexlOp and is essential for peroxisome biogenesis in Pichia pastoris.. Mol.Biol.Cell 10: 1745-1761.

30.. Gotte Kv Girzalsky W., Linkert M., Baumgart E., Kammerer S., Kunau W.H. and Erdmann R. (1998) Pexl9p,, a farnesylated protein essential for peroxisome biogenesis. Mol.Cell Biol. 18: 616-628. 31.. Snyder W.B., Koller A., Choy A.J. and Subramani S. (2000) The peroxin Pexl9p interacts with multiple, integrall membrane proteins at the peroxisomal membrane. J.Cell Biol. 149:1171-1178. 32.. Snyder W.B., Koller A., Choy A.J., Johnson M.A., Cregg J.M., Rangell L., Keller G.A. and Subramani S. (1999)) Pexl7p is required for import of both peroxisome membrane and lumenal proteins and interacts 22 2 Generall introduction

withh Pexl9p and the peroxisome targeting signal-receptor docking complex in Pichia pastoris. Mol.Biol.CellMol.Biol.Cell 10:4005-4019. 33.. Soukupova M, Sprenger C, Gorgas K., Kunau W.H. and Dodt G. (1999) Identification and characterizationn of the human peroxin PEX3. Eur.j.Cell Biol. 78: 357-374. 34.. Fransen M., Wylin T., Brees C., Mannaerts G.P. and Van Veldhoven P.P. (2001) Human pexl9p binds peroxisomall integral membrane proteins at regions distinct from their sorting sequences. Mol.Cell Biol. 21:: 4413-4424. 35.. Ghaedi K., Tamura S., Okumoto K., Matsuzono Y. and Fujiki Y. (2000) The peroxin pex3p initiates membranee assembly in peroxisome biogenesis. Mol.Biol.Cell 11: 2085-2102. 36.. Muntau A.C., Mayerhofer P.U., Paton B.C., Kammerer S. and Roscher A.A. (2000) Defective peroxisome membranee synthesis due to mutations in human PEX3 causes Zellweger syndrome, complementation groupp G. Am.J.Hum.Cenet. 67: 967-975. 37.. Purdue P.E. and Lazarow P.B. (2001) Peroxisome biogenesis. Annu.Rev.Cell Dev.Biol. 17: 701-752. 38.. Honsho M., Hiroshige T. and Fujiki Y. (2002) The membrane biogenesis peroxin Pexl6p. Topogenesis andd functional roles in peroxisomal membrane assembly. J.Biol.Chem. Til: 44513-44524. 39.. Eitzen G.A., Szilard R.K. and Rachubinski R.A. (1997) Enlarged peroxisomes are present in oleic acid- grownn Yarrowia lipolytica overexpressing the PEX16 gene encoding an intraperoxisomal peripheral membranee peroxin. J.Cell Biol 137:1265-1278. 40.. Lin Y„ Sun L., Nguyen L.V., Rachubinski R.A. and Goodman H.M. (1999) The Pexlóp homolog SSE1 andd storage organelle formation in Arabidopsis seeds. Science 284: 328-330. 41.. McNew J.A. and Goodman J.M. (1994) An oligomeric protein is imported into peroxisomes in vivo. J.CellJ.Cell Biol. 127: 1245-1257. 42.. Walton P.A., Hill P.E. and Subramani S. (1995) Import of stably folded proteins into peroxisomes. Mol.Biol.CellMol.Biol.Cell 6: 675-683. 43.. Gould S.J., Keller G.A., Hosken N., Wilkinson J. and Subramani S. (1989) A conserved tripeptide sorts proteinss to peroxisomes. J.Cell Biol. 108:1657-1664. 44.. Elgersma Y., Vos A., Van den B.M., van Roermund C.W., van der S.P., Distel B. and Tabak H.F. (1996) Analysiss of the carboxyl-terminal peroxisomal targeting signal 1 in a homologous context in Saccharomycess cerevisiae. J.Biol.Chem. 271: 26375-26382. 45.. Lametschwandtner G., Brocard C, Fransen M., Van Veldhoven P., Berger J. and Hartig A. (1998) The differencee in recognition of terminal tripeptides as peroxisomal targeting signal 1 between yeast and humann is due to different affinities of their receptor Pex5p to the cognate signal and to residues adjacent too it. J.Biol.Chem. 273: 33635-33643. 46.. Miura S., Kasuya-Arai I., Mori H., Miyazawa S., Osumi T., Hashimoto T. and Fujiki Y. (1992) Carboxyl- terminall consensus Ser-Lys-Leu-related tripeptide of peroxisomal proteins functions in vitro as a minimall peroxisome-targeting signal. J.Biol.Chem. 267:14405-14411. 47.. Subramani S., Koller A. and Snyder W.B. (2000) Import of peroxisomal matrix and membrane proteins. Annu.Rev.Biochem.Annu.Rev.Biochem. 69: 399-418. 48.. Swinkels B.W., Gould S.J., Bodnar A.G., Rachubinski R.A. and Subramani S. (1991) A novel, cleavable peroxisomall targeting signal at the amino-terminus of the rat 3-ketoacyl-CoA thiolase. EMBO J. 10: 3255- 3262. . 49.. Klein AT., Van den B.M., Bottger G., Tabak H.F. and Distel B. (2002) Saccharomyces cerevisiae acyl- CoAA oxidase follows a novel, non-PTSl, import pathway into peroxisomes that is dependent on Pex5p. J.Biol.Chem.J.Biol.Chem. 277: 25011-25019. 50.. Dodt G., Braverman N., Wong C., Moser A., Moser H.W., Watkins P., Valle D. and Gould S.J. (1995) Mutationss in the PTS1 receptor gene, PXR1, define complementation group 2 of the peroxisome biogenesiss disorders. Nat.Genet. 9:115-125. 51.. Brocard C, Kragler F., Simon M.M., Schuster T. and Hartig A. (1994) The tetratricopeptide repeat- domainn of the PAS10 protein of Saccharomyces cerevisiae is essential for binding the peroxisomal targetingg signal-SKL. Biochem.Biophys.Rcs.Commun. 204: 1016-1022. 52.. Gatto G.J., Jr., Geisbrecht B.V., Gould S.J. and Berg J.M. (2000) Peroxisomal targeting signal-1 recognitionn by the TPR domains of human PEX5. Nal.Struct.Biol. 7: 1091-1095. 53.. Otera H., Setoguchi K., Hamasaki M., Kumashiro T., Shimizu N. and Fujiki Y. (2002) Peroxisomal targetingg signal receptor Pex5p interacts with cargoes and import machinery components in a spatiotemporallyy differentiated manner: conserved Pex5p WXXXF/Y motifs are critical for matrix proteinn import. Mol.Cell Biol. 22:1639-1655. 54.. Saidowsky J., Dodt G., Kirchberg K., Wegner A., Nastainczyk W., Kunau W.H. and Schliebs W. (2001) Thee di-aromatic pentapeptide repeats of the human peroxisome import receptor PEX5 are separate high 23 3 Chapterr 1

affinityy binding sites for the peroxisomal membrane protein PEX14. J.Biol.Chem. 276: 34524-34529. 55.. Purdue P.E., Yang X. and Lazarow P.B. (1998) Pexl8p and Pex21p, a novel pair of related peroxins essentiall for peroxisomal targeting by the PTS2 pathway. J.Cell Biol. 143:1859-1869. 56.. Einwachter H., Sowinski S., Kunau W.H. and Schliebs W. (2001) Yarrowia lipolyrica Pex20p, Saccharomycess cerevisiae Pexl8p/Pex21p and mammalian PexSpL fulfil a common function in the early stepss of the peroxisomal PTS2 import pathway. EMBO Rep. 2: 1035-1039. 57.. Sichting M, Schell-Steven A., Prokisch H., Erdmann R. and Rottensteiner H. (2003) Pex7p and Pex20p of Neurosporaa crassa Function Together in PTS2-dependent Protein Import into Peroxisomes. Mol.Biol.Cell 14:810-821. . 58.. Dodt G., Warren D., Becker E., Rehling P. and Gould SJ. (2001) Domain mapping of human PEX5 revealss functional and structural similarities to Saccharomyces cerevisiae Pexl8p and Pex21p. I.Biol.Chem.I.Biol.Chem. 276: 41769-41781. 59.. Otera H., harano t., Honsho M., Ghaedi K., Mukai S., Tanaka A., Kawai A., Shimizu N. and Fujiki Y. (2000)) The mammalian peroxin Pex5pL, the longer isoform of the mobile peroxisome targeting signal (PTS)) type 1 transporter, translocates the Pex7p.PTS2 protein complex into peroxisomes via its initial dockingg site, Pexl4p. J.Biol.Chem. 275: 21703-21714. 60.. Motley A.M., Hettema E.H., Hogenhout E.M., Brites P., ten Asbroek A.L., Wijburg F.A., Baas F., Heijmanss H.S., Tabak H.F., Wanders R.J. and Distel B. (1997) Rhizomelic chondrodysplasia punctata is a peroxisomall protein targeting disease caused by a non-functional PTS2 receptor. Nat.Genet. 15: 377-380. 61.. Holroyd C. and Erdmann R. (2001) Protein translocation machineries of peroxisomes. FEBS Lett. 501: 6- 10. . 62.. Urquhart A.J., Kennedy D., Gould S.J. and Crane D.I. (2000) Interaction of Pex5p, the type 1 peroxisome targetingg signal receptor, with the peroxisomal membrane proteins Pexl4p and Pexl3p. J.Biol.Chem. 275: 4127-4136. . 63.. Liu Y., Bjorkman J., Urquhart A., Wanders R.J., Crane D.I. and Gould S.J. (1999) PEX13 is mutated in complementationn group 13 of the peroxisome-biogenesis disorders. Am.J.Hum.Genet. 65: 621-634, 64.. Smith J.J., Szilard R.K., Marelli M. and Rachubinski R.A. (1997) The peroxin Pexl7p of the yeast Yarrowiaa lipolyrica is associated peripherally with the peroxisomal membrane and is required for the importt of a subset of matrix proteins. Mol.Cell Biol. 17: 2511-2520. 65.. Huhse B„ Rehling P., Albertini M., Blank L., Meller K. and Kunau W.H. (1998) Pexl7p of Saccharomyces cerevisiaee is a novel peroxin and component of the peroxisomal protein translocation machinery. J.Cell Biol.Biol. 140: 49-60. 66.. Shimozawa N., Tsukamoto T., Suzuki Y., Orii T., Shirayoshi Y., Mori T. and Fujiki Y. (1992) A human genee responsible for Zellweger syndrome that affects peroxisome assembly. Science 255: 1132-1134. 67.. Okumoto K., Itoh Rv Shimozawa N., Suzuki Y., Tamura S., Kondo N. and Fujiki Y. (1998) Mutations in PEX100 is the cause of Zellweger peroxisome deficiency syndrome of complementation group B. Hum.Mol.Genet.Hum.Mol.Genet. 7:1399-1405. 68.. Warren D.S., Morrell J.C., Moser H.W., Valle D. and Gould S.J. (1998) Identification of PEX10, the gene defectivee in complementation group 7 of the peroxisome-biogenesis disorders. Am.J.Hum.Genet. 63: 347- 359. . 69.. Chang C.C., Lee W.H., Moser H., Valle D. and Gould SJ. (1997) Isolation of the human PEX12 gene, mutatedd in group 3 of the peroxisome biogenesis disorders. Nat.Genet. 15: 385-388. 70.. Chang C.C., Warren D.S., Sacksteder K.A. and Gould SJ. (1999) PEX12 interacts with PEX5 and PEX10 andd acts downstream of receptor docking in peroxisomal matrix protein import. J.Cell Biol. 147: 761-774. 71.. Okumoto K., Abe I. and Fujiki Y. (2000) Molecular anatomy of the peroxin Pexl2p: ring finger domain is essentiall for Pexl2p function and interacts with the peroxisome- targeting signal type 1-receptor Pex5p andd a ring peroxin, PexlOp. J.Biol.Chem. 275: 25700-25710. 72.. Albertini M., Girzalsky W., Veenhuis M. and Kunau W.H. (2001) Pexl2p of Saccharomyces cerevisiae is aa component of a multi-protein complex essential for peroxisomal matrix protein import. Eur.J.Cell Biol. 80:: 257-270. 73.. Reguenga C, Oliveira M.E., Gouveia A.M., Sa-Miranda C. and Azevedo J.E. (2001) Characterization of thee mammalian peroxisomal import machinery: Pex2p, Pex5p, Pexl2p, and Pexl4p are subunits of the samee protein assembly. J.Biol.Chem. 276: 29935-29942. 74.. Waterham H.R., Titorenko V.I., Haima P., Cregg J.M., Harder W. and Veenhuis M. (1994) The Hansenulaa polymorpha PERI gene is essential for peroxisome biogenesis and encodes a peroxisomal matrixx protein with both carboxy- and amino-terminal targeting signals. J.Cell Biol. 127: 737-749. 75.. Liu H., Tan X., Russell K.A., Veenhuis M. and Cregg J.M. (1995) PER3, a gene required for peroxisome biogenesiss in Pichia pastoris, encodes a peroxisomal membrane protein involved in protein import. 24 4 Generall introduction

J.Biol.Chem.J.Biol.Chem. 270: 10940-10951. 76.. Rehling P., Skaletz-Rorowski A., Girzalsky W., Voorn-Brouwer T., Franse M.M., Distel B., Veenhuis M., Kunauu W.H. and Erdmann R. (2000) Pex8p, an intraperoxisomal peroxin of Saccharomyces cerevisiae requiredd for protein transport into peroxisomes binds the PTS1 receptor pex5p. J.Biol.Chem. 275: 3593- 3602. . 77.. Agne B., Meindl N.M., Niederhoff K., Einwachter H., Rehling P., Sickmann A., Meyer H.E., Girzalsky W.. and Kunau W.H. (2003) Pex8p: an intraperoxisomal organizer of the peroxisomal import machinery. Mol.CellMol.Cell 11: 635-646. 78.. Dodt G. and Gould SJ. (1996) Multiple PEX genes are required for proper subcellular distribution and stabilityy of Pex5p, the PTS1 receptor: evidence that PTS1 protein import is mediated by a cycling receptor.. J.Cell Biol. 135: 1763-1774. 79.. Dammai V. and Subramani S. (2001) The human peroxisomal targeting signal receptor, Pex5p, is translocatedd into the peroxisomal matrix and recycled to the cytosol. Celt. 105: 187-196. 80.. Reuber B.E., Germain-Lee E., Collins C.S., Morrell J.C., Ameritunga R., Moser H.W., Valle D. and Gould S.J.. (1997) Mutations in PEX1 are the most common cause of peroxisome biogenesis disorders. Nat.Genet. 17:: 445-448. 81.. Portsteffen H., Beyer A., Becker E., Epplen C, Pawlak A., Kunau W.H. and Dodt G. (1997) Human PEX1 iss mutated in complementation group 1 of the peroxisome biogenesis disorders. Nat.Genet. 17: 449-452. 82.. Fukuda S., Shimozawa N., Suzuki Yv Zhang Z., Tomatsu S., Tsukamoto T., Hashiguchi N., Osumi T., Masunoo M., Imaizumi K., Kuroki Y., Fujiki Y., Orii T. and Kondo N. (1996) Human peroxisome assemblyy factor-2 (PAF-2): a gene responsible for group C peroxisome biogenesis disorder in humans. Am.J.Hum.Genet.Am.J.Hum.Genet. 59:1210-1220. 83.. Faber K.N., Heyman J.A. and Subramani S. (1998) Two AAA family peroxins, PpPexlp and PpPex6p, interactt with each other in an ATP-dependent manner and are associated with different subcellular membranouss structures distinct from peroxisomes. Mol.Cell Biol. 18: 936-943. 84.. Yahraus T., Braverman N., Dodt G., Kalish J.E., Morrell J.C., Moser H.W., Valle D. and Gould S.J. (1996) Thee peroxisome biogenesis disorder group 4 gene, PXAAA1, encodes a cytoplasmic ATPase required forr stability of the PTS1 receptor. EMBO J. 15: 2914-2923. 85.. Kiel J.A., Hilbrands R.E., Van D.K., I, Rasmussen S.W., Salomons F.A., van der H.M., Faber K.N., Cregg J.M.. and Veenhuis M. (1999) Hansenula polymorpha Pexlp and Pex6p are peroxisome-associated AAA proteinss that functionally and physically interact. Yeast 15: 1059-1078. 86.. Tamura S., Okumoto K., Toyama R., Shimozawa N., Tsukamoto T., Suzuki Y., Osumi T., Kondo N. and Fujikii Y. (1998) Human PEX1 cloned by functional complementation on a CHO cell mutant is responsiblee for peroxisome-deficient Zellweger syndrome of complementation group I. Proc.Natl.Acad.Sci.U.S.AProc.Natl.Acad.Sci.U.S.A 95: 4350-4355. 87.. Tsukamoto T., Miura S., Nakai T., Yokota S., Shimozawa N., Suzuki Y., Orii T., Fujiki Y., Sakai F., Bogaki A.. and . (1995) Peroxisome assembly factor-2, a putative ATPase cloned by functional complementation onn a peroxisome-deficient mammalian cell mutant. Nat.Genet. 11: 395-401. 88.. Spong A.P. and Subramani S. (1993) Cloning and characterization of PAS5: a gene required for peroxisomee biogenesis in the methylotrophic yeast Pichia pastoris. J.Cell Biol. 123: 535-548. 89.. Collins C.S., Kalish J.E., Morrell J.C., McCaffery J.M. and Gould S.J. (2000) The peroxisome biogenesis factorss pex4p, pex22p, pexlp, and pex6p act in the terminal steps of peroxisomal matrix protein import. Mol.CellMol.Cell Biol. 20: 7516-7526. 90.. Patel S. and Latterich M. (1998) The AAA team: related ATPases with diverse functions. Trends Cell Biol. 8:65-71. . 91.. Birschmann I., Stroobants A.K., Van den B.M., Schafer A., Rosenkranz K., Kunau W.H. and Tabak H.F. (2003)) Pexl5p of Saccharomyces cerevisiae provides a molecular basis for recruitment of the AAA peroxinn Pex6p to peroxisomal membranes. Mol.Biol.Cell 14: 2226-2236. 92.. Matsumoto N., Tamura S. and Fujiki Y. (2003) The pathogenic peroxin Pex26p recruits the Pexlp-Pex6p AAAA ATPase complexes to peroxisomes. Nat.Cell Biol. 5: 454-460. 93.. Matsumoto N., Tamura S., Furuki S., Miyata N., Moser A., Shimozawa N., Moser H.W., Suzuki Y,, Kondoo N. and Fujiki Y. (2003) Mutations in novel peroxin gene PEX26 that cause peroxisome-biogenesis disorderss of complementation group 8 provide a genotype-phenotype correlation. Am.J.Hum.Genet. 73: 233-246. . 94.. Koller A., Snyder W.B., Faber K.N., Wenzel T.J., Rangell L., Keller G.A. and Subramani S. (1999) Pex22p off Pichia pastoris, essential for peroxisomal matrix protein import, anchors the ubiquitin-conjugating enzyme,, Pex4p, on the peroxisomal membrane. J.Cell Biol, lib: 99-112. 95.. Wiebel F.F. and Kunau W.H. (1992) The Pas2 protein essential for peroxisome biogenesis is related to 25 5 Chapterr 1

ubiquitin-conjugatingg enzymes. Nature, 359: 73-76. 96.. Erdmann R. and Blobel G. (1995) Giant peroxisomes in oleic acid-induced Saccharomyces cerevisiae lackingg the peroxisomal membrane protein Pmp27p. J.Cell Biol. 128: 509-523. 97.. Marshall P.A., Krimkevich Y.I., Lark R.H., Dyer J.M., Veenhuis M. and Goodman J.M. (1995) Pmp27 promotess peroxisomal proliferation. j.Cell Biol. 129: 345-355. 98.. Schrader M., Reuber B.E., Morrell J.C., Jimenez-Sanchez G., Obie C, Stroh T.A., Valle D., Schroer T.A. andd Gould S.J. (1998) Expression of PEXllbeta mediates peroxisome proliferation in the absence of extracellularr stimuli. J.Biol.Chem. 273: 29607-29614. 99.. van Roermund C.W., Tabak H.F., Van den B.M., Wanders R.J. and Hettema E.H. (2000) Pexllp plays a primaryy role in medium-chain fatty acid oxidation, a process that affects peroxisome number and size in Saccharomycess cerevisiae. J.Cell Biol. 150:489-498. . 100.. Hoepfner D., Van den B.M., Philippsen P., Tabak H.F. and Hettema E.H. (2001) A role for Vpslp, actin, andd the Myo2p motor in peroxisome abundance and inheritance in Saccharomyces cerevisiae. J.Cell Biol. 155:: 979-990. 101.. Li X. and Gould S.J. (2003) The dynamin-like GTPase DLP1 is essential for peroxisome division and is recruitedd to peroxisomes in part by PEX11. J.Biol.Chem. 278: 17012-17020. 102.. Smith J.J., Marelli M., Christmas R.H., Vizeacoumar F J., Dilworth D.J., Ideker T., Galitski T., Dimitrov K.,, Rachubinski R.A. and Aitchison J.D. (2002) Transcriptome profiling to identify genes involved in peroxisomee assembly and function. J.Cell Biol. 158: 259-271.

103.. Tarn Y.Y., Torres-Guzman J.C., Vizeacoumar F.J., Smith J.J., Marelli Mv Aitchison J.D. and Rachubinski R.A.. (2003) Pexll-related Proteins in Peroxisome Dynamics: A Role for the Novel Peroxin Pex27p in Controllingg Peroxisome Size and Number in Saccharomyces cerevisiae. Mol.Biol.Cell 14: 4089-4102. 104.. Rottensteiner H., Stein K., Sonnenhol E. and Erdmann R. (2003) Conserved function of pexllp and the novell pex25p and pex27p in peroxisome biogenesis. Mol.Biol.Cell 14: 4316-4328. 105.. Vizeacoumar F.J., Torres-Guzman J.C., Tam Y.Y., Aitchison J.D. and Rachubinski R.A. (2003) YHR150w andd YDR479c encode peroxisomal integral membrane proteins involved in the regulation of peroxisome number,, size, and distribution in Saccharomyces cerevisiae. J.Cell Biol. 161: 321-332. 106.. Wanders R.J., Barth P.G. and Heymans H.S. (2001) Single peroxisomal enzyme deficiencies. In: Scriver C.R.,, Beaudet A.L., Valle D. and Sly W.S. (eds.) The metabolic and molecular bases of inherited disease. McGraw-Hill,, New York, 3219-3256. 107.. Ferdinandusse S., Denis S., Mooijer P.A., Zhang Z., Reddy J.K., Spector A.A. and Wanders R.J. (2001) Identificationn of the peroxisomal beta-oxidation enzymes involved in the biosynthesis of docosahexaenoicc acid. J.Lipid Res. 42: 1987-1995. 108.. Wanders R.J., Jansen G.A. and Lloyd M.D. (2003) Phytanic acid alpha-oxidation, new insights into an oldd problem: a review. Biochim.Biophys.Acta 1631: 119-135. 109.. Ginsberg L., Rafique S., Xuereb J.H., Rapoport S.I. and Gershfeld N.L. (1995) Disease and anatomic specificityy of ethanolamine plasmalogen deficiency in Alzheimer's disease brain. Brain Res. 698: 223-226. 110.. Kovacs W.J., Olivier L.M. and Krisans S.K. (2002) Central role of peroxisomes in isoprenoid biosynthesis.. Pwg.Lipid Res. 41: 369-391. 111.. Hogenboom S., Romeijn G.J., Houten S.M., Baes M., Wanders R.J. and Waterham H.R. (2002) Absence of functionall peroxisomes does not lead to deficiency of enzymes involved in cholesterol biosynthesis. J.LipidJ.Lipid Res. 43: 90-98. 112.. Hogenboom S. (2003) Subcellular localization of the human isoprenoid biosynthesis pathway. Thesis 113.. Ulrich J., Herschkowitz N., Heitz P., Sigrist T. and Baerlocher P. (1978) Adrenoleukodystrophy. Preliminaryy report of a connatal case. Light- and electron microscopical, immunohistochemical and biochemicall findings. Acta Neuropathol.(Berl) 43: 77-83. 114.. Kelley R.I., Datta N.S., Dobyns W.B., Hajra A.K., Moser A.B., Noetzel M.J., Zackai E.H. and Moser H.W. (1986)) Neonatal adrenoleukodystrophy: new cases, biochemical studies, and differentiation from Zellwegerr and related peroxisomal polydystrophy syndromes. Am.J.Med.Genet. 23: 869-901. 115.. Scotto J.M., Hadchouel M., Odievre M., Laudat M.H., Saudubray J.M., Dulac O., Beucler I. and Beaune P.. (1982) Infantile phytanic acid storage disease, a possible variant of Refsum's disease: three cases, includingg ultrastructural studies of the liver. J.Inherit.Metab Dis. 5: 83-90. 116.. Poulos A., Sharp P. and Whiting M. (1984) Infantile Refsum's disease (phytanic acid storage disease): a variantt of Zellweger's syndrome? Clin.Genet. 26: 579-586. 117.. Ogier H., Roels F., Comelis A., Poll The BT, Scotto J.M., Odievre M. and Sandubray J.M. (1985) Absence off hepatic peroxisomes in a case of infantile Refsum's disease. Scand.J.Clin.Lab Invest 45: 767-768. 118.. Wanders RJ, Barth PG, Schutgens RB and Heymans HS (1996) Peroxisomal disorders: Post- and prenatal diagnosiss based on a new classification with flowcharts. International pediatrics 11: 202-214. 26 6 Generall introduction

119.. Brul S., Westerveld A., Strijland A., Wanders R.J., Schram A.W., Heymans H.S., Schutgens R.B., van den B.H.. and Tager J.M. (1988) Genetic heterogeneity in the cerebrohepatorenal (Zellweger) syndrome and otherr inherited disorders with a generalized impairment of peroxisomal functions. A study using complementationn analysis. J.Clin.Invest 81:1710-1715. 120.. Gould S.J. and Valle D. (2000) Peroxisome biogenesis disorders: genetics and cell biology. Trends Genet. 16:: 340-345. 121.. Geisbrecht B.V., Collins C.S., Reuber B.E. and Gould S.J. (1998) Disruption of a PEX1-PEX6 interaction is thee most common cause of the neurologic disorders Zellweger syndrome, neonatal adrenoleukodystrophy,, and infantile Refsum disease. Proc.Natl.Acad.Sci.U.S.A 95: 8630-8635. 122.. Collins C.S. and Gould S.J. (1999) Identification of a common PEX1 mutation in Zellweger syndrome. Hum.Mutat.Hum.Mutat. 14: 45-53. 123.. Imamura A., Tamura S., Shimozawa N., Suzuki Y., Zhang Z., Tsukamoto T., Orii T., Kondo N., Osumi T. andd Fujiki Y. (1998) Temperature-sensitive mutation in PEX1 moderates the phenotypes of peroxisome deficiencyy disorders. Hum.Mol.Genet. 7: 2089-2094. 124.. Gartner ]., Preuss N., Brosius U. and Biermanns M. (1999) Mutations in PEX1 in peroxisome biogenesis disorders:: G843D and a mild clinical phenotype. J.lnherit.Metab Dis. 22: 311-313. 125.. Maxwell M.A., Nelson P.V., Chin S.J., Paton B.C., Carey W.F. and Crane D.I. (1999) A common PEX1 frameshiftt mutation in patients with disorders of peroxisome biogenesis correlates with the severe Zellwegerr syndrome phenotype. Hum.Genet. 105: 38-44. 126.. Walter C, Gootjes J., Mooijer P.A., Portsteffen H., Klein C, Waterham H.R., Barth P.G., Epplen J.T., Kunauu W.H., Wanders R.J. and Dodt G. (2001) Disorders of peroxisome biogenesis due to mutations in PEX1:: phenotypes and PEX1 protein levels. Am.J.Hum.Genet. 69: 35-48. 127.. Shimozawa N., Nagase T., Takemoto Y., Ohura T., Suzuki Y. and Kondo N. (2003) Genetic heterogeneity off peroxisome biogenesis disorders among Japanese patients: Evidence for a founder haplotype for the mostt common PEX10 gene mutation. Am.J.Med.Genet. 120A: 40-43. 128.. Imamura A., Tsukamoto T., Shimozawa N., Suzuki Y., Zhang Z., Imanaka T., Fujiki Y., Orii T., Kondo N.. and Osumi T. (1998) Temperature-sensitive phenotypes of peroxisome-assembly processes represent thee milder forms of human peroxisome-biogenesis disorders. Am.].Hum.Genet. 62:1539-1543. 129.. Imamura A., Shimozawa N., Suzuki Y., Zhang Z., Tsukamoto T., Fujiki Y., Orii T., Osumi T., Wanders RJ.. and Kondo N. (2000) Temperature-sensitive mutation of PEX6 in peroxisome biogenesis disorders inn complementation group C (CG-C): comparative study of PEX6 and PEX1. Pediatr.Res. 48: 541-545. 130.. Imamura A., Shimozawa N., Suzuki Y., Zhang Z., Tsukamoto Tv Orii T., Osumi T. and Kondo N. (2001) Temperaturee sensitive acyl-CoA oxidase import in group A peroxisome biogenesis disorders. J.Med.Genet.J.Med.Genet. 38: 871-874. 131.. Shimozawa N., Suzuki Y., Zhang Z., Imamura A., Toyama R., Mukai S., Fujiki Y., Tsukamoto T., Osumi T.,, Orii Tv Wanders R.J. and Kondo N. (1999) Nonsense and temperature-sensitive mutations in PEX13 aree the cause of complementation group H of peroxisome biogenesis disorders. Hum.Mol.Genet. 8: 1077- 1083. . 132.. Wilson G.N., Holmes R.G., Custer J., Lipkowitz J.L., Stover J., Datta N. and Hajra A. (1986) Zellweger syndrome:: diagnostic assays, syndrome delineation, and potential therapy. Am.J.Med.Genet. 24: 69-82. 133.. Moser A.B., Borel J., Odone A., Naidu S., Cornblath D., Sanders D.B. and Moser H.W. (1987) A new dietaryy therapy for adrenoleukodystrophy: biochemical and preliminary clinical results in 36 patients. Ann.Neurol.Ann.Neurol. 21: 240-249. 134.. Setchell K.D., Bragetti P., Zimmer-Nechemias L., Daugherty C, Pelli M.A., Vaccaro R., Gentili G., Distruttii E., Dozzini G., Morelli A. and . (1992) Oral bile acid treatment and the patient with Zellweger syndrome.. Hematology 15: 198-207. 135.. Martinez M. (2001) Restoring the DHA levels in the brains of Zellweger patients. J.Mol.Neuwsci. 16: 309- 316. . 136.. Martinez M. and Vazquez E. (1998) MR1 evidence that docosahexaenoic acid ethyl ester improves myelinationn in generalized peroxisomal disorders. Neurology 51: 26-32. 137.. Lazarow P.B., Black V„ Shio H., Fujiki Y., Hajra A.K., Datta N.S., Bangaru B.S. and Dancis J. (1985) Zellwegerr syndrome: biochemical and morphological studies on two patients treated with clofibrate. Pediatr.Res.Pediatr.Res. 19:1356-1364. 138.. Bjorkhem I., Blomstrand S., Glaumann H. and Strandvik B. (1985) Unsuccessful attempts to induce peroxisomess in two cases of Zellweger disease by treatment with clofibrate. Pediatr.Res. 19: 590-593. 139.. Wei H., Kemp S., McGuinness M.C., Moser A.B. and Smith K.D. (2000) Pharmacological induction of peroxisomess in peroxisome biogenesis disorders. Ann.Neurol. 47: 286-296.

27 7

Chapterr 2

Biochemicall markers predicting survival in peroxisome biogenesis disorders s

Jeannettee Gootjes, Petra A.W. Mooijer, Conny Dekker, Peter G. Barth, Bu/ee Tien Poll-The, Hans R.. Waterham, Ronald J.A. Wanders, (2002) Neurology 59:1746-1749 Chapterr 2 Biochemicall markers predicting survival in peroxisome biogenesis disorders s

Jeannettee Gootjes1, Petra A.W. Mooijer', Conny Dekker1, Peter G. Barth2, Bwee Tien Poll- The2,, Hans R. Waterham1, Ronald J.A. Wanders1

JLrtfr.. Genetic Metabolic Diseases and Department of Pediatrics/Emma Children's Hospital, AcademicAcademic Medical Center, University of Amsterdam, The Netherlands.

Summary y

Objective:Objective: To identify prognostic markers reflecting the extent of peroxisome dysfunction inn primary skin fibroblasts from patients with peroxisome biogenesis disorders (PBD). Background:Background: The PBDs are a genetically heterogeneous group of disorders due to defects in att least 11 distinct genes. Zellweger syndrome (ZS) is the prototype of this group of disorderss with neonatal adrenoleukodystrophy (NALD) and infantile Refsum disease (IRD)) as milder variants. Common to these three disorders are liver disease, variable neurodevelopmentall delay, retinopathy and perceptive deafness. Since genotype- phenotypee studies are complicated by the genetic heterogeneity among PBD patients, we evaluatedd a series of biochemical markers as a measure of peroxisome dysfunction in skin fibroblasts.. Methods: Multiple peroxisomal functions including de novo plasmalogen synthesis,, DHAPAT activity, C26:0/C22:0 ratio, C26:0 and pristanic acid p-oxidation and phytanicc acid a-oxidation were analyzed in fibroblasts from a series of patients with definedd clinical phenotypes. Results: A poor correlation with age of death was found for de novonovo plasmalogen synthesis, C26:0/C22:0 ratio and phytanic acid a-oxidation. A fairly goodd correlation was found for pristanic acid p-oxidation, but the best correlation was foundd for DHAPAT activity and C26:0 p-oxidation. A mathematic combination of DHAPATT activity and C26:0 p-oxidation showed an even better correlation. Conclusions: DHAPATT activity and C26:0 p-oxidation are the best markers in predicting life expectancy off PBD patients. Combination of both markers gives an even better prediction. These resultss contribute to the management of PBD patients.

Introduction n

Peroxisomess harbor a variety of metabolic functions including fatty acid p-oxidation, etherphospholipidd biosynthesis and fatty acid a-oxidation.1 Peroxisomal disorders are subdividedd into two groups including the peroxisome biogenesis disorders (PBDs)2 and thee single peroxisomal enzyme deficiencies.1 The PBDs, which comprise the Zellweger syndromee (ZS), neonatal adrenoleukodystrophy (NALD) and infantile Refsum disease (IRD),, represent a spectrum of disease severity with ZS being the most, and IRD the least severee disorder. Common to all three PBDs are liver disease, variable neurodevelopmental delay,, retinopathy and perceptive deafness.2 Patients with ZS are severely hypotonic from birthh and die before one year of age. Patients with NALD experience neonatal onset of hypotoniaa and seizures and suffer from progressive white matter disease, dying usually in latee infancy.3 Patients with IRD may survive beyond infancy and some may even reach

30 0 Biochemicall markers predicting survival adulthood.44 Clinical differentiation between these disease states is not very well-defined andd patients can have overlapping symptoms.5 Theree is also genetic heterogeneity among PBDs. Cell fusion complementation studies usingg patient fibroblasts led to the identification of 11 distinct genetic groups. So far 10 of thee corresponding (PEX) genes have been identified. Most complementation groups are associatedd with more than one clinical phenotype.6 PBDD patients have an impaired synthesis of plasmalogens, due to a deficiency of the twoo enzymes dihydroxyacetonephosphate acyltransferase (DHAPAT) and alkyl- dihydroxyacetonephosphatee synthase.7-8 Peroxisomal fatty acid p-oxidation is also defective,, leading to the accumulation of very-long chain fatty acids (VLCFAs), notably C26:0,, the branched chain fatty acid pristanic acid and the bile acid intermediates di- and trihydroxycholestanoicc acid (DHCA and THCA).2 Phytanic acid a-oxidation and L- pipecolicc acid oxidation are also impaired.2 In contrast, some peroxisomal enzymes show normall activity including catalase, D-amino acid oxidase, L-a-hydroxy acid oxidase A and alaninerglyoxylatee aminotransferase.2 Sincee genotype-phenotype studies are complicated by the marked genetic heterogeneityy among patients with a PBD, we evaluated a number of different biochemical markerss as a measure of peroxisome dysfunction in order to identify the best marker predictingg the survival of patients with peroxisome biogenesis disorders.

Subjectss and Methods

Subject Subject Thirty-fivee patients with a PBD, collected during the past 20 years, were enrolled in this study.. The diagnosis was confirmed in our laboratory based on biochemical studies in plasmaa and fibroblasts. Most patients were Dutch, but some originated from other parts of Europe.. Patients were divided into two groups: 1. patients who died before one year of age,, representing the classical ZS group, and 2. patients who survived for more than five years,, representing the relatively milder phenotypes of NALD and IRD.

BiochemicalBiochemical assays DHAPATT activity,9 de novo plasmalogen synthesis,10 concentrations of VLCFAs,11 C26:0 andd pristanic acid P-oxidation12 and phytanic acid a-oxidation13 were assayed in primary skinn fibroblasts cultured in DMEM or HAM-F10 medium as previously described. Inter- andd intraassay CVs are 15% and 4.4% for DHAPAT activity, 8.8 % and 2.3 % for VLCFA ratios,, 18% and 5.4% for C26:0 p-oxidation, 22% and 5.3% for pristanic acid p-oxidation andd 22% and 4.3% for phytanic acid a-oxidation. All presented data are the means of two individuall measurements.

NumericalNumerical and statistical analysis Combinationn of DHAPAT activity and C26:0 P-oxidation was done using the formula: (DHAPATT activity/control value DHAPAT activity + C26:0 p-oxidation/control value C26:00 p-oxidation) x 0.5 x 100%. Control values were 10.9 nmol/2hr.mg protein for DHAPATT activity and 1350 pmol/hr.mg protein for C26:0 p-oxidation. The correlation of thee different markers and survival between the two groups was evaluated using the Mann-Whitneyy U test.

31 1 Chapterr 2 Results s

Inn this study we included thirty-five patients divided into two groups: patients who died beforee one year of age, representing the classical ZS group (group 1), and patients who survivedd for more than five years, representing relatively mild phenotypes including NALDD and IRD (group 2). Patients that died between one and four years of age were excludedd because this study seeks to distinguish between severe and mild cases. Six markerss of peroxisome function were measured in cultured skin fibroblasts of the patients: 1.. DHAPAT activity, 2. de novo plasmalogen synthesis, 3. C26:0/C22:0 ratio, 4. C26:0 (3- oxidation,, 5. pristanic acid p-oxidation and 6. phytanic acid a-oxidation.

PlasmalogenPlasmalogen biosynthesis Twoo markers of plasmalogen biosynthesis were determined including DHAPAT activity andd de novo plasmalogen synthesis. DHAPAT activity clearly differed between the two groupss (PO.001) (figure 1) as illustrated by the numbers shown above the graph. Only two off nine patients in the classical ZS group, have DHAPAT activities that fall within the standardd deviation found for DHAPAT in group 2, whereas the DHAPAT activity found inn four of the 20 patients in group 2 fall within the standard deviation of group 1. Thus, DHAPATT activity appears a very good marker in predicting survival of PBD patients. This iss in contrast to de novo plasmalogen biosynthesis (data not shown) in which there is a largee overlap between the two groups of patients (P=0.491).

2/9 9 3/20 0 6.00 • Figuree 1 DHAPAT activity in 0 0 fibroblastss from PBD patients, who diedd before one year of age (group 1) 5.00 • 0 0 andd patients who survived for more 0 0 thann five years (group 2). Each circle 400 • representss the activity of DHAPAT as measuredd in fibroblasts from each

3,0-- individuall patient (mean of duplicate experiments).. The individual values weree used to calculate the mean (group 20 0 1:: 0.5 and group2: 2.1) plus standard deviationn (0.20 and 1.4) as shown in the : : 1,0 0 o o graph.. Mann-Whitney U test showed thatt the two groups were different from "f" " >: > eachh other (PO.001). 0,0 0 I I deceased d alive e << 1 yr >> 5 yrs

PeroxisomalPeroxisomal j3-oxidation Forr peroxisomal p-oxidation we evaluated the C26:0/C22:0 ratio, C26:0 p-oxidation and pristanicc acid p-oxidation. The C26:0/C22:0 ratios determined in fibroblast homogenates showw extensive overlap between the two groups (data not shown), indicating that this ratioo has no prognostic value in terms of patient survival (P=0.059). Figure 2 reveals a clear distinctionn between the two groups for C26:0 p-oxidation (P<0.001). Only one of seven classicall ZS patients belonging to group 1 falls within the standard deviation of group 2

32 2 Biochemicall markers predicting survival

900-- 1/7 7 0/15 5 o o 8000 - Figuree 2 C26:0 B-oxidation in fibroblasts 7000 - fromm patients belonging to group 1 6000 - (>: ( > (deathh before one year of age) and groupp 2 (survival beyond 5 years of !55 E xx iJ 5000 age).. Each circle represents the result OO J= 0 0 <=-- o 4000 forr each individual patient (mean of 99 E CDD Q_ duplicatee experiments) and mean CMM — 3000 O O valuess (124 and 377) and standard o o 2000 deviationss (52 and 164) are shown in 0 0 thee graph. Mann-Whitney U test 100-- I I showedd that the two groups were differentt from each other (P<0.001). 00 11 1 deceased d alive e << 1 yr >> 5 yrs andd none of the milder patients fall within the standard deviation of group 1. Thus, also C26:00 p-oxidation appears a very good marker predicting the survival of PBD patients. Pristanicc acid p-oxidation shows less correlation with survival (P=0.009) (figure 3) than C26:00 p-oxidation, but still appears informative.

PhytanicPhytanic acid a-oxidation Theree was no clear distinction between the two groups (P=0.359) with respect to phytanic acidd a-oxidation indicating that this is not a good predictive marker (data not shown).

180-- 2/8 8 3/12 2 o o 160-- Figuree 3 Pristanic acid B-oxidation in 1400 - fibroblastss from patients belonging to 1200 - groupp 1 (death before one year of age) xx en c) c ) andd group 2 (survival beyond 5 years of ?? E 1000 - age).. Each circle represents the result 800 - forr each individual patient (mean of oo a. 0 0 duplicatee experiments) and mean 600 - valuess (16 and 60) and standard 400 - f f deviationss (24 and 44) are shown in the graph.. Mann-Whitney U test showed 200 • < >< > thatt the two groups were different from < < eachh other (P=0.009). 1 1 decease11d d ,aliv e e << 1 yr >> 5yr s s

CombinationCombination DHAPAT activity and C26:0 ^-oxidation Althoughh DHAPAT activity and C26:0 p-oxidation were best in predicting survival of the patients,, both showed some overlap between the two groups (see figures 1 and 2). Combiningg both markers, however, led to a complete separation of the two groups (P=0.001,, figure 4).

33 3 Chapterr 2

Figuree 4 Combination of DHAPAT 0/5 5 0/14 4 activityy and C26:0 p-oxidation ((DHAPATT activity/control value DHAPATT activity + C26:0 fJ- oxidation/controll value C26:0 p- oo —' oxidation)) x 0.5 x 100%) in fibroblasts I-- S 40,00 • fromm patients belonging to group 1 ?? « (deathh before one year of age) and 0-- -o 30,0-- groupp 2 (survival beyond 5 years of << X xx o age)) as percentage of control values. QQ ca. Eachh circle represents a patient and <== o 20,0-- 2 showedd that the two groups were o o + + differentt from each other (P=O.001). deceased d alive e << 1 yr >> 5 yrs

Discussion n

Thiss study investigated biochemical markers to predict the survival of patients with a peroxisomee biogenesis disorder. The relationship between the extent of peroxisomal dysfunctionn and the patient survival has not been defined. Previous studies have shown a clearr genotype-phenotype correlation for only two mutations in PEX1, the gene affected in thee majority of PBD patients. Unfortunately the correlation only holds for either the mild 2528G>AA or the severe 2097insT mutation.1416 In case of heterozygosity or defects in one of thee other PEX genes the correlation is not clear. This implies that at present molecular analysiss will only be helpful for a subset of patients. For this reason we evaluated the consequencess of mutations, rather than the mutations themselves in cultured skin fibroblasts.. Our results show that of the six biochemical markers analyzed, DHAPAT and C26:00 acid p-oxidation were the only markers showing a good correlation with disease severity,, whereas pristanic acid p-oxidation activity correlates reasonably well. The predictivee power of DHAPAT and C26:0 p-oxidation was even better when the two markerss were combined. Previouss studies have shown that, on average, plasmalogen biosynthesis is less impairedd in NALD and IRD fibroblasts than in ZS fibroblasts.1017 However, when the individuall values were considered, there was a large overlap indicating that plasmalogen synthesiss is an adequate diagnostic tool but not a good predictive test, which is in agreementt with our results. Ass an alternative one could study the temperature sensitivity of the cell lines. It was shownn recently that in some PBD cell lines the defect in peroxisome biogenesis can be (partly)) corrected by growth of the cells at a lower temperature.18 This phenomenon correlatess with the milder phenotype. Although we did not evaluate this in this article, it mayy be a useful approach for the future. Inn this study, peroxisomal functions were evaluated in cultured skin fibroblasts only. However,, the dysfunction of peroxisomes is reflected also in plasma by elevated levels of VLCFAs,, DHCA, THCA, phytanic and pristanic acid and in erythrocytes, by lowered

34 4 Biochemicall markers predicting survival plasmalogenn levels. Ideally, one should measure also these metabolites to see whether theree is a relation between phenotype and extent of abnormality. Unfortunately, we did nott have plasma (or serum) samples from most of the patients in amounts required for suchh analyses, making such a comparison impossible. Earlier studies have shown that plasmaa VLCFA levels give a significant correlation with the three phenotypes, although thee spreads were rather large.19 AA limitation of this study is that it uses survival as the only marker of phenotype, whereass parents of children diagnosed with a PBD often will be interested also in the patient'ss quality of life and what will be achieved in terms of neurological and neurosensoryy development. We are currently in the process of developing a scoring system200 that may help in this respect.

Acknowledgements s

Thee authors thank Rebecca Brauner for suggestions and critical reading of the manuscript andd Dr. Guy Besley for editorial comments. Supported by Prinses Beatrix Fonds, grant 99.0220. .

References s

1.. Wanders R.J., Barth P.G. and Heymans H.S. (2001) Single peroxisomal enzyme deficiencies. In: Scriver C.R.,, Beaudet A.L., Valle D. and Sly W.S. (eds.) The metabolic and molecular bases of inherited disease. McGraw-Hill,, New York, 3219-3256. 2.. Gould S.J., Raymond G.V. and Valle D. (2001) The peroxisome biogenesis disorders. In: Scriver C.R., Beaudett A.L., Valle D. and Sly W.S. (eds.) The metabolic and molecular bases of inherited disease. McGraw-Hill,, New York, 3181-3217. 3.. Kelley R.I., Datta N.S., Dobyns W.B., Hajra A.K., Moser A.B., Noetzel M.J., Zackai E.H. and Moser H.W. (1986)) Neonatal adrenoleukodystrophy: new cases, biochemical studies, and differentiation from Zellwegerr and related peroxisomal polydystrophy syndromes. Am.JMed.Genet. 23: 869-901. 4.. Poll-The B.T., Saudubray J.M., Ogier H.A., Odievre M., Scotto J.M., Monnens L., Govaerts L.C., Roels F., Corneliss A. and Schutgens R.B. (1987) Infantile Refsum disease: an inherited peroxisomal disorder. Comparisonn with Zellweger syndrome and neonatal adrenoleukodystrophy. Eur.J.Pediatr. 146: 477-483. 5.. Barth P.G., Gootjes J., Bode H., Vreken P., Majoie C.B. and Wanders R.J. (2001) Late onset white matter diseasee in peroxisome biogenesis disorder. Neurology 57: 1949-1955. 6.. Gould S.J. and Valle D. (2000) Peroxisome biogenesis disorders: genetics and cell biology. Trends Genet. 16:: 340-345. 7.. Heymans H.S., Schutgens R.B., Tan R., van den Bosch H. and Borst P. (1983) Severe plasmalogen deficiencyy in tissues of infants without peroxisomes (Zellweger syndrome). Nature. 306: 69-70. 8.. Datta N.S., Wilson G.N. and Hajra A.K. (1984) Deficiency of enzymes catalyzing the biosynthesis of glycerol-etherr lipids in Zellweger syndrome. A new category of metabolic disease involving the absence off peroxisomes. N.EnglJMed. 311: 1080-1083. 9.. Ofman R. and Wanders R.J. (1994) Purification of peroxisomal acyl-CoA: dihydroxyacetonephosphate acyltransferasee from human placenta. Biochim.Biophys.Acta 1206: 27-34. 10.. Schrakamp G., Schalkwijk C.G., Schutgens R.B., Wanders R.J., Tager J.M. and van den B.H. (1988) Plasmalogenn biosynthesis in peroxisomal disorders: fatty alcohol versus alkylglycerol precursors. J.Lipid Res.Res. 29: 325-334. 11.. Vreken P., van Lint A.E., Bootsma A.H., Overmars H., Wanders R.J. and van Gennip A.H. (1998) Rapid stablee isotope dilution analysis of very-long-chain fatty acids, pristanic acid and phytanic acid using gas chromatography-electronn impact mass spectrometry. J.Chromatogr.B Biomed.Sci.Appl. 713: 281-287. 12.. Wanders R.J., Denis S., Ruiter J.P., Schutgens R.B., van Roermund C.W. and Jacobs B.S. (1995) Measurementt of peroxisomal fatty acid beta-oxidation in cultured human skin fibroblasts. J.Inherit.Metab Dis.Dis. 18 Suppl 1: 113-124. 13.. Wanders R.J. and van Roermund C.W. (1993) Studies on phytanic acid alpha-oxidation in rat liver and 35 5 Chapterr 2

culturedd human skin fibroblasts. Biochim.Biophys.Ada 1167: 345-350. 14.. Maxwell M.A., Nelson P.V., Chin S.J., Paton B.C., Carey W.F. and Crane D.I. (1999) A common PEX1 frameshiftt mutation in patients with disorders of peroxisome biogenesis correlates with the severe Zellwegerr syndrome phenotype. Hum.Genet. 105: 38-44. 15.. Reuber B.E., Germain-Lee E., Collins C.S., Morrell J.C., Ameritunga R., Moser H.W., Valle D. and Gould S.J.. (1997) Mutations in PEX1 are the most common cause of peroxisome biogenesis disorders. Nat.Genet. 17:: 445-448. 16.. Collins C.S. and Gould S.J. (1999) Identification of a common PEX1 mutation in Zellweger syndrome. Hum.Mutat.Hum.Mutat. 14: 45-53. 17.. Lazarow P.B. and Moser H.W. (1995) Disorders of peroxisome biogenesis. In: Scriver C.R., Beaudet A.L., Slyy W.S. and Valle D. (eds.) The Metabolic and Molecular Basis of Inherited Disease. McGraw Hill Inc., Neww York, 2287-2324. 18.. Imamura A., Shimozawa N., Suzuki Y., Zhang Z., Tsukamoto T., Fujiki Y., Orii T., Osumi T. and Kondo N.. (2000) Restoration of biochemical function of the peroxisome in the temperature-sensitive mild forms off peroxisome biogenesis disorder in humans. Brain Dev. 22: 8-12. 19.. Moser A.B., Kreiter N., Bezman L., Lu S., Raymond G.V., Naidu S. and Moser H.W. (1999) Plasma very longg chain fatty acids in 3,000 peroxisome disease patients and 29,000 controls. Ann.Neurol. 45: 100-110. 20.. Kelley R.I. and Hennekam R.C. (2000) The Smith-Lemli-Opitz syndrome. J.Med.Genet. 37: 321-335.

36 6 Chapterr 3

Novell mutations in the PEX2 gene of four unrelated patients with a peroxisomee biogenesis disorder

Jeannettee Gootjes, Orly Elpeleg, Francois. Eysbens, Hanna Mandel, Delphine Mitanchez, Noboyubi Shimozawa,, Vasuyubi Suzuki, Hans R. Waterham, Ronald J.A. Wanders, (2004) Pediatr.Res. (In press) ) Chapterr 3 Novell mutations in the PEX2 gene of four unrelated patients with a peroxisomee biogenesis disorder

Jeannettee Gootjes1, Orly Elpeleg2, Francois Eyskens3, Hanna Mandel4, Delphine Mitanchez5, Noboyukii Shimozawa6, Yasuyuki Suzuki6, Hans R. Waterham1, and Ronald J.A. Wanders1

]]Lab.Lab. Genetic Metabolic Diseases, Department of Clinical Chemistry and Peadiatrics, Emma Children'sChildren's Hospital, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands,Netherlands, 2The Metabolic Disease Unit, Shaare-Zedek Medical Center, Jerusalem, Israel 3The UniversityUniversity Hospital, Antwerp, Belgium 4Metabolic Unit, Department of Pediatrics, Rambam MedicalMedical Center, Haifa, Israel 5Höpital Meeker-Enfants Malades, Paris, France Department of Pediatrics,Pediatrics, Gift University School of Medicine, Gifu, Japan.

Summary y

Thee peroxisome biogenesis disorders (PBDs) form a genetically and clinically heterogeneouss group of disorders due to defects in at least 11 distinct genes. The prototypee of this group of disorders is Zellweger syndrome (ZS) with neonatal adrenoleukodystrophyy (NALD) and infantile Refsum disease (IRD) as milder variants. Commonn to PBDs are liver disease, variable neurodevelopmental delay, retinopathy and perceptivee deafness. PBD patients belonging to complementation group 10 (CG10) have mutationss in the PEX2 gene (PXMP3), which codes for a protein (PEX2) that contains two transmembranee domains and a zinc-binding domain considered to be important for its interactionn with other proteins of the peroxisomal protein import machinery. We report on thee identification of four PBD patients belonging to CG10. Sequence analysis of their PEX2 geness revealed 4 different mutations, 3 of which have not been reported before. Two of the patientss had homozygous mutations leading to truncated proteins lacking both transmembranee domains and the zinc-binding domain. These mutations correlated well withh their severe phenotypes. The third patient had a homozygous mutation leading to the absencee of the zinc-binding domain (W223X) and the fourth patient had a homozygous mutationn leading to the change of the second cysteine residue of the zinc-binding domain (C247R).. Surprisingly, the patient lacking the domain had a mild phenotype, whereas the C247RR patient had a severe phenotype. This might be due to an increased instability of PEX22 due to the R for C substitution or to a dominant negative effect on interacting proteins. .

Introduction n

Thee peroxisome biogenesis disorders (PBDs; MIM # 601539), which comprise Zellweger syndromee (ZS; MIM # 214100), neonatal adrenoleukodystrophy (NALD; MIM # 202370) andd infantile Refsum disease (IRD; MIM # 266510), represent a spectrum of disease severityy with ZS being the most, and IRD the least severe disorder. Common to all three PBDss are liver disease, variable neurodevelopmental delay, retinopathy and perceptive deafness.11 Patients with ZS are severely hypotonic from birth and die before one year of age.. Patients with NALD experience neonatal onset of hypotonia and seizures and suffer fromm progressive white matter disease, dying usually in late infancy.2 Patients with IRD

38 8 Novell mutations in the PEX2 gene mayy survive beyond infancy and some may even reach adulthood.3 Clinical differentiation betweenn these disease states is not very well-defined and patients can have overlapping symptoms.4 4 Thee absence of functional peroxisomes in patients with a PBD leads to a number of biochemicall abnormalities. PBD patients have an impaired synthesis of plasmalogens, due too a deficiency of the two enzymes dihydroxyacetonephosphate acyltransferase (DHAPAT)) and alkyl-dihydroxyacetonephosphate synthase.5-6 Peroxisomal fatty acid p- oxidationn is also defective, leading to the accumulation of very-long chain fatty acids (VLCFAs),, notably C26:0, the branched chain fatty acid pristanic acid and the bile acid intermediatess di- and trihydroxycholestanoic acid (DHCA and THCA).1 Phytanic acid a- oxidationn and L-pipecolic acid oxidation are also impaired.1 In contrast, some peroxisomal enzymess show normal activity including catalase, D-amino acid oxidase, L-a-hydroxy acid oxidasee A and alanine:glyoxylate aminotransferase, although subcellular fractionation studiess have shown that these enzymes are mislocalized in the cytoplasm.1 Thee PBDs are caused by genetic defects in PEX genes encoding proteins called peroxins,, which are required for the biogenesis of peroxisomes and function in the assemblyy of the peroxisomal membrane or in the import of enzymes into the peroxisome.7 Afterr synthesis on free polyribosomes, peroxisomal matrix proteins carrying either a carboxy-terminall peroxisomal targeting sequence 1 (PTS1) or a cleavable amino-terminal PTS22 signal are translocated across the peroxisomal membrane.89 A defect in one of the peroxinss of the peroxisomal import machinery leads to failure of protein import via the PTS1-- and/or PTS2-dependent import pathway, and consequently to functional peroxisomee deficiency. Cell fusion complementation studies using patient fibroblasts revealedd the existence of at least 11 distinct genetic groups of which currently all correspondingg PEX genes have been identified. Most complementation groups are associatedd with more than one clinical phenotype.7 PBDD patients belonging to CG10 (CG F according to the Japanese nomenclature) have mutationss in the PEX2 gene (PXMP3: MIM # 170993).10 The PEX2 gene was the first gene foundd to be mutated in ZS and spans approximately 17.5kb in length and contains four exons.. The entire coding sequence is included in exon 4.11 The gene encodes a 305 amino acidd protein (PEX2), with a molecular weight of -35 kDa. PEX2 is an integral membrane proteinn with two transmembrane domains, exposing its NH2 and COOH termini to the cytoplasm.122 PEX2 contains a zinc-binding motif (C3HC4) at the C-terminal part, probably involvedd in interaction with the other proteins of the peroxisomal protein import machinery.. PEX10 and PEX12 also contain similar zinc-binding motifs. PEX2 was shown too interact with PEX10,13 and was present in a complex consisting of PEX2, PEX5, PEX12 andd PEX14.14 Inn this study we report the identification of novel mutations in the PEX2 gene in four PBDD patients which, using cell fusion complementation analysis, were shown to belong to complementationn group 10. The correlation between genotypes and phenotypes is discussed. .

39 9 Chapterr 3 Methods s

Subjects Subjects Alll patients analyzed showed the clinical characteristics of PBDs. After we obtained informedd consent, samples were collected from patients and sent to our laboratory for biochemicall and molecular diagnosis. The biochemical diagnosis of a PBD was substantiatedd by detailed studies in primary skin fibroblasts, which included the following analyses:: de novo plasmalogen synthesis, DHAPAT activity, C26:0 and pristanic acid (3- oxidation,, VLCFA levels, phytanic acid a-oxidation, catalase immunofluorescence and immunoblott analysis of peroxisomal thiolase and acyl-CoA oxidase.15

CaseCase reports Patientt 1 was a male infant, first child of consanguineous Moroccan parents, born after an uneventfull pregnancy with low birth weight (2290 g) for gestational age (41 weeks). He wass severely hypotonic with absent tendon reflexes and had a large anterior fontanelle andd metopic sutures, a high forehead, slight hepatomegaly, cryptorchidism, hypospadias andd a cardiac murmur on auscultation. He was transferred to the neonatal intensive care unitt because of generalized convulsions and myoclonic jerks. Neuroimaging of the brain (MRI)) showed a complete absence of the corpus callosum, colpocephaly, pachygyria, leucomalacia,, and subcortical and periventricular and cerebellar hypoplasia. EEG abnormalitiess were not specific and showed diffuse epileptic activity. Ocular abnormalitiess included a pendular nystagmus, cataracts, optic atrophy and a negative visuall evoked response (VER). There was an impaired hearing with reduced brainstem auditoryy evoked potentials (BAEP). There were no skeletal abnormalities. Ultrasonographyy of the kidneys showed no abnormalities. Cardiac defects included insufficiencyy of the mitral, tricuspid and aortic valves and a peripheral pulmonary artery stenosis.. From the first day he developed a severe icterus with elevated serum liver enzymess (ASAT, ALAT, LDH) and a predominance of serum conjugated bilirubine (cholestasis).. A liver biopsy showed severe cholestasis with mitochondrial abnormalities (absencee of cristae) on electron microscopy (EM) and absence of peroxisomes and catalase activityy present in the cytoplasm of the hepatocytes revealed by immunohistochemical examinations.. A skin biopsy showed spicular inclusions in a Schwan cell on EM as has beenn described in adrenomyeloneuropathy. Biochemical abnormalities included high serumm levels of VLCFA, very low plasmalogen content of red blood cell membranes and thee presence of THCA and C29 dicarboxylic acid in urine. The course of the disease was rapid:: difficulties with sucking and swallowing necessitated gavage feeding; convulsions persistedd under therapy with phenobarbital and vigabatrin; the cholestatic icterus worsenedd with age and his general condition deteriorated progressively. He died at the agee of 3 months. Patientt 2 has been described before as the third child of Israeli Arab, 1st degree cousins.166 He was born at term, after an uncomplicated pregnancy and delivery. On routinee examination at 9 months of age he was reported as an alert, well developed baby withoutt dysmorphic features, hepatomegaly or neurological abnormalities. At age 22 monthss he could not walk unassisted, had hypotonia with absent tendon reflexes and athetoidd movements. MRI revealed cerebellar and vermian atrophy and dysmyelination. Att age 4 years he had retinitis pigmentosa, a flattened electroretinogram, abnormal visual

40 0 Novell mutations in the PEX2 gene evokedd potentials and sensorineural hearing loss documented by abnormal BAEP. Motor andd sensory nerve conductions were prolonged. Results of screening of urine and plasma forr abnormal amino acids, organic acids, oligosacharides and purine and pyrimidine metabolitess were negative. Lysosomal enzyme activities in fibroblasts were normal. The patientt continued to deteriorate and was in a vegetative state at the age of 9 years. At this agee he had elevated plasma levels of VLCFA, pipecolic and phytanic acid and abnormal bilee acid intermediates which suggested a peroxisomal biogenesis defect. EM and immunocytochemicall studies of the liver disclosed absence of peroxisomes in approximatelyy 90% of hepatocytes. The remaining 10% of the hepatocytes however, had numerouss normal looking peroxisomes containing catalase, alanine-glyoxylate aminotransferasee and peroxisomal p-oxidation enzymes. At that time, studies performed inn cultured fibroblasts revealed normal f$-oxidation of VLCFA and normal DHAPAT activityy and a normal catalase latency test.16 The child's condition continued to deteriorate andd he died from pneumonia at age 13 years. Patientt 3 was a female infant, first child of non-consanguineous parents from Ashkenazi-Jewishh origin. At birth, she looked dysmorphic with epicanthal folds, broad nasall bridge, high palate, dysplastic ears, excessive skin on the upper back and neck, hypoplasticc nipples, hypoplastic external genitalia and hypoplastic nails. She had a broad anteriorr fontanelle and her liver was enlarged. Her muscle tone was markedly decreased andd there was paucity of spontaneous movements. Biochemical investigations in plasma revealedd clear abnormalities indicative of a PBD as confirmed in fibroblasts in which a generalizedd loss of peroxisomal functions and the absence of peroxisomes were found. The patientt died in early infancy. The parents had a second child, who was healthy. Their third childd was a female, born at 42 weeks. Her physical examination revealed dysmorphism similarr to that of her older sister. Echocardiography revealed an atrial septal defect, a ventricularr septal defect and tricuspid regurgitation. She was severely hypotonic and unablee to suck. Seizures started on the second day of life and continued till her death at onee month. Patientt 4 was a full term male of first cousins. He had three healthy sisters. He was deliveredd after a normal pregnancy by an emergency perpartum caesarian section because off sudden fetal distress. He required immediate mechanical ventilation for the absence of respiratoryy movements. Generalized seizures were noted soon after birth and treated by intravenouss diazepam. The patient was transferred to the intensive care unit. Lethargy, severee hypotonia, poor spontaneous movements and absence of sucking were noted, as welll as an unusual large anterior fontanelle. The baby was not dysmorphic. Cardiac and respiratoryy examination were normal, hemodynamic status was stable and the liver was nott enlarged. Initial laboratory investigations were normal. Because of the isolation of Staphylococcuss aureus from the mother, neonatal infection was first considered. However, thee patient's neurological status did not improve and the seizures persisted despite the administrationn of antibiotics and anticonvulsants and the absence of meningitis. Brain MRI examinationn was normal, excluding severe perinatal asphyxia. Laboratory investigations att 7 weeks of life evidenced moderate cytolysis (ASAT: 246 U/l, ALAT: 88 U/l, yGT: 387 U/l,, alkaline phosphatase: 780 U/l). Liver ultrasound examination was normal but renal ultrasoundd showed two polycystic kidneys. X-ray skeleton was normal. Indirect ophthalmoscopyy did not reveal any lesion. In contrast, signal on electroretinogram and visuall evoked potentials were absent. Plasma VLCFAs were abnormally elevated

41 1 Chapterr 3 (C24/C222 ratio: 1.76 (N: 0.86 0.07) and C26/C22 ratio: 0.472 (N: 0.026 0.016)). Pipecolic acidd as well as C27 bile acid intermediates were elevated (pipecolic acid: 13.5 fimol/1 (N: 0.54-2.46);; THCA: 47.5 umol/1 (N < 0.035); DHCA: 61.9 umol/1 (N < 0.119)). These data were indicativee of a PBD as confirmed in fibroblasts in which a generalized loss of peroxisomal functionss and the absence of peroxisomes were found. Neurological status progressively worsenedd and the patient died at the age of 2 months.

BiochemicalBiochemical analysis DHAPATT activity,17 C26:0 and pristanic acid p-oxidation18 were assayed in primary skin fibroblastss as previously described. Catalase immunofluorescence19 and complementation analysis200 were performed as described before. To allow complementation analysis in the cellss of patient 2, we cultured these at 40°C for 3 days after fusion of the cells. This treatmentt results in a significant decrease of catalase-positive particles due to the mosaicism.. Details on this method will be described elsewhere (Gootjes et al., Chapter 5).

MutationMutation analysis PEX22 mutation analysis in the patients was performed at the genomic DNA level. Genomicc DNA was isolated from primary skin fibroblasts using the Wizard genomic DNAA purification kit (Promega, Madison, WI). The entire exons plus flanking intron sequencess from the PEX2 gene were amplified by PCR using the primer sets shown in tablee 1. All forward and reverse primers used for mutation analysis were tagged with a - 21M133 (5'-TGTAAAACGACGGCCAGT-3') sequence and M13rev (5'- CAGGAAACAGCTATGACC-3')) sequence, respectively. PCR fragments were sequenced inn two directions using '-21M13' and 'M13rev' fluorescent primers on an Applied Biosystemss 277A automated DNA sequencer following the manufacturer's protocol (Perkinn Elmer, Wellesley, MA).

Tablee 1 Primer sets used for PEX2 mutation analysis ampliconn 5' primer (forward) 3' primer (reverse) exonn 1 [-21M13]-TCAGAGACAGAGTTCTTCCG [M13rev]-CAGGAAGCCAATAAACAGGG exonn 2 [-21M13J-ACTGAAGGCTCAGATGGTTG [M13rev]-TGGTCTTCACCATCACAGTC exonn 3 [-21M13]-TTAGAACACTGGCAGTGTGG [M13rev]-ATGCTTCTCACCATAAATGCC exonn 4a [-21M13J-AAACGCTCATCGCCTATGTG [M13rev]-GTTGCAAACTTTCCCCTCTG exonn 4b [-21M13J-TGGGAAAGTCAAGCAGTGTG [M13rev]-ATGCCTGGAAAGGAGAAGAC

QuantitativeQuantitative real-time RT-PCR analysis Totall RNA was isolated from primary skin fibroblasts using Trizol (Invitrogen, Carlsbad, CA)) extraction, after which cDNA was prepared using a first strand cDNA synthesis kit forr RT-PCR (Roche, Mannheim, Germany). Quantitative real-time PCR analysis of PEX2 andd |3-2-microglobulin RNA was performed using the LightCycler FastStart DNA Master SYBRR green I kit (Roche, Mannheim, Germany). PEX2 primers used were: PEX2-LC-F, 5'- GTCTCTGAGCTTCTGGCAAGG -3' and PEX2-LC-R, 5'-AAACTGGGACCAAACTAGCTG- 3'.. p-2-MicrogIobulin primers used were: b2M-FW, 5'-TGAATTGCTATGTGTCTGGG-3' andd b2M-REV, 5'-CATGTCTCGATCCCACTTAAC-3'. The PCR program comprised a 10 minn initial denaturation step at 95°C to activate the hot start polymerase, followed by 40 cycless of 95°C for 10 sec, 58°C for 2 sec and 72°C for 11 sec (9 sec for (3-2-microglobulin). Fluorescencee was measured at 82°C for PEXZ and 80°C for p-2-microgIobulin. Melt curve

42 2 Novell mutations in the PEX2 gene

Tablee 2 PEX2 mutations and biochemical markers infibroblast ss from 4 patients with a PBD IDD Pheno Survi-- Mutationn genomic DNA Conse-- DHAPAT T C26:00 p- Pris.. acid P- Catalase 2 2 22 type e val l quence e activity1 1 oxidation oxidation IF 11 ZS 33 mo c.739T>CC (homo) C247R R 0.7 7 186 6 2 2 22 IRD 133 yrs C.669G>AA (homo) W223X X 7.8 8 1172 2 495 5 +/-- 33 ZS C.355C>TT (homo) R119X X 0.6 6 98 8 41 1 44 ZS 22 mo c.279-283delGAGAT(homo) ) R94fs,, 98X 1.3 3 78 8 1 1 Controll values 5.8-12.3 3 1100-1500 0 675-1100 0 + + 11 nmol/2hr.mg protein 2 pmol/hr.mg protein * early infancy

analysiss to show generation of a single product for each reaction was carried out following thee PCR program. Amplification of a single product of the correct size was also confirmed byy agarose gel electrophoresis. Duplicate analysis was performed for all samples. Data weree analyzed using LightCycler Software, version 3.5 (Roche, Mannheim, Germany). To adjustt for variations in the amount of input RNA, the values for the PEX2 gene were normalizedd against the values for the housekeeping gene p-2-microglobulin and the patientt ratios were presented as a percentage of the mean of 2 control fibroblast cell lines.

Results s

Inn this study we analyzed four patients affected by a PBD as concluded from the finding of typicall abnormalities in plasma (elevated levels of VLCFA, bile acid intermediates, pristanicc and phytanic acid) and primary skin fibroblasts (deficient DHAPAT activity, C26:00 p-oxidation and pristanic acid p-oxidation (table 2)). Catalase immunofluorescence revealedd the absence of peroxisomes in patient 1, 3 and 4, whereas patient 2 displayed a mosaicc pattern, characterized by the absence of punctate immunofluorescence in the majorityy of cells whereas in about 30% of cells a punctate staining pattern was found. Subsequentt cell fusion complementation studies revealed that the four patients belong to CG100 with PEX2 as the causative gene. Sequence analysis of the PEX2 gene of these patientss revealed 4 different mutations, 3 of which have not been reported before. The mutationss involve one missense mutation, two nonsense mutations and one deletion (table 2).. Patient 1 was homozygous for a missense mutation changing the cysteine at position 2477 to an arginine (figure 1). This cysteine residue is the second cysteine residue of the

11 140 159 195213 21 4 4 >833 3{ PEX22 WT 11 1

1.. 739C>T |C247R 2.. 669G>A | I W223X

3.. 3550T I I R119X 4.. 279-283del | U 94fs, 98X

Figuree 1 Deduced PEX2 products of 4 PBD patients. The diagram shows the predicted protein productt of each PEX2 allele. The zinc-binding domain is indicated by a dark gray box and each off the transmembrane domains is indicated by the black boxes. The light gray bar indicates the lengthh of additional amino acids that are appended as a result of a frameshifting mutation.

43 3 Chapterr 3 zinc-bindingg domain. Patient 2 was homozygous for a nonsense mutation (W223X) that truncatess the protein between the second transmembrane domain and the zinc-binding domain.. Patient 3 was homozygous for a nonsense mutation (R119X) that truncates the proteinn before the first transmembrane domain. This mutation has been described before.10-211 Patient 4 was homozygous for a 5-bp deletion (279-283delGAGAT) that results inn a frameshift and leads to truncation of the protein before the first transmembrane domain.. Thus, three of the four mutations create an early termination codon in the PEX2 openn reading frame that will result in a truncated protein product (figure 1). Inn eukaryotic cells, the introduction of a nonsense codon into mRNA can also lead to nonsense-mediatedd decay of the mRNA, resulting in a reduction of protein production, a processs common in human genetic disease.22-21 To test for this latter possibility as a primaryy cause of PEX2 dysfunction in these patients, RNA from the patient cell lines was analyzedd by real-time RT-PCR to quantify PEX2 mRNA. These analyses showed that PEX2PEX2 transcript levels in patient 1, carrying the missense mutation C247R, were elevated 150%,, compared to controls (figure 2). Of the three patients with frameshift or nonsense mutations,, only patient 2 showed decreased PEX2 mRNA levels of around 35%. The PEX2 transcriptt levels in patient 3 and 4 were relatively normal with 90% and 80%, respectively.

Controll 1 Controll 2 Patientt 1: C247R Figuree 2 Quantitative real- Patientt 2: W223X timee RT-PCR analysis of PEX2.PEX2. Presented are the Patientt 3: R119X PEX2/[3-2-microglobulinn ratios Patientt 4: 94fs, 98X expressedd as percentages of thee mean of controls 1 and 2. 00 20 40 60 80 100 120 140 PEX2/b-2-microglobulinn (% of mean of controls)

Discussion n

Mutationss in PEX2 are known to underlie the disease in patients with a PBD belonging to complementationn group 10.10 In this study we determined the PEX2 genotypes of four patientss diagnosed in our laboratory. All four patients have mutations in the PEX2 gene, confirmingg that a defective PEX2 is responsible for the disease in these patients. The mutationss involve one missense mutation, two nonsense mutations and one deletion. Threee of the mutations have not been described previously. Except for patient 2, all patientss had the severe ZS phenotype and died before 3 months of age. Patient 2 was diagnosedd with IRD and survived for over 9 years. For patient 3 and 4 the phenotype appearss to correlate rather well with the genotype. The two mutations in both patients involvee a stop codon upstream of the sequences encoding the transmembrane domains andd result into a severe ZS phenotype. This strongly suggests that either no functional PEX22 protein is produced or that the truncated proteins are not correctly localized to the peroxisomall membrane. The mutation in patient 3 has been described before in homozygous100 and compound heterozygous form.24-25 Both homozygous patients

44 4 Novell mutations in the PEX2 gene describedd presented with the ZS phenotype. In one compound heterozygous patient the mutationn was found in combination with a temperature-sensitive missense mutation (E55K),, which led to a milder phenotype, whereas in another patient it was found in combinationn with an R125X mutation on the other allele. This patient was diagnosed with thee severe ZS phenotype and died before 3 months of age. In addition to this, one more patientt was described lacking (one of) the transmembrane domains. This patient was homozygouss for a del550C mutation, leading to a frameshift at amino acid 184 and terminationn seven amino acids downstream.26 The predicted protein sequence lacks both thee second transmembrane domain and the zinc-binding domain and results in the ZS phenotype.. These additional cases support our conclusions on patient 3 and 4. Biochemicall data are in agreement with the genotype in patients 3 and 4: DHAPAT activity,, C26:0 |3-oxidation and pristanic acid p-oxidation are clearly abnormal. Recent studiess in fibroblasts of patients suffering from severe and mild forms of PBD have shown thatt DHAPAT activity, C26:0 p-oxidation and, to a lesser extent, pristanic acid p-oxidation correlatee best with patients' survival.27 Thee mutation found in patient 2 is predicted to result in a protein that lacks the zinc- bindingg domain but does contain the two transmembrane domains. This patient was describedd before as a patient with a 'new type of peroxisomal disorder with variable expressionn in liver and fibroblasts'.16 When examined at 9 months of age, no major abnormalitiess were found but after the first year of life neurodegenerative symptoms developedd and at the age of 9 he was in a vegetative state. The patient died from pneumoniaa at the age of 13 years. Previous studies in fibroblasts of this patient did not reveall peroxisomal abnormalities with regard to de novo plasmalogen synthesis, DHAPAT activityy and the presence of catalase in a particle bound form. However, these studies were donee in the beginning of the 1990s, and since then more sensitive methods to assess peroxisomall functioning have been developed including immunofluorescence microscopy analysiss using antibodies raised against catalase as well as the measurements of C26:0 and pristanicc acid p-oxidation. When we reinvestigated the patient's fibroblasts using these methodss we found clear abnormalities such as a reduced rate of pristanic acid p-oxidation andd an abnormal catalase immunofluorescence pattern with both positive and negative cellss (table 2). This mosaic pattern is indicative of a peroxisomal biogenesis defect. Biochemicall parameters such as VLCFA, phytanic acid and DHCA and THCA levels were alsoo abnormal in plasma of the patient. In liver, catalase was localized in only 10% of peroxisomes.166 Although PEX2 RNA levels were decreased to 35%, in part of the fibroblastss peroxisomes were normally present. This suggests that the truncated form of PEX22 lacking the zinc-binding domain that is present may be localized correctly and is still (partly)) active. This would imply that the zinc-binding domain is not obligatory for the activityy of PEX2. A similar phenomenon was described before in another P£X2-deficient patientt that had a deletion (642delG) leading to a frameshift at amino acid 214 leading to terminationn two amino acids downstream.26 This patient was diagnosed also with a mild phenotypee (IRD). In this patient only fibroblasts were studied, which also showed a mosaicc pattern of catalase staining (20% of the cells contained normal peroxisomes), and mildlyy reduced VLCFA p-oxidation and normal DHAPAT activity. It can be concluded fromm both our patient as well as the patient reported by Shimozawa et al., 2000, that truncatedd PEX2 lacking the zinc-binding domain still displays some functional activity.

45 5 Chapterr 3

Thee mutation found in patient 1, which changes the second cysteine residue (position 247) off the zinc-binding domain into arginine, however, seems to disagree with this postulate. Thiss patient displays a severe phenotype and severely impaired biochemical parameters, indicativee of a severe impairment in peroxisome biogenesis. A comparable mutation was foundd in a CHO-mutant (C246Y; the CHO PEX2 comprises 304 amino acids, one residue shorterr than human PEX2)28 which also did not show any catalase positive particles. Apparently,, the complete absence of the zinc-binding domain is less deleterious for the functioningg of PEX2, than a mutation within the domain itself. Because PEX2 RNA transcriptt levels in this patient were normal, this may be due to an increased instability of PEX22 protein due to this mutation. Unfortunately, no antibodies raised against full length PEX22 are available to study this possibility. Alternatively, it may be that the mutation in thee zinc-binding domain, which is thought to function in the interaction with other proteinss (for instance PEX1013), causes an inhibiting effect on the function of these other proteins,, thereby causing a severe impairment of peroxisome biogenesis. Such a 'dominant negative'' effect is not present in patients completely lacking the zinc-binding domain. CHOO cell lines with missense mutations of two other cysteine residues in the zinc-binding domainn have also been reported. A C258Y mutation has been described, which leads to a disturbedd import of PTS1 proteins, whereas the PTS2 protein peroxisomal thiolase is normallyy imported.29 A CHO mutant with a C264S mutation was found to have a normal catalasee import.30 Thus, not all cysteine mutations in this region lead to a severe defect. Mutationss in the other two zinc-binding domain-containing peroxins PEX10 and PEX122 have also been reported. In PEX10, one mutation leads to truncated PEX10 lacking thee zinc-binding domain.31-32 All patients homozygous for this mutation were diagnosed withh the severe ZS phenotype. Moreover, all patients lacking the zinc-binding domain of PEX122 display a severe clinical phenotype and abnormal biochemical parameters,33 suggestingg that in PEX12 the zinc-binding domain is indispensable for its function. Thus, regardingg the zinc-binding domain, the genotype-phenotype correlation for PEX2 seems too be different than for other proteins, making the function of this domain in PEX2 unclear, andd worthwhile to study in more detail.

Acknowledgements s

Thee authors thank Petra Mooijer and Conny Dekker for biochemical analyses in patient fibroblasts.. Dr. Deprettere is gratefully acknowledged for his help in the diagnosis of one off the patients.

References s

1.. Gould S.J., Raymond G.V. and Valle D. (2001) The peroxisome biogenesis disorders. In: Scriver C.R., Beaudett A.L., Valle D. and Sly W.S. (eds.) The metabolic and molecular bases of inherited disease. McGraw-Hill,, New York, 3181-3217. 2.. Kelley R.I., Datta N.S., Dobyns W.B., Hajra A.K., Moser A.B., Noetzel M.J., Zackai E.H. and Moser H.W. (1986)) Neonatal adrenoleukodystrophy: new cases, biochemical studies, and differentiation from Zellwegerr and related peroxisomal polydystrophy syndromes. Am.]Med.Genet. 23: 869-901. 3.. Poll-The B.T., Saudubray J.M., Ogier H.A., Odievre M., Scotto J.M., Monnens L., Govaerts L.C., Roels F., Corneliss A. and Schutgens R.B. (1987) Infantile Refsum disease: an inherited peroxisomal disorder. Comparisonn with Zellweger syndrome and neonatal adrenoleukodystrophy. Eur.J.Pediatr. 146: 477-483. 4.. Barth P.G., Gootjes ]., Bode H., Vreken P., Majoie C.B. and Wanders RJ. (2001) Late onset white matter

46 6 Novell mutations in the PEX2 gene

diseasee in peroxisome biogenesis disorder. Neurology 57: 1949-1955. 5.. Heymans H.S., Schutgens R.B., Tan R., van den Bosch H. and Borst P. (1983) Severe plasmalogen deficiencyy in tissues of infants without peroxisomes (Zellweger syndrome). Nature. 306: 69-70. 6.. Datta N.S., Wilson G.N. and Hajra A.K. (1984) Deficiency of enzymes catalyzing the biosynthesis of glycerol-etherr lipids in Zellweger syndrome. A new category of metabolic disease involving the absence off peroxisomes. N.Engl.].Med. 311:1080-1083. 7.. Gould S.J. and Valle D. (2000) Peroxisome biogenesis disorders: genetics and cell biology. Trends Genet. 16:: 340-345. 8.. Subramani S. (1996) Protein translocation into peroxisomes. J.Biol.Chem. 271: 32483-32486. 9.. Terlecky S.R., Legakis J.E., Hueni S.E. and Subramani S. (2001) Quantitative analysis of peroxisomal proteinn import in vitro. Exp.Cell Res. 263: 98-106. 10.. Shimozawa N., Tsukamoto T., Suzuki Y., Orii T., Shirayoshi Y„ Mori T. and Fujiki Y. (1992) A human genee responsible for Zellweger syndrome that affects peroxisome assembly. Science 255: 1132-1134. 11.. Biermanns M. and Gartner J. (2000) Genomic organization and characterization of human PEX2 encodingg a 35- kDa peroxisomal membrane protein. Biochem.Biophys.Res.Commun. 273: 985-990. 12.. Harano T., Shimizu N., Otera H. and Fujiki Y. (1999) Transmembrane topology of the peroxin, Pex2p, an essentiall component for the peroxisome assembly. J.Biochem. 125: 1168-1174. 13.. Okumoto K., Abe I. and Fujiki Y. (2000) Molecular anatomy of the peroxin Pexl2p: ring finger domain is essentiall for Pexl2p function and interacts with the peroxisome- targeting signal type 1-receptor Pex5p andd a ring peroxin, PexlOp. J.Biol.Chem. 275: 25700-25710. 14.. Reguenga C, Oliveira M.E., Gouveia A.M., Sa-Miranda C. and Azevedo J.E. (2001) Characterization of thee mammalian peroxisomal import machinery: Pex2p, Pex5p, Pexl2p, and Pexl4p are subunits of the samee protein assembly. J.Biol.Chem. 276: 29935-29942. 15.. Wanders R.J., Schutgens R.B. and Barth P.G. (1995) Peroxisomal disorders: a review. J.Neuropathol.Exp.Neurol.J.Neuropathol.Exp.Neurol. 54: 726-739. 16.. Mandel H., Espeel M., Roels F., Sofer N., Luder A., Iancu T.C., Aizin A., Berant M., Wanders R.J. and Schutgenss R.B. (1994) A new type of peroxisomal disorder with variable expression in liver and fibroblasts.. J.Pediatr. 125: 549-555. 17.. Ofrnan R. and Wanders R.J. (1994) Purification of peroxisomal acyl-CoA: dihydroxyacetonephosphate acyltransferasee from human placenta. Biochim.Biophys.Acta 1206: 27-34. 18.. Wanders R.J., Denis S., Ruiter J.P., Schutgens R.B., van Roermund C.W. and Jacobs B.S. (1995) Measurementt of peroxisomal fatty acid beta-oxidation in cultured human skin fibroblasts. J.Inherit.Metab Dis.Dis. 18 Suppl 1:113-124. 19.. Heikoop J.C., van Roermund C.W., Just W.W., Ofrnan R., Schutgens R.B., Heymans H.S., Wanders R.J. andd Tager J.M. (1990) Rhizomelic chondrodysplasia punctata. Deficiency of 3-oxoacyl-coenzyme A thiolasee in peroxisomes and impaired processing of the enzyme. J.Clin.lnvest 86: 126-130. 20.. Brul S„ Westerveld A., Strijland A., Wanders R.J., Schram A.W., Heymans H.S., Schutgens R.B., van den B.H.. and Tager J.M. (1988) Genetic heterogeneity in the cerebrohepatorenal (Zellweger) syndrome and otherr inherited disorders with a generalized impairment of peroxisomal functions. A study using complementationn analysis. J.Clin.lnvest 81: 1710-1715. 21.. Shimozawa N., Suzuki Y., Orii T., Moser A., Moser H.W. and Wanders RJ. (1993) Standardization of complementationn grouping of peroxisome-deficient disorders and the second Zellweger patient with peroxisomall assembly factor-1 (PAF-1) defect. Am.J.Hum.Genet. 52: 843-844. 22.. Jacobson A. and Peltz S.W. (1996) Interrelationships of the pathways of mRNA decay and translation in eukaryoticc cells. Annu.Rev.Biochem. 65: 693-739. 23.. Maquat L.E. (1996) Defects in RNA splicing and the consequence of shortened translational reading frames.. Am.].Hum.Genet. 59: 279-286. 24.. Imamura A., Tsukamoto T., Shimozawa N., Suzuki Y., Zhang Z., Imanaka T., Fujiki Y., Orii T., Kondo N. andd Osumi T. (1998) Temperature-sensitive phenotypes of peroxisome-assembly processes represent the milderr forms of human peroxisome-biogenesis disorders. Am.J.Hum.Genet. 62:1539-1543. 25.. Shimozawa N., Suzuki Y., Tomatsu S„ Nakamura H., Kono T., Takada H., Tsukamoto T., Fujiki Y„ Orii T.. and Kondo N. (1998) A novel mutation, R125X in peroxisome assembly factor-1 responsible for Zellwegerr syndrome. Hum.Mutat. Suppl 1: S134-S136. 26.. Shimozawa N., Zhang Z., Imamura A., Suzuki Y., Fujiki Y., Tsukamoto T., Osumi T., Aubourg P., Wanderss R.J. and Kondo N. (2000) Molecular mechanism of detectable catalase-containing particles, peroxisomes,, in fibroblasts from a PEX2-defective patient. Biochem.Biophys.Res.Commun. 268: 31-35. 27.. Gootjes J., Mooijer P.A., Dekker C, Barth P.G., Poll-The B.T., Waterham H.R. and Wanders R.J. (2002) Biochemicall markers predicting survival in peroxisome biogenesis disorders. Neurology 59: 1746-1749. 47 7 Chapterr 3

28.. Thieringer R. and Raetz C.R. (1993) Peroxisome-deficient Chinese hamster ovary cells with point mutationss in peroxisome assembly factor-1. J.Biol.Chem. 268: 12631-12636. 29.. Huang Y., Ito R., Miura S., Hashimoto T. and Ito M. (2000) A missense mutation in the RING finger motif off PEX2 protein disturbs the import of peroxisome targeting signal 1 (PTSl)-containing protein but not thee PTS2-conraining protein. Biochcm.Biophys.Res.Cotnmun. 270: 717-721. 30.. Tsukamoto T., Shimozawa N. and Fujiki Y. (1994) Peroxisome assembly factor 1: nonsense mutation in a peroxisome-- deficient Chinese hamster ovary cell mutant and deletion analysis. Mol.Cell.Biol. 14: 5458- 5465. . 31.. Okumoto K.., Itoh R., Shimozawa N., Suzuki Y., Tamura S., Kondo N. and Fujiki Y. (1998) Mutations in PEX100 is the cause of Zellweger peroxisome deficiency syndrome of complementation group B. Hum.Mol.Genet.Hum.Mol.Genet. 7: 1399-1405. 32.. Warren D.S., Wolfe B.D. and Gould S.J. (2000) Phenotype-genotype relationships in PEXlO-deficient peroxisomee biogenesis disorder patients. Hum.Mutat. 15: 509-521. 33.. Chang C.C. and Gould S.J. (1998) Phenotype-genotype relationships in complementation group 3 of the peroxisome-biogenesiss disorders. Am.J.Hum.Genet. 63:1294-1306.

48 8 Chapterr 4

Novell mutations in the PEX12 gene of patients with a peroxisome biogenesiss disorder

Jeannettee Gootjes, Frank Sdimohl, Hans R. Waterham, Ronald J.A. Wanders, (2004) Eur.J.Hum.CenetEur.J.Hum.Cenet (In press) Chapterr 4 Novell mutations in the PEX12 gene of patients with a peroxisome biogenesiss disorder

Jeannettee Gootjes', Frank Schmohl1, Hans R. Waterham2, Ronald J. A. Wanders12

Lab.Lab. Genetic Metabolic Diseases, Departments of Clinical Chemistry and 2Pediatrics/Emma Children'sChildren's Hospital, Academic Medical Center, University of Amsterdam, The Netherlands.

Summary y

Thee peroxisome biogenesis disorders (PBDs) form a genetically and clinically heterogeneouss group of disorders due to defects in at least 11 distinct genes. The prototypee of this group of disorders is Zellweger syndrome (ZS), with neonatal adrenoleukodystrophyy (NALD) and infantile Refsum disease (IRD) as milder variants. Liverr disease, variable neurodevelopmental delay, retinopathy and perceptive deafness aree common to PBDs. PBD patients belonging to complementation group 3 (CG3) have mutationss in the PEX12 gene, which codes for a protein (PEX12) that contains two transmembranee domains, and a zinc-binding domain considered to be important for its interactionn with other proteins of the peroxisomal protein import machinery. We report on thee identification of five PBD patients belonging to CG3. Sequence analysis of their PEX12 geness revealed five different mutations, four of which have not been reported before. Four off the patients have mutations that disrupt the translation frame and/or create an early terminationn codon in the PEX12 open reading frame predicted to result in truncated proteinn products, lacking at least the COOH-terminal zinc-binding domain. All these patientss display the more severe phenotypes (ZS or NALD). The fifth patient expresses twoo PEX12 alleles capable of encoding a protein that does contain the zinc-binding domainn and displayed a milder phenotype (IRD). The three biochemical markers measuredd in fibroblasts (DHAPAT activity, C26:0 B-oxidation and pristanic acid B- oxidation)) also correlated with the genotypes. Thus, the genotypes of our CG3 patients showw a good correlation with the biochemical and clinical phenotype of the patients.

Introduction n

Thee peroxisome biogenesis disorders (PBDs; MIM: 601539), which include Zellweger syndromee (ZS; MIM: 214100), neonatal adrenoleukodystrophy (NALD; MIM: 202370) and infantilee Refsum disease (IRD; MIM: 266510), represent a spectrum of disease severity withh ZS being the most, and IRD the least severe disorder. Liver disease, variable neurodevelopmentall delay, retinopathy and perceptive deafness are common to all the threee PBDs.1 Patients with ZS are severely hypotonic from birth and die before 1 year of age.. Patients with NALD experience neonatal onset of hypotonia and seizures, and suffer fromm progressive white matter disease, dying usually in late infancy.2 Patients with IRD mayy survive beyond infancy and some may even reach adulthood.3 Clinical differentiation betweenn these disease states is not very well defined and patients can have overlapping symptoms.4 4 Thee absence of functional peroxisomes in patients with a PBD leads to a number of

50 0 Novell mutations in the PEX12 gene biochemicall abnormalities: (i) PBD patients have an impaired synthesis of plasmalogens, duee to a deficiency of the two enzymes dihydroxyacetonephosphate acyltransferase (DHAPAT)) and alkyl-dihydroxyacetonephosphate synthase (alkyl-DHAP-synthase).56 (ii) Peroxisomall fatty acid P-oxidation is defective, leading to the accumulation of very-long- chainn fatty acids (VLCFAs), notably 026:0, the branched-chain fatty acid pristanic acid and thee bile acid intermediates di- and trihydroxycholestanoic acid (DHCA and THCA).1 (iii) Phytanicc acid a-oxidation and L-pipecolic acid oxidation are impaired.1 While some peroxisomall enzymes are deficient, others show normal activity, including catalase, D- amino-acidd oxidase, L-a-hydroxy-acid oxidase A and alanine:glyoxylate aminotransferase, althoughh subcellular fractionation studies have shown that these enzymes are mislocalizedd to the cytoplasm.1 Thee PBDs are caused by genetic defects in PEX genes encoding proteins called peroxins,, which are required for the biogenesis of peroxisomes and function in the assemblyy of the peroxisomal membrane or in the import of enzymes into the peroxisome.7 Afterr synthesis on free polyribosomes, peroxisomal matrix proteins carrying either a carboxy-terminall peroxisomal targeting sequence 1 (PTS1) or a cleavable amino-terminal PTS22 signal are translocated across the peroxisomal membrane.7 A defect in one of the peroxinss of the peroxisomal import machinery leads to failure of protein import via the PTS1-- and/or PTS2-dependent import pathway and, consequently, to functional peroxisomee deficiency. Cell fusion complementation studies using patient fibroblasts revealedd the existence of at least 11 distinct genetic groups, of which currently all the correspondingg PEX genes have been identified. Most complementation groups are associatedd with more than one clinical phenotype.7 PBDD patients belonging to complementation group 3 (CG3) have mutations in the PEX222 gene (MIM: 601758).8 PEX12 was first identified in the yeast Pichia pastoris,9 and moree recent studies have led to the identification of the human homologue of this gene.810"122 HsPEXll encodes a 359 amino acid protein (PEX12), with a molecular weight off -41 kDa. PEX12 is an integral peroxisomal membrane protein with a zinc-binding motif att its COOH terminus.910 It spans the peroxisomal membrane twice and exposes its NH2 andd COOH termini to the cytoplasm. The protein interacts with PEX5 and PEX10 via its COOH-terminall zinc-binding domain, and is most likely involved in the actual process of translocationn of peroxisomal matrix proteins across the peroxisomal membrane.13 InIn this study, we report the identification of novel mutations in the PEX12 gene in five PBDD patients, which, using cell fusion complementation analysis, were shown to belong to complementationn group 3. The correlation between genotypes and phenotypes are discussed. .

Patientss and Methods

PatientPatient samples Alll patients analyzed showed the clinical characteristics of PBDs. Based on their clinical characteristicss patients have been diagnosed with ZS, NALD or IRD. Samples were collectedd from patients and sent to our laboratory for biochemical and molecular diagnosis. .

51 1 Chapterr 4

BiochemicalBiochemical analysis Thee biochemical diagnosis of a PBD was substantiated by detailed studies in primary skin fibroblasts,, including the measurement of DHAPAT activity14 and C26:0 and pristanic acid P-oxidation,155 and immunofluorescence using antibodies against catalase, D-bifunctional proteinn and the PTS1 signal peptide SKL (Zymed laboratories, San Francisco, CA, USA).16

ComplementationComplementation analysis Too identify the defective PEX gene in the patients, cell fusion complementation studies weree performed.17 Fibroblasts from the patients were fused with index fibroblasts from knownn complementation groups. The resulting heterokaryons were assayed for complementationn by catalase immunofluorescence as previously described.16

MutationMutation analysis PEX12PEX12 mutation analysis in the patients was performed at the genomic DNA level. Genomicc DNA was isolated from primary skin fibroblasts using the Wizard genomic DNAA purification kit (Promega, Madison, WI, USA). The entire exons plus flanking intron sequencess from the PEX12 gene were amplified by PCR using the primer sets shown in tablee 1. All forward and reverse primers used for mutation analysis were tagged with a - 211 Ml 3 (5'-TGTAAAACGACGGCCAGT-3') sequence and M13rev (5'- CAGGAAACAGCTATGACC-3')) sequence, respectively. PCR fragments were sequenced inn two directions using '-21M13' and 'M13rev' fluorescent primers on an Applied Biosystemss 277A automated DNA sequencer, following the manufacturer's protocol (Perkinn Elmer, Wellesley, MA, USA).

Tablee 1 Primer sets used for mutation analysis of the PEX12 gene at chromosome 17ql2 Ampliconn 5' primer (forward) 3' primer (reverse) Exonn 1 [-21M13]-TGAGCACCCATCTGATACTC [M13rev]-CGCTAGGCTACCAAATAAGC Exonn 2 [-21M13]-TGTGTCATGGAATGAATTTCAC [M13rev]-GGGATACGATTTTCGAATTTAC Exonn 3 [-21M131-GGAGATAGTACCAGTCTACC [M13rev]-TACCATGCTGAAACCAGCTC

QuantitativeQuantitative real-time RT-PCR analysis Totall RNA was isolated from primary skin fibroblasts using Trizol (Invitrogen, Carlsbad, CA,, USA) extraction, after which cDNA was prepared using a first strand cDNA synthesis kitt for RT-PCR (Roche, Mannheim, Germany). Quantitative real-time PCR analysis of PEX12PEX12 and (3-2-microglobulin RNA was performed using the LightCycler FastStart DNA Masterr SYBR green I kit (Roche, Mannheim, Germany). The PEX12 primers used were: PEX12-LC-F,, 5-CAGCCAGGAGTGTTAGTGAG-3'; and PEX12-LC-R, 5'- GGTTTTACGACACAGTGGGC-3'.. The |3-2-microglobulin primers used were: b2M-FW, S'-TGAATTGCTATGTGTCTGGG-S';; and b2M-REV, 5'-CATGTCTCGATCCCACTTAAC- 3'.. The PCR program comprised a 10 min initial denaturation step at 95°C to activate the hott start polymerase, followed by 40 cycles of 95°C for 10 s, 58°C for 2 s and 72°C for 11 s (99 s for (3-2-microglobulin). Fluorescence was measured at 82°C for PEX12 and 80°C for p- 2-microglobulin.. Melt curve analysis to show the generation of a single product for each reactionn was carried out following the PCR program. Amplification of a single product of thee correct size was also confirmed by agarose gel electrophoresis. Duplicate analysis was performedd for all samples. Data were analyzed using LightCycler Software, version 3.5

52 2 Novell mutations in the PEX12 gene

(Roche,, Mannheim, Germany). To adjust for variations in the amount of input RNA, the valuess for the PEX12 gene are normalized against the values for the housekeeping gene |3- 2-microglobulinn and the patient ratios are presented as a percentage of the mean of two controll fibroblast cell lines.

Results s

Inn this study, we analyzed five patients affected by a PBD, as concluded from the finding off typical abnormalities in plasma (elevated levels of VLCFA, bile acid intermediates, pristanicc and phytanic acid) and primary skin fibroblasts (deficient DHAPAT activity, C26:00 p-oxidation and pristanic acid p-oxidation and absence of catalase-positive particles visualizedd by immunofluorescence (table 2)).

Tablee 2 PEX12 mutations and biochemical markers in 5 patients with a PBD IDD Pheno Survival Mutation in Consequence DHAPAT C26:0 0- Pris. acid p- Cata- typee genomic DNA activity' oxidationb oxidationb lase IF PEX12-01 1 ZS S 99 mo 887-888delTC C L296fs->307X X 0.8 8 48 8 1 1 PEX12-02 2 IRD D 2.55 yrs 273A>T' ' R91S S 10.2 2 384 4 67 7 PEX12-03 3 ZS S 4.55 mo 625C>T T Q209X X 0.5 5 100 0 0 0 887-888delTC C L296fs->307X X PEX12-04 4 NALD D55 mo 604OT' ' R202X X 0.6 6 236 6 3 3 PEX12-05 5 ZS S 2.55 mo 308-309insT' ' L103fs->105X X 0.5 5 107 7 5 5 Controll values 5.8-12.33 1200-1500 675-1100 '' nmol/2hr.mg protein b pmol/hr.mg protein homozygous

Inn patient PEX12-2 normal levels of DHAPAT activity and a relatively high rate of C26:0 p- oxidationn were found, but no peroxisomal localization of catalase. This prompted us to studyy the localization of other peroxisomal matrix proteins in these fibroblasts. D- bifunctionall protein immunofluorescence revealed a particle-bound localization in approximatelyy 40% of the cells, and immunofluorescence with antibodies against the PTS1 signall peptide SKL showed a particle-bound localization in approximately 50% of the cells (figuree 1). In the positive cells, peroxisomes were larger and less abundant. These results indicatee that although catalase is almost exclusively localized in the cytosol, other peroxisomall matrix proteins display a mosaic distribution. This may account for the mild biochemicall abnormalities found in these cells.

Figuree 1 Immunofluorescent staining off fibroblasts from control (a) and patientt PEX12-02 (b-d). Cells were stainedd with antibodies against catalasee (a,b), D-bifunctional protein (c)) and the PTS1 signal peptide SKL (d). .

53 3 Chapterr 4

Celll fusion complementation studies revealed that the five patients belong to CG3 with PEX12PEX12 as the causative gene. Sequence analysis of the PEX12 gene of these patients revealedd five different mutations, four of which have not been reported before. The mutationss involve one deletion, one insertion, one missense and two nonsense mutations (tablee 2). Patient PEX12-01 was homozygous for a 2-bp deletion (887-888delTC) that was previouslyy described in a patient, who was compound heterozygous for this mutation.11 Thiss mutation results in a frameshift and premature termination of the protein before the COOH-terminall zinc-binding domain (figure 2). Patient PEX12-02 was homozygous for a missensee mutation (R91S) in the N-terminal part of the protein. Patient PEX12-03 was heterozygouss for a nonsense mutation (Q209X) that truncates PEX12 before the second transmembranee domain, and a 2-bp deletion that was also found in patient PEX12-01. Patientt PEX12-04 was homozygous for a nonsense mutation (R202X) that truncates PEX12 beforee the second transmembrane domain, and patient PEX12-05 was homozygous for a 1- bpp insertion (308-309insT) that results in a frameshift and premature termination of the proteinn before the first transmembrane domain. Thus, four of the five mutations disrupt thee translation frame and/or create an earlier termination codon in the PEX12 open readingg frame, and are predicted to result in a truncated protein product (figure 2) or in no productt at all.

PEX122 WT

12-01 1 887-888delTC C 296fs,, 307X 12-02 2 273A>T T •• R91S 12-03 3 625C>T T ]] Q209X 887-888delTC C || 296fs, 307X 12-04 4 604OT T R202X X 12-05 5 308-309insT T ]] 103fs, 105X

Figuree 2 Deduced PEX12 products of five PBD patients. The diagram shows the predicted proteinn product of each PEX12 allele. The zinc-binding domain is indicated by a horizontally stripedd box and each of the transmembrane domains is indicated by a vertically striped box. Thee black boxes indicate the length of additional amino acids that are appended as a result of frame-shiftingg mutations.

Inn eukaryotic cells, the introduction of a nonsense codon into mRNA can also lead to nonsense-mediatedd decay of the mRNA and subsequent reduction in protein production, aa process common in human genetic disease.1819 To test for this latter possibility as a primaryy cause of PEX12 dysfunction in these patients, RNA from the patient cell lines was analyzedd by real-time RT-PCR to quantify PEX12 mRNA. These analyses showed that the levelss of PEX12 mRNA in patient PEX12-02, carrying the missense mutation, were relativelyy normal (figure 3). From the four patients with frameshift and/or nonsense mutations,, patient PEX12-01, homozygous for the 887-888delTC mutation, displayed relativelyy normal PEX12 transcript levels (>80%). The PEX12 transcript level in patient PEX12-03,, compound heterozygous for the mutation in patient PEX12-01 and the nonsense

54 4 Novell mutations in the PEX12 gene mutationn Q209X, was shown to be 50% of controls, whereas the level in patient PEX12-04 withh the nonsense mutation R202X was markedly reduced to 20%. Patient PEX12-05, homozygouss for the 308-309insT mutation, showed PEX12 transcript levels of 40%. Except forr patient PEX12-01, these results indicate that PEX12 transcripts containing a nonsense codonn are actively removed by nonsense-mediated decay.

Ctrll 1 Ctrll 2 PP 1: 296fs, 307X P2:: R91S Figuree 3 Quantitative real-time RT- PP 3: 296fs, 307X/Q209X PCRR analysis of PEX12. The PEX12/|3-2-microglobulinn ratios PP 4: R202X expressedd as percentages of the P5:: 103fs,105X meann of controls 1 and 2 are given. 200 40 60 80 100 PEX77 2/p-2-microglobulin (%% of mean of controls) Discussion n

Mutationss in PEX12 are known to underlie the disease in patients with a peroxisome biogenesiss disorder belonging to CG3.810 Previous studies have shown a relatively straightforwardd relationship between genotype and phenotype in seven patients of this group.111 In this study, we determined the PEX12 genotypes of five additional patients, diagnosedd in our laboratory. After having assigned the patients to CG3 by cell fusion complementationn studies, we found mutations in the PEX12 gene of all the five patients, confirmingg that a defective PEX12 is indeed responsible for the disease in these patients. Fourr patients were apparent homozygotes for a mutation and one patient a heterozygote forr two mutations. No parental DNA was available for confirmation of the zygosity. The mutationss found involve one deletion, one insertion, one missense and two nonsense mutations.. Four of the mutations have not been described previously. Exceptt for patient PEX12-02, all patients displayed the more severe phenotypes (ZS or NALD)) and survived for less than 9 months. Patient PEX12-02 was diagnosed with IRD andd survived for 2.5 years. All severely affected patients in our cohort lacked the COOH- terminall zinc-binding domain that is important for PEX12 function and interacts with PEX55 and PEX10.13-20 In cells of three of these four patients, reduced PEX12 mRNA levels weree found, which will contribute to a reduced PEX12 function, but cannot explain this entirely.. Unfortunately, no antibodies raised against full-length PEX12 are available to studyy protein stability of the truncated PEX12 products. The milder affected patient (patientt PEX12-02) contained a missense mutation (R91S) in the N-terminus of the protein and,, consequently, is predicted to produce full length PEX12. In 1998, Chang and Gould describedd a patient with a 2-bp deletion at the N-terminal part of the protein that theoreticallyy would produce an eight amino acid protein.11 This patient had the IRD phenotypee and in vitro translation showed that translation was re-initiated at a downstreamm AUG codon, at position 94. This shows that the first part of the protein is not obligatoryy for import/function of PEX12. Extrapolation of this result to our own data suggestss that the R91S mutation does not have a major deleterious effect on PEX12 function. .

55 5 Chapterr 4

Wee found that, in our cohort, severe defects in PEX12 activity were associated with mutationss that truncated PEX12 upstream of the COOH-terminal zinc-binding domain. Mutationss in another zinc-binding domain-containing PEX10 have also been reported. In PEX10,PEX10, one mutation leads to truncated PEX10 lacking the zinc-binding domain.2122 All patientss homozygous for this mutation were diagnosed with the severe ZS phenotype; so regardingg the zinc-binding domain, the genotype-phenotype correlation for PEX12 seems too be similar to PEXW. Recentt studies in fibroblasts have shown that DHAPAT activity, C26:0 (3-oxidation and,, to a lesser extent, pristanic acid P-oxidation correlate best with patients' survival.23 Thee mutations in our cohort correlate rather good with the biochemical markers. All patientss with truncated PEX12 proteins have a severely deficient DHAPAT activity and C26:00 and pristanic acid (3-oxidation, whereas the IRD patient with the missense mutation hass a normal DHAPAT activity, a mildly defective C26:0 and pristanic acid (3-oxidation, andd a mosaic distribution of peroxisomal matrix proteins, as demonstrated by immunofluorescencee with antibodies against D-bifunctional protein and the PTS1 signal peptidee SKL. Thus, the genotypes of our CG3 patients show a good correlation with the biochemicall and clinical phenotype of the patients.

Acknowledgements s

Thee authors thank Petra Mooijer and Conny Dekker for biochemical analyses in patient fibroblasts.. This work was supported by the Prinses Beatrix Fonds, grant 99.0220.

References s

1.. Gould S.J., Raymond G.V. and Valle D. (2001) The peroxisome biogenesis disorders. In: Scriver C.R., Beaudett A.L., Valle D. and Sly W.S. (eds.) The metabolic and molecular bases of inherited disease. McGraw-Hill,, New York, 3181-3217. 2.. Kelley R.I., Datta N.S., Dobyns W.B., Hajra A.K., Moser A.B., Noetzel M.J., Zackai E.H. and Moser H.W. (1986)) Neonatal adrenoleukodystrophy: new cases, biochemical studies, and differentiation from Zellwegerr and related peroxisomal polydystrophy syndromes. Am.}.Med.Genet. 23: 869-901. 3.. Poll-The B.T., Saudubray J.M., Ogier H.A., Odievre M, Scotto J.M., Monnens L., Govaerts L.C., Roels F., Corneliss A. and Schutgens R.B. (1987) Infantile Refsum disease: an inherited peroxisomal disorder. Comparisonn with Zellweger syndrome and neonatal adrenoleukodystrophy. Eur.j.Pediatr. 146: 477-483. 4.. Barth P.G., Gootjes J., Bode H., Vreken P., Majoie C.B. and Wanders RJ. (2001) Late onset white matter diseasee in peroxisome biogenesis disorder. Neurology 57: 1949-1955. 5.. Datta N.S., Wilson G.N. and Hajra A.K. (1984) Deficiency of enzymes catalyzing the biosynthesis of glycerol-etherr lipids in Zellweger syndrome. A new category of metabolic disease involving the absence off peroxisomes. N.Engl.JMed. 311: 1080-1083. 6.. Heymans H.S., Schutgens R.B., Tan R., van den Bosch H. and Borst P. (1983) Severe plasmalogen deficiencyy in tissues of infants without peroxisomes (Zellweger syndrome). Nature. 306: 69-70. 7.. Gould S.J. and Valle D. (2000) Peroxisome biogenesis disorders: genetics and cell biology. Trends Genet. 16:: 340-345. 8.. Chang C.C., Lee W.H., Moser H., Valle D. and Gould S.J. (1997) Isolation of the human PEX12 gene, mutatedd in group 3 of the peroxisome biogenesis disorders. Nat.Genet. 15: 385-388. 9.. Kalish J.E., Keller G.A., Morrell J.C., Mihalik S.J., Smith B., Cregg J.M. and Gould S.J. (1996) Characterizationn of a novel component of the peroxisomal protein import apparatus using fluorescent peroxisomall proteins. EMBO.J. 15: 3275-3285. 10.. Okumoto K. and Fujiki Y. (1997) PEX12 encodes an integral membrane protein of peroxisomes [letter]. Nat.Genet.Nat.Genet. 17: 265-266.

56 6 Novell mutations in the PEX12 gene

11.. Chang C.C. and Gould S.J. (1998) Phenotype-genotype relationships in complementation group 3 of the peroxisome-biogenesiss disorders. Am.J.Hnm.Gcnet. 63: 1294-1306. . 12.. Okumoto K., Shimozawa N., Kawai A., Tamura S., Tsukamoto T., Osumi T., Moser H., Wanders R.J., Suzukii Y., Kondo N. and Fujiki Y. (1998) PEX12, the pathogenic gene of group III Zellweger syndrome: cDNAA cloning by functional complementation on a CHO cell mutant, patient analysis, and characterizationn of PEX12p. Mol.Ceil.Biol. 18: 4324-4336. 13.. Chang C.C, Warren D.S., Sacksteder K.A. and Gould S.J. (1999) PEX12 interacts with PEX5 and PEX10 andd acts downstream of receptor docking in peroxisomal matrix protein import. J.Cell Biol. 147: 761-774. 14.. Ofman R. and Wanders R.J. (1994) Purification of peroxisomal acyl-CoA: dihydroxyacetonephosphate acyltransferasee from human placenta. Biochim.Biophys.Acta 1206: 27-34. 15.. Wanders R.J., Denis S., Ruiter J.P., Schutgens R.B., van Roermund C.W. and Jacobs B.S. (1995) Measurementt of peroxisomal fatty acid beta-oxidation in cultured human skin fibroblasts. ].Inherit.Metab Dis.. 18 Suppl 1:113-124. 16.. van Grunsven E.G., van Berkel E., Mooijer P.A., Watkins P.A., Moser H.W., Suzuki Y., Jiang L.L., Hashimotoo T., Hoefler G., Adamski J. and Wanders RJ. (1999) Peroxisomal bifunctional protein deficiencyy revisited: resolution of its true enzymatic and molecular basis. Am.J.Hnm.Genet. 64: 99-107. 17.. Brul S-, Westerveld A., Strijland A., Wanders R.J., Schram A.W., Heymans H.S., Schutgens R.B., van den B.H.. and Tager J.M. (1988) Genetic heterogeneity in the cerebrohepatorenal (Zellweger) syndrome and otherr inherited disorders with a generalized impairment of peroxisomal functions. A study using complementationn analysis. J.Clin.Invest 81: 1710-1715. 18.. Jacobson A. and Peltz S.W. (1996) Interrelationships of the pathways of mRNA decay and translation in eukaryoticc cells. Annu.Rev.Biochem. 65: 693-739. 19.. Maquat L.E. (1996) Defects in RNA splicing and the consequence of shortened translational reading frames.. Am.].Hum.Genet. 59: 279-286. 20.. Okumoto K., Abe I. and Fujiki Y. (2000) Molecular anatomy of the peroxin Pexl2p: ring finger domain is essentiall for Pexl2p function and interacts with the peroxisome- targeting signal type 1-receptor Pex5p andd a ring peroxin, PexlOp. J.Biol.Chem. 275: 25700-25710. 21.. Okumoto K., Itoh R., Shimozawa N., Suzuki Y., Tamura S., Kondo N. and Fujiki Y. (1998) Mutations in PEX100 is the cause of Zellweger peroxisome deficiency syndrome of complementation group B. Hum.Mol.Genet.Hum.Mol.Genet. 7: 1399-1405. 22.. Warren D.S., Wolfe B.D. and Gould S.J. (2000) Phenotype-genotype relationships in PEXlO-deficient peroxisomee biogenesis disorder patients. Hum.Mutat. 15: 509-521. 23.. Gootjes J., Mooijer P.A., Dekker C, Barth P.G., Poll-The B.T., Waterham H.R. and Wanders R.J. (2002) Biochemicall markers predicting survival in peroxisome biogenesis disorders. Neurology 59: 1746-1749.

57 57

Chapterr 5

Identificationn of the molecular defect in patients with peroxisomal mosaicismm using a novel method involving culturing of cells at : implicationss for other inborn errors of metabolism

Jeannettee Gootjes, Frank Schmohl, Petra A.W. Mooijer, Conny Dekker, Hanna Mandel, Meral Topcu,, Martina Huemer, M. won Schiitz, Thorsten Marquardt, Jan A. Smeitink, Hans R. Waterham,, Ronald J.A. Wanders, Submitted for publication Chapterr 5 Identificationn of the molecular defect in patients with peroxisomal mosaicismm using a novel method involving culturing of cells at 40°C: implicationss for other inborn errors of metabolism

Jeannettee Gootjes1, Frank Schmohl1, Petra A.W. Mooijer2, Conny Dekker2, Hanna MandeP, Merall Topcu4, Martina Huemer5, M. von Schutz6, Thorsten Marquardt7, Jan A. Smeitink8, Hanss R. Waterham2, Ronald J.A. Wanders12

DepartmentsDepartments of * Clinical Chemistry and '-Pediatrics, Emma Children's Hospital, Academic Medical Center,Center, University of Amsterdam, The Netherlands, 3Metabolic Unit, Department of Pediatrics, RambamRambam Medical Center, Haifa, Israel, Pediatric Neurology Unit, Hacettepe University School of Medicine,Medicine, Ankara, Turkey, r,Landeskrankenhaus Feldkirch, Dept. of Pediatrics, Feldkirch, Austria, bbKinderkrankenhausKinderkrankenhaus Auf der Bult, Hannover, Germany, 7Klinik und Poliklinik fur Kinderheilkunde,Kinderheilkunde, Munster, Germany, ^Department of Pediatrics, University Medical Centre Nijmegen,Nijmegen, Nijmegen, The Netherlands.

Summary y

Thee peroxisome biogenesis disorders (PBDs), which comprise Zellweger syndrome (ZS), neonatall adrenoleukodystrophy and infantile Refsum disease (IRD), represent a spectrum off disease severity with ZS being the most, and IRD the least severe disorder. The PBDs aree caused by mutations in one of the at least 12 different PEX genes encoding proteins involvedd in the biogenesis of peroxisomes. We report the biochemical characteristics and molecularr basis of a subset of atypical PBD patients. These patients were characterized by abnormall peroxisomal plasma metabolites, but otherwise normal to very mildly abnormal peroxisomall parameters in cultured skin fibroblasts, including a mosaic catalase immunofluorescencee pattern in fibroblasts. Since this latter feature made standard complementationn analysis impossible, we developed a novel complementation technique inn which fibroblasts were cultured at 40°C, which exacerbates the defect in peroxisome biogenesis.. Using this method, we were able to assign eight patients to complementation groupp 3, followed by the identification of a single homozygous S320F mutation in their PEX12PEX12 gene. We also investigated various peroxisomal biochemical parameters in fibroblastss at 30°C, 37°C and 40°C and found that all parameters showed a temperature- dependentt behavior. The principle of culturing cells at elevated temperatures to exacerbatee the defect in peroxisome biogenesis and thereby preventing certain mutations too be missed, may well have a much wider applicability for a range of different inborn errorss of metabolism.

Introduction n

Thee peroxisome biogenesis disorders (PBDs; MIM # 601539), which comprise Zellweger syndromee (ZS; MIM # 214100]), neonatal adrenoleukodystrophy (NALD; MIM # 202370]) andd infantile Refsum disease (IRD; MIM # 266510), represent a spectrum of disease severityy with ZS being the most, and IRD the least severe disorder. Common to all three PBDss are liver disease, variable neurodevelopmental delay, retinopathy and perceptive deafness.11 Patients with ZS are severely hypotonic from birth and die before one year of

60 0 PBDD patients with peroxisomal mosaicism resolved age.. Patients with NALD experience neonatal onset of hypotonia and seizures and suffer fromm progressive white matter disease, dying usually in late infancy.2 Patients with IRD mayy survive beyond infancy and some may even reach adulthood.3 Clinical differentiation betweenn these disease states is not very well-defined and patients can have overlapping symptoms.4 4 Thee absence of functional peroxisomes in patients with a PBD leads to a number of biochemicall abnormalities. PBD patients have an impaired synthesis of plasmalogens, due too a deficiency of the two enzymes dihydroxyacetonephosphate acyltransferase (DHAPAT)) and alkyl-dihydroxyacetonephosphate synthase (alkyl-DHAP-synthase).5-6 Peroxisomall fatty acid p-oxidation is defective, leading to the accumulation of very-long chainn fatty acids (VLCFAs), notably C26:0/ the branched chain fatty acid pristanic acid and thee bile acid intermediates di- and trihydroxycholestanoic acid (DHCA and THCA).1-7 Furthermore,, phytanic acid a-oxidation and L-pipecolic acid oxidation are impaired.1-7 Somee peroxisomal enzymes show normal activity including catalase, D-amino acid oxidase,, L-a-hydroxy acid oxidase A and alanine:glyoxylate aminotransferase, but subcellularr fractionation studies have shown that these enzymes are mislocalized in the cytoplasm.1-7 7 Thee PBDs are caused by genetic defects in PEX genes encoding proteins called peroxins,, which are required for the biogenesis of peroxisomes and function in the assemblyy of the peroxisomal membrane or in the import of enzymes into the peroxisome.8 Afterr synthesis on free polyribosomes, peroxisomal matrix proteins carrying either a carboxy-terminall peroxisomal targeting sequence 1 (PTS1) or a cleavable amino-terminal PTS22 signal are translocated across the peroxisomal membrane.8 A defect in one of the peroxinss of the peroxisomal import machinery leads to failure of protein import via the PTS1-- and/or PTS2-dependent import pathway and, consequently, to functional peroxisomee deficiency. Cell fusion complementation studies using patient fibroblasts revealedd the existence of at least 12 distinct genetic groups of which currently all of the correspondingg PEX genes have been identified. Most complementation groups (CGs) are associatedd with more than one clinical phenotype.8 Recentt studies have shown that in fibroblasts of patients with milder forms of PBDs (IRDD and some NALD patients) temperature sensitivity of biochemical parameters is observed.99 In these cells, peroxisomes were formed when cells were cultured at 30°C and peroxisomall parameters and the import of peroxisomal enzymes were restored. This phenomenonn has been reported for patients belonging to CGI (PEX1),10 CG4 (PEX6),11 CG8 (PEX26),122 CG10 (PEX2),9 and CG13 (PEX13).13 Inn the present study, we have determined the biochemical characteristics and molecularr basis of a subset of patients within our large collection of > 600 PBD patients. Thesee patients were characterized by abnormal peroxisomal plasma metabolites (VLCFA, phytanicc acid and DHCA and THCA levels), but normal to very mildly abnormal parameterss in cultured skin fibroblasts, including a mosaic catalase immunofluorescence patternn which obstructed complementation analysis and therefore made it impossible to unravell the molecular basis of these patients. In order to circumvent this problem, we developedd a new technique in which fibroblasts are grown at 40°C rather than 37°C. It turnedd out that at 40°C the defect in peroxisome biogenesis is exacerbated, allowing complementationn studies to be done. We have applied this new method to classify a group off patients to CG3 (PEX12; MIM # 601758) followed by resolution of the molecular defect.

61 1 Chapterr 5 Furthermore,, we studied the temperature sensitivity of several other peroxisomal biochemicall parameters in fibroblasts of these patients at 30°C, 37°C and 40°C.

Subjectss and Methods

Subjects Subjects Ourr study included eight unrelated patients, suspected of a peroxisomal disorder, five of whomm were from Turkish (1, 4, 5, 7, 8), two of whom were from Arab Moslem (3,6), and onee from unknown origin (2). In 7 (1, 3-8) of the patients consanguinity of the parents was present,, of patient (2) this was unknown. After informed consent was obtained, blood and fibroblastt samples were collected from the patients and sent to our laboratory for biochemicall and molecular diagnosis. Patient 1 has been described before.14

CellCell lines and culture conditions Humann skin fibroblasts were cultured in HAM F-10 medium (Gibco, Invitrogen), supplementedd with 10% fetal calf serum (FCS, Bio-Whittaker), 100 U/ml penicillin, 100 ug/mll streptomycin and 25 mM Hepes buffer with L-glutamine in a humidified atmospheree of 5% C02. Unless otherwise stated, cells were cultured at 37°C.

BiochemicalBiochemical assays Peroxisomall metabolites in body fluids, including VLCFA, branched chain fatty acids and bilee acid intermediates, were done according to standard procedures developed in our laboratory.15177 DHAPAT activity,18 concentrations of VLCFAs,19 C26:0 and pristanic acid |3- oxidation200 and phytanic acid a-oxidation21 were assayed in primary skin fibroblasts as previouslyy described. For DHAPAT activity, C26:0 and pristanic acid (3-oxidation and phytanicc acid a-oxidation, incubations were performed at 37°C.

ComplementationComplementation analysis Skinn fibroblasts of two patients were co-cultured to 100% confluency on glass cover slips inn 6-well plates. Whole cell fusions were initiated by adding consecutively with 2 minute intervals:: 1 ml 42% (w/v) polyethylene glycol 1000 (PEG, Merck, Darmstadt, Germany) solutionn in DMEM without FCS (DMEM-), 1 ml 25% (w/v) PEG solution in DMEM-, 3.5 ml DMEM-,, and 3.5 ml DMEM-. After 2 more minutes the total solution was removed, and cellss were washed twice with DMEM-, after which the cells were cultured at DMEM with 10%% FCS for 6 hours. Then the medium was changed to DMEM- and the fused cells were culturedd for three days, after which the occurrence of complementation was tested by meanss of catalase immunofluorescence. As a negative control, unfused co-cultivations weree used.

ImmunofluorescenceImmunofluorescence and immunoblot analysis Immunofluorescencee was performed in cultured skin fibroblasts as previously described.22 Anti-catalase,, anti-D-bifunctional protein (anti-DBP) or anti-peroxisomal thiolase were usedd as primary antibodies. Immunoblot analysis of acyl-CoA oxidase and peroxisomal thiolasee in fibroblasts homogenates was done as described.23

62 2 PBDD patients with peroxisomal mosaicism resolved

MutationMutation analysis PEX12PEX12 mutation analysis in the patients was performed as described before.24

Results s

BiochemicalBiochemical phenotype Wee studied a selected subset of six patients from our large collection of PBD patients, who alll presented with an atypical biochemical phenotype in skin fibroblasts. Although peroxisomall metabolite levels in plasma (VLCFAs, pristank acid, phytanic acid, and the bile acidd intermediates DHCA and THCA) were abnormal (table 1), the peroxisomal parameters inn cultured skin fibroblasts (DHAPAT activity, de novo plasmalogen synthesis, concentrationss of VLCFAs, C26:0 and pristank acid p-oxidation and phytanic acid a- oxidation)) were mostly normal to slightly abnormal (table 2), which is in marked contrast too the results commonly found in PBD patients.

Tablee 1 Biochemical parameters in plasma Patientt VLCFAs (JAM) Branched chain fatty acids (|iM) Bilee acid intermediates (nM) C26:00 C26/C22 Phytanic acid Pristank acid DHCAA THCA Ctrll 0.5-1.3 0-0.02 0-9 9 0-4 4 0-0.02 2 0-0.08 8 1 1 5.4 4 0.26 6 48 8 16 6 3.0 0 0.9 9 2 2 4.2 2 0.23 3 14 4 4 4 12.0 0 39.0 0 3 3 1.8 8 0.06 6 41 1 7 7 4.1 1 4.7 7 4 4 2.7 7 0.19 9 n.d. . n.d. . 2.8 8 14.8 8 5 5 4.0 0 0.10 0 19 9 4 4 ND D ND D 6 6 1.6 6 0.07 7 54 4 28 8 13.3 3 2.8 8 ND:: Not Done; n.d.: not detectable

Tablee 2 Biochemical parameters in fibroblasts Patientt p-oxidation VLCFA A a-oxidation n DHAPATT act. Immuno-- pmol/hr*mgg protein Hmol/gg protein pmol/hr*mg g nmol/2hr*mg g fluorescence e protein n protein n a-catalase e C26:00 Prist, acid C26:0 C26/C22 Phytanic acid :tri i 1200-1500 0 675-1100 0 0.18-0.38 8 0.03-0.07 7 44-82 2 5.8-12.3 3 1 1 ND D ND D 0.08 8 0.02 2 ND D 7.5 7.5 +/-- 2 2 894 4 642 2 0.14 4 0.02 2 88 8 5.8 8 +/-- 3 3 711 1 797 7 0.12 2 0.02 2 84 4 7.0 0 +/-- 4 4 1730 0 640 0 0.21 1 0.05 5 32 2 7.1 1 +/-- 5 5 1458 8 724 4 1.01 1 0.45 5 19 9 8.1 1 +/-- 6 6 913 3 332 2 0.26 6 0.06 6 48 8 72 72 +/-- 1386 6 555 5 0.51 1 0.12 2 15 5 ib¥ ib¥ +/-- 1562 2 905 5 0.23 3 0.04 4 43 3 9.0 0 +/-- ND:: Not Done; n.d.:: not detectable

PeroxisomalPeroxisomal mosaicism and temperature sensitivity ofcatalase immunofluorescence Whenn catalase immunofluorescence in cultured skin fibroblasts of the patients was performed,, we found a mosaic pattern with both positive and negative cells (figure 1). Thiss phenomenon has been described in literature before25-26 but never in such an extreme form.. In some of our patients more than 70% of the cells were catalase-positive. Because studiess in the past have shown that in some mild PBD cell lines the defect in peroxisome

63 3 Chapterr 5

Figuree 1 Mosaic pattern of catalase immunofluorescence in celll line 8. Other cell lines showed similar results. biogenesiss can be (partly) corrected by growth of the cells at a lower temperature (30°C),9 wee investigated whether this was also true for our cell lines. Furthermore, we also studied whetherr the reverse was true, i.e. if growth of the cells at higher temperatures would exacerbatee the defect in peroxisome biogenesis, leading to an increased peroxisome deficiency.. To this end, we cultured the fibroblasts for seven days at 30°C, 37°C and 40°C, followedd by catalase immunofluorescence microscopy. This revealed a control-like pattern att 30°C, with all cells showing punctate catalase fluorescence. At 37°C, a mosaic pattern wass observed whereas at 40°C, all cells were negative for punctate catalase fluorescence (figuree 2 a-c). When we compared the catalase immunofluorescence results with those in fibroblastss from a PBD patient homozygous for the PEX1-G843D allele, which is known forr its temperature sensitivity,1027 we observed that our newly identified patients had a milderr defect than the PEX1 patient. Whereas a mosaic pattern was found in our patients' cellss at 37°C, the cells from the PEX1-G843D patient were negative at this temperature (figuree 2 d-f). 30°CC 37°C 40°C

Figuree 2 Immunofluorescence of cell line 4 (a-c) and PEX1-G843D (d-f) cells using antibodies againstt catalase. Cells were cultured at 30°C, 37°C or 40°C for 7 days prior to immunofluorescence.. Other cell lines showed similar results.

64 4 PBDD patients with peroxisomal mosaicism resolved

ComplementationComplementation analysis at 40°C Thee marked degree of mosaicism at 37°C observed in fibroblasts from our new patients madee it impossible to identify the defective PEX gene by standard complementation analysis.. To solve this, we decided to culture the fibroblasts at 40°C for three days after cell fusion.. All cell lines showed restoration of peroxisome formation when fused with cells fromm all known complementation groups except for CG3, indicating that the peroxisome biogenesiss defect found in these patients is caused by mutations in the PEX12 gene (figure 3). .

Figuree 3 Complementation analysiss of cell line 8 at 40°C withh CGI (a) and CG3 (b) cell lines.. After fusion, cells were culturedd for three days at 40°C, afterr which the occurrence of complementationn was tested by meanss of catalase immunofluorescence.. Other cell liness showed similar results.

MutationMutation analysis Subsequentt sequence analysis of the PEX12 gene revealed the presence of a single homozygouss mutation in all patients. A 959C>T mutation was found, leading to a Ser320Phee substitution at the protein level. During this study, two additional patients weree found carrying the same mutation on both alleles. Biochemical characteristics in fibroblastss were comparable to the original patients and are described in table 2. No plasmaa was available from these patients.

TemperatureTemperature sensitivity of other biochemical parameters Inn addition to catalase immunofluorescence, immunofluorescence with antibodies against otherr proteins was performed and other biochemical parameters in fibroblasts were determinedd at the three temperatures to further characterize the PEX12-S320F patients. Becausee it is known that catalase has a divergent PTS1 (KANL instead of SKL or one of its conservedd variants),28 which results in a less efficient import of catalase into peroxisomes ass compared to other PTS1 or PTS2 proteins,29-30 we also studied the subcellular localizationn of D-bifuncional protein (DBP) (PTS1, AKL) and peroxisomal thiolase (PTS2) usingg immunofluorescence at the three temperatures (figure 4 a-c, g-i). The results show thatt in the PEX12-S320F cell lines, DBP is normally imported into the peroxisomes at 37°C, andd that even at 40°C, DBP is mainly present inside the peroxisomes. This is in contrast to cellss from the PEX1-G843D patient which show a more severe temperature-sensitive phenotypee than the PEX12-S320F cells (figure 4 d-f). Peroxisomal thiolase immunofluorescencee shows a normal puncate pattern at 37°C, as observed for DBP, whereass the cells show a more mosaic pattern at 40°C (figure 4 g-i). All immunofluorescencee experiments were also carried out for control fibroblasts and fibroblastss from a PBD patient with a severe defect in PEX12 leading to the severe ZS phenotype,, which show normal peroxisomal staining for all antibodies at all temperatures inn the control fibroblasts and absence of staining at all temperatures in these PEX12- deficientt fibroblasts (data not shown).

65 5 Chapterr 5

Figuree 4 Immunofluorescence of cell line 4 (a-c, g-i) and PEX1-G843D (d-f) cells using antibodiess against DBP (a-f) and peroxisomal thiolase (g-i). Cells were cultured at 30°C, 37°C or 40°CC for 7 days prior to immunofluorescence. Other PEX12-S320F cell lines showed similar results. .

Too investigate if the temperature-sensitive phenomenon observed with immuno- fluorescencee is also reflected in the peroxisomal p-oxidation, we studied the rate of (3- oxidationn of the very-long chain fatty acid C26:0 and its accumulation in fibroblasts, and thee rate of p-oxidation of the branched-chain fatty acid pristanic acid after culturing the cellss for seven days at 30°C, 37°C and 40°C. Figure 5a shows that the C26:0 p-oxidation ratee in PEX12-S320F cells decreases with temperature. At 40°C, C26:0 p-oxidation is still onlyy slightly abnormal. The C26:0 p-oxidation activities found in the patients' fibroblasts aree reflected in the accumulation of VLCFAs after 14 days of culturing at 30°C, 37°C and 40°CC (figure 5c). Whereas C26:0 levels in fibroblasts from the PEX12-S320F patients were foundd to be rather normal at 37°C, slightly abnormal levels were found at 40°C. Pristanic acidd p-oxidation shows a similar pattern as C26:0 p-oxidation (figure 5b). For all three p- oxidationn parameters, the PEX12-S320F cells show a milder temperature sensitivity than thee PEX1-G843D cells.

66 6 PBDD patients with peroxisomal mosaicism resolved

PEX1 1 G843D D

•• C C C C C

dTll J^ • • I I Ctrl l PEX12 2 PEX1 1 zs s S320F F G843D D Figuree 5 Peroxisomal (3-oxidation of very-long andd branched chain fatty acids. C26:0 p- 30°C oxidationn activity in living fibroblasts (a), n37°C C C26:00 levels in fibroblasts (b) and pristanic D40°C C acidd p-oxidation in living fibroblasts (c) from control,, patient 8, PEX1-G843D, and ZS patient defectivee in PEX12. Other PEX12-S320F cell liness showed similar results

Becausee in PBD fibroblasts peroxisomal proteins are not imported into the peroxisomes, butt remain in the cytosol, some of these proteins are not converted to their mature forms.31 Acyl-CoAA oxidase is synthesized as a 75 kDa precursor, and is proteolytically cleaved into 53kDaa and 22 kDa polypeptides, while peroxisomal thiolase is synthesized as a 44 kDa precursorr and is processed to a 41 kDa mature form inside the peroxisome. Because it has beenn shown that the processing of the peroxisomal enzymes acyl-CoA oxidase and thiolasee was restored at 30°C in temperature-sensitive cell lines,10-29-32 we also investigated thiss in the PEX12-S320F cell lines. Acyl-CoA oxidase is present in all three forms in both controll cells and the PEX12-S320F patients' fibroblasts at all temperatures, whereas in the PEX1-G843DD cell line it is processed at 30°C, is partly processed at 37°C and is only presentt in its precursor form at 40°C (figure 6).

PEX122 PEX1 Ctrl l S320FF ZS G843D a a 37 7 400 30 37 40 30 37 40 30 37 40 755 kDa I .—— .. ._- Figuree 6 Peroxisomal processing. 533 kDa • Immunoblott analysis of acyl-CoA oxidasee (a) and peroxisomal thiolase (b) 222 kDa __ — — inn fibroblasts homogenates from control, b b patientt 8, PEX1-G843D, and ZS patient defectivee in PEX12. Other PEX12-S320F 444 kDa -- .. - celll lines showed similar results.

67 7 Chapterr 5 Thee same was found for peroxisomal thiolase, which was normally present in fibroblasts fromm the PEX12-S320F patient group, whereas a temperature-sensitive behaviour was foundd for PEX1-G843D fibroblasts. Thus, the PEX12-S320F fibroblasts show a normal processingg of acyl-CoA oxidase and peroxisomal thiolase, whereas the PEX1-G843D fibroblastss show a temperature-sensitive processing.

ClinicalClinical phenotype Clinically,, the PEX12-S320F patients displayed a relatively mild phenotype when comparedd to the whole PBD spectrum (table 3). When compared to mild PEX1-G843D patientss as described by Preuss et al.,33 they displayed less dysmorphic features and ocular abnormalities,, although their cerebral and liver abnormalities are similar. To judge the patients'' achievements in terms of neurological and neurosensory development, the compoundd developmental score described by Poll-The et al.34 was used. This scoring systemm is designed to distinguish mild PBD patients surviving for more than 4 years. Pointss can be attained for different aspects of statural motor control, hand control, verbal developmentt and visual development (table 3). In total a maximum score of 10 points can bee obtained. Because the ability to read is included, the maximum score for patients of 4 yearss is 9 instead of 10. Using this score, our patients showed a significant lower compoundd developmental score than the mean of 7.1 (range: 4-9) found in 9 Dutch PEX1- G843DD patients (Poll-The et al. in press)34 (table 3).

Discussion n

Inn the present study, we investigated the biochemical and clinical characteristics of a selectedd subset of patients within our large collection of > 600 PBD patients, and determinedd the underlying molecular basis, using a novel method for complementation analysis.. The patients presented as a separate group because they were characterized by abnormall peroxisomal plasma metabolites, but normal to slightly abnormal peroxisomal parameterss in cultured skin fibroblasts, in marked contrast to the vast majority of PBD patientss in whom clear abnormalities are found both in plasma and fibroblasts. With respectt to their biochemical phenotype in fibroblasts, these patients are among the mildest PBDD patients in literature. In some of the patients the only abnormal parameter suggesting aa PBD was the absence of a punctate catalase immunofluorescence only in some of their fibroblasts.. Only few comparable patients have been described. Analogouss to previous studies showing that in some mild PBD cell lines the defect in peroxisomee biogenesis can be corrected by growth of the cells at a lower temperature,9 we alsoo investigated this for our cell lines, and in addition studied the reverse: growth of the cellss at higher temperatures, which showed an exacerbation of the defect in peroxisome biogenesiss and related biochemical parameters. This finding has important consequences forr the diagnosis of other atypical PBD patients. Our results indicate that when there is anyy uncertainty about the diagnosis of PBD patients due to (nearly) normal peroxisomal parameterss in fibroblasts, catalase immunofluorescence microscopy analysis at 40°C may bee required to reach a definite conclusion, followed by measurement of additional peroxisomall parameters. The results in this paper may well have important implications forr a much wider range of inborn errors of metabolism. In our laboratory we currently use thiss principle for the diagnosis of mild peroxisomal and mitochondrial fatty acid P-oxida-

68 8 PBDD patients with peroxisomal mosaicism resolved Tablee 3 Clinical features PEX12-S320F F PEX1-G843D D l l 3 3 4 4 55 6 7 8 8 freq q freq** * Survivall (months) (*: alive) 52 30* 52 106* 43* 7V Dysmorphicc features Largee fontanel + 1/4 4 4/4 4 Highh forehead - - + + + 2/5 5 2/2 2 Broadd nasal bridge + + + - 3/6 6 3/3 3 Hyperr telorism + + + + 4/6 6 4/4 4 Shalloww orbital ridge - - - 0/6 6 3/4 4 Epicanthuss - + 1/6 6 2/2 2 Externall ear deformity + - - 1/6 6 1/2 2 Cerebral l Poorr sucking + .. + + + + 5/7 7 4/4 4 Gavagee feeding + + - + + 4/6 6 3/4 4 Hypotoniaa + + + + + + + 717 717 4/4 4 Psychomotorr retardation + + + + + + + 7/7 7 4/4 4 Neonatall seizures ...... 0/6 6 0/4 4 Ocular r Cataractt ...... 0/7 7 0/3 3 Retinitiss pigmentosa - + + + - - 3/6 6 3/3 3 Opticc atrophy - - - + - + 2/6 6 2/3 3 Nystagmuss + - - + + 3/7 7 3/3 3 Hearingg deficit + + + + + + + 7/7 7/7 Hepatorenal l Hepatomegalyy + - + + + - 4/7 7 3/4 4 Liverr fibrosis + - + 2/3 3 1/3 3 Elevatedd liver enzymes + + + + + - - 5/7 7 3/4 4 Splenomegalyy ...... 0/7 7 Renall cysts ...... 0/6 6 2/4 4 Skeletall system Calcificc stippling - 0/5 5 0/2 2 Failuree to thrive + + - + + + + 6/7 7 Achievementss (>4 years) n - - - - Unsupportedd sit + n - - - - Unsupportedd walk - n - - + Intentionall hand use + n - - Activee hearing/vocalizing - n - - - - Talkingg 3 or more words - n - - - - Talkingg telegram sentences - n - - - Grammaticall language - n - - - - Readingg - n - - - Visuall acuity 1-10% + n - - + + Visuall acuity >10% - n - - - - Totall achievement score 3 n 0 0 2 1 7.1*** n,, score not applicable for patients < 4 years, ** B, ***7A, range 4-9

Honn defects, including short-chain acyl CoA dehydrogenase deficiency. Furthermore, this principlee of elevation of the cell culturing temperature enabled us to perform complementationn analysis in the patients with peroxisomal mosaicism and classify them to CG3.. This novel technique of complementation analysis at 40°C, which prevents certain mutationss to be missed, can also be used for many other atypical PBD patients, as well as 69 9 Chapterr 5 forr patients suspected of other inborn errors of metabolism, like inborn errors of cobalaminn metabolism.35 Thee finding that the extent of peroxisomal dysfunction increases from 37° to 40°C, at leastt in the fibroblasts from the patients described in this paper, may also have clinical consequences.. Indeed, if these data are extrapolated to the in vivo situation, infections causingg fever may exacerbate the patients' clinical condition indicating that fever should bee treated rigorously. Whenn the temperature-sensitive behavior of the PEX12-S320F cells was compared to a celll line from a PBD patient homozygous for the G843D mutation in PEX1, which is knownn to be correlated with a mild phenotype36 and causes temperature sensitivity in fibroblasts,100 the PEX12-S320F cell lines displayed a milder biochemical temperature- sensitivee phenotype for all parameters tested. In contrast, some aspects of the clinical phenotypee of the PEX12-S320F were more severe than of the PEX1-G843D patients. Althoughh dysmorphic features and ocular abnormalities were less frequent and liver and cerebrall abnormalities were similar, the compound developmental score of the PEX12- S320FF patients was significantly lower when compared to PEX1-G843D patients. An explanationn for this discrepancy between biochemical phenotype in fibroblasts and the clinicall phenotype might be that the defect is more pronounced in other cells/tissues than inn fibroblasts. The presence of marked peroxisomal abnormalities in plasma, which reflects thee overall situation in the body, supports this.

a a 11 155 172 238 254 300 345 359

Figuree 7 PEX12 protein, (a) Schematic representation of PEX12.The zinc binding domain is indicatedd by a horizontally striped box and each of the transmembrane domains is indicated by aa vertically striped box. The mutation is indicated by a dot. (b) Amino acid alignment of human (Hs),(Hs), rat (Rn), mouse (Mm), Chinese hamster (CI), Saccharomyces cerevisiae (Sc), Pichia pastoris (Pp)(Pp) and Schizosaccharomyces pombe (Sp) PEX12 zinc binding domain. Circles indicate conservedd cysteine residues. The box indicates the position of the mutation.

Althoughh not related, all our patients were found to be homozygous for a 9590T mutationn in PEX12, which encodes an integral peroxisomal membrane protein with a zinc- bindingg motif at its COOH terminus.3738 The protein interacts with PEX5 and PEX10 via its COOH-terminall zinc-binding domain and is most likely involved in the actual process of translocationn of peroxisomal matrix proteins across the peroxisomal membrane.39 The

70 0 PBDD patients with peroxisomal mosaicism resolved mutationn found in our patients leads to a missense mutation S320F at the protein level, locatedd in the PEX12 zinc-binding domain (figure 7a). Although HsPEX12 has a very high homologyy (88-89%) with various mammalian orthologs, its homology with some yeast orthologss is much lower (18-25%). However, the zinc-binding domain is more conserved betweenn all species (figure 7b). Although Ser320 is conserved among the different PEX12s fromm the various mammalian species, it is absent in PEX12 from the different yeast species. Thiss suggests that Ser320 may not be essential for PEX12 function, which might explain thee mild effect the S320F mutation has on the human PEX12 function and consequently on peroxisomall parameters. The mutation has been described before in one patient by Chang ett al. (1999). No clinical data of this patient were presented. These authors showed that thiss mutation reduces the binding of PEX12 to PEX5 and PEX10. Overexpression of either PEX55 or PEX10 was able to suppress the PEXT.2 mutation. The mutation was shown to causee import of PEX5 into the peroxisome lumen, whereas in control cells PEX5 is cytosolicc and normal PEX12-deficient cell lines show a peroxisomally associated PEX5 at thee cytosolic side. Inn conclusion, this study presents eight PBD patients with very mild but temperature- sensitivee biochemical peroxisomal parameters in fibroblasts, although their clinical phenotypee was not that mild, suggesting the defect may be more pronounced in other tissues.. Their molecular defect was resolved using a novel method for complementation analysiss in which the cells were grown at 40°C rather than 37°C. This principle of growing thee cells at elevated temperatures to exacerbate the defect in peroxisome biogenesis, therebyy preventing certain mutations to be missed, can be applied to the diagnosis of other atypicall PBD patients, as well as patients suffering from other inborn errors of metabolism. .

Acknowledgements s

Thee authors thank Dr. Sietske Hogenboom for technical assistance with confocal laser scanningg laser microscopy. Henny Rusch, Luminita Bobu, Johan Gerrits, Henk Overmars, Arashh Kamangerpour and Patricia Veltman are acknowledged for biochemical analyses in patientt material. This work was supported by the Prinses Beatrix Fonds, grant 99.0220.

References s

1.. Gould S.J., Raymond G.V. and Valle D. (2001) The peroxisome biogenesis disorders. In: Scriver C.R., Beaudett A.L., Valle D. and Sly W.S. (eds.) The metabolic and molecular bases of inherited disease. McGraw-Hilll New York, 3181-3217. 2.. Kelley R.I., Datta N.S., Dobyns W.B., Hajra A.K., Moser A.B., Noetzel M.J., Zackai E.H. and Moser H.W. (1986)) Neonatal adrenoleukodystrophy: new cases, biochemical studies, and differentiation from Zellwegerr and related peroxisomal polydystrophy syndromes. Am.J.Med.Genet. 23: 869-901. 3.. Poll-The B.T., Saudubray J.M., Ogier H.A., Odievre M., Scotto J.M., Monnens L., Govaerts L.C., Roels F., Corneliss A. and Schutgens R.B. (1987) Infantile Refsum disease: an inherited peroxisomal disorder. Comparisonn with Zellweger syndrome and neonatal adrenoleukodystrophy. Eur.J.Pediatr. 146: 477-483. 4.. Barth P.G., Gootjes J., Bode H., Vreken P., Majoie C.B. and Wanders R.J. (2001) Late onset white matter diseasee in peroxisome biogenesis disorder. Neurology 57: 1949-1955. 5.. Datta N.S., Wilson G.N. and Hajra A.K. (1984) Deficiency of enzymes catalyzing the biosynthesis of glycerol-etherr lipids in Zellweger syndrome. A new category of metabolic disease involving the absence off peroxisomes. N.Engl.J.Med. 311: 1080-1083.

71 1 Chapterr 5

6.. Heymans H.S., Schutgens R.B., Tan R., van den Bosch H. and Borst P. (1983) Severe plasmalogen deficiencyy in tissues of infants without peroxisomes (Zellweger syndrome). Nature. 306: 69-70. 7.. Wanders R.J., Schutgens R.B. and Barth P.G. (1995) Peroxisomal disorders: a review. J.Neuropathol.Exp.Neurol.. 54: 726-739. 8.. Gould S.J. and Valle D. (2000) Peroxisome biogenesis disorders: genetics and cell biology. Trends Genet. 16:: 340-345. 9.. Imamura A., Tsukamoto T., Shimozawa N., Suzuki Y., Zhang Z., Imanaka T., Fujiki Y., Orii T., Kondo N. andd Osumi T. (1998) Temperature-sensitive phenotypes of peroxisome-assembly processes represent the milderr forms of human peroxisome-biogenesis disorders. Am.J.Hum.Genet. 62: 1539-1543. 10.. Imamura A,, Tamura S., Shimozawa N., Suzuki Y., Zhang Z., Tsukamoto T., Orii T., Kondo N., Osumi T. andd Fujiki Y. (1998) Temperature-sensitive mutation in PEX1 moderates the phenotypes of peroxisome deficiencyy disorders. Hum.Mol.Genet. 7: 2089-2094. 11.. Imamura A., Shimozawa N., Suzuki Y., Zhang Z., Tsukamoto Tv Fujiki Y., Orii T., Osumi T., Wanders R.j.. and Kondo N. (2000) Temperature-sensitive mutation of PEX6 in peroxisome biogenesis disorders in complementationn group C (CG-C): comparative study of PEX6 and PEX1. Pediatr.Res. 48: 541-545. 12.. Imamura A., Shimozawa N., Suzuki Y., Zhang Z., Tsukamoto T., Orii T., Osumi T. and Kondo N. (2001) Temperaturee sensitive acyl-CoA oxidase import in group A peroxisome biogenesis disorders. J.Med.Genet.. 38: 871-874. 13.. Shimozawa N., Suzuki Y., Zhang Z., Imamura A., Toyama R., Mukai S., Fujiki Y., Tsukamoto T., Osumi T.,, Orii T., Wanders R.J. and Kondo N. (1999) Nonsense and temperature-sensitive mutations in PEX13 aree the cause of complementation group H of peroxisome biogenesis disorders. Hum.Mol.Genet. 8: 1077- 1083. . 14.. Schutgens R.B., Wanders R.J., Jakobs C, Arslan-Kirchner M., Miller K., Wieacker P., Hunnemann D., Hurterr P. and von Schutz M. (1994) A new variant of Zellweger syndrome with normal peroxisomal functionss in cultured fibroblasts. J.Inherit.Metab Dis. 17: 319-322. 15.. Vreken P., van Lint A.E., Bootsma A.H., Overmars H., Wanders R.J. and van Gennip A.H. (1998) Rapid stablee isotope dilution analysis of very-long-chain fatty acids, pristanic acid and phytanic acid using gas chromatography-electronn impact mass spectrometry. J.Chromatogr.B Biomed.Sci.Appl. 713: 281-287. 16.. Vreken P., van Rooij A., Denis S., van Grunsven E.G., Cuebas D.A. and Wanders R.J. (1998) Sensitive analysiss of serum 3alpha, 7alpha, 12alpha,24-tetrahydroxy- 5beta-cholestan-26-oic acid diastereomers usingg gas chromatography-mass spectrometry and its application in peroxisomal D-bifunctional protein deficiency.. J.Lipid Res. 39: 2452-2458. 17.. Vreken P., Valianpour F., Overmars H., Barth P.G., Selhorst J.J., van Gennip A.H. and Wanders R.J. (2000)) Analysis of plasmenylethanolamines using electrospray tandem mass spectrometry and its applicationn in screening for peroxisomal disorders. J.Inherit.Metab Dis. 23: 429-433. 18.. Ofman R. and Wanders R.J. (1994) Purification of peroxisomal acyl-CoA: dihydroxyacetonephosphate acyltransferasee from human placenta. Biochim.Biophys.Acta 1206: 27-34. 19.. Valianpour F., Selhorst J.J., van Lint L.E., van Gennip A.H., Wanders R.J. and Kemp S. (2003) Analysis of veryy long-chain fatty acids using electrospray ionization mass spectrometry. Mol.Genet.Metab 79: 189- 196. . 20.. Wanders R.J., Denis S., Ruiter J.P., Schutgens R.B., van Roermund C.W. and Jacobs B.S. (1995) Measurementt of peroxisomal fatty acid beta-oxidation in cultured human skin fibroblasts. J.Inherit.Metabb Dis. 18 Suppl 1:113-124. 21.. Wanders R.J. and van Roermund C.W. (1993) Studies on phytanic acid alpha-oxidation in rat liver and culturedd human skin fibroblasts. Biochim.Biophys.Acta 1167: 345-350. 22.. van Grunsven E.G., van Berkel E., Mooijer P.A., Watkins P.A., Moser H.W., Suzuki Y., Jiang L.L., Hashimotoo T., Hoefler G., Adamski J. and Wanders R.J. (1999) Peroxisomal bifunctional protein deficiencyy revisited: resolution of its true enzymatic and molecular basis. Am.J.Hum.Genet. 64: 99-107. 23.. Wanders R.J., Dekker C, Ofman R., Schutgens R.B. and Mooijer P. (1995) Immunoblot analysis of peroxisomall proteins in liver and fibroblasts from patients. J.Inherit.Metab Dis. 18 Suppl 1: 101-112. 24.. Gootjes J., Schmohl F., Waterham H.R. and Wanders R.J. (2003) Novel mutations in the PEX12 gene of patientss with a peroxisome biogenesis disorder. Eur.J.Hum.Genet. in press. 25.. Shimozawa N., Zhang Z., Imamura A., Suzuki Y., Fujiki Y., Tsukamoto T., Osumi T., Aubourg P., Wanderss R.J. and Kondo N. (2000) Molecular mechanism of detectable catalase-containing particles, peroxisomes,, in fibroblasts from a PEX2-defective patient. Biochem.Biophys.Res.Commun. 268: 31-35. 26.. Raas-Rothschild A., Wanders R.J., Mooijer P.A., Gootjes J., Waterham H.R., Gutman A., Suzuki Y., Shimozawaa N., Kondo N., Eshel G., Espeel M., Roels F. and Korman S.H. (2002) A PEX6-defective

72 2 PBDD patients with peroxisomal mosaicism resolved

peroxisomall biogenesis disorder with severe phenotype in an infant, versus mild phenotype resembling Usherr syndrome in the affected parents. Am.J.Hum.Genet. 70:1062-1068. 27.. Walter C, Gootjes J., Mooijer P.A., Portsteffen H., Klein C, Waterham H.R., Barth P.G., Epplen J.T., Kunauu W.H., Wanders R.J. and Dodt G. (2001) Disorders of peroxisome biogenesis due to mutations in PEX1:: phenotypes and PEX1 protein levels. Am.J.Hum.Genet. 69: 35-48. 28.. Purdue P.E. and Lazarow P.B. (1996) Targeting of human cataïase to peroxisomes is dependent upon a novell COOH-terminal peroxisomal targeting sequence. J.Cell Biol. 134: 849-862. 29.. Fujiwara C., Imamura A., Hashiguchi N., Shimozawa IM., Suzuki Y., Kondo N., Imanaka T., Tsukamoto T.. and Osumi T. (2000) Catalase-less peroxisomes. Implication in the milder forms of peroxisome biogenesiss disorder. J.Biol.Chem. 275: 37271-37277. 30.. Legakis J.E., Koepke J.L, Jedeszko C., Barlaskar F., Terlecky L.J., Edwards H.J., Walton P.A. and Terlecky S.R.. (2002) Peroxisome senescence in human fibroblasts. Mol.Biol.Cell 13: 4243-4255. 31.. Okumoto K., Shimozawa N., Kawai A., Tamura S., Tsukamoto T., Osumi T., Moser H., Wanders R.J., Suzukii Y., Kondo N. and Fujiki Y. (1998) PEX12, the pathogenic gene of group III Zellweger syndrome: cDNAA cloning by functional complementation on a CHO cell mutant, patient analysis, and characterizationn of PEX12p. MoI.Cell Biol. 18: 4324-4336. 32.. Imamura A., Shimozawa N., Suzuki Y., Zhang Zv Tsukamoto T., Fujiki Y., Orii T., Osumi T. and Kondo N.. (2000) Restoration of biochemical function of the peroxisome in the temperature-sensitive mild forms off peroxisome biogenesis disorder in humans. Brain Dev. 22: 8-12. 33.. Preuss N., Brosius U., Biermanns M., Muntau A.C., Conzelmann E. and Gartner J. (2002) PEX1 mutations inn complementation group 1 of Zellweger spectrum patients correlate with severity of disease. Pediatr.Res.. 51: 706-714. 34.. Poll-The B.T., Gootjes J., Duran M., de Klerk J.B., Maillette de Buy Wenniger-Prick L.J., Admiraal R.J., Waterhamm H.R., Wanders R.J. and Barth P.G. (2003) Peroxisome biogenesis disorders with prolonged survival:: phenotypic expression in a cohort of 31 patients. J.Med.Genet. in press 35.. Watkins D., Matiaszuk N. and Rosenblatt D.S. (2000) Complementation studies in the cblA class of inbornn error of cobalamin metabolism: evidence for interallelic complementation and for a new complementationn class (cblH). J.Med.Genet. 37: 510-513. 36.. Reuber B.E., Germain-Lee Ev Collins C.S., Morrell J.C., Ameritunga R., Moser H.W., Valle D. and Gould S.J.. (1997) Mutations in PEX1 are the most common cause of peroxisome biogenesis disorders. Nat.Genet.. 17: 445-448. 37.. Kalish J.E., Keller G.A., Morrell J.C., Mihalik S.J., Smith B., Cregg J.M. and Gould S.J. (1996) Characterizationn of a novel component of the peroxisomal protein import apparatus using fluorescent peroxisomall proteins. EMBO.J. 15: 3275-3285. 38.. Okumoto K. and Fujiki Y. (1997) PEX12 encodes an integral membrane protein of peroxisomes [letter]. Nat.Genet.. 17: 265-266. 39.. Chang C.C.; Warren D.S., Sacksteder K.A. and Gould S.J. (1999) PEX12 interacts with PEX5 and PEX10 andd acts downstream of receptor docking in peroxisomal matrix protein import. J.Cell Biol. 147: 761-774.

73 3

Chapterr 6

Reinvestigationn of trihydroxycholestanoic acidemia: a peroxisome biogenesiss disorder as true defect

Jeannettee Gootjes, Flemming Sbovby, Ernst Christensen, Ronald J.A. Wanders, Sacha Ferdinandusse,, Submitted for publication Chapterr 6 Reinvestigationn of trihydroxycholestanoic acidemia: a peroxisome biogenesiss disorder as true defect

Jeannettee Gootjes1, Flemming Skovby2, Ernst Christensen2, Ronald J.A. Wanders'3, and Sachaa Ferdinandusse1

DepartmentsDepartments of Clinical Chemistry and -^Pediatrics, Emma Children's Hospital, Academic Medical Center,Center, University of Amsterdam, The Netherlands and "Department of Clinical Genetics, CopenhagenCopenhagen University Hospital, Copenhagen, Denmark.

Summary y

Objective:Objective: To unravel the true enzymatic defect in a patient with ataxia, dysarthric speech, dryy skin, hypotonia and absent reflexes, who previously was reported with a presumed deficiencyy of trihydroxycholestanoyl-CoA oxidase. Background: Peroxisomes harbor a varietyy of metabolic functions including 1) fatty acid P-oxidation, 2) etherphospholipid biosynthesis,, 3) phytanic acid a-oxidation and 4) L-pipecolic acid oxidation. The patient wee report here, was described previously with an isolated peroxisomal P-oxidation defect duee to a deficiency of the enzyme trihydroxycholestanoyl-CoA oxidase, which was based onn the pattern of accumulating metabolites. Methods: Measurement of (3-oxidation enzymes,, peroxisomal biochemical analysis in body fluids and cultured skin fibroblasts, DNAA analysis of the PEX12 gene. Results: An isolated p-oxidation defect in this patient wass excluded by measurement of the various p-oxidation enzymes. Instead, we found that thee patient was suffering from a peroxisome biogenesis disorder caused by mutations in thee PEX12 gene, although all peroxisomal functions in cultured skin fibroblasts were normal.. Conclusions: The absence of clear peroxisomal abnormalities in the patient's fibroblasts,, including a normal peroxisomal localization of catalase, imply that even when alll peroxisomal functions in fibroblasts are normal, a PBD cannot be fully excluded and additionall studies may be required. In addition, our findings imply that there is no longer evidencee for the existence of trihydroxycholestanoyl-CoA oxidase deficiency as a distinct diseasee entity.

Introduction n

Peroxisomess harbor a variety of metabolic functions among which 1) fatty acid P-oxidation off very-long chain fatty acids (VLCFA), notably C26:0, and of the branched chain fatty acids,, such as pristanic acid and the bile acid intermediates di- and trihydroxycholestanoic acidd (DHCA and THCA), 2) etherphospholipid biosynthesis, 3) phytanic acid a-oxidation andd 4) L-pipecolic acid oxidation.1 Peroxisomal disorders are subdivided into the peroxisomee biogenesis disorders (PBD), which are caused by defects in one of the PEX genes,, and the single peroxisomal enzyme deficiencies. Inn 1990, Christensen et al. described a patient with ataxia, dysarthric speech, dry skin, hypotoniaa and absent reflexes.2 The levels of phytanic acid and bile acid intermediates weree elevated in plasma from this patient, but phytanic acid oxidation measured in the patient'ss fibroblasts was normal. Furthermore, C26:0 p-oxidation, VLCFA levels,

76 6 Reinvestigationn of trihydroxycholestanoic acidemia dihydroxyacetonephosphate-acyltransferasee (DHAPAT) activity and de novo plasmalogen biosynthesiss in fibroblasts were normal. Later studies by Ten Brink et al. showed that pristanicc acid was also elevated in plasma from this patient.3 Phytanic acid levels in plasmaa normalized after the patient was put on a phytanic acid restricted diet, whereas pristanicc acid remained elevated. These results led to the conclusion that the patient sufferedd from a deficiency of the enzyme responsible for the first step of p-oxidation of DHCA,, THCA and pristanic acid. Att the time the patient was described, the exact routes of p-oxidation of different substratess in the peroxisome were not entirely known. It is now well established that humann peroxisomes contain two sets of p-oxidation enzymes.4 VLCFAs are p-oxidized by thee consecutive action of the enzymes straight-chain acyl-CoA oxidase (SCOX), D- bifunctionall protein (DBP) and can then be thiolytically cleaved by both 3-ketoacyl-CoA thiolasee and sterol-carrier protein X (SCPx) (figure 1). Pristanic acid, THCA and DHCA are exclusivelyy p-oxidized by the actions of the enzymes branched-chain acyl-CoA oxidase (BCOX),, DBP and SCPx. Furthermore, it has become clear that the peroxisomal P- oxidationn system is also involved in the biosynthesis of the poly-unsaturated fatty acid docosahexaenoicc acid (DHA, C22:6n-3). The major enzymes involved in the P-oxidation of C24:6n-33 to C22:6n-3 in this pathway are SCOX, DBP and both 3-ketoacyl-CoA thiolase andd SCPx.5"

VLCFA-CoA A pristanoyl-CoA A C24:6-CoA A THC-CoA A * * SCOX X BCOX X * * i i ii )BF Figuree 1 Schematic representation f f i i off fatty-acid p-oxidation machinery "1 1 inn human peroxisomes catalyzing thiolase e SCPx x thee oxidation of very-long chain fattyy acids (VLCFA-CoA), C24:6n-3, VLCFA-CoAA n-2 * trimethyltridecanoyl-CoA andd branched-chain fatty acyl-CoAs C22:6-CoAA (DHA-CoA) choloyl-CoA (i.e.. pristanoyl-CoA, THC-CoA).

Thesee new insights into the peroxisomal P-oxidation system and the development of novell methods to measure the activity of the different p-oxidation enzymes in skin fibroblastss prompted us to reinvestigate the underlying defect in the reported patient, sincee the original diagnosis of a defect at the level of THCA-CoA oxidase (now called BCOX)) was based on the pattern of accumulating metabolites only and was not supported byy enzyme activity measurements or DNA analysis. In this paper, we describe the unravelingg of the true enzymatic defect in this patient.

Patientt and Methods

CaseCase report Thiss girl is the only child of unrelated parents. The patient's early clinical and biochemical characteristicss have been described previously.2'3 At age 5 an elevated plasma level of

11 11 Chapterr 6 phytanicc acid was found and physical examination revealed psychomotor retardation, hypotonia,, ataxia, dysarthria, convergent strabismus, nystagmus, and absent deep tendon reflexes.. CT of the brain, EMG, NCV (nerve conduction velocity), VEP (visual evoked potential),, ERG (electroretinogram), ABR (auditory brainstem response), and SSEP (somatosensoryy evoked potential) were within normal limits. She was unable to walk withoutt support. A phytanic acid-restricted diet caused plasma phytanic acid to drop to tracee levels, which have been maintained ever since. The diet improved motor strength andd balance, and she was able to take 3-4 steps without support. A bilateral sensory hearingg loss with a threshold of 45 dB at 1000 Hz was detected at age 8. Mental evaluation att age 15 revealed a functional level of 7-8 years. Bilateral Achilles tendon extensions were performedd at age 16. Due to persistent ataxia and instability of the lower extremities, triple arthrodesess of the ankles was done at age 20 and 22. Currently, she can take about 30 steps withoutt support. ERG at age 18 showed lack of flicker response at 32 Hz, and ophthalmoscopyy suggested early retinitis pigmentosa. A low serum level of a-tocopherol wass noted at age 18 (11 umol/1; normal range: 17-40 umol/1), and oral vitamin E supplementss were started.

MeasurementMeasurement of fi-oxidation enzymes Thee activity of BCOX was measured in fibroblast homogenates prepared in PBS containing 500 fiM FAD by sonication under continuous cooling with ice water. Reactions were conductedd in a medium of the following composition: 50 mM Tris-HCl (pH 8.5), 50 uM FAD,, 0.05% bovine serum albumin and 100 uM pristanoyl-CoA was used as substrate. Reactionss were allowed to proceed for 60 minutes at 37°C using a protein concentration of 0.55 mg/ml. Reactions were terminated by addition of acetonitrile to a final concentration of 41%.. After centrifugation for 10 min at 20,000 x g at 4°C, the supernatant was applied to a reversed-phasee Cis-column (Supelcosil LC-18-DB, 25 cm x 4.6 mm, Supelco). Resolution betweenn the different CoA esters was achieved by elution with a linear gradient of acetonitrilee (40 -» 58% (v/v)) in 16.9 mM sodium phosphate buffer (pH 6.9) at a flow rate off 1 ml/min under continuous monitoring of the absorbance at 254 nm. The amount of pristenoyl-CoAA formed was calculated from the ratio of pristenoyl-CoA over the total amountt of substrate and product (with a correction for different absorption coefficients), andd was used to calculate the enzyme activity. Measurements of SCOX,7 DBP (hydratase (HY)) and dehydrogenase (DH) activity),8 SCPx9 and a-methylacyl-CoA racemase (AMACR)100 were performed as previously described.

BiochemicalBiochemical assays Peroxisomall investigations in body fluids (concentrations of VLCFAs, branched-chain fattyy acids, bile acid intermediates, poly-unsaturated fatty acids, L-pipecolic acid and plasmalogens)) were done according to standard procedures developed in our laboratory (seee references in Wanders et al.n). VLCFAs and plasmalogen levels, C26:0 and pristanic acidd B-oxidation, phytanic acid a-oxidation, DHAPAT activity were determined in primaryy skin fibroblasts cultured in HAM-F10 medium as previously described.11 Additionally,, immunoblot analysis was performed in fibroblast lysates with antibodies againstt SCOX and 3-ketoacyl-CoA thiolase according to Wanders et al.11

78 8 Reinvestigationn of trihydroxycholestanoic acidemia

PEX12PEX12 mutation analysis PEX12PEX12 mutation analysis was performed as previously described.12

ImmunofluorescenceImmunofluorescence microscopy Immunofluorescencee using antibodies against catalase, DBP, the PTS1 signal peptide SKL (Zymedd laboratories, San Francisco, CA) and PMP70 (Zymed laboratories) was performed ass previously described.13

Resultss and discussion

Ourr patient was originally diagnosed with a defect at the level of THCA-CoA oxidase (BCOX),, which was based on the pattern of accumulating metabolites, but was not supportedd by enzyme activity measurements or DNA analysis. Because we have recently developedd an HPLC-based method which allows us to measure BCOX activity using pristanoyl-CoAA as substrate, we measured this activity in fibroblasts of this patient to confirmm the presumed deficiency. Surprisingly, BCOX activity was entirely normal (table 1).. In addition, we found normal activities for the other enzymes required for the breakdownn of peroxisomal substrates: SCOX, DBP, SCPx, and a-methylacyl-CoA racemasee (AMACR) (table 1).

Tablee 1Activit y yo f fperoxisoma ll p-oxidation nenzyme s s enzyme e controll subjects3 patientb b BCOX-- 1822 0 181 1 SCOXd d 922 9 83 3 DBP-HY? ? 2644 92 308 8 DBP-DH--- 766 6 115 5 SCPx' ' 7777 8 118 8 AMACRs s 922 0 170 0 Alll activities are given in pmol/min/mg, n value SD, bMean of twoo individual experiments. BCOX = branched-chain acyl-CoA oxidase;; SCOX = straight-chain acyl-CoA oxidase; DBP = D- bifunctionall protein; HY = hydratase; DH = dehydrogenase; SCPx = sterol-carrierr protein X; AMACR = a-methylacyl-CoA racemase

Thee absence of a deficiency of one of the peroxisomal p-oxidation enzymes in this patient promptedd us to perform a full reinvestigation of peroxisomal functions according to standardd procedures developed in our laboratory in both cultured skin fibroblasts and a recentt blood sample (table 2). In fibroblasts, no abnormalities could be found regarding VLCFAA and branched chain fatty acid oxidation and the presence of catalase-positive particles.. Plasmalogen levels were normal, although DHAPAT activity was borderline- normal.. Measurements in plasma not only confirmed the elevation of pristanic acid and bilee acid intermediates, as reported in the original article, but also showed a very mildly elevatedd C26:0/C22:0 ratio, although C26:0 levels were within the normal range. Furthermore,, levels of DHA were decreased in plasma as well as in erythrocytes, and levelss of L-pipecolic acid were increased. Both of these findings point to a more general peroxisomall dysfunction.

79 9 Chapterr 6

Tablee 2. Biochemical data in plasma, erythrocytes and fibroblasts controll subjects patient t Plasma a VLCFA A C26:0 0 0.45-1.32 2 0.76 6 C26:0/C22:0 0 0-0.02 2 0.03 3 branched-chainn fatty acids phytanicc acid15 0-9 9 6.0 0 pristanicc acidJ 0-4 4 4.5 5 bilee acid intermediates DHCA» » 0-0.02 2 1.4 4 THCAJ J 0-0.08 8 1.8 8 poly-unsaturatedd fattyacid s s DHA' ' 75-180 0 55.7 7 L-pipecolicc acid L-pipecolicc acidJ 0.1-7 7 146.2 2 Erythrocytes s poly-unsaturatedd fattyacid s s DHAb b 15.2-37.6 6 14.1 1 plasmalogens s C16:0-DMAC C 6.8-11.9 9 8.1 1 C18:0-DMAf f 10.6-24.9 9 16.1 1 Fibroblasts s VLCFA A C26:0J J 0.18-0.38 8 0.21 1 C26:0/C22:0 0 0.03-0.07 7 0.05 5 C26:00 p-oxidationl* 1214-1508 8 2192 2 branched-chainn fatty acids phytanicc acid a-oxidation' 44-82 2 98 8 pristanicc acid f3-oxidatione 675-1121 1 1691 1 plasmalogens s C16:0-DMAC C 7.2-13.4 4 14.1 1 C18:0-DMAC C 5.8-11.6 6 9.7 7 DHAPATT activity' 5.8-12.3 3 5.6 6 imm mu nofluorescence catalase e + + + + immunoblot t thiolasee processing + + + + SCOXX processing + + + + auM,, hpmol/106 cells, c% of total phospholipids, dumol/g protein, epmol/h/mg protein, 'nmol/2h/mgg protein VLCFA = very-long chain fatty acids; DHCA = dihydroxycholestanoic acid; THCAA = trihydroxycholestanoic acid; DHA = docosahexaenoic acid; DMA = dimethyl acetal; DHAPATT = dihydroxyacetonephosphate-acyltransferase; SCOX = straight-chain acyl-CoA oxidase e

Wee recently identified eight patients with normal to mildly abnormal peroxisomal functionss in fibroblasts (plasmalogen biosynthesis, peroxisomal a- and p-oxidation, mosaic catalasee immunofluorescence) and abnormal parameters in plasma (VLCFA, branched- chainn fatty acids, bile acid intermediates, DHA, L-pipecolic acid) (Gootjes et al., submitted).. These patients were found to suffer from a PBD caused by a homozygous mutationn in the PEX12 gene, leading to an amino acid substitution S320F at the protein level.. The similarity between the biochemical abnormalities in these patients and our patientt prompted us to perform mutation analysis of the PEX12 gene in this patient. Althoughh we did not find the S320F mutation, we did identify a nonsense mutation R180X (5380T)) and a missense mutation L317F (9490T). Mutation analysis in the parents confirmedd that the mutations were located on different alleles. Sincee the patient appeared to be affected with a PBD, we performed immunofluorescencee experiments with antibodies against different peroxisomal proteins too study their localization. Immunofluorescence microscopy with antibodies against catalase,, DBP, the PTS1 signal peptide SKL and PMP70 gave normal results after culturing thee cells at either 37°C or 40°C, so even at the higher temperature no abnormal localization off peroxisomal proteins could be detected (data not shown). This is in contrast to studies

80 0 Reinvestigationn of trihydroxycholestanoic acidemia inn fibroblasts of patients with the S320F mutation in which catalase immunofluorescence changedd from a mosaic pattern with catalase-positive peroxisomes in more than 70% of thee cells to a completely cytosolic labeling, when the culturing temperature of the cells was shiftedd from 37°C to 40°C (Gootjes et al., submitted). Thee PEX12 protein contains two transmembrane domains and one C-terminal zinc- bindingg domain thought to be important for its interaction with other proteins.14 The R180XX mutation truncates the PEX12 protein after the first transmembrane domain (figure 2).. For this reason, a protein is produced that is likely to be localized incorrectly and to be inactive.. This mutation has been described in two compound heterozygous patients with a severee Zellweger phenotype.15 The missense mutation L317F, which has not been reported previously,, is localized in the zinc-binding domain of PEX12 (figure 2). The leucine residuee that is changed to a phenylalanine is highly conserved between different species, evenn in several yeast species with whom its overall homology is rather low (18-25%). This mutationn is probably responsible for the mild phenotype found in our patient. It is located closelyy to the S320F mutation, which also causes a mild phenotype.

a a 11 R180X 11 "-1 ' L317F

11 155 172 238 254 300 345X 359

Figuree 2 (a) Schematic representation of the mutated PEX12 proteins. The zinc binding domain iss indicated by a horizontally striped box and each of the transmembrane domains is indicated byy a vertically striped box. The mutation is indicated by a black dot. (b) Amino acid alignment off the human (Hs), rat (Rn), mouse (Mm), Chinese hamster (CI), Saccharomyces cerevisiae (Sc), ViduaVidua pastoris (Pp) and Schizosaccharomyces pombe (Sp) PEX12 zinc-binding domains. Circles indicatee conserved cysteine residues. The box indicates the position of the mutation.

Clinicallyy our patient is among the mildest PBD patients reported. When compared to patientss homozygous for the G843D mutation in PEX1,16 which is known to be correlated withh a mild phenotype, and to the patients homozygous for the S320F mutation in PEX12, thiss patient is even more mildly affected, especially since she has no dysmorphic features andd no apparent liver abnormalities. Thee biochemical phenotype of this patient is very intriguing. The presence of peroxisomall abnormalities in plasma, which reflects the overall situation in the body, but thee absence of any abnormality in fibroblasts, suggests that there is an organ-specific biochemicall defect. However, there is no tissue specific genetic defect since mutation

81 1 Chapterr 6

analysiss was performed in fibroblasts. In patients homozygous for the S320F mutation, whoo display a mosaic catalase immunofluorescence pattern in fibroblasts that varies from celll to cell, a delicate balance is present determining if a cell can or cannot produce functionall peroxisomes. The nature of the factor causing this balance to tilt, however, remainss elusive. Maybe this balance tilts to the positive side in all fibroblasts from our patient,, whereas it tilts to the negative side in other tissues. This mechanism should be studiedd in more detail, since this might provide clues for treatment of mildly affected PBD patients. . Ourr investigation of this unique patient shows that even when all peroxisomal functionss in fibroblasts, which are routinely used to diagnose PBDs, are normal, a PBD cannott be excluded and additional studies are required. Our findings stress the importancee of reinvestigating patients that have been described in literature with unknownn defects in peroxisomal [3-oxidation or more general peroxisomal defects, now thatt the knowledge of peroxisomal function has improved greatly in recent years. The elucidationn of the true defect in these patients will further increase our understanding of peroxisomess and their function, and it will be important for prenatal diagnosis in this groupp of patients. In addition, we can conclude that at the moment there is no longer evidencee for the existence of trihydroxycholestanoyl-CoA oxidase deficiency as a distinct diseasee entity.

Acknowledgements s

Thee authors thank Henny Rusch, Luminita Bobu, Johan Gerrits, Henk Overmars, Arash Kamangerpour,, Petra Mooijer, Conny Dekker and Simone Denis for biochemical analyses inn patient material. Hans Waterham is acknowledged for critical reading of the manuscript.. This work was supported by the Princess Beatrix Fund, grant 99.0220.

References s

1.. Gould S.J., Raymond G.V. and Valle D. (2001) The peroxisome biogenesis disorders. In: Scriver C.R., Beaudett A.L., Valle D. and Sly W.S. (eds.) The metabolic and molecular bases of inherited disease. McGraw-Hill,, New York, 3181-3217. 2.. Christensen E., Van Eldere J., Brandt N.J., Schutgens R.B., Wanders R.J. and Eyssen H.J. (1990) A new peroxisomall disorder: di- and trihydroxycholestanaemia due to a presumed trihydroxycholestanoyl- CoAA oxidase deficiency, ƒ.Inherit.Metab Dis. 13: 363-366. 3.. ten Brink H.J., Wanders R.J., Christensen E., Brandt N.J. and Jakobs C. (1994) Heterogeneity in di/trihydroxycholestanoicc acidaemia. Ann.Clin.Biochem. 31: 195-197. 4.. Wanders R.J., Barth P.G. and Heymans H.S. (2001) Single peroxisomal enzyme deficiencies. In: Scriver C.R.,, Beaudet A.L., Valle D. and Sly W.S. (eds.) The metabolic and molecular bases of inherited disease. McGraw-Hill,, New York, 3219-3256. 5.. Ferdinandusse S., Denis S., Mooijer P.A., Zhang Z., Reddy J.K., Spector A.A. and Wanders RJ. (2001) Identificationn of the peroxisomal beta-oxidation enzymes involved in the biosynthesis of docosahexaenoicc acid. J.Lipid Res. 42: 1987-1995. 6.. Su H.M., Moser A.B., Moser H.W. and Watkins P.A. (2001) Peroxisomal straight-chain Acyl-CoA oxidase andd D-bifunctional protein are essential for the rerroconversion step in docosahexaenoic acid synthesis. J.Biol.Chem.J.Biol.Chem. 276: 38115-38120. 7.. Souri M., Aoyama T. and Hashimoto T. (1994) A sensitive assay of acyl-coenzyme A oxidase by coupling withh beta-oxidation multienzyme complex. Anal.Biochem. 221: 362-367. 8.. van Grunsven E.G., van Berkel E., Ijlst L., Vreken P., de Klerk J.B., Adamski J., Lemonde Hv Clayton P.T., Cuebass D.A. and Wanders R.J. (1998) Peroxisomal D-hydroxyacyl-CoA dehydrogenase deficiency:

82 2 Reinvestigationn of trihydroxycholestanoic acidemia

resolutionn of the enzyme defect and its molecular basis in bifunctional protein deficiency. Proc.Natl.Acad.Sci.U.S.AProc.Natl.Acad.Sci.U.S.A 95: 2128-2133. 9.. Ferdinandusse S., Denis S., van Berkel E., Dacremont G. and Wanders R.J. (2000) Peroxisomal fatty acid oxidationn disorders and 58 kDa sterol carrier protein X (SCPx). Activity measurements in liver and fibroblastss using a newly developed method, ƒ.Lipid Res. 41: 336-342. 10.. Ferdinandusse S., Denis S., Clayton P.T., Graham A., Rees J.E., Allen J.T., McLean B.N., Brown A.Y., Vrekenn P., Waterham H.R. and Wanders RJ. (2000) Mutations in the gene encoding peroxisomal alpha- methylacyl-CoAA racemase cause adult-onset sensory motor neuropathy. Nat.Genet. 24: 188-191. 11.. Wanders RJ, Barth PG, Schutgens RB and Heymans HS (1996) Peroxisomal disorders: Post- and prenatal diagnosiss based on a new classification with flowcharts. International pediatrics 11: 202-214. 12.. Gootjes J., Schmohl F., Waterham H.R. and Wanders R.J. (2003) Novel mutations in the PEX12 gene of patientss with a peroxisome biogenesis disorder. Eur.].Hum.Genet, in press. 13.. van Grunsven E.G., van Berkel E., Mooijer P.A., Watkins P.A., Moser H.W., Suzuki Y„ Jiang L.L., Hashimotoo T., Hoefler G., Adamski J. and Wanders R.J. (1999) Peroxisomal bifunctional protein deficiencyy revisited: resolution of its true enzymatic and molecular basis. Am.].Hum.Genet. 64: 99-107. 14.. Okumoto K. and Fujiki Y. (1997) PEX12 encodes an integral membrane protein of peroxisomes [letter]. Nat.Genet.Nat.Genet. 17: 265-266. 15.. Chang C.C. and Gould S.J. (1998) Phenotype-genotype relationships in complementation group 3 of the peroxisome-biogenesiss disorders. Am.J.Hum.Genet. 63: 1294-1306. 16.. Preuss N., Brosius U., Biermanns M., Muntau A.C., Conzelmann E. and Gartner J. (2002) PEX1 mutations inn complementation group 1 of Zellweger spectrum patients correlate with severity of disease. Pediatries.Pediatries. 51: 706-714.

83 3

Rapidd diagnosis of peroxisomal biogenesis disorders by means of immunofluorescencee microscopy in lymphocytes

Jeannettee Gootjes, Carlo W.T. van Roermund, Hans R. Waterham, Ronald J.A. Wanders, SubmittedSubmitted for publication Chapterr 7 Rapidd diagnosis of peroxisomal biogenesis disorders by means of immunofluorescencee microscopy in lymphocytes

Jeannettee Gootjes1, Carlo W.T. van Roermund1, Hans R. Waterham2, Ronald J.A. Wanders12 2

Lab.Lab. Genetic Metabolic Diseases, Departments of Clinical Chemistry and '-Pediatrics!Emma Children'sChildren's Hospital, Academic Medical Center, University of Amsterdam, the Netherlands.

Abstract t

Thee peroxisome biogenesis disorders (PBD), which comprise Zellweger syndrome, neonatall adrenoleukodystrophy and infantile Refsum disease, are caused by mutations in onee of at least 12 different PEX genes, encoding proteins involved in the biogenesis of peroxisomes.. The absence of peroxisomes in PBD patients leads to defects in the peroxisomall metabolic pathways, including peroxisomal f$-oxidation, plasmalogen biosynthesis,, and phytanic acid a-oxidation. Laboratory diagnosis of a PBD is performed byy metabolite analysis in plasma and erythrocytes of patients, followed by detailed peroxisomall studies in cultured skin fibroblasts, including catalase immunofluorescence microscopyy to determine the presence of catalase-containing peroxisomes. In this study we describee an alternative technique to determine the presence or absence of peroxisomes in patientt cells, which is rapid and non-invasive: immunofluorescence microscopy analysis inn lymphocytes, which can be isolated from the same blood samples as used for metabolite analyses.. Our results show that blood samples can be stored for at least four days at room temperaturee without any negative effect on the results. In some mild cases, immunofluorescencee microscopy results in lymphocytes were less ambiguous than in culturedd skin fibroblasts, which will aid in a more clear and firm diagnosis.

Introduction n

Thee peroxisome biogenesis disorders (PBDs), which include Zellweger syndrome (ZS), neonatall adrenoleukodystrophy (NALD) and infantile Refsum disease (IRD), represent a spectrumm of disease severity with ZS being the most, and IRD the least severe disorder. Commonn to all three PBDs are liver disease, variable neurodevelopmental delay, retinopathyy and perceptive deafness.1 Patients with ZS are severely hypotonic from birth andd die before one year of age. Patients with NALD experience neonatal onset of hypotoniaa and seizures and suffer from progressive white matter disease and usually die inn late infancy.2 Patients with IRD may survive beyond infancy and some may even reach adulthood.33 Clinical differentiation between these disease states is not very well-defined andd patients can have overlapping symptoms.4 Thee PBDs are caused by genetic defects in PEX genes, encoding proteins called peroxins,, which are required for the biogenesis of peroxisomes and function in the assemblyy of the peroxisomal membrane or in the import of enzymes into the peroxisome.5 Afterr synthesis on free polyribosomes, peroxisomal matrix proteins carrying either a carboxy-terminall peroxisomal targeting sequence 1 (PTS1) or a cleavable amino-terminal PTS22 signal are translocated across the peroxisomal membrane.5 A defect in one of the

86 6 Immunofluorescencee microscopy in lymphocytes peroxinss of the peroxisomal import machinery leads to failure of protein import via the PTS1-- and/or PTS2-dependent import pathway and, consequently, to functional peroxisomee deficiency. Thee absence of functional peroxisomes in patients with a PBD leads to impairment in a varietyy of metabolic functions among which 1) f5-oxidation of very-long chain fatty acids (VLCFA),, the branched chain fatty acid pristanic acid and the bile acid intermediates di- andd trihydroxycholestanoic acid, 2) etherphospholipid biosynthesis, 3) phytanic acid a- oxidationn and 4) L-pipecolic acid oxidation.1 Laboratoryy diagnosis of a PBD is usually made by investigations in plasma (concentrationss of VLCFAs, pristanic acid, phytanic acid, bile acid intermediates, poly- unsaturatedd fatty acids and L-pipecolic acid) and erythrocytes (plasmalogens).6 This is usuallyy followed by the measurement of various parameters in cultured skin fibroblasts (VLCFAA concentration, C26:0 and pristanic acid B-oxidation, phytanic acid a-oxidation, dihydroxyacetonephosphate-acyltransferasee activity and immunoblot analysis). The most decisivee parameter to the diagnosis of a PBD is the absence of peroxisomes as shown by immunofluorescencee microscopy analysis using antibodies against the peroxisomal enzymee catalase. Inn this study we describe an alternative technique to determine the presence of peroxisomess in patient cells: immunofluorescence microscopy analysis in lymphocytes. Sincee clinical suspicion of a peroxisomal disorder in a particular patient requires full blood forr analysis of peroxisomal metabolites, direct analysis of peroxisomes in lymphocyte isolatess from the same sample allows rapid and unequivocal identification of a peroxisome biogenesiss disorder. Furthermore, we show that in some cases, immunofluorescence microscopyy results in lymphocytes are less ambiguous than in cultured skin fibroblasts.

Materiall and Methods

ImmunofluorescenceImmunofluorescence microscopy in lymphocytes Lymphocytess were isolated from heparin or EDTA-blood using Lymphoprep density gradientt medium (Axis-Shield PoC, Oslo, Norway) in Leucosep rubes (Greiner Bio-one, Frickenhausen,, Germany). After isolation, lymphocytes were washed once with 0.9% NaCl,, and once with RPMI1640 medium (Invitrogen, Carlsbad, CA) containing 10% foetal calff serum (RPMI-FCS). Cells were resuspended in a small volume of RPMI-FCS and pipettedd on to microscope slides coated with Poly-L-lysine solution (0.1% w/v) (Sigma, St. Louis,, MO) containing two frame-seal chambers (Biozym, Germany) placed on top of each other.. Cells were incubated for 30 min at 37°C, after which cells were spun down to adhere too the microscope slides by a short period of centrifugation (10 sec) in a centrifuge suitable forr micro-titer plates (max. 350 x g). Cells were washed, fixed, permeabilized, and incubatedd with antibodies as described for fibroblasts.7

Resultss and Discussion

Inn this study we have developed a novel method to determine the presence of peroxisomess in lymphocytes using immunofluorescence microscopy as a rapid, non- invasivee alternative for a similar procedure developed for cultured skin fibroblasts. Figure

87 7 Chapterr 7

catalase e DBP P AH H

-33 _i - !

JHk k

Figuree 1 Catalase and DBP immunofluorescencee microscopy in lymphocytess from a control and a PBD patient. .

11 shows the results of immunofluorescence microscopy using antibodies against catalase andd the peroxisomal P-oxidation enzyme D-bifunctional protein (DBP) in control lymphocytess and lymphocytes from a PBD patient with a defect in the PEX1 gene (GenBankk accession no. AF030356). This patient is compound heterozygous for the two commonn PEX1 mutations c.2528G>A (p.G843D) and c.2097_2098insT.810 Control lymphocytess show a punctate pattern of peroxisomal labeling with both anti-catalase and anti-DBPP antibodies, whereas the cells from the PBD patient show a diffuse cytosolic staining. . Too investigate whether this method is also useful for older blood samples, EDTA blood fromm a control subject was left at room temperature for 0, 1, 2 and 4 days, prior to the isolationn of lymphocytes. Subsequent catalase and DBP immunofluorescence microscopy analysiss in the lymphocytes shows that blood can be stored for at least four days without anyy negative effect on the results (figure 2). It should be noted, however, that the isolation off lymphocytes becomes more difficult after this period.

dayO O dayy 1 dayy 2 dayy 4

TO TO S S Ü Ü

Q_ _ m m Q Q

Figuree 2 Time-dependency of catalase and DBP immunofluorescence microscopy in control lymphocytess after incubation at room temperature for 0, 1, 2 and 4 daysH prior to isolation. H 88 8 Immunofluorescencee microscopy in lymphocytes

Itt is known that catalase has a divergent PTS1 (KANL instead of SKL or one of its conserved variants),111 which results in a less efficient import of catalase into peroxisomes as compared too other PTS1 or PTS2 proteins.1213 Immunofluorescence microscopy with antibodies against catalasee in fibroblasts from PBD patients homozygous for the p.G843D mutation in PEX1, whichh are known for their mild biochemical and clinical phenotype,14 shows a virtually completee cytosolic labeling, as shown in figure 3. Immunofluorescence microscopy with antibodiess against DBP (carrying a conserved PTS1 variant AKL) in these cells, however, showss labeling of peroxisomes, although their numbers are less than in control fibroblasts. Whenn catalase and DBP immunofluorescence microscopy analysis was performed in lymphocytess from two siblings homozygous for the p.G843D mutation, neither catalase- positivee particles, nor DBP-positive particles were present (figure 3). These results indicate thatt catalase immunofluorescence microscopy in lymphocytes can also be used for the diagnosiss of patients suffering from a mild form of PBD. Moreover, the results with the DBP antibodiess indicate that immunofluorescence microscopy in lymphocytes may give less ambiguouss results than in cultured skin fibroblasts. This may aid in the diagnosis of patients withh an even milder biochemical defect than the p.G843D homozygous patients, catalasee DBP

Figuree 3 Catalase and DBP immunofluorescencee microscopy in fibroblastss and lymphocytes from a PBD patientt homozygous for the p.G843D mutationn in PEX1. Immunolocalizationn studies in patient material other than cultured skin fibroblasts have beenn described before. As an alternative for immunolocalization in highly-invasive liver biopsies,, Shimozawa et al. described immunolocalization in less, but still invasive rectal mucosaa biopsies.15 Santos et al. performed experiments in lymphoblasts16 because of their unlimitedd life-span and high efficiency of transformation and transfection with DNA. Moreover,, both Suzuki et al.17 and Zhang et al.18 have applied immunofluorescence microscopyy to buccal smears, which can be obtained rather easily. The method we describee here makes use of lymphocytes, which can be collected from the same samples alreadyy used for plasma and erythrocyte analysis. Furthermore, results obtained in lymphocytess may well be more physiological, as compared with buccal cells, fibroblasts andd lymphoblasts. A disadvantage of immunofluorescence microscopy in lymphocytes comparedd to fibroblast immunofluorescence microscopy is that for each patient sample the immunofluorescencee procedure must be carried out within a few days after collection of thee material. In skin fibroblasts, cells can be kept in culture until material of more patients iss collected. For standard diagnostic purposes where fibroblast material is also available, immunofluorescencee microscopy in lymphocytes might therefore be more time-

89 9 Chapterr 7 consuming.. However, in cases in which a fast diagnosis is required, this new technique willl be preferable.

Acknowledgements s

Thee authors thank Prof. Dr. Peter G. Barth and Prof. Dr. Bwee Tien Poll-The for supplying patientt material. This work was supported by the Prinses Beatrix Fonds, grant 99.0220.

References s

1.. Gould S.J., Raymond G.V. and Valle D. (2001) The peroxisome biogenesis disorders. In: Scriver C.R., Beaudett A.L., Valle D. and Sly W.S. (eds.) The metabolic and molecular bases of inherited disease. McGraw-Hill,, New York, 3181-3217. 2.. Kelley R.I., Datta N.S., Dobyns W.B., Hajra A.K., Moser A.B., Noetzel M.J., Zackai E.H. and Moser H.W. (1986)) Neonatal adrenoleukodystrophy: new cases, biochemical studies, and differentiation from Zellwegerr and related peroxisomal polydystrophy syndromes. Am.].Med.Genet. 23: 869-901. 3.. Poll-The B.T., Saudubray J.M., Ogier H.A., Odievre M, Scotto J.M., Monnens L., Govaerts L.C., Roels F., Comeliss A. and Schutgens R.B. (1987) Infantile Refsum disease: an inherited peroxisomal disorder. Comparisonn with Zellweger syndrome and neonatal adrenoleukodystrophy. Eur.J.Pediatr. 146: 477-483. 4.. Barth P.G., Gootjes J., Bode H., Vreken P., Majoie C.B. and Wanders R.J. (2001) Late onset white matter diseasee in peroxisome biogenesis disorder. Neurology 57: 1949-1955. 5.. Gould S.J. and Valle D. (2000) Peroxisome biogenesis disorders: genetics and cell biology. Trends Genet. 16:: 340-345. 6.. Wanders R.J., Barth P.G., Schutgens R.B. and Heymans H.S. (1996) Peroxisomal disorders: Post- and prenatall diagnosis based on a new classification with flowcharts. International pediatrics 11: 202-214. 7.. van Grunsven E.G., van Berkel E., Mooijer P.A., Watkins P.A., Moser H.W., Suzuki Y., Jiang L.L., Hashimotoo T., Hoefler G., Adamski J. and Wanders R.J. (1999) Peroxisomal bifunctional protein deficiencyy revisited: resolution of its true enzymatic and molecular basis. Am.].Hum.Genet. 64: 99-107. 8.. Collins C.S. and Gould S.J. (1999) Identification of a common PEX1 mutation in Zellweger syndrome. Hum.Mutat.Hum.Mutat. 14: 45-53. 9.. Maxwell M.A., Allen T., Solly P.B., Svingen T., Paton B.C. and Crane D.I. (2002) Novel PEX1 mutations andd genotype-phenotype correlations in Australasian peroxisome biogenesis disorder patients. Hum.Mutat.Hum.Mutat. 20: 342-351. 10.. Walter C, Gootjes J., Mooijer P.A., Portsteffen H., Klein C, Waterham H.R., Barth P.G., Epplen J.T., Kunauu W.H., Wanders RJ. and Dodt G. (2001) Disorders of peroxisome biogenesis due to mutations in PEX1:: phenotypes and PEX1 protein levels. Am.J.Hum.Genet. 69: 35-48. 11.. Purdue P.E. and Lazarow P.B. (1996) Targeting of human catalase to peroxisomes is dependent upon a novell COOH-terminal peroxisomal targeting sequence. ].Cell Biol. 134: 849-862. 12.. Fujiwara C, Imamura A., Hashiguchi N., Shimozawa N., Suzuki Y., Kondo N., Imanaka T., Tsukamoto T.. and Osumi T. (2000) Catalase-less peroxisomes. Implication in the milder forms of peroxisome biogenesiss disorder. J.Biol.Chem. 275: 37271-37277. 13.. Legakis J.E., Koepke J.I., Jedeszko C, Barlaskar F., Terlecky L.J., Edwards H.J., Walton P.A. and Terlecky S.R.. (2002) Peroxisome senescence in human fibroblasts. Mol.Biol.Cell 13: 4243-4255. 14.. Gartner J., Preuss N., Brosius U. and Biermanns M. (1999) Mutations in PEX1 in peroxisome biogenesis disorders:: G843D and a mild clinical phenotype. ƒ.Inkerit.Metab Dis. 22: 311-313. 15.. Shimozawa N., Suzuki Y., Orii T., Yokota S. and Hashimoto T. (1988) Biochemical and morphologic aspectss of peroxisomes in the human rectal mucosa: diagnosis of Zellweger syndrome simplified by rectall biopsy. Pediatries. 24: 723-727. 16.. Santos M.J., Moser A.B., Drwinga H., Moser H.W. and Lazarow P.B. (1993) Analysis of peroxisomes in lymphoblasts:: Zellweger syndrome and a patient with a deletion in chromosome 7. Pediatr.Res. 33: 441- 444. . 17.. Suzuki Y., Zhang Z., Shimozawa N., Orii T. and Kondo N. (1997) Use of buccal smears for rapid detectionn of peroxisomes. Eur.J.Pediatr. 156:250. 18.. Zhang Z., Suzuki Y., Shimozawa N. and Kondo N. (2000) Rapid diagnosis of peroxisome biogenesis disorderss through immunofluorescence staining of buccal smears. Ann.Neurol. 47: 836-837.

90 0 Chapterr 8

Mutationall spectrum of peroxisome biogenesis disorders

Jeannettee Gootjes, Josephine Vos, Geert T. Prins, Frank Schmohl, Janet Haasjes, Ronald J.A. Wanders,, Hans R. Waterham, parts of this chapter have been submitted for publication Chapterr 8 Mutationall spectrum of peroxisome biogenesis disorders

Jeannettee Gootjes1, Josephine Vos1, Geert T. Prins1, Frank Schmohl1, Janet Haasjes1, Ronald J.A.. Wanders1-2, Hans R. Waterham2

Lab.Lab. Genetic Metabolic Diseases, Departments of Clinical Chemistry and "-Pediatrics (Emma Children'sChildren's Hospital), Academic Medical Centre - University of Amsterdam, Amsterdam, The Netherlands Netherlands

Abstract t

Peroxisomess are organelles that play an indispensable role in a large variety of metabolic processes,, including fatty acid a- and (3-oxidation and plasmalogen biosynthesis. The importancee of peroxisomes is underlined by the existence of several disorders caused by a dysfunctionn of peroxisomes. These disorders can be divided into single enzyme defects andd peroxisome biogenesis disorders (PBDs). The PBDs form a clinically and genetically heterogeneouss group of disorders due to defects in at least 13 distinct genes. The prototypee of this group of disorders is Zellweger syndrome with neonatal adrenoleukodystrophyy and infantile Refsum disease as milder variants. Common to PBDs aree liver disease, variable neurodevelopmental delay, retinopathy and perceptive deafness.. The PBDs are caused by mutations in the PEX genes, encoding proteins involved inn peroxisomal membrane biogenesis and peroxisomal matrix protein import. We here reportt the various mutations we identified so far in the different PEX genes. In addition, wee have listed all mutations reported in literature to date, to present a complete overview off the mutational spectrum of PBDs. Frequently occurring mutations are discussed as well ass the effects of the mutations on the encoded proteins and cellular and clinical phenotypes. .

Introduction n

Peroxisomess are essential single-membrane bounded organelles found in virtually all eukaryoticc cells. They play an indispensable role in a large variety of metabolic pathways, includingg in man, among others, 1) fatty acid (3-oxidation of very-long chain fatty acids (VLCFAs),, notably C26:0, and of branched chain fatty acids, such as pristanic acid and the bilee acid intermediates di- and trihydroxycholestanoic acid, 2) etherphospholipid biosynthesis,, 3) phytanic acid a-oxidation and 4) L-pipecolic acid oxidation.1 The importancee of peroxisomes for human health and survival is underlined by the severe consequencess of defects in peroxisomal functions. These defects range from single enzyme deficienciess (e.g. X-linked adrenoleukodystrophy, Refsum disease) to defects resulting in a completee absence of functional peroxisomes, collectively known as the peroxisome biogenesiss disorders (PBDs). Thee PBDs include Zellweger syndrome (ZS), neonatal adrenoleukodystrophy (NALD) andd infantile Refsum disease (IRD). These disorders represent a spectrum of disease severityy with ZS being the most, and IRD the least severe disorder. Common to all three PBDss are liver disease, variable neurodevelopmental delay, retinopathy and perceptive deafness.11 Patients with ZS are severely hypotonic from birth and die before one year of

92 2 Mutationall spectrum of PBDs age.. Patients with NALD experience neonatal onset of hypotonia and seizures and suffer fromm progressive white matter disease, and usually die in late infancy.2 Patients with IRD mayy survive beyond infancy and some may even reach adulthood.3 Clinical differentiation betweenn these disease states is not very well-defined and patients can have overlapping symptoms.44 Due to the absence of functional peroxisomes in patients with a PBD, most peroxisomall metabolic functions are disturbed, resulting in accumulations of VLCFAs, pristanicc acid, bile acid intermediates, phytanic and L-pipecolic acid, and a deficiency of plasmalogens. . Alll PBDs are autosomal recessively inherited and can be caused by mutations in at leastt 12 different PEX genes. These PEX genes encode proteins called peroxins, which are requiredd for the biogenesis of peroxisomes and either function in the assembly of the peroxisomall membrane or in the import of proteins (enzymes) into the peroxisome.5 The peroxinss PEX3, PEX 16 and PEX19 are involved in the assembly of the peroxisomal membranee as is also clear from the complete absence of peroxisomal remnants in cells of patientss with two severe mutations in any of the encoding genes. Cells of patients with twoo severe mutations in any of the other PEX genes still have peroxisomal remnants ("ghosts")) that contain some peroxisomal membrane proteins, but lack most of their matrixx proteins. These cell lines have a defect in the import of peroxisomal matrix enzymes,, implying that the encoding peroxins are involved in peroxisomal protein import. Afterr synthesis on free polyribosomes, peroxisomal matrix proteins carrying either a carboxy-terminall peroxisomal targeting sequence 1 (PTS1) or a cleavable amino-terminal PTS22 signal are recognized by the PTSl-receptor PEX5 and the PTS2-receptor PEX7 (see figuree 2, chapter 1). The resulting receptor-matrix protein complexes subsequently dock at thee peroxisomal membrane, a process in yeast facilitated by the peroxins PEX13, PEX14 andd PEX17. In humans, however, no PEX17 ortholog has been identified yet. The matrix proteinss are then translocated over the peroxisomal membrane, a process involving PEX2, PEX10,, and PEX12. The PTS-receptors likely are co-imported with their cargo and leave thee peroxisome after delivering their cargo.6 PEX1 and PEX6 have been proposed to be involvedd in the recycling of the receptors. The recently discovered PEX26 was shown to anchorr PEX6 and PEX1 to the peroxisomal membrane.7 Different isoforms of PEX11 have beenn postulated to play a regulatory role in peroxisome proliferation, after the finding that yeastt cells lacking PEX11 contain few giant peroxisomes and appear to be unable to segregatee the giant peroxisomes to daughter cells.8 Because of the different cellular phenotypee in yeast, as well as in the mouse PEX11 knock-out model9 a PEX11 deficiency is nott considered to be a PBD. Thee laboratory diagnosis of patients suspected to be affected with a PBD starts with the analysiss of various parameters in plasma (concentrations of VLCFAs, pristanic acid, phytanicc acid, bile acid intermediates, poly-unsaturated fatty acids and L-pipecolic acid) andd erythrocytes (plasmalogens).10 When the results point to a PBD, this is followed by the measurementt of various parameters in cultured skin fibroblasts (VLCFA concentration, C26:00 and pristanic acid (3-oxidation, phytanic acid a-oxidation, dihydroxyacetonephosphate-acyltransferasee activity and immunoblot analysis). The diagnosiss is completed by immunofluorescence microscopy with antibodies against the peroxisomall enzyme catalase, to confirm the absence of peroxisomes, and with antibodies againstt the peroxisomal membrane protein ALDP to reveal the presence or absence of peroxisomall ghosts in the fibroblasts.

93 3 Chapterr 8

Whenn the diagnosis of a PBD is established, cell fusion complementation analysis is performed,, to identify the defective PEX gene." In this technique, fibroblasts from a new patientt are fused with cells from a patient belonging to a known complementation group, therebyy combining the genetic information of both patients. When the cells do not complementt each other and there is no restoration of peroxisome formation, the defective geness in both patients are the same. If peroxisomes are formed, the defective gene in both patientss is different. Peroxisome formation is assayed by catalase immunofluorescence microscopy. . Tablee 1 Results of complementation studies in 246 patients:: the Amsterdam experience Complementationn Group KKI* * Gifu" " Gene e Patients s %c c 1 1 E E PEX1 1 174 4 59 9 2 2 PEX5 5 5 5 2 2 3 3 PEX12 2 16 6 6 6 4 4 C C PEX6 6 31 1 12 2 7 7 B B PEXX 10 3 3 1 1 8 8 A A PEX26 6 4 4 2 2 9 9 D D PEX16 6 2 2 1 1 10 0 F F PEX2 2 7 7 3 3 11 1 R R PEX7 7 n.i. . n.i. . 12 2 G G PEX3 3 0 0 0 0 13 3 H H PEX13 3 2 2 1 1 14 4 J J PEX19 9 2 2 1 1 'Kennedyy Krieger institute, Baltimore, USA, bGifu univerisry,, Gifu, Japan, c% of cell lines complemented with thiss CG, CG11 was excluded, n.i. not included

Celll fusion complementation studies using patient fibroblasts so far has revealed the existencee of at least 13 distinct genetic groups of which currently all corresponding PEX geness have been identified (table 1). Except for PEX2 and PEX26, all PEX genes were identifiedd on the basis of their homology to their yeast orthologs. These were then screenedd for involvement in the PBDs by functional complementation assays in PBD fibroblastss and by mutation identification studies.12 PEX2 and PEX26 were identified by functionall complementation of peroxisome-deficient Chinese hamster ovary cells with mammaliann cDNA expression libraries.713 Most complementation groups (CGs) are associatedd with more than one clinical phenotype, indicating that different mutations in thee same gene may lead to ZS, NALD or the IRD phenotype.5 Patients belonging to CG11, causedd by defects in the PEX7 gene, present with the RCDP phenotype, a phenotype differentt from the PBD spectrum. These patients are only deficient in the few enzymes importedd by the PTS2 pathway, and present with proximal shortening of the limbs, periarticularr calcifications, microcephaly, coronal vertebral clefting, dwarfin, congenital cataract,, ichthyosis and severe mental retardation.1 In our laboratory, so far 246 PBD patientss have been assigned to the different CGs (table 1). The distribution among the differentt CGs is similar as reported by others.1 The large majority of the patients belong to CGI,, with PEX1 as the affected gene. The second most common CG is CG4, in which PEX6 iss defective. Together, mutations in these two PEX genes account for more than 70% of the PBDD patients.

94 4 Mutationall spectrum of PBDs Mutationn analysis

Afterr the assignment of patients cells to a certain CG, mutation analysis can be performed inn the respective PEX genes. As part of the diagnostic program for patients affected with PBDss we perform molecular analysis for the PEX1, PEX2, PEX5, PEX6 and PEX12 genes, whichh are the genes most commonly affected in patients (compare table 1). We here report thee various mutations we identified so far in the different PEX genes. In addition, we have listedd all mutations reported in literature to date.

MutationsMutations in PEX1 Thee human PEX1 gene is located on chromosome 7q21-q22. The gene is approximately 42 kbb in length, and contains 24 exons. It encodes a 1283 amino acids long protein of 143 kDa, belongingg to the AAA ATPase protein family (ATPases Associated with various cellular Activities)) and containing two ATP-binding folds. As already mentioned, the PEX1 gene is thee most affected among patients with a PBD. This is also reflected by the large number of mutationss in PEX2 identified to date (table 2).1423 Of all mutations in PEX1 (except for a few off which only the consequence at the mRNA level is reported), approximately 65% are single basee pair substitutions, while the remaining mutations comprise insertions and deletions of onee or more nucleotides. These mutations lead to missense mutations (27%), nonsense mutationss (22%), frameshift mutations (30%), small in-frame amino acid insertions or deletionss (5%), and large deletions of one or more exons (3%). Of the remaining mutations, whichh are mostly splice-site mutations, the effect at the protein level is unknown. Two polymorphismss have been identified in the PEX1 gene, c.2331A>C (G777G), and a 16 bp insertionn in intron 11 (c.1900 + 142insAGAAATTTTAAGTCTT).2324 Amongg these mutations a few common mutations have been identified. Most common iss a missense mutation in exon 15 (c.2528G>A) leading to the substitution of the glycine at positionn 843 by an asparagin (p.G843D) in the second ATP-binding domain. Patients homozygouss for this mutation are affected with the mild IRD phenotype.1718 The mutation reducess the binding between PEX1 and PEX6.25 Furthermore, it is known for its temperature sensitivity,, meaning that when fibroblasts of patients homozygous for G843D are cultured at 30°C,, they regain the ability to import catalase and other matrix proteins, as well as the variouss peroxisomal metabolic functions.1526 The G843D allele frequency ranges from 0.25 too 0.37 in the different cohorts.1518'20'2123-26 In our own patient cohort we found an allele frequencyy of 0.36 using RFLP analysis in 151 PEX1 patients. 20% of the patients were homozygotess and 33% were compound heterozygotes for the G843D mutation. The second mostt common mutation is a T insertion in exon 13: c.2097_2098insT, which results in a frameshiftt and low steady state PEX1 mRNA levels, presumably caused by nonsense mediatedd RNA decay.21-23 At the protein level it leads to truncation of the PEX1 protein within thee second AAA domain, abolishing PEX1 function. In homozygous form the mutation resultss in the severe ZS phenotype. In three different studies an allele frequency of around 0.3 hass been reported.1521-23 However, in our own patient cohort we found an allele frequency of 0.16.. Together, these two mutations account for around 50-60% of all PEX2 alleles, which is aboutt 40% of all PBD alleles. Another relatively common mutation is the deletion of the A at positionn c.2916, which in two previous studies accounted for 6% of all PEX1 alleles.1622 Thiss mutation has not yet been found in our own population. The remaining PEX1 mutationss are unique or occur only few times.

95 5 Chapterr 8 Tablee 2 Mutations in the PEX1 gene Num berom f f Phenotype e patients sidentifie d d associatedd with Predictedd effect on Homo o Hetero o patientt (age of Nucleotidee change exon n codingg sequence zygous s zygous s death) ) Ref f Missense e c.3G>A A 1 1 unknown n 1 1 n* * C.1777G>A A 10 0 p.G593R R 1 1 IRDD (6y^) b,n n c,1991T>C C 12 2 p.L664P P 1 1 ZSS (2m4) f f C.1976T>A A 12 2 p.V659D D 1 1 n* * c.2008C>A A 12 2 p.L670M M 1 1 ZS(ld) ) b,n n c.2392C>G G 14 4 p.R798G G 1 1 (155 m') c c c.2528G>A A 15 5 p.G843D D many y many y IRD,, NALD d,e,n n c.2636T>C C 16 6 p.L879S S 22 ' n* * c.2846G>A A 18 8 p.R949Q Q 1 1 ZSS (3m) b b c.3850T>C C 24 4 p.X1284QX28 8 1 1 (>2y) ) b,n n Nonsense e c.569C>A A 5 5 p.S190X X 3 3 n* * c.781C>T T 5 5 p.Q261X X 1 1 ZSS (4m4) a a C.18970T T 11 1 p.R633X X 1 1 NALDD (20m4) a a c.2368C>T T 14 4 p.R790X X 2 2 (11 >-) c,n n c.2383C>T T 14 4 p.R795X X 1 1 ZS S I I c.2614C>T T 16 6 p.R872X X 1 1 (2m) ) i i c.2992C>T T 19 9 p.R998X X 1 1 <6y') ) c c c.3378C>?2 2 21 1 p.Y1126X X 1 1 (9m) ) i i Deletion n c.788_789delCA A 5 5 p.T263fsX5 5 1 1 ZSS (3m) b,n n c.904delG G 5 5 p.A302fsX22 2 1 1 (2m) ) c c c.911_912delCT T 5 5 p.S304fsX3 3 1 1 n* * c.l713_1716delTCAC C 10 0 p.H571fsX10 0 1 1 n* * c.2633_2635delTGT T 16 6 p.L879del l 1 1 n n c.2730delA A 17 7 p.L910fsX50 0 2 2 ZSS (3m) b,n n c.2814_2818del l 18 8 p.F938fsXl l 1 1 (3m) ) i i c.2916delA A 18 8 p.G973fsX15 5 8 8 (Idd -4m) c,i i Insertion n c.l960_1961dupCAGTGTGGA A 12 2 p.T651_W653dup p 3 3 ZS,, (10yS), (23y<) d,e,i i c.2097_2098insT T 13 3 p.I700fsX41 1 many y many y ZS,, NALD, IRD h,n n c.3180_3181insT T 20 0 p.G1061fsX15 5 11 ' ZS S i i Deletion/insertion n

c.434_448delinsGCAA A 4 4 p.S125fsX6 6 1 1 ZS(ld) ) b,n n c.h h 19/20 0 p.V977fsX5 5 2 2 n* * Splicee site c.472+lG>T T 5 5 7 7 1 1 n* * c.l670+5G>T T 9 9 7 7 1 1 ZS(18m) ) b b c.2071+lG>T T 12 2 7 7 2 2 IRDD (6y5) b,n n c.2926+lG>A A 18 8 7 7 1 1 ZS S d,e e c.2926+2T>C C 18 8 7 7 1 1 b b c.3207+lG>C C 20 0 p.D1070_S1090del l 1 1 NALD D e e Miscellanious,, only mutation cDNA known c.exon3ins35bpp & 3/12 2 frameshift t 1 1 NALDD (20m4) a a c.l901_2070del2 2 c.exon9&ll 2del/exon9-l 2del2 9 9 frameshift t 1 1 ZSS (4m4) a a 2 2 c.l90bpdel 12/13 3 ? ? 2 2 ZS(G,1886_1887delGT T 8 8 p.T526A,, p.C629X 1 1 n* * deletionn of exon 14, genomic mutation not reported, details not reported caused by nextmutation ?? age at death or lastt follow-up 5alive, 6c.2927-15T_3208-342A (3207+1109A) delinsATAGTATAGA && 3849+779_3849+29!9, leadingg to exonl9/20del on cDNA,72406_2407insertion of intron!4 on cDNA, a14, b15, c16,d ,7,eIg,f,y,g20,h2l,i22,j23, , n:: this study, *: novel mutation

96 6 Mutationall spectrum of PBDs

Off the 20 different mutations identified in our cohort of patients, ten are novel, including 4 missense,, 2 nonsense, 3 deletions and 1 deletion/insertion mutation. This latter mutation is veryy unusual. It concerns the substitution of exons 19 and 20, including portions of the intronn boundaries (c.2927-15T_3208-342Adel) by a stretch of ten base-pairs (ATAGTATAGA),, followed by a portion of the gene that normally is located downstream off exon 24 (c.3849+779_3849+2919), which is inserted in a reverse complementary way. At thee mRNA level this mutation leads to the deletion of exons 19 and 20 resulting in a shift off reading frame, predicted to produce a truncated non-functional protein (p.V977fsX5).

MutationsMutations in PEX2 Thee PEX2 gene is located at chromosome 8q21.1 and was the first gene found to be mutatedd in ZS (CG10).13 It spans approximately 17.5kb in length and contains four exons. Thee entire coding sequence is included in exon 4.27 The gene encodes a 305 amino acid protein,, with a molecular weight of -35 kDa. PEX2 is an integral membrane protein with twoo transmembrane domains and a zinc-binding motif (C3HC4) in the C-terminal part, probablyy involved in interaction with other proteins of the peroxisomal protein import machinery.28 8 Soo far, nine different mutations have been identified in PEX2, eight of which have been describedd in literature (table 3).13*2934 Seven of these mutations are unique; one mutation hass been described in five homozygous patients and two heterozygous patients (c.3550T).. Two of the mutations are missense mutations; the other six mutations are eitherr deletions (3) or nonsense mutations (3), causing truncation of the encoded PEX2 protein,, and are all found in a homozygous form. The E55K allele was found to be temperaturee sensitive and leads to a partial peroxisomal protein import deficiency, mainly effectingg catalase.29

Tablee 3 Mutations in the PEX2 gene Predicted d Numberr of patients Phenotype e effectt on identified d associatedd with coding g Homo o Hetero o patientt (age of Nucleotidee change exon n sequence e zygous s zygous s death) ) Ref f c.-133G>A' ' 1 1 1 1 n* * c.l63G>A A 4 4 p.E55K K 1 1 a a c.2799 283delGAGAT 4 4 p.R94fsX4 4 1 1 ZSS (2m) b b c.355C>T T 4 4 p.R119X X 5 5 2 2 ZS S b,c,d,a,f f c.373C>T T 4 4 p.R125X X 1 1 1 1 ZS S c.550delC C 4 4 p.R184fsX7 7 1 1 ZSS (2y) e e c.642delG G 4 4 p.K215fsXl l 1 1 IRD D e e C.6690A A 4 4 p.W223X X 1 1 IRDD (13y) b b c.739T>C C 4 4 P.C247R R 1 1 ZSS (3m) b b 'lastt base of the non-coding exon ,, presumably resultingg in a splicesit- ee dysfunction, a29,b31 cJ0, d'\ e2J ,f\g3\h34 4 n:: this study, *: novel mutation

Alll mutations that truncate PEX2 before the second transmembrane domain (c.279_283delGAGAT,, c.355C>T, c.363C>T and c.550delC) give rise to the ZS phenotype; thee mutations that truncate PEX2 between the second transmembrane domain and the zinc-bindingg domain (c.642delG and c.669G>A) lead to the IRD phenotype. This suggests thatt the zinc-binding domain is not obligatory for the activity of PEX2. However, the

97 7 Chapterr 8 missensee mutation C247R, which changes the second cysteine residue of the zinc-binding domain,, seems to disagree with this postulate,35 since this mutation results in the ZS phenotype.. This could be due to instability of the protein, caused by this mutation, or an inhibitingg effect on the function of the protein it interacts with. Recently we found one novell homozygous mutation in the non-coding exon 1 of PEX2 in a patient assigned to CG100 by cell fusion complementation studies. This one base-pair substitution is positioned att the last base of this exon, and thus may result in alternative splicing. The effects at the mRNAA and protein level, however, are unknown.

MutationsMutations in PEX3 Thee PEX3 gene is located at chromosome 6q23-24, is composed of 12 exons and spans a regionn of approximately 40 kb. It encodes a 42-kDa protein of 373 amino acids with two putativee membrane-spanning domains.36 Mutations in PEX3 are disease-causing in CG12.37-399 Three different mutations in PEX3 have been reported (table 4), which all lead to aa truncation of the protein.3740 One of the mutations truncates the protein between the two transmembranee domains, the two other after the second transmembrane domain. All mutationss have been found in homozygous state and lead to the severe Zellweger phenotype. .

Tablee 4 Mutations in the PEX3 gene Predictedd Number of patients Phenotype effectt on identified associated with codingg Homo Hetero patient (age of Nucleotidee change exon sequence zygous zygous death) Ref C.1570TT 2 p.R53X 1 ZS c

c.543_544insTT 7 p.V182fsX2 1 ZS a,b,c c.942-8T>Gii 11 pR314fsX3 1 ZS (19d) b,d 11 deletion of exon 11 on cDNA, a", b3\ c4U, d39

MutationsMutations in PEX5 PEX5PEX5 has been mapped to chromosome 12pl3.3 and consists of 15 exons.4143 Mutations in PEX5PEX5 are the cause of disease in PBD patients belonging to CG2.12 The PEX5 protein containss seven tetratricopeptide repeats (TPRs), which together constitute the binding site forr the PTS1 of the cargo proteins44 and also interact with PEX12, while highly conserved N-terminall pentapeptide repeats were shown to be essential for the interaction with the memberss of the docking complex.454* Two forms of PEX5 mRNA have been identified, PEX5SPEX5S and PEX5L, which differ by the presence or absence of 111 bp due to alternative splicingg of exon 8.43 The two mRNAs encode for a 67 kDa PEX5S protein (602 amino acids) andd a 70 kDa PEX5L protein (639 amino acids), respectively. PEX5S is involved in PTS1 import,, while PEX5L assists in PTS2 import.43 Soo far, five different mutations in PEX5 have been identified of which three have been describedd in literature (table 5). The R390X mutation is predicted to truncate the PEX5 proteinn within the third TPR domain of the protein, but also causes mRNA decay.124347 Bothh PTS1 and PTS2 protein import into peroxisomes are deficient in cell lines homozygouss for this mutation. The N489K is found in one patient homozygous for this mutation,, and is associated with the NALD phenotype.12'47-48 The amino acid substitution is locatedd inside the sixth TPR domain, and causes only PTS1 protein import deficiency,

98 8 Mutationall spectrum of PBDs whilee PTS2 protein import is unaffected. This asparagine residue, together with arginine R520,, is thought to be critical in the binding of the PTS1 peptides to PEX5.49 The mutation attenuatess the affinity for the PTS1.1 The third mutation is an amino acid substitution in thee C-terminal part of the protein (S563W).47 It is associated with the IRD phenotype, and causess only a mild import deficiency of inefficiently imported PTS1-containing proteins likee catalase. Other PTS1 proteins, as well as PTS2 proteins are imported normally. We identifiedd one novel nonsense mutation in our patient cohort: c.979C>T (Q327X), which is locatedd in the first TPR domain. The mutation was found in a homozygous patient of whomm no clinical data was available. The biochemical phenotype of this patient was severe.. In another CG2 patient no mutations could be found in exons 1-4 and 6-15. We weree not able to amplify exon 5 in this patient using various primer sets, suggesting a deletionn of exon 5 and flanking regions in this patient. Although this would be expected to resultt in a severe phenotype, the patient was diagnosed with the mild IRD phenotype, but developedd cerebral white matter degeneration in the third year of life.4

Tablee 5 Mutations in the PEX5 gene Predicted d Numberr of patients Phenotype e effectt on identified d associatedd with coding g Homoo Hetero patientt (age of Nucleotidee change1 exon n sequence e zygouss zygous death) ) Ref f c.979(1090)OT T 9(10) ) p.Q327(364)X X 1 1 n* * cll68(1279)C>T T 11(12) ) p.R390(427)X X 2 2 ZS S a,b b C.1467(1578)T>G G 13(14) ) p.N489(526)K K 1 1 NALD D a,b,c,n n C.1688(1799)OG G 14(15) ) p.S563(600)W W 1 1 IRD D b,n n 11 position in PEX5L is shown between parentheses, a12, b47, c48, n: this study, *: novel mutation

MutationsMutations in PEX6 Thee PEX6 gene is located at chromosome 6p21.1. It contains 17 exons and spans approximatelyy 14 kb. It encodes a 980 amino acid protein of 104 kDa, which is also a memberr of the AAA ATPase protein family and interacts with PEX1. Mutations in this genee are disease-causing in CG4.50 So far, 25 different mutations have been identified of whichh 22 mutations have been described in literature (table 6), which are distributed 5051 5253 54 33 throughoutt the gene. ' ' - All mutations are unique, except the C.1688+1G>A 52 mutation,, which was found in two unrelated Japanese patients. The C.1715T>C and c.2094+2T>CC mutations were found in a family in which both parents as well as the son weree affected.54 Both parents had sensorineural deafness and retinitis pigmentosa and weree initially misdiagnosed with Usher syndrome. The underlying PBD in both (i.e. the IRDD phenotype) was only recognized when their son presented with the severe ZS phenotype.. The father was homozygous for the C.1715T>C mutation, the mother was compoundd heterozygous for the c.2094+2T>C mutation and two coupled missense mutationss on the other allele (c.2426C>T and c.2534T>C). The child was compound heterozygouss for both the C.1715T>C and the c.2094+2T>C mutation. One of the PEX6 mutationss (C.170T>C, p.L57P) was reported to cause a temperature-sensitive biochemical phenotype.511 In our population we identified eight different mutations including three novell mutations: a two base-pair insertion c.690_691insAG (p.S232fsX14), a splice site mutationn leading to exon 4 skipping in PEX6 mRNA (c.H31-lG>C, p.R379fsX3) and a missensee mutation (c.H98T>A, p.Y400A). The first two mutations were found in

99 9 Chapterr 8

homozygouss patients and were associated with the severe ZS phenotype. Furthermore, we identifiedd three additional patients, who were homozygous for the c.402delC mutation, whichh makes this the most frequent mutation in PEX6. Three polymorphisms in PEX6 havee been identified: c.399T>G and C.2814G/A, which are silent, and C.2816C/A which resultss in the amino acid substitution P939Q.

Tablee 6 Mutations in the PEX6 gene Numberr of Phenotype e Predictedd effect patientss identified associated d onn coding Homo o Hetero o withh patient Nucleotidee change exon n sequence e zygous s zygous s (agee of death) Ref f C.170T>C C p.L57P P 1 1 NALD D a,n n c.275_280del l p.V92_R93del l 1 1 ZS S b b c.402delC C p.G135fsX22 2 4 4 ZS(l-3m) ) b,n n c.510_511insT T p.G171fsX70 0 1 1 c c c.530delC C p.P177fsX28 8 1 1 ZS S b b c.690_691insAG G p.S232fsX14 4 1 1 ZS S n* * C.7270T T p.Q243X X 1 1 ZSS (2d) b b c.800_813del' ' p.207_Q294deI I 1 1 NALD D d d c.814_815insCTTG G p.V273fsX8 8 1 1 ZS S b b c.883-2A>GG (cDNA: del exon 2) 2 2 p.R295fsX34/X8 8 1 1 ZS S b b C.1130+1OAA (cDNA: del exon3) 3 3 p.V350_W378del l 1 1 c c C.1131-1G>CC (cDNA: del exon 4) 4 4 p.R379fsX3 3 1 1 lm m n* * c,1198T>A A 4 4 p.Y400A A 1 1 n* * c.l301delC C 5 5 p.S343fsX15 5 1 1 ZSS (8m) b b c.1688+11 G>A (cDNA: del exon 7 7 7 p.V494fsX18, , 2 2 ZSS (3-4m) b b andd del exon 6 & & 7) p.G457_S563del l c.l715T>C C 8 8 p.T572I I 1 1 1 1 IRD3,, (17m) e,n n c.2094+2T>C C 10 0 p.I699fsX37 7 2 2 IRD3,, (17m) e,n n c.2362G>A A p.I699fsX40 p.I699fsX40 1 1 NALD D d d c.2426C>T&2534T>C2 2 13 3 p.A809V&I845T T 1 1 IRD3 3 e,n n c.2434C>T T 13 3 p.R812W W 1 1 ZS S b b c.2435G>A A 13 3 p.R812Q Q 1 1 ZS S b b c.2666+2T>CC (cDNAdelexo: n n15 ) ) 15 5 p.D865_F890del l 1 1 ZS S b b Miscellaneous,, only mutationn cDNA known c.l962_1969dell (splice site) p.L655fsX3 3 1 1 f f c.2398_2417delinsT T p.I800fsX15 5 1 1 f f 11 leading to 619_882 del on cDNA,2 both mutations on same allele, unknown which mutation causes disease, 33 patients originally diagnosed with Usher syndrome, a^1, bS2, c50, d53, eM, i55, n: this study, *: novel mutation

MutationsMutations in PEX7 Becausee patients with defects in the PEX7 gene do not display the PBD phenotypes, but presentt with the distinct RCDP phenotype, mutations in PEX7 will not be discussed here. Mutationss in PEX7 have been reviewed elsewhere.5657

MutationsMutations in PEX10 Thee human PEXW gene has been mapped to chromosome lp36.32, consists of seven exons andd spans 8 kb of genomic DNA.58 Two mRNA splice forms of PEX10 have been identified:: PEXW and PEX10E. The latter is 57 bp longer, caused by the use of a different splicee acceptor site at the 3' end of intron 3. The longer form accounts for up to 10% of the

100 0 Mutationall spectrum of PBDs

PEX10PEX10 mRNA in the cell and appears to be slightly less functional.58 The PEX10 protein consistss of 326 amino acids and has a molecular mass of 37 kDa. Like PEX2 and PEX12, the PEX100 protein is an integral membrane protein and contains two transmembrane domains andd a C-terminal zinc-binding motif. PEX10 is the defective gene in CG7.5960 Six mutations inn PEX10 have been described in literature (table 7).5861 Five of the mutations lead to prematuree truncation of the PEX10 protein, the sixth mutation is a missense mutation, changingg the zinc-coordinating histidine of the zinc-binding domain into a glutamine (p.H290Q).599 This mutation only partially reduces PEX10 function.58 The c.814_815delCT mutationn causes a frameshift resulting in a protein lacking the zinc-binding domain. All elevenn Japanese CG7 patients are homozygous for this mutation, due to a founder effect.61 Thiss mutation correlates with the severe ZS phenotype: so, in contrast to PEX2, the zinc- bindingg domain of PEX10 is indispensable for its function. Four single nucleotide polymorphismss have been described for PEX10: C.279C/T, C.291G/A, C.1029G/A and 1154A/G,, of which the last two are localized outside the coding region.

Tablee 7 Mutations in the PEX10 gene Predicted d Numberr of Phenotype e effectt on patients sidentifie d d associatedd with coding g Homo o Hetero o patientt (age of Nucleotidee change exon n sequence e zygous s zygous s death) ) Ref f c.133 28delins' 1 1 p.A5fsX46 6 1 1 ZS S a a c.600+lG>AA (cDNAde: ll exon 3) 3 3 p.G65fsX15 5 1 1 ZS S b b C.405OT T 3 3 p.R125X X 1 1 NALD D b b c.7044 705insA 4 4 p.L236fsX102 2 1 1 ZS S a a c.8144 815delCT 5 5 p.L272fsX65 5 12 2 ZS S a,c,d d C.902OG G 5 5 p.H290Q Q 1 1 NALD D b b 11 c.13 28delinsCCGCCAGCACCTGCGCCGCC, a58, bs", c«', d61

MutationsMutations in PEX12 Thee PEX12 gene has been mapped to chromosome 17q21.1. The gene consists of 3 exons andd spans 2.5 kb.62 It encodes a 359 amino acid protein of 41 kDa, with two transmembranee domains and, like PEX2 and PEX10, contains a C-terminal zinc-binding motif.63-644 PBD patients belonging to CG3 have mutations in the PEX12 gene.62 So far, sixteenn different mutations have been described in literature (table S).35-48-62'6466 Two of the mutations,, which are positioned in the N-terminal part of the protein, were associated withh a mild phenotype: the c.26_27delCA, which gives rise to the start of protein translationn at the alternative initiation codons M94 and M118,65 and the c.273A>T mutation (R91S).355 These mutations show that the first part of the protein is not obligatory for residuall import/function of PEX12. Furthermore, all mutations leading to a truncated proteinn lacking the zinc-binding domain correlate with a severe phenotype.63 The patient homozygouss for the c.959C>T mutation (S320F) was originally thought to have a defect in PEXW,PEXW, because complementation of this cell line with a PEX10-deficient cell line resulted inn a restoration of peroxisome formation.59 However, additional studies showed that the patientt was defective in PEX22.48 This mutation is located inside the zinc-binding domain. Laterr studies identified eight additional patients homozygous for this mutation and reportedd that the mutation causes a distinct biochemical phenotype and is temperature sensitivee (Chapter 5).

101 1 Chapterr 8 Tablee 8 Mutations in the PEX12 gene Predicted d Numberr of Phenotype e effectt on patientss identified associatedd with coding g Homoo Hetero patientt (age of Nucleotidee change exonn sequence zygouss zygous death)) Re f c.26_J27delCA A p.startt at M94 1 1 IRD D &M118 8 C.126+1G>T T p.V43fsX2 2 ZS.IRD D c.273A>T T p.R91S S IRDD (2.5y) c.202_204delCTT T p.L68del l NALDD (>4y) c.268_271delAAGA A p.K90fsX2 2 ZS S c.308_308insT T p.L103fsX2 2 ZSS (2m) c.538C>T T p.R180X X ZS S c.604C>T T p.R202X X NALDD (5m) c.625C>T T p.Q209X X ZSS (4m) c.684_687delTAGT T p.S229fsX3 3 ZSS (3m) c.691A>T T p.K231X X ZS S c.733_734insGCCT T p.L245fsX18 8 ZS S c.744J745insT T p.T249fsX13 3 ZS S c.875_876delCT T p.S292X X ZS S c.887_888delTC C p.L297fsXll 1 ZSS (4-9m) a,b b c.959C>T T p.S320F F NALD D 11 c.l3_28delinsCCGCCAGCACCTGCGCCGCC, a*5, b*5, ch2, dh4, e6", f48, g: Chapter 5

MutationsMutations in PEX13 PEX13PEX13 is localized at chromosome 2pl4-pl6 and spans approximately 11 kb.67 It consists of 44 exons and encodes a peroxisomal integral membrane protein of 44 kDa with two putativee membrane domains and with a C-terminal SH3 domain facing the cytosol, which bindss PEX568-6* and (in yeast) PEX14.70 The N-terminal part of yeast PEX13 interacts with PEX7.711 Mutations in PEX13 are disease-causing in CG137273 and have been described in onlyy two patients (table 9). The W234X mutation truncates the protein between the two transmembranee domains and results in the severe ZS phenotype.72 The I326T mutation is locatedd at a conserved position in the SH3 domain and attenuates PEX13 function, leading too the intermediate NALD phenotype.7273 Residual levels of PTS1 and PTS2 proteins are importedd into peroxisomes in cells of this patient and this mutation was found to cause a temperaturee sensitive biochemical phenotype.

Tablee 9 Mutations in the PEX13 gene Predicted d Numberr of Phenotype e effectt on patientss identified associatedd with coding g Homoo Hetero patientt (age of Nucleotidee change exon n sequence e zygouss zygous death) ) Ref f c.702G>A A 2 2 p.W234X X 1 1 ZS S a a c.977T>C C 4 4 p.B26T T 1 1 NALD D a,b b a72,, b"

MutationsMutations in PEX16 Thee PEX16 gene localizes to chromosome llpl2-pll.2 and consists of 11 exons.74 It encodess a 336 amino acid protein of 39 kDa that contains two transmembrane domains.75 Mutationss in the PEX16 gene are responsible for CG9.76 Two different mutations in PEX16 102 2 Mutationall spectrum of PBDs havee been described in literature (table 10).7476 The first mutation c.526C>T results in the truncationn of the protein between the two transmembrane domains7576 and leads to the severee ZS phenotype. The second mutation is a splice site mutation that leads to exon 10 skippingg in PEX16 mRNA, which causes a frameshift in the C-terminal part of the protein, replacingg the last 39 amino acids by 38 different amino acids.74 The produced protein does containn the two transmembrane domains, as well as the region of the protein required for sortingg to the peroxisomal membrane.77 The mutation is found in two homozygous patientss with the ZS phenotype.

Tablee 10 Mutations in the PEX16 gene Predicted d Numberr of Phenotype e effectt on patientss identified associatedd with coding g Homoo Hetero patientt (age of Nucleotidee change exonn sequence zygouss zygous death) ) Ref f C.5260T T p.R176X X 1 1 ZS S a,b b c.952+2T>CC (del exonlO) p.R298fsX38 8 2 2 ZS S c c

MutationsMutations in PEX19 Thee PEX19 gene is localized at chromosome lq22, contains eight exons and spans approximatelyy 9 kb.78 Three splice variants of PEX19 have been identified, lacking exon 2, exonn 4 or exon 8.78 Two of these splice variants exhibit distinct functions in peroxisomal assembly.799 The PEX19 gene encodes a mainly cytosolic protein that binds many peroxisomall membrane proteins.80 Only one mutation in PEX19 has been described in two siblingss belonging to CG14 (table ll).81 This insertion (c.763_764insA) results in a frameshiftt in the C-terminal part of the protein, and causes the severe ZS phenotype.

Tablee 11 Mutations in the PEX19 gene Predicted d Numberr of Phenotype e effectt on patientss identified associatedd with coding g Homoo Hetero patientt (age of Nucleotidee change exonn sequence zygouss zygous death) ) Ref f c.763^764insA A p.M255fsX24 4 1 1 ZS S a a a81 1

MutationsMutations in PEX26 PEX26PEX26 has been identified very recently at chromosome 22qll.21.7 The gene encodes a 305 aminoo acid protein with one putative membrane-spanning domain. Mutations in PEX26 causee the disease in PBD patients of CG8.7 So far, seven mutations in the PEX26 gene have beenn identified (table 12), two of which were found on the same allele.782 Six of the mutationss are located in the first half of the protein.82 Some of the mutations were found to leadd to a temperature-sensitive biochemical phenotype.

InIn conclusion, mutation analysis in PBD patient samples has revealed many mutations in thee PEX genes in the past years. Linking these mutations with the cellular phenotype of thee patients will aid in the investigation of the functions and functional domains of the encodedd proteins. Moreover, mutation analysis results may provide valuable insight into possiblee genotype-phenotype relationship, which eventually may give pediatricians possi- 103 3 Chapterr 8

Tablee 12 Mutations in the PEX26 gene Numberr of Predictedd effect patients sidentifie d d onn coding Homo o Hetero o Phenotypee associated Nucleotidee change sequence e zygous s zygous s withh patient (age of death) Ref f c.2T>C C unknown n 1 1 IRDD (4y!) a a c.l34T>C C p.L45P P 1 1 IRDD (4y') a a c.254_255insT T p.C86fsX28 8 1 1 IRDD (12y') a a c.265G>A A p.G89R R 2 2 ZS(4-llm1) ) a a C.2920T T p.R98W W 2 2 1 1 NALDD (6-10y]), IRD (12y)] a,b b Mutationss on same allele c.34_35insC C p.L12fsX102 2 1 1 ZS(3w') ) a a c.668_814del2 2 p.G223__ P271del 1 1 ZS(3w') ) a a 11 age at death or last follow-up, 2only mutation cDNA known, a82, b7 bilitiess to give a prognosis for patients. Finally, it will provide an additional reliable diagnosticc platform for the prenatal diagnosis of PBD cases.

References s

1.. Gould S.J., Raymond G.V. and Valle D. (2001) The peroxisome biogenesis disorders. In: Scriver C.R., Beaudett A.L., Valle D. and Sly W.S. (eds.) The metabolic and molecular bases of inherited disease. McGraw-Hill,, New York, 3181-3217. 2.. Kelley R.I., Datta N.S., Dobyns W.B., Hajra A.K., Moser A.B., Noetzel M.J., Zackai E.H. and Moser H.W. (1986)) Neonatal adrenoleukodystrophy: new cases, biochemical studies, and differentiation from Zellwegerr and related peroxisomal polydystrophy syndromes. Am.]Med.Genet. 23: 869-901. 3.. Poll-The B.T., Saudubray J.M., Ogier H.A., Odievre M., Scotto J.M., Monnens L., Govaerts L.C., Roels F., Cornellss A. and Schutgens R.B. (1987) Infantile Refsum disease: an inherited peroxisomal disorder. Comparisonn with Zellweger syndrome and neonatal adrenoleukodystrophy. Eur.].Pediatr. 146: 477-483. 4.. Barth P.G., Gootjes J., Bode H., Vreken P., Majoie C.B. and Wanders R.J. (2001) Late onset white matter diseasee in peroxisome biogenesis disorder. Neurology 57: 1949-1955. 5.. Gould S.J. and Valle D. (2000) Peroxisome biogenesis disorders: genetics and cell biology. Trends Genet. 16:: 340-345. 6.. Dammai V. and Subramani S. (2001) The human peroxisomal targeting signal receptor, Pex5p, is translocatedd into the peroxisomal matrix and recycled to the cytosol. Cell. 105:187-196. 7.. Matsumoto N., Tamura S. and Fujiki Y. (2003) The pathogenic peroxin Pex26p recruits the Pexlp-Pex6p AAAA ATPase complexes to peroxisomes. Nat.Cell Biol. 5: 454-460. 8.. Erdmann R. and Blobel G. (1995) Giant peroxisomes in oleic acid-induced Saccharomyces cerevisiae lackingg the peroxisomal membrane protein Pmp27p. j.Cell Biol. 128: 509-523. 9.. Li X., Baumgart E., Morrell J.C., Jimenez-Sanchez G., Valle D. and Gould SJ. (2002) PEX11 beta deficiencyy is lethal and impairs neuronal migration but does not abrogate peroxisome function. Mol.Cell Biol.Biol. 22: 4358-4365. 10.. Wanders RJ, Barth PG, Schutgens RB and Heymans HS (1996) Peroxisomal disorders: Post- and prenatal diagnosiss based on a new classification with flowcharts. International pediatrics 11: 202-214. 11.. Brul S., Westerveld A., Strijland A., Wanders RJ., Schram A.W., Heymans H.S., Schutgens R.B., van den B.H.. and Tager J.M. (1988) Genetic heterogeneity in the cerebrohepatorenal (Zellweger) syndrome and otherr inherited disorders with a generalized impairment of peroxisomal functions. A study using complementationn analysis. J.CHn.lnvest 81:1710-1715. 12.. Dodt G., Braverman N., Wong C, Moser A., Moser H.W., Watkins P., Valle D. and Gould S.J. (1995) Mutationss in the PTS1 receptor gene, PXR1, define complementation group 2 of the peroxisome biogenesiss disorders. Nat.Genet. 9: 115-125. 13.. Shimozawa N., Tsukamoto T., Suzuki Y., Orii T., Shirayoshi Y., Mori T. and Fujiki Y. (1992) A human genee responsible for Zellweger syndrome that affects peroxisome assembly. Science 255:1132-1134. 14.. Tamura S., Matsumoto N., Imamura A., Shimozawa N„ Suzuki Y., Kondo N. and Fujiki Y. (2001) Phenotype-genotypee relationships in peroxisome biogenesis disorders of PEX1-defective

104 4 Mutationall spectrum of PBDs

complementationn group 1 are defined by Pexlp-Pex6p interaction. Biochem.J. 357: 417-426. 15.. Walter C, Gootjes J., Mooijer P.A., Portsteffen H., Klein C, Waterham H.R., Barth P.G., Epplen J.T., Kunauu W.H., Wanders R.J. and Dodt G. (2001) Disorders of peroxisome biogenesis due to mutations in PEX1:: phenotypes and PEX1 protein levels. Am.].Hum.Genet. 69: 35-48. 16.. Maxwell M.A., Allen T., Solly P.B., Svingen T., Paton B.C. and Crane D.I. (2002) Novel PEX1 mutations andd genotype-phenotype correlations in Australasian peroxisome biogenesis disorder patients. HumMutat.HumMutat. 20: 342-351. 17.. Portsteffen H., Beyer A., Becker E., Epplen C, Pawlak A., Kunau W.H. and Dodt G. (1997) Human PEX1 iss mutated in complementation group 1 of the peroxisome biogenesis disorders. Nat.Genet. 17:449-452. 18.. Reuber B.E., Germain-Lee E., Collins C.S., Morrell J.C., Ameritunga R., Moser H.W., Valle D. and Gould S.J.. (1997) Mutations in PEX1 are the most common cause of peroxisome biogenesis disorders. Nat.Genet. 17:: 445-448. 19.. Tamura S., Okumoto K., Toyama R., Shimozawa N., Tsukamoto T., Suzuki Y., Osumi T., Kondo N. and Fujikii Y, (1998) Human PEX1 cloned by functional complementation on a CHO cell mutant is responsiblee for peroxisome-deficient Zellweger syndrome of complementation group I. Pwc.Natl.Acad.Sci.U.SAPwc.Natl.Acad.Sci.U.SA 95: 4350-4355. 20.. Gartner J., Preuss N., Brosius U. and Biermanns M. (1999) Mutations in PEX1 in peroxisome biogenesis disorders:: G843D and a mild clinical phenotype. J.Inherit.Metab Dis. 22: 311-313. 21.. Maxwell M.A., Nelson P.V., Chin S.J., Paton B.C., Carey W.F. and Crane D.I. (1999) A common PEX1 frameshiftt mutation in patients with disorders of peroxisome biogenesis correlates with the severe Zellwegerr syndrome phenotype. Hum.Genet. 105: 38-44. 22.. Preuss N., Brosius U., Biermanns M., Muntau A.C., Conzelmann E. and Gartner J. (2002) PEX1 mutations inn complementation group 1 of Zellweger spectrum patients correlate with severity of disease. Pediatr.Res.Pediatr.Res. 51: 706-714. 23.. Collins C.S. and Gould S.J. (1999) Identification of a common PEX1 mutation in Zellweger syndrome. HumMutat.HumMutat. 14: 45-53. 24.. Preuss N. and Gartner J. (2001) Two polymorphic mutations (c2331A>C and IVSll+142insAGAAATTTTAAGTCTT)) in the human peroxin 1 gene (PEX1). HumMutat. 17: 353. 25.. Geisbrecht B.V., Collins C.S., Reuber B.E. and Gould S.J. (1998) Disruption of a PEX1-PEX6 interaction is thee most common cause of the neurologic disorders Zellweger syndrome, neonatal adrenoleukodystrophy,, and infantile Refsum disease. Proc.Natl.Acad.Sci.U.S.A 95: 8630-8635. 26.. Imamura A., Tamura S., Shimozawa N., Suzuki Y., Zhang Z., Tsukamoto T., Orii T., Kondo N., Osumi T, andd Fujiki Y. (1998) Temperature-sensitive mutation in PEX1 moderates the phenotypes of peroxisome deficiencyy disorders. Hum.Mol.Genet. 7: 2089-2094. 27.. Biermanns M. and Gartner J. (2000) Genomic organization and characterization of human PEX2 encodingg a 35- kDa peroxisomal membrane protein. Biochem.Biophys.Res.Commun. 273: 985-990. 28.. Harano T., Shimizu N., Otera H. and Fujiki Y. (1999) Transmembrane topology of the peroxin, Pex2p, an essentiall component for the peroxisome assembly. J.Biochem. 125:1168-1174. 29.. Imamura A., Tsukamoto T., Shimozawa N., Suzuki Y., Zhang Z., Imanaka T., Fujiki Y., Orii T., Kondo N. andd Osumi T. (1998) Temperature-sensitive phenotypes of peroxisome-assembly processes represent the milderr forms of human peroxisome-biogenesis disorders. Am.].Hum.Genet. 62:1539-1543. 30.. Shimozawa N., Suzuki Y„ Orii T., Moser A., Moser H.W. and Wanders R.J. (1993) Standardization of complementationn grouping of peroxisome-deficient disorders and the second Zellweger patient with peroxisomall assembly factor-1 (PAF-1) defect. Am.].Hum.Genet. 52: 843-844. 31.. Gootjes J., Elpeleg O., Eyskens F and Mandel (2003) Novel mutations in the PEX2 gene of four unrelated patientss with a peroxisome biogenesis disorder. Pediatr.Res. in press. 32.. Shimozawa N., Zhang Z., Imamura A., Suzuki Y., Fujiki Y., Tsukamoto T., Osumi T., Aubourg P., Wanderss R.J. and Kondo N. (2000) Molecular mechanism of detectable catalase-containing particles, peroxisomes,, in fibroblasts from a PEX2-defective patient. Biochem.Biophys.Res.Commun. 268: 31-35. 33.. Shimozawa N., Suzuki Y., Tomatsu S., Nakamura H., Kono T., Takada H., Tsukamoto T., Fujiki Y., Orii T.. and Kondo N. (1998) A novel mutation, R125X in peroxisome assembly factor-1 responsible for Zellwegerr syndrome. HumMutat. Suppl 1: S134-S136. 34.. Shimozawa N., Imamura A., Zhang Z., Suzuki Y., Orii T., Tsukamoto T., Osumi T., Fujiki Y., Wanders R.J.,, Besley G. and Kondo N. (1999) Defective PEX gene products correlate with the protein import, biochemicall abnormalities, and phenotypic heterogeneity in peroxisome biogenesis disorders. J.Med.Genet.J.Med.Genet. 36: 779-781. 35.. Gootjes J., Schmohl F., Waterham H.R. and Wanders RJ. (2003) Novel mutations in the PEX12 gene of patientss with a peroxisome biogenesis disorder. Eur.J.Hum.Genet. in press. 105 5 Chapterr 8

36.. Kammerer S., Holzinger A., Welsch U. and Roscher A.A. (1998) Cloning and characterization of the gene encodingg the human peroxisomal assembly protein Pex3p. FEBS Lett. 429: 53-60. 37.. Shimozawa N., Suzuki Y., Zhang Z., Imamura A., Ghaedi K., Fujiki Y. and Kondo N. (2000) Identificationn of PEX3 as the gene mutated in a Zellweger syndrome patient lacking peroxisomal remnantt structures. Hum.Mol.Genet. 9: 1995-1999. 38.. Muntau A.C., Mayerhofer P.U., Paton B.C., Kammerer S. and Roscher A.A. (2000) Defective peroxisome membranee synthesis due to mutations in human PEX3 causes Zellweger syndrome, complementation groupp G. Am.J.Hum.Genet. 67: 967-975. 39.. Ghaedi K., Honsho M, Shimozawa N., Suzuki Y., Kondo N. and Fujiki Y. (2000) PEX3 is the causal gene responsiblee for peroxisome membrane assembly-defective Zellweger syndrome of complementation groupp G. Am.J.Hum.Genet. 67: 976-981. 40.. South ST., Sacksteder K.A., Li X., Liu Y. and Gould S.J. (2000) Inhibitors of COPI and COPII do not block PEX3-mediatedd peroxisome synthesis. J.Cell Biol. 149: 1345-1360. 41.. Wiemer E.A., Nuttley W.M., Bertolaet B.L., Li X., Francke U., Wheelock M.J., Anne U.K., Johnson K.R. andd Subramani S. (1995) Human peroxisomal targeting signal-1 receptor restores peroxisomal protein importt in cells from patients with fatal peroxisomal disorders. j.CeU Biol. 130: 51-65. 42.. Marynen P., Fransen M., Raeymaekers P., Mannaerts G.P. and Van Veldhoven P.P. (1995) The gene for thee peroxisomal targeting signal import receptor (PXR1) is located on human chromosome 12pl3, flankedflanked by TPI1 and D12S1089. Genomics 30: 366-368. 43.. Braverman N., Dodt Gv Gould S.J. and Valle D. (1998) An isoform of pex5p, the human PTS1 receptor, is requiredd for the import of PTS2 proteins into peroxisomes. Hum.Mol.Genet. 7:1195-1205. 44.. Brocard C, Kragler F., Simon M.M., Schuster T. and Hartig A. (1994) The tetratricopeptide repeat- domainn of the PAS10 protein of Saccharomyces cerevisiae is essential for binding the peroxisomal targetingg signal-SKL. Biochem.Biophys.Res.Commun. 204: 1016-1022. 45.. Otera H., Setoguchi K., Hamasaki M., Kumashiro T., Shimizu N. and Fujiki Y. (2002) Peroxisomal targetingg signal receptor Pex5p interacts with cargoes and import machinery components in a spatiotemporallyy differentiated manner: conserved Pex5p WXXXF/Y motifs are critical for matrix protein import.. Mol.Cell Biol. 22: 1639-1655. 46.. Saidowsky J., Dodt G., Kirchberg K., Wegner A., Nastainczyk W., Kunau W.H. and Schliebs W. (2001) Thee di-aromatic pentapeptide repeats of the human peroxisome import receptor PEX5 are separate high affinityy binding sites for the peroxisomal membrane protein PEX14. J.Biol.Chem. 276: 34524-34529. 47.. Shimozawa N., Zhang Z., Suzuki Y., Imamura A., Tsukamoto T., Osumi T., Fujiki Y., Orii T., Barth P.G., Wanderss R.J. and Kondo N. (1999) Functional heterogeneity of C-terminal peroxisome targeting signal 1 inn PEX5-defective patients. Biochem.Biophys.Res.Commun. 262: 504-508. 48.. Chang C.C., Warren D.S., Sacksteder K.A. and Gould S.J. (1999) PEX12 interacts with PEX5 and PEX10 andd acts downstream of receptor docking in peroxisomal matrix protein import. J.Cell Biol. 147: 761-774. 49.. Gatto G.J., Jr., Geisbrecht B.V., Gould S.J. and Berg J.M. (2000) A proposed model for the PEX5- peroxisomall targeting signal-1 recognition complex. Proteins 38: 241-246. 50.. Fukuda S., Shimozawa N., Suzuki Y., Zhang Z., Tomatsu S., Tsukamoto T., Hashiguchi N., Osumi T., Masunoo M, Imaizumi K., Kuroki Y., Fujiki Y., Orii T. and Kondo N. (1996) Human peroxisome assembly factor-22 (PAF-2): a gene responsible for group C peroxisome biogenesis disorder in humans. Am.J.Hum.Genet.Am.J.Hum.Genet. 59:1210-1220. 51.. Imamura A., Shimozawa N., Suzuki Y., Zhang Z., Tsukamoto T., Fujiki Y., Orii T., Osumi T., Wanders R.J.. and Kondo N. (2000) Temperature-sensitive mutation of PEX6 in peroxisome biogenesis disorders in complementationn group C (CG-C): comparative study of PEX6 and PEX1. Pediatr.Res. 48: 541-545. 52.. Zhang Z., Suzuki Y., Shimozawa N., Fukuda S., Imamura A., Tsukamoto T., Osumi T., Fujiki Y., Orii T., Wanderss R.J., Barth P.G., Moser H.W., Paton B.C, Besley G.T. and Kondo N. (1999) Genomic structure andd identification of 11 novel mutations of the PEX6 (peroxisome assembly factor-2) gene in patients withh peroxisome biogenesis disorders. HumMutat. 13: 487-496. 53.. Matsumoto N., Tamura S., Moser A., Moser H.W., Braverman N., Suzuki Y., Shimozawa N., Kondo N. andd Fujiki Y. (2001) The peroxin Pex6p gene is impaired in peroxisomal biogenesis disorders of complementationn group 6.}.Hum.Genet. 46:273-277. 54.. Raas-Rothschild A., Wanders R.J., Mooijer P.A., Gootjes J., Waterham H.R., Gutman A., Suzuki Y., Shimozawaa N., Kondo N., Eshel G., Espeel M., Roels F. and Korman S.H. (2002) A PEX6-defecrive peroxisomall biogenesis disorder with severe phenotype in an infant, versus mild phenotype resembling Usherr syndrome in the affected parents. Atn.lHum.Genet. 70:1062-1068. 55.. Yahraus T., Braverman N., Dodt G., Kalish J.E., Morrell J.C., Moser H.W., Valle D. and Gould S.J. (1996) Thee peroxisome biogenesis disorder group 4 gene, PXAAA1, encodes a cytoplasmic ATPase required for 106 6 Mutationall spectrum of PBDs

stabilityy of the PTS1 receptor. EMBO ƒ. 15: 2914-2923. 56.. Motley A.M., Brites P., Gerez L., Hogenhout E., Haasjes J., Benne R., Tabak H.F., Wanders R.J. and Waterhamm H.R. (2002) Mutational spectrum in the PEX7 gene and functional analysis of mutant alleles in 788 patients with rhizomelic chondrodysplasia punctata type 1. Am.].Hum.Genet. 70: 612-624. 57.. Braverman N., Chen L., Lin P., Obie C, Steel G., Douglas P., Chakraborty P.K., Clarke J.T., Boneh A., Moserr A., Moser H. and Valle D. (2002) Mutation analysis of PEX7 in 60 probands with rhizomelic chondrodysplasiaa punctata and functional correlations of genotype with phenotype. Hum.Mutat. 20: 284- 297. . 58.. Warren D.S., Wolfe B.D. and Gould S.J. (2000) Phenotype-genotype relationships in PEXlO-deficient peroxisomee biogenesis disorder patients. Hum.Mutat. 15: 509-521. 59.. Warren D.S., Morrell J.C., Moser H.W., Valle D. and Gould S.J. (1998) Identification of PEX10, the gene defectivee in complementation group 7 of the peroxisome-biogenesis disorders. Am.J.Hum.Genet. 63: 347- 359. . 60.. Okumoto K., Itoh R., Shimozawa N., Suzuki Yv Tamura S., Kondo N. and Fujiki Y. (1998) Mutations in PEX100 is the cause of Zellweger peroxisome deficiency syndrome of complementation group B. Hum.Mol.Genet.Hum.Mol.Genet. 7: 1399-1405. 61.. Shimozawa N., Nagase T., Takemoto Y., Ohura T., Suzuki Y. and Kondo N. (2003) Genetic heterogeneity off peroxisome biogenesis disorders among Japanese patients: Evidence for a founder haplotype for the mostt common PEX10 gene mutation. Am.J.Med.Genet. 120A: 40-43. 62.. Chang C.C., Lee W.H., Moser H., Valle D. and Gould S.J. (1997) Isolation of the human PEX12 gene, mutatedd in group 3 of the peroxisome biogenesis disorders. Nat.Genet. 15: 385-388. 63.. Kalish J.E., Keller G.A., Morrell J.C, Mihalik S.J., Smith B., Cregg J.M. and Gould S.J. (1996) Characterizationn of a novel component of the peroxisomal protein import apparatus using fluorescent peroxisomall proteins. EMBO.]. 15: 3275-3285. 64.. Okumoto K. and Fujiki Y. (1997) PEX12 encodes an integral membrane protein of peroxisomes [letter]. Nat.Genet.Nat.Genet. 17: 265-266. 65.. Chang C.C. and Gould S.J. (1998) Phenotype-genotype relationships in complementation group 3 of the peroxisome-biogenesiss disorders. Am.J.Hum.Genet. 63:1294-1306. 66.. Okumoto Kv Shimozawa N., Kawai A., Tamura S., Tsukamoto T., Osumi T., Moser H., Wanders R.J., Suzukii Y., Kondo N. and Fujiki Y. (1998) PEX12, the pathogenic gene of group III Zellweger syndrome: cDNAA cloning by functional complementation on a CHO cell mutant, patient analysis, and characterizationn of PEX12p. Mol.Cell Biol. 18: 4324-4336. 67.. Bjorkman J., Stetten G., Moore C.S., Gould S.J. and Crane D.I. (1998) Genomic structure of PEX13, a candidatee peroxisome biogenesis disorder gene. Genomic» 54: 521-528. 68.. Gould S.J., Kalish J.E., Morrell J.C, Bjorkman J., Urquhart A.J. and Crane D.I. (1996) Pexl3p is an SH3 proteinn of the peroxisome membrane and a docking factor for the predominantly cytoplasmic PTsl receptor.. J.Cell Biol. 135: 85-95. 69.. Barnett P., Bottger G., Klein A.T., Tabak H.F. and Distel B. (2000) The peroxisomal membrane protein Pexl3pp shows a novel mode of SH3 interaction. EMBO J. 19: 6382-6391. 70.. Albertini M., Rehling P., Erdmann R., Girzalsky W., Kiel J.A., Veenhuis M. and Kunau W.H. (1997) Pexl4p,, a peroxisomal membrane protein binding both receptors of the two PTS-dependent import pathways.. Cell. 89: 83-92. 71.. Girzalsky W., Rehling P., Stein K., Kipper J., Blank L., Kunau W.H. and Erdmann R. (1999) Involvement off Pexl3p in Pexl4p localization and peroxisomal targeting signal 2-dependent protein import into peroxisomes.. J.Cell Biol. 144: 1151-1162. 72.. Shimozawa N., Suzuki Y., Zhang Z., Imamura A., Toyama R., Mukai S., Fujiki Y., Tsukamoto T., Osumi T.,, Orii T-, Wanders R.J. and Kondo N. (1999) Nonsense and temperature-sensitive mutations in PEX13 aree the cause of complementation group H of peroxisome biogenesis disorders. Hum.Mol.Genet. 8: 1077- 1083. . 73.. Liu Y., Bjorkman J., Urquhart A., Wanders R.J., Crane D.I. and Gould SJ. (1999) PEX13 is mutated in complementationn group 13 of the peroxisome-biogenesis disorders. Am.J.Hum.Genet. 65: 621-634. 74.. Shimozawa N., Nagase T„ Takemoto Y., Suzuki Y., Fujiki Y., Wanders RJ. and Kondo N. (2002) A novel aberrantt splicing mutation of the PEX16 gene in two patients with Zellweger syndrome. Biochem.Biophys.Res.Commun.Biochem.Biophys.Res.Commun. 292:109-112. 75.. South S.T. and Gould S.J. (1999) Peroxisome synthesis in the absence of preexisting peroxisomes. J.Cell Biol.Biol. 144: 255-266. 76.. Honsho M., Tamura S., Shimozawa N., Suzuki Y., Kondo N. and Fujiki Y. (1998) Mutation in PEX16 is causall in the peroxisome-deficient Zellweger syndrome of complementation group D. Am.J.Hum.Genet. 107 7 Chapterr 8

63:: 1622-1630. 77.77. Fransen M., Wylin T., Brees C, Mannaerts G.P. and Van Veldhoven P.P. (2001) Human pexl9p binds peroxisomall integral membrane proteins at regions distinct from their sorting sequences. Mol.Cell Biol. 21:: 4413-4424.

78.. Kammerer Sv Arnold N., Gutensohn W., Mewes H.W., Kunau W.H., Hofler Gv Roscher A.A. and Braun A.. (1997) Genomic organization and molecular characterization of a gene encoding HsPXF, a human peroxisomall farnesylated protein. Genomics 45: 200-210. 79.. Mayerhofer P.U., Kattenfeld T., Roscher A.A. and Muntau A.C. (2002) Two splice variants of human PEX199 exhibit distinct functions in peroxisomal assembly. Bwchem.Biophys.Res.Commun. 291: 1180-1186. 80.. Sacksteder K.A., Jones J.M., South ST., Li X., Liu Y' and Gould SJ. (2000) PEX19 binds multiple peroxisomall membrane proteins, is predominantly cytoplasmic, and is required for peroxisome membranee synthesis. j.Cell Biol. 148: 931-944. 81.. Matsuzono Y., Kinoshita N., Tamura S., Shimozawa N., Hamasaki M., Ghaedi K., Wanders R.J., Suzuki Y.,, Kondo N. and Fujiki Y. (1999) Human PEX19: cDNA cloning by functional complementation, mutationn analysis in a patient with Zellweger syndrome, and potential role in peroxisomal membrane assembly.. Pwc.Natl.Acad.Sci.U.S.A 96: 2116-2121. 82.. Matsumoto N., Tamura S., Furuki S., Miyata N., Moser A., Shimozawa N., Moser H.W., Suzuki Y., Kondoo N. and Fujiki Y. (2003) Mutations in novel peroxin gene PEX26 that cause peroxisome-biogenesis disorderss of complementation group 8 provide a genotype-phenotype correlation. Am.J.Hum.Genet. 73: 233-246. .

108 8 Summary y

Summary y Summary y

Thee peroxisome biogenesis disorders (PBDs), which include Zellweger syndrome (ZS), neonatall adrenoleukodystrophy (NALD) and infantile Refsum disease (IRD), represent a spectrumm of disease severity with ZS being the most, and IRD the least severe disorder. Commonn to all three PBDs are liver disease, variable neurodevelopmental delay, retinopathyy and perceptive deafness. Patients with ZS are severely hypotonic from birth andd die before one year of age. Patients with NALD experience neonatal onset of hypotoniaa and seizures and suffer from progressive white matter disease, dying usually in latee infancy. Patients with IRD may survive beyond infancy and some may even reach adulthood. . Thee absence of functional peroxisomes in patients with a PBD leads to a number of biochemicall abnormalities among which 1) impaired synthesis of plasmalogens, due to a deficiencyy of the two enzymes dihydroxyacetonephosphate acyltransferase (DHAPAT) andd alkyl-dihydroxyacetonephosphate synthase (alkyl-DHAP-synthase), 2) impaired peroxisomall fatty acid (3-oxidation, leading to the accumulation of very-long- chain fatty acidss (VLCFAs), notably C26:0, the branched-chain fatty acid pristanic acid and the bile acidd intermediates di- and trihydroxycholestanoic acid (DHCA and THCA), and 3) impairedd phytanic acid a-oxidation. Thee PBDs are caused by genetic defects in PEX genes encoding proteins called peroxins,, which are required for the biogenesis of peroxisomes and function in the assemblyy of the peroxisomal membrane or in the import of enzymes into the peroxisome. Afterr synthesis on free polyribosomes, peroxisomal matrix proteins carrying either a carboxy-terminall peroxisomal targeting sequence 1 (PTS1) or a cleavable amino-terminal PTS22 signal are translocated across the peroxisomal membrane. A defect in one of the peroxinss of the peroxisomal import machinery leads to failure of protein import via the PTS1-- and/or PTS2-dependent import pathway and, consequently, to functional peroxisomee deficiency. Cell fusion complementation studies using patient fibroblasts revealedd the existence of at least 11 distinct genetic groups of which currently all correspondingg PEX genes have been identified. Most complementation groups are associatedd with more than one clinical phenotype.

Inn this thesis some aspects of the peroxisome biogenesis and the PBDs have been studied. Chapterr one reviews the current knowledge on peroxisome biogenesis, peroxisomal functions,, the PBDs and their diagnosis, and therapy. Because of the marked genetic heterogeneityy in PBDs, caused by the many complementation groups and the presence of manyy unique mutations among patients, genotype-phenotype studies are limited in giving aa prognosis for new PBD patients. Therefore, in chapter two a different approach was used too predict the life expectancy of the patients: the effects of the defective genes on peroxisomee function were examined, rather that the mutations themselves, by conducting aa search for the biochemical parameters in fibroblasts, which would be best in predicting thee severity of patients. DHAPAT activity and C26:0 p-oxidation turned out to be the best markerss in predicting life expectancy of PBD patients. Combination of both markers gave ann even better prediction. In chapter three and four, novel mutations in the PEX2 and PEX12PEX12 genes of PBD patients were identified. Both PEX2 and PEX12 contain a C-terminal zinc-bindingg domain, considered to be important for their interaction with other proteins

110 0 Summary y off the peroxisomal protein import machinery. The importance of the zinc-binding domain inn PEX12 was underlined by the mutations found in our patients. However, patients lackingg the zinc-binding domain of PEX2 displayed a mild phenotype, whereas a patient withh a specific mutation within the domain was affected with the severe ZS phenotype. Thiss makes the importance of this domain in PEX2 unclear. Chapter five describes eight PBDD patients with a very unusual biochemical phenotype, characterized by abnormal peroxisomall plasma metabolites, but normal to very mildly abnormal parameters in culturedd skin fibroblasts, including a mosaic catalase immunofluorescence pattern, which soo far made complementation analysis impossible. We developed a novel complementationn technique in which fibroblasts are grown at 40°C rather than 37°C, whichh exacerbated the defect in peroxisome biogenesis. Using this method, we assigned alll patients to CG3, and subsequently identified a single homozygous S320F mutation in theirr PEX12 gene. We investigated various biochemical parameters in fibroblasts of these patientss at 30°C, 37°C and 40°C and found a temperature-dependent behavior for all parameters.. When compared to fibroblasts from patients homozygous for the G843D mutationn in PEX1, well known for its mild biochemical and clinical phenotype, our patientss displayed a milder biochemical temperature-sensitive phenotype for all parameterss tested. Nevertheless, their clinical phenotype was more severe, suggesting the defectt to be organ specific. In chapter six the reinvestigation of a unique patient is described,, who was reported with a presumed deficiency in THCA-CoA oxidase, but insteadd was found to be suffering from a mild PBD, caused by two mutations in the PEX12 gene.. The absence of clear peroxisomal abnormalities in the patient's cultured skin fibroblasts,, including a normal peroxisomal localization of catalase, implied that even when,, upon routine diagnostics, all peroxisomal functions in fibroblasts are normal, a PBD cannott be fully excluded and additional studies may be required. Chapter seven describes aa rapid, non-invasive alternative technique to determine the presence of peroxisomes in patientt cells: immunofluorescence microscopy analysis in lymphocytes, which can be isolatedd from the same blood samples as used for metabolite analyses. In some mild cases, immunofluorescencee microscopy results in lymphocytes were less ambiguous than in culturedd skin fibroblasts, which will aid in a more clear and firm diagnosis. In chapter eight,, we report all mutations in the different PEX genes that have been determined in our laboratoryy so far, combined with those reported in literature, to present an overview of the mutationall spectrum of the PBDs.

Ill l

Samenvatting g

Samenvattingg voor iedereen Samenvattingg voor iedereen

Eenn cel bestaat uit verschillende compartimenten (organellen), zoals bijvoorbeeld de kern enn de mitochondrieën (figuur la). Elk organel wordt door een membraan omgeven. Doordatt de meeste stoffen niet zomaar door een membraan heen kunnen gaan, worden stoffenn in een organel van de andere organellen gescheiden. Door de diverse chemische processenn in de cel onder te brengen in verschillende organellen kan de cel de aanmaak en afbraakk van stoffen geordend laten verlopen. Elk organel heeft dan ook een aantal specifiekee functies. In dit proefschrift gaat het over het organel genaamd 'peroxisoom'. Hett peroxisoom is een organel dat je je kunt voorstellen als een klein bolletje in de cel. Elke cell bevat een paar honderd van deze peroxisomen. Binnenin het peroxisoom vindt een aantall processen plaats, dat heel belangrijk is voor het goed functioneren van de cel en daardoorr dus ook voor het functioneren van het menselijk lichaam.

aa cel b peroxisoom Figuurr 1 Opbouw van de cel (a) en van het peroxisoom (b).

Ditt proefschrift gaat over patiënten die geen peroxisomen hebben. Deze patiënten lijden aann het zogenaamde Zellweger syndroom, of aan twee minder ernstige vormen van deze ziektee die 'neonatale adrenoleukodystrofie' en 'infantiele Refsum ziekte' heten. Omdat dezee drie ziekten dezelfde oorzaak hebben en het verwarrend was dat de namen door elkaarr heen gebruikt werden, gebruiken we tegenwoordig liever bij alle patiënten de term 'peroxisoomm biogenese defect', wat aangeeft dat er bij deze patiënten iets mis is met de aanmaakk (biogenese) van peroxisomen. Doordat de patiënten geen peroxisomen hebben, kunnenn ook de processen die normaal in het peroxisoom zouden plaatsvinden niet goed verlopen.. Daardoor ontstaat in het lichaam van deze patiënten een tekort aan stoffen die normaall in het peroxisoom gemaakt worden en een ophoping van stoffen die normaal in hett peroxisoom afgebroken worden. Hierdoor worden de patiënten ziek. Patiënten met eenn peroxisoom biogenese defect hebben een aantal uiterlijke kenmerken zoals een hoog voorhoofd,, laag geplaatste oren, een brede neusbrug en een vergrote afstand tussen hun neuss en mond. Daarnaast hebben ze last van spierzwakte en hebben ze problemen met hunn lever en nieren. Verder hebben ze oog- en oorafwijkigen waardoor ze blind en doof kunnenn worden. Bovendien vertonen ze een achterstand in verstandelijke ontwikkeling. Patientjess met een ernstig peroxisoom biogenese defect zijn vaak zo ziek dat ze al binnen

114 4 Samenvattingg voor iedereen eenn paar weken overlijden. Door de problemen met hun lever hebben ze een gelig uiterlijk, enn als je ze optilt zijn ze helemaal slap. Maar er zijn ook patiënten die veel milder aangedaann zijn en wel ouder dan twintig jaar worden. Zij gaan als kind soms zelfs naar eenn gewone basisschool. De peroxisoom biogenese defecten komen voor bij één op de 50.0000 kinderen. Waaromm hebben deze patiënten geen peroxisomen? Wanneer een cel deelt, worden ook dee peroxisomen verdeeld over de twee nieuw gevormde cellen. Vervolgens moeten er dan weerr peroxisomen bijgemaakt worden, anders neemt het aantal peroxisomen natuurlijk steedss verder af bij verdere celdelingen. Deze aanmaak van nieuwe peroxisomen wordt de peroxisoomm biogenese genoemd. Net zoals cellen, delen ook de peroxisomen. Voordat het peroxisoomm kan delen moet hij eerst groter gemaakt worden door de toevoeging van nieuwee membranen en membraanbestanddelen. Ook moeten de bestanddelen binnenin hett peroxisoom worden aangevuld. In het peroxisoom zitten namelijk allemaal 'enzymen' diee helpen bij de chemische processen die in het peroxisoom plaatsvinden. Deze enzymen wordenn buiten het peroxisoom gemaakt, maar kunnen niet zomaar door het membraan hett peroxisoom in. Ze moeten daarom 'geïmporteerd' worden (figuur lb). Je kunt je voorstellenn dat dit allemaal niet vanzelf gaat. Bij het vergroten van de membranen en de importt van de enzymen zijn dan ook twee 'machines' nodig: de 'membraan-machine' en dee 'enzym-import-machine'. Beide machines bestaan uit verschillende onderdelen: verschillendee eiwitten die TEX eiwitten' worden genoemd. Alle onderdelen zijn genummerd:: PEX1 tot en met PEX32. Wanneer er nu een fout zit in een van de machine- onderdelenn (vergelijk met een kapot tandwiel) kun je je voorstellen dat daardoor één van beidee machines niet meer werkt. Hierdoor worden dus kapotte membranen gemaakt of ontstaann er peroxisomen zonder enzymen erin. In beide gevallen kunnen de chemische processenn in het peroxisoom niet meer goed verlopen, ontstaan er tekorten en ophopingen vann stoffen en wordt de patiënt ziek. Eenn fout in een machine-onderdeel/eiwit wordt veroorzaakt door een fout in de bouwtekeningg van dat onderdeel: het gen. Voor elk eiwit zijn er twee genen. Wanneer er inn één van beide genen een fout zit is er niets aan de hand; er kan nog steeds een goed eiwitt gevormd worden en de import- of membraan-machine kan nog steeds z'n werk doen.. Maar wanneer er in beide bouwtekeningen een fout zit, kan er geen goed werkend eiwitt gemaakt worden en word je ziek. Kinderen erven van beide ouders één kopie. Wanneerr beide ouders één goed en één defect gen hebben, hebben ze een kans van één op vierr dat hun kind twee defecte genen erft en dus ziek wordt. Wanneerr een arts denkt dat een patientje lijdt aan een peroxisoom biogenese defect, stuurtt hij bloed van de patiënt op naar ons laboratorium. Wij onderzoeken dan of de verwachtee ophopingen en tekorten van peroxisomale stoffen in het bloed te vinden zijn. Wanneerr dat zo is, vragen we de arts om een klein stukje huid van de patiënt af te nemen (eenn huidbiopt). In ons laboratorium laten we deze huidcellen dan groeien en vermenigvuldigenn in zogenaamde kweekflessen: we kweken de cellen. Zo kunnen we met maarr een heel klein stukje huid toch een heleboel experimenten doen. In ons laboratorium doenn we in de gekweekte huidcellen zes testen om te kijken of de verschillende processen diee normaal in het peroxisoom plaatsvinden, gestoord zijn. Bovendien kijken we met een bepaaldee microscopie techniek (immunofluorescentie) of de peroxisomen wel of niet aanwezigg zijn. In figuur 2 is te zien hoe dat er uit ziet in huidcellen van een gezonde persoonn en van een patiënt met een peroxisoom biogenese defect. In de cellen van

115 5 gezondee personen zijn allemaal stipjes te zien (de peroxisomen), in de cellen van de patiëntt zijn de stippen afwezig. Wanneer de testen zowel in bloed als in huidcellen negatieff zijn en we met immunofluorescentie geen peroxisomen kunnen aantonen, kunnen wee met zekerheid zeggen dat de patiënt lijdt aan een peroxisoom biogenese defect. Daarna zoekenn we uit in welk PEX gen de mutaties zitten.

Figuurr 2 Immunofluores- centiee in huidcellen van een gezondee persoon (a) en een patiëntt met een peroxisoom biogenesee defect (b).

Inn dit proefschrift beschrijf ik een aantal studies die ik de afgelopen vier jaar in samenwerkingg met anderen als onderdeel van mijn promotie-onderzoek heb uitgevoerd enn die allemaal te maken hebben met peroxisoom biogenese defecten. In hoofdstuk één geeff ik een overzicht van de huidige kennis over de peroxisoom biogenese en over de peroxisoomm biogenese defecten. Inn hoofdstuk twee beschrijf ik de nadere bestudering van de zes testen die we uitvoerenn in de gekweekte huidcellen van de patiënten. Naast of ze alle zes geschikt zijn omm aan te tonen of de patiënt wel of niet lijdt aan een peroxisoom biogenese defect, heb ik onderzochtt of we ze ook zouden kunnen gebruiken om te voorspellen hoe oud een patiënt zall worden en hoe ernstig ziek hij of zij zal zijn. Voor veel ouders van patiënten blijkt het namelijkk erg belangrijk te zijn dit te weten. Tot nu toe kunnen artsen dat nog niet zo goed voorspellen.. Uit de testen die wij doen komen voor alle patiënten bepaalde waardes. Bij eenn groep Nederlandse patiënten uit het verleden waar we veel over weten, hebben we gekekenn of patiënten met hele hoge (of bij andere testen hele lage) waardes ook veel snellerr zijn overleden. Voor sommige testen bleek daar geen verband tussen te bestaan, bij anderee testen wel. Twee testen kwamen als beste uit de bus en wanneer we de resultaten vann deze twee testen combineerden werd de voorspellende waarde nog hoger. Artsen kunnenn dit nu gebruiken om ouders van patiënten voor te lichten. Inn hoofdstuk drie en vier beschrijven we een nadere bestudering van twee PEX eiwitten,, te weten PEX2 en PEX12. Beide zijn onderdeel van de import-machine. We hebbenn bij een aantal patiënten, van wie we al wisten dat ze een fout in een van beide PEX eiwittenn zouden moeten hebben, onderzocht wat die fouten (mutaties) nou precies waren. Niett elke patiënt heeft namelijk dezelfde mutatie. Om dat te onderzoeken hebben we het PEX22 gen en het PEX12 gen van deze patiënten bestudeerd. Je kunt, wanneer er bij meerderee patiënten een fout zit in hetzelfde stuk van de bouwtekening van het machine- onderdeel,, concluderen dat dit stuk van het onderdeel kennelijk erg belangrijk is voor de functie.. Zo leren we meer over hoe de verschillende onderdelen precies werken. De machineonderdelenn PEX2 en PEX12 lijken een beetje op elkaar. Ze hebben allebei een bepaaldd domein (zink-bindend domein) waarvan al bekend was dat het belangrijk is voor dee binding van PEX2 en PEX12 aan andere PEX eiwitten. Wij hebben nu ontdekt dat bij 116 6 Samenvattingg voor iedereen

PEX22 dit domein toch minder belangrijk is dan bij PEX12. Bij patiënten die door een mutatiee dit domein in PEX12 misten, was de import machine namelijk helemaal defect en dee patiënten waren ernstig ziek. Bij patiënten die dit domein in PEX2 misten deed de machinee het nog een beetje, en de patiënten waren minder ernstig aangedaan. Ook kunnen wee de mutatie die we bij een patiënt vinden (genotype) vergelijken met hoe ernstig ziek de patiëntt is (fenotype). Als we later weer een patiënt vinden met dezelfde mutatie, kunnen wee voorspellen dat hij waarschijnlijk net zo ziek zal worden als die eerste patiënt. Natuurlijkk spelen hierbij meer dingen een rol, maar het geeft een goede indicatie. Inn hoofdstuk vijf beschrijven we het onderzoek van acht bijzondere patiënten. Hoewel wee in hun bloed de ophopingen en tekorten van stoffen vonden die we verwachtten, kondenn we in de gekweekte huidcellen nauwelijks afwijkingen vinden: alle processen die wee bestudeerden waren nagenoeg normaal. Bovendien vonden we wanneer we een immunofluorescentieexperimentt deden dat in sommige huidcellen géén peroxisomen aanwezigg waren en in andere wel, wat heel bijzonder is. Alle acht patiënten bleken dezelfdee mutatie in het PEX12 gen te hebben. We hebben vervolgens het effect van de temperatuurr op deze cellen onderzocht. De huidcellen worden normaal in ons laboratoriumm gekweekt bij 37°C, de lichaamstemperatuur. Wanneer we de cellen van deze patiëntenn echter bij een lagere temperatuur kweekten (30°C) vonden we weer peroxisomenn in alle cellen, maar wanneer we de huidcellen bij een hogere temperatuur kweektenn (40°C) verdwenen de peroxisomen in alle cellen. Ook waren bij 40°C alle peroxisomalee chemische processen gestoord. Dit kan belangrijk zijn voor de patiënten. Wanneerr dit in de patiënten precies hetzelfde zou gaan, kun je je voorstellen dat koorts heell slecht voor ze zou zijn, omdat ze dan nog minder peroxisomen krijgen dan ze al hebben.. Ook zou je je kunnen voorstellen dat wanneer je de lichaamstemperatuur van de patiëntenn (tijdelijk) zou kunnen verlagen, dit een gunstig effect zou kunnen hebben. Hoe wee dat in de praktijk zouden moeten doen en wat voor gevolgen dat verder zou hebben, is nogg niet bekend. Inn hoofdstuk zes beschrijf ik het onderzoek van nog een erg bijzondere patiënt. Deze patiëntt was lang geleden al onderzocht en de onderzoekers hadden toen geconcludeerd datt de patiënt geen peroxisoom biogenese defect had, maar een ziekte waarbij maar één vann de chemische processen in het peroxisoom gestoord is. Dit konden ze toen alleen nog niett helemaal bewijzen, want de testen die we nu doen bestonden toen nog niet. Nu kunnenn we dat wel en hun diagnose bleek onjuist. De patiënt bleek namelijk wel degelijk aann een peroxisoom biogenese defect te lijden en we vonden wederom mutaties in het PEX12PEX12 gen. De reden dat ze vroeger dachten dat deze patiënt geen peroxisoom biogenese defectt kon hebben was dat bij deze patiënt, net als bij de patiënten van hoofdstuk 5, geen afwijkingenn in de gekweekte huidcellen gevonden werden. Bovendien vonden we met de immunofluorescentietechniekk zelfs peroxisomen in alle cellen. Dit is nog nooit eerder beschrevenn en het is ook erg belangrijk voor de diagnose van peroxisoom biogenese defect patiëntenn in het algemeen. Wanneer we in het vervolg een patiënt vinden, bij wie we met onzee standaardtesten niets abnormaals in huidcellen kunnen vinden, kunnen we een peroxisoomm biogenese defect toch niet uitsluiten. Inn hoofdstuk zeven hebben we de ontwikkeling van een nieuwe immunofluorescentie- techniekk beschreven. Tot nu toe deden we deze techniek altijd in gekweekte huidcellen; in dee nieuwe techniek voeren we de test uit in cellen die we uit bloed van de patiënt kunnen halen.. Het is voor een patientje natuurlijk veel minder ingrijpend om wat bloed af te staan

117 7 dann om een stukje huid af te laten nemen. En bovendien kunnen de cellen uit hetzelfde bloedd worden gehaald als waarmee we de andere testen doen. Toch vindt een aantal anderee bepalingen nog wel steeds in de huidcellen plaats. Op dit moment kunnen we dus nogg niet zonder het afnemen van een huidbiopt. Bovendien kun je de huidcellen kweken enn de bloedcellen niet, waardoor je met huidcellen veel meer en veel langer testen kunt doen.. Toch zal in een aantal gevallen, wanneer geen huidcellen voorhanden zijn of wanneerr snel een uitslag vereist is, deze nieuwe methode voordelen bieden in de diagnose vann peroxisoom biogenese defect patiënten. Inn het allerlaatste hoofdstuk heb ik een overzicht gemaakt van alle mutaties in alle PEX genenn die tot nu toe in de medische literatuur zijn beschreven. Dit is handig voor wetenschapperss en artsen op de hele wereld, zodat ze een overzicht hebben wat voor effectt bepaalde mutaties hebben op de PEX eiwitten en wat deze effecten zijn op de ernst vann de ziekte bij de patiënt.

Samengevatt heb ik in dit proefschrift allereerst geprobeerd om beter te kunnen voorspellenn hoe ernstig ziek een bepaalde patiënt wordt; zowel met behulp van de testen inn huidcellen, als door verbanden te leggen tussen mutaties die we vinden bij patiënten en dee ernst van hun ziekte. Verder hebben we een diagnose gesteld bij een aantal patiënten bijj wie nog niet precies duidelijk was wat ze hadden en uit de resultaten ook conclusies getrokkenn over de behandeling van de patiënten (b.v. oppassen voor koorts) en hoe we het bestee een diagnose kunnen stellen. Tenslotte hebben we een nieuwe, minder ingrijpende testt ontwikkeld voor de diagnose van de patiënten. Hett liefst zou je natuurlijk een behandeling vinden waarmee patiënten met een peroxisoomm biogenese defect zouden kunnen genezen, maar dat is, omdat dit een erfelijke ziektee is, bijna onmogelijk. Pas wanneer gen-therapie echt toepasbaar wordt, zouden we ietss kunnen doen, hoewel dat effect beperkt wordt door het feit dat de meeste schade bij dezee patiënten al wordt aangericht voor hun geboorte. Op dit moment kunnen we echter niett veel meer doen dan kinderen de stoffen die ze te kort komen toe te dienen via medicijnenn en te zorgen dat ze de stoffen die ze ophopen niet binnen krijgen via hun voeding.. Toch hoop ik met dit promotieonderzoek een klein steentje te hebben bijgedragenn aan het beter begrijpen van de peroxisoom biogenese en de peroxisoom biogenesee defecten, waardoor we ouders en patiënten beter kunnen helpen.

118 8 Dankwoord d

Dankwoord d Dankwoord d

Hett is zover: de experimenten bedacht en uitgevoerd, de resultaten uitgewerkt, de artikelenn geschreven, de commissie akkoord en de lay-out opgemaakt. Vier jaar werk samengevatt in dit boekje. Werk dat nooit was gestart, volgehouden en succesvol gefinisht zonderr de hulp van velen:

Ronald,, na mijn 'sollicitatiegesprek' waarin jij bijna non-stop aan het woord was over de inss & outs van de peroxisomal ziekten (foto's van patientjes in plaats van je kinderen sierdenn je kamer), over het belang van het project en bovendien over de geweldige mensen vann het lab die jij om je heen had verzameld, wist ik zeker dat dit een geweldige AIO- plaatss moest zijn. En dat is ook 100% zo gebleken. Dat enthousiasme van je is er gelukkig ookk altijd gebleven (in zoverre zelfs dat ik na slechts een paar maanden op het lab te hebbenn rondgelopen werd uitgekozen om 2 presentaties te geven op het internationale SSIEM-congress in Cambridge. Jij had 3 abstracts voor me geschreven waarvan er 2 waren uitgekozenn voor een oral en 1 voor een poster. Detail hierbij was dat voor de ene presentatiee de gegevens nog verzameld moesten worden... Ik kon direct volop aan de slag!).. Bedankt voor dit enthousiasme, je begeleiding en het delen van je enorme metabole kennis! !

Hans,, de toevoeging van jou als mijn co-promotor maakte mijn begeleiding compleet. Jouww (veel meer dan) moleculair biologische kennis en je bereidheid om steeds maar weer mijnn artikelen te redigeren (van verbindingsstreepjes tot split-infinitives (met een streepje?))) hebben in grote mate bijgedragen aan dit proefschrift. Bedankt hiervoor! Terechtt ben je ook laatste auteur bij het afsluitende mutatie-hoofdstuk.

Sacha,, ook jou wil ik hier bedanken. Ons lab wordt bevolkt door groepjes: een cholesterol groepje,, een fytaanzuur groepje, een X-ALD groepje en ga zo maar. Iedereen hoorde bij eenn groepje... behalve ik. Toch voelde ik me met jou toch een beetje een groepje, eigenlijk zelfss twee: een 'hersen groepje' (laten we die maar opheffen...), en veel belangrijker, een 'onbegrepen-p-oxidatiee defect = PBD?-groepje' wat heeft geleid tot het inkorten van jouw lijstjee en een erg mooi artikel met jou als laatste auteur. Bedankt!

Watt mijn project zo bijzonder leuk maakte was het contact met de kliniek. Peter Barth en Bweee Tien Poll-The, bedankt voor al jullie klinische input in onze peroxisoom besprekingen.. Via jullie zag ik ook de patientjes waar het eigenlijk allemaal om ging en wistt ik weer precies waar ik allemaal voor bezig was. Ook Ries bedankt voor je bijdragen bijj deze besprekingen. Ook heeft jouw intermediaire rol al weer veel klinische informatie vann nieuwe patiënten opgeleverd. Hoeveel questionnaires zouden er nog binnen komen?

Sietskee en Magrita, mijn paranimfen. Met jullie aan mijn zijde durf ik het wel aan! Lievee Siets, hoewel we al 5 jaar samen studeerden, leerde ik je in Amsterdam pas echt kennen.. Jammer, want ik had al veel eerder zo'n lieve vriendin kunnen gebruiken! Bedanktt voor je steun als collega/vriendin, je vriendschap en het organiseren van al die gezelligee dingen. Zal je dagelijkse aanwezigheid missen, maar wie weet worden we ooit well weer collega's.

120 0 Dankwoord d

Lievee Magrita, hoewel ik jou nog heb moeten uitleggen wat een paranimf precies is en doet,, weet ik zeker dat je die rol prima zult vervullen. Je bent lief, belangstellend, behulpzaamm en bent bovendien in je element als je in de belangstelling staat. Precies de goedee kwaliteiten voor een paranimf.... en een topvriendin!

Wiee dit proefschrift helemaal leest zal begrijpen dat ik al dat werk niet allemaal alleen heb gedaan.. Ik heb allereerst enorm veel hulp gehad van mijn studenten. Geert, je was de eerste,, maar het was gelijk helemaal vertrouwd. Dat had er natuurlijk ook mee te maken datt we allebei uit de polder kwamen en op de zelfde middelbare school hadden gezeten. Jee hebt veel werk verzet wat onder andere mee heeft geholpen aan de totstandkoming hoofdstukk 8, we hebben veel lol gehad en je was goed in het bewaren van 'geheimen'. Josephine,, je hebt er lang op moeten wachten, maar zoals je ziet is er toch eindelijk een artikell van gemaakt. Het is opgestuurd, dus nog even geduld. Bedankt voor het onuitputtelijkk sequencen. Je hebt trouwens nog steeds een Harry Potter van me tegoed. Frank,, hoe blij ik met je was zei ik al in mijn speech bij je afstuderen, die gelukkig enthousiastt ontvangen werd. Was ook eigenlijk geen grote prestatie met alle slaapverwekkendee concurrentie. Bedankt voor hoofdstuk 4 en 5! Annemieke, hoewel je eigenlijkk meer je eigen onderzoekje had, kwam je toch onder mijn hoede. Het was een superleukee tijd. Ik hoop dat je in het AMC kunt blijven! En tja, Marit, eigenlijk hoor jij ook inn dit rijtje thuis. Jouw carrière op ons lab begon per slot van rekening met je scriptie bij mij.. Je maakte een zeer goed en prettig leesbaar verhaal over een eigenlijk best wel droog onderwerp.. Ik heb er bij het schrijven van mijn inleiding nog veel aan gehad!

Daarnaastt waren er natuurlijk al die mensen die net zo geweldig bleken als Ronald ze al in mijnn sollicitatiegesprek had beschreven.

Inn het bijzonder wil ik Petra en Janet H noemen. Petra, bedankt dat je mij de beginselen vann de Zellweger-diagnostiek hebt bijgebracht. In het bijzonder de speciale manier om de P-oxidatiee telpotjes te schudden, die cruciaal bleek. Daarnaast was het erg leuk om samen mett je op massageles te gaan. En wanneer is nu eindelijk die frozen-Margarita avond? Janett H, bedankt voor al je DNA-hulp. Al die knipjes en al die 24 vreselijke exonen van PEX1.... Helaas ben ik er straks niet meer om je daarbij bij te staan.

Daarnaastt alle anderen van de research bedankt voor alle hulp en suggesties maar ook voorr de gezelligheid die het werken hier zo fijn maakte. Jos (voor alle powerpoint figuren enn Utrecht II - Ajax II waar we eigenlijk niet naar binnen mochten, maar waar we toch eindigdenn tussen tientallen flippo-ruilende kinderen), Michiel (voor de curries en de restaurantsuggesties),, Conny (voor alle DHAPAT assays en blotjes; helaas werd het met PEX22 en PEX12 niets), Patricia (voor al het ontdooien, kweken en het zakmes), Simone (zonderr jou geen hoofdstuk 6), Rob (wat een eikel was die vent op de snelweg naar Groningen),, Stef (toch bijzonder, dat bad), Lay la (voor al die heerlijke koekjes), Wendy (lieff dat je zo bezorgd bent over mijn alleen-reis plannen), Carla (voor die geweldige musicaltip),, Janet K (ik wil nog wel een keer revanche met squashen), Gerrit-Jan (leuk dat ikk nog net ga meemaken dat je weer terug bent), Joram (wat zag dat hersenprutje er vies uit!),, Carlo (voor de eerste stappen van de bloedcellen IF), Fredoen (dat valt niet mee hè,

121 1 datt regelen van je promotie) en Lodewijk (voor alle verhalen over schildpadden, kikkers enn andere bijzondere dieren).

Dann alle AIO's en oud AIO's. We begonnen met maar een paar, we eindigden met een grotee gezellige groep. Fred (zonder die illegale versies was m'n proefschrift nooit wat geworden),, Sacha (die SSIEMs zal ik nooit vergeten, jouw kennismaking(en) met Frank Roelss ook niet), Sander (alweer een tijdje weg, maar nog niet vergeten), Sietske (liever die foto,, dan die nieuwe), Daan (hierbij vergeef ik je definitief die twee fietsongelukken; zullen wee dat vieren met een bezoekje aan de IKEA?), Wouter (waarom zijn die zuurstofbelletjes nouu groter dan de waterstofbelletjes?), Annemieke (lekker samen zeuren over de AMR), Pedroo (we still have to watch Meg in French Kiss), Jolein (hebben we nou vanmiddag peroxisoombespreking?),, Ma(u)rit (ik vertrouw erop dat je mij waardig zult opvolgen als 'vreetzak'),, Saskia (denk jij ook nog wel eens terug aan dat ruziënde stel op de Enny Vredelaan?),, Ference (ben nog steeds onder de indruk van jouw kermis van de Nederlandsee winkelstraten), Robert Jan (nu nooit meer verhuizen?), Naomi (wat ga je kokenn op het AIO-eten? ik mag nog wel komen toch?) en Jasper (na al die verhalen ben ik heell benieuwd naar die vrienden van je).

Waarr zouden we zijn zonder het ondersteunende deel van het lab. Susan, Iet, Maddy en Jolanda,, bedankt voor alle hulp bij het vinden van Ronald, het doorsturen van mailtjes, het pakkenn van de laptop (onderschat dat niet) en alle andere secretariële zaken. Rally, Annelies,, Sharon, Nabila, Desi en Jan, ook jullie bedankt.

Tenslottee alle anderen van het lab GMZ. Ik heb niet met iedereen evenveel te maken gehad,, maar jullie hebben allemaal bijgedragen aan de fijne sfeer die er altijd op dit lab hing.. Nico, Rinus, Eva, Luminita, Jeroen, Albert, Marieke, Arno, Johan, Sjoukje, Ben, Andréé (zonder mijn tijd op jouw kamer was mijn boekje nooit zo mooi geworden), Wim, Solange,, René (dat was werkelijk de allerlekkerste en allermachtigste taart die ik ooit heb gegeten..),, Henk van L (ik viel bijna van mijn stoel toen je mij een vreetzak noemde), Lia, (Jan)) Rutger (met je horrorschoenen), Henk O, Ingrid, Henny, Liny, Wilma, Lida S, Marjoleinn en Lida Z, allemaal bedankt!

Promoverenn is niet iets wat ophoudt bij de uitgang van het AMC. Daarom wil ik ook iedereenn buiten het lab bedanken voor alle interesse, het delen van de successen, de bemoedigingg bij tegenslagen en alle gezelligheid.

Lieve,, Anja (succes met jouw laatste loodjes), Esther (al in dat bootje op het meer bewezen wee dat wij de wereld wel aankonden), Hermen Jan (niet alleen bedankt voor alle steun tijdenss de begintijd van mijn promotie, maar ook voor het feit dat je steun en interesse er, ondankss de grotere afstand tussen ons, altijd zijn gebleven), Ilse (laten we de traditie van hett chocoladefonduen, de NOTP en de after-kerst-uitbuik-videoavonden nog lang voortzetten),, Lonneke (al zien we elkaar tijden niet, het is altijd weer super-gezellig, succes mett jouw promotie), Nieke (een paranimf is toch echt iets anders dan een nymfomane), Reintt Willem (jammer dat je er niet bij kunt zijn, ik hoop dat ik die Jeep van je nog eens in hett echt kan bewonderen), Yvonne (bedankt voor je hulp bij de samenvatting en onze

122 2 Dankwoord d jarenlangee vriendschap; ben blij dat we lang geleden dezelfde jas hadden!) en Wendy (na anderhalfjaarr nog net zo gezellig!), bedankt!

Lievee Clarine, naar Hilversum verhuizen, waar ik niemand kende, was best een stap, maar hebb van die beslissing geen moment spijt gehad. Jij zorgde dat ik een heel fijn 'thuis' had. Jee bakte zelfs altijd koekjes... Vind het vreselijk dat ik nu een 'scheiding van tafel en bed' veroorzaak.. Maar gelukkig blijven we natuurlijk altijd vriendinnen. Bedankt voor alle vriendschap,, steun en lol!

All mijn familie en andere bekenden, bedankt voor jullie belangstelling.

Lievee papa en mama, bedankt dat jullie altijd achter me staan en er altijd voor me zijn. Julliee geven me altijd het gevoel dat jullie trots op me zijn. Jullie zijn de allerliefste ouders. Bedanktt voor alles! Lief Knorretje, en jij bent het allerliefste broertje!

Lievee Sebastiaan, ook voor jou een plekje in mijn 'dankje-woordje'. Jij gaf me de rust om tussenn het promoveren door helemaal te ontspannen. Bedankt voor al je interesse, steun en liefde! !

123 3

Curriculumm vitae Curriculumm vitae

Jeannettee Gootjes werd geboren op 21 juli 1976 te Ens. De middelbare schoolopleiding werdd door haar gevolgd aan het Emelwerda College te Emmeloord, alwaar in 1994 het VWOO diploma behaald werd. Inn datzelfde jaar werd begonnen met de studie Scheikunde aan de Universiteit Utrecht. Inn oktober 1999 behaalde zij het doctoraal diploma waaraan het judicium Cum Laude werdd toegekend. Als bijvakken werden Medische Microbiologie (Dr. W.T.M. Janssen, Dr. H.. Snippe en Prof. dr. J. Verhoef, Eijkman-Winkler Instituut, Universitair Medisch Centrum,, faculteit Geneeskunde, Universiteit Utrecht), Chemieonderwijs, en Protease inhibitorss and active site interactions (Dr. S.H. Hung en Prof. dr. B.M. Dunn, Molecular Biologyy and Biochemistry, College of Medicine, University of Florida, Gainesville, Florida, USA)) gevolgd. Het afstudeeronderzoek werd uitgevoerd bij de sectie Biochemie van Lipidenn (Dr. J. Biermann en Prof. dr. H. van den Bosch, faculteit Scheikunde, Universiteit Utrecht).. Voor dit afstudeeronderzoek ontving zij de CIVI-afstudeerprijs in de categorie Biochemiee en Biotechnologie, uitgereikt door de Koninklijke Hollandsche Maatschappij derr Wetenschappen. Vanaff november 1999 was de schrijfster van dit proefschrift werkzaam als assistent in opleidingg bij het laboratorium Genetische Metabole Ziekten in het Academisch Medisch Centrumm te Amsterdam. De resultaten van dit onderzoek, dat werd uitgevoerd onder leidingg van Prof. dr. R.J.A. Wanders en Dr. H.R. Waterham, zijn beschreven in dit proefschrift. .

126 6

GEGENERALISEERDEE PEROXISOMAL!

Naamm HjFibror rcn-rcr r

KgQi,Dgyidee _ \ : ï I ï ] N 1 N ïï Koudd ijs E99/02 2 6 JÉDut nu m rner^

am.. Ronald

yrmrrtyrmrrt rrrrrm vmrrrmmn*rrmrtTwrrrTTrrrmrt«rrmfir11mmr •iri>Miiv>nMiiuj].iH»miu .rniiiriiiMiiMMM M

1"""** UÏUUA4 fil'f'iViVViflV^I'^llfllillJ'il'llfit'lllftllAlflIllflIt^llllUII f ill'WlHitlltllT'lftjimiftMfllflIl

iHIIMlll rflIHIII ; fTTIIf 1 1 Illllllll \< HI'IIMIII -\*è*êM

tpHBM»» —mm nmwmwmmmmmwmÊmTrmmmmmÊÈÊÈmmmmmmm ti'r^*&^'&y~V&Vi?^~m —— MMI w —LMvwémumèmm — ny—t»*r09rsmma'smtmr* \mrrm\mrrm irmm rtmmvmmmm*mmmmmmmMmrmm wmmmmm^rrmmmm "™?22 mmmm MWW"M"""ll,l"l"l'WMIW,M,B,MM,*> MMMMMMMMMMMBMBMMB

Luitenn .Katie ;lff/0027^ÖeenmatoiaaL Maas,, Stefan E87/ÖÖ5Ï Geen materiaal

Mesdag,, Sara E92/Ü3Ü2 tl Tl ND! ND 1 /men n iMpprkprkk AnrlrpJPQfi/ni 19 Jfc&i Jy^KinlKini