Ecology, Evolution and Organismal Biology Ecology, Evolution and Organismal Biology Publications

3-2017 Genetic diversity and population structure of the threatened temperate woody bamboo Kuruna debilis (Poaceae: Bambusoideae: Arundinarieae) from Sri Lanka based on microsatellite analysis Lakshmi Attigala Iowa State University, [email protected]

Timothy Gallaher Iowa State University

John Nason Iowa State University, [email protected]

Lynn G. Clark Iowa State University, [email protected] Follow this and additional works at: https://lib.dr.iastate.edu/eeob_ag_pubs Part of the Ecology and Evolutionary Biology Commons, Forest Management Commons, and the Plant Breeding and Genetics Commons The ompc lete bibliographic information for this item can be found at https://lib.dr.iastate.edu/ eeob_ag_pubs/271. For information on how to cite this item, please visit http://lib.dr.iastate.edu/ howtocite.html.

This Article is brought to you for free and open access by the Ecology, Evolution and Organismal Biology at Iowa State University Digital Repository. It has been accepted for inclusion in Ecology, Evolution and Organismal Biology Publications by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Genetic diversity and population structure of the threatened temperate woody bamboo Kuruna debilis (Poaceae: Bambusoideae: Arundinarieae) from Sri Lanka based on microsatellite analysis

Abstract Species of the temperate woody bamboo genus Kuruna Attigala, Kathriar. & L.G. Clark (Poaceae: Bambusoideae) distributed in Sri Lanka and southern India, are threatened due to deforestation and habitat fragmentation. The current study focused on the tetraploid woody bamboo Kuruna debilis (Thwaites) Attigala, Kathriar. & L.G. Clark, using twelve variable microsatellite loci to assess the genetic diversity and population structure in six known Sri Lankan populations. Due to the rarity of the species, an exhaustive sampling of accessible plants resulted in a total of only 28 individuals. Nonetheless, the allelic diversity was high at most loci and given the limited distances separating populations (< 65 km apart), they exhibited a fairly high genetic differentiation (FST = 0.113) and strong isolation by distance. Structure, neighbour-joining, and neighbour-net analyses concur in grouping the six K. debilis populations into three genetic clusters consistent with the spatial proximity of the populations: one cluster comprised populations from the Piduruthalagala Mountain and Horton Plains, the second cluster consisted of the population from Adams Peak and the last comprised the populations from the Handapan Ella Plains. Due to multiple indicators of high allelic diversity, the population from the northern Horton Plains (LA124) should be targeted for conservation. Moreover, the population found in Adams Peak (LA159) is also genetically important and critical to the conservation of these species due to its unique genetic diversity. As the first population genetics study of Bambusoideae in Sri Lanka, we anticipate that our results will provide a foundation for future comparative population genetics and conservation studies in the country.

Keywords Kuruna debilis, microsatellites, population genetics, Sri Lanka

Disciplines Ecology and Evolutionary Biology | Forest Management | Plant Breeding and Genetics

Comments This article is published as Attigala, Lakshmi, Timothy Gallaher, John Nason, and Lynn G. Clark. "Genetic diversity and population structure of the threatened temperate woody bamboo Kuruna debilis (Poaceae: Bambusoideae: Arundinarieae) from Sri Lanka based on microsatellite analysis." Journal of the National Science Foundation of Sri Lanka 45, no. 1 (2017). doi: 10.4038/jnsfsr.v45i1.8038. Posted with permission.

Creative Commons License

This work is licensed under a Creative Commons Attribution 4.0 License.

This article is available at Iowa State University Digital Repository: https://lib.dr.iastate.edu/eeob_ag_pubs/271 J.Natn.Sci.Foundation Sri Lanka 2017 45 (1): 53-65 DOI: http://dx.doi.org/10.4038/jnsfsr.v45i1.8038

RESEARCH ARTICLE

Genetic diversity and population structure of the threatened temperate woody bamboo Kuruna debilis  3RDFHDH%DPEXVRLGHDH Arundinarieae) from Sri Lanka based on microsatellite analysis †

Lakshmi Attigala *, Timothy Gallaher, John Nason and Lynn G. Clark Department of Ecology, Evolution and Organismal Biology, College of Liberal Arts and Sciences, Iowa State University, 251 Bessey Hall, Ames, IA, 50011-1020, USA.

5HYLVHG$SULO$FFHSWHG$XJXVW

$EVWUDFW Species of the temperate woody bamboo INTRODUCTION genus Kuruna Attigala, Kathriar. & L.G. Clark (Poaceae: Bambusoideae) distributed in Sri Lanka and southern India, are Bamboos (subfamily Bambusoideae, Poaceae) are threatened due to deforestation and habitat fragmentation. The current study focused on the tetraploid woody bamboo Kuruna an essential component of forest and tropical high debilis (Thwaites) Attigala, Kathriar. & L.G. Clark, using altitude grassland ecosystems worldwide (Soderstrom twelve variable microsatellite loci to assess the genetic diversity  &DOGHUyQ  -XG]LHZLF] et al ., 1999; Clark and population structure in six known Sri Lankan populations. et al ., 2015). In Sri Lanka, bamboos occur naturally in all Due to the rarity of the species, an exhaustive sampling of WKUHHPDMRUFOLPDWLF]RQHV :HW'U\DQG,QWHUPHGLDWH  accessible plants resulted in a total of only 28 individuals. however, no native bamboo is found in extremely dry Nonetheless, the allelic diversity was high at most loci and given areas (Kariyawasam, 1998). Bamboo, in general, is an WKHOLPLWHGGLVWDQFHVVHSDUDWLQJSRSXODWLRQV NPDSDUW  economically, culturally and ecologically important they exhibited a fairly high genetic differentiation (F ST = 0.113) plant for Sri Lanka (De Zoysa & Vivekanandan, 1994; and strong isolation by distance. Structure, neighbour-joining, Gunatilleke et al ., 1994). Most of the non-native and neighbour-net analyses concur in grouping the six bamboos are used in housing and construction due to their K. debilis populations into three genetic clusters consistent enduring, versatile and highly renewable nature. There with the spatial proximity of the populations: one cluster are no statistics on bamboo consumption, but the forestry comprised populations from the Piduruthalagala Mountain and sector master plan (FSMP) of Sri Lanka estimated that Horton Plains, the second cluster consisted of the population the total annual consumption was at least 80,000 m 3, i.e. from Adams Peak and the last comprised the populations about 700,000 culms two decades ago (FSMP, 1995). from the Handapan Ella Plains. Due to multiple indicators Although the native bamboos are not of economic of high allelic diversity, the population from the northern Horton Plains (LA124) should be targeted for conservation. LPSRUWDQFH WKHLU HFRORJLFDO YDOXH LV VLJQL¿FDQW 2QH such example is the animal biodiversity associated Moreover, the population found in Adams Peak (LA159) is also genetically important and critical to the conservation of with the native bamboos such as the Sambar deer, WKHVH VSHFLHV GXH WR LWV XQLTXH JHQHWLF GLYHUVLW\$V WKH ¿UVW many insects and fungi (Abayasinghe et al ., 2014; population genetics study of Bambusoideae in Sri Lanka, we personal observations ). Bamboo studies conducted in anticipate that our results will provide a foundation for future Sri Lanka have mainly focused on its reproductive comparative population genetics and conservation studies in ecology (Ramanayake & Yakandawala, 1995; 1998; the country. Ramanayake & Weerawardene, 2003), vegetative propagation (Ramanayake et al ., 2001; 2007) and growth .H\ZRUGV Kuruna debilis , microsatellites, population and development (Rajapakse, 1992; Ramanayake et al ., genetics, Sri Lanka. 2001).

* Corresponding author ([email protected]) †7KLVPDWHULDOZDVSUHVHQWHGDW%RWDQ\%RLVH,GDKR86$ 54 Lakshmi Attigala et al.

Bamboos, with over 1500 species worldwide, are Based on herbarium records K. debilis populations are FODVVL¿HGLQWKUHHWULEHVWKHWURSLFDOZRRG\%DPEXVHDH found at the Adams Peak, Horton Plains, Piduruthalagala the temperate woody Arundinarieae and the herbaceous Mountain, Knuckles Mountains and the Handapan Ella Olyreae (Clark et al ., 2015). A recent study revealed that Plains of Sri Lanka. Muktesh Kumar (2011) reported that all of the native Sri Lankan temperate woody bamboos K. debilis has also been located recently from the Kerala along with the south Indian species form a major lineage part of the Western Ghats, but provided no documentation. in the Arundinarieae resulting in the recognition of the 7KH RWKHU ¿YH VSHFLHV K. densifolia , . ÀRULEXQGD , genus Kuruna (Attigala et al ., 2014). To date, there K. scandens , K. serrulata and K. walkeriana ) are each are seven species in this genus including two endemic UHVWULFWHG WR  ௅  SRSXODWLRQV RQ D IHZ PRXQWDLQ Sri Lankan species [ K. scandens (Soderstr. & R.P. summits and in open montane grasslands in Sri Lanka Ellis) Attigala, Kathriar. & L.G. Clark and K. serrulata (Figure 1). Due to their restricted distribution and habitat Attigala Kathriar. & L.G. Clark], one species endemic ORVV UHODWHG WR KXPDQ DFWLYLWLHV WKHVH ¿YH VSHFLHV DUH to south India [ Kuruna wightiana (Nees) Attigala, already at risk. Population genetic studies are essential Kathriar. & L.G. Clark], and four species [ K. debilis ; for planning conservation strategies for these Kuruna K. densifolia (Munro) Attigala, Kathriar. & L.G. Clark; species. Such studies provide conservation managers . ÀRULEXQGD (Thwaites) Attigala, Kathriar. & L.G. ZLWKVLJQL¿FDQWLQIRUPDWLRQFRQFHUQLQJHOHYDWHGOHYHOV Clark; K. walkeriana (Munro) Attigala, Kathriar. & of random genetic drift and inbreeding, and reduced L.G. Clark] occurring in both Sri Lanka and South LQWHUSRSXODWLRQ JHQH ÀRZ DQG JHQHWLF HVWLPDWHV RI India (Seethalaksmi & Muktesh Kumar, 1998; Muktesh these processes could potentially be used to initiate Kumar, 2011; Attigala et al.   conservation planning (Ellstrand & Elam, 1993; Young et al    7KHLQGLJHQRXVÀRZHULQJSODQWVRI6UL/DQNDLQFOXGH DERXWVSHFLHV :LMHVXQGDUDet al ., 2012). Nearly The primary objective of this study was to assess the one fourth of these are endemic and concentrated genetic diversity and population structure in six natural in the humid southwestern quarter of the country populations of the tetraploid woody bamboo K. debilis in (Gunatilleke & Gunatilleke, 1990). For many years, Sri Lanka. forests in Sri Lanka have been cleared both legally and illegally, due to the rapidly increasing demand for land METHODOLOGY for settlement schemes, timber production, economic and agricultural developments and weak enforcement of land use policies in the country (Gunatilake, 1998; 3RSXODWLRQVDPSOLQJ Government of Sri Lanka, 2000; Bandaratillake & Fernando, 2003). Several studies have reported that the Leaf samples were collected from 28 individual FORVHGFDQRS\ IRUHVW FRYHU KDV GHFUHDVHG IURP   SODQWV IURP  GLIIHUHQW JHRJUDSKLF ORFDOLWLHV PDLQO\ from 3 remote montane forests and an open montane LQWRDSSUR[LPDWHO\LQ 1DQD\DNNDUD grassland (Figure 1). Of the 5 main localities of  )$2   7KXV GHIRUHVWDWLRQ FDQ QHJDWLYHO\ LQÀXHQFH WKH VXUYLYDO RI WKH WKUHDWHQHG DQG HQGHPLF K. debilis populations (Adams Peak, Horton Plains, ÀRUD DQG IDXQD LQ 6UL /DQND 0DQ\ SODQW PROHFXODU Piduruthalagala Mountain, Knuckles Mountains and studies have shown that habitat fragmentation and small Handapan Ella Plains), the authors were able to collect SRSXODWLRQ VL]H PD\ QHJDWLYHO\ LQÀXHQFH WKH JHQHWLF population samples from all localities except the diversity of populations (Ellstrand & Elam, 1993; Fischer Knuckles Mountains. Although a collection trip was made & Matthies, 1998; Luijten et al ., 2000; Paschke et al ., to Knuckles Mountains we were unable to locate any 2002). Low levels of genetic diversity typically limit the K. debilis populations. Kuruna debilis has a pachymorph ability of a population to adapt to adverse environmental UKL]RPHV\VWHPUHVXOWLQJLQGHQVHO\SDFNHGFXOPVWKDWFDQ conditions or increased competition (Fischer et al ., occupy a relatively large area. Due to clonal propagation, 2000; Pluess & Stocklin, 2004). Each of the Kuruna LWLVGLI¿FXOWLQWKH¿HOGWRGLIIHUHQWLDWHLQGLYLGXDOVDWD species found in Sri Lanka has a limited distributional SDUWLFXODUORFDOLW\EHFDXVHDVLPSOHµKHDGFRXQW¶PD\QRW UDQJH SRSXODWLRQV   NP DSDUW  DQG WKHUHIRUH PD\ reveal the true number of genets, or genetic individuals be under severe threat due to deforestation and habitat in a population. Therefore, samples were collected from fragmentation. Of the six native Kuruna species, only individuals that were readily distinguishable as a single K. debilis has several, spatially distinct populations plant and all propagating clones of an individual plant in the understory of the upper cool mountain slopes of were considered as a single entity to allow for a number 6UL/DQND¶V&HQWUDO3URYLQFH HOHYDWLRQ௅P  RIVWDWLVWLFDOO\VLJQL¿FDQWUHVXOWV

March 2017 Journal of the National Science Foundation of Sri Lanka 45(1) Genetic diversity and population structure of Kuruna debilis 55

)LJXUH Distribution of Sri Lankan Kuruna species. Colours indicate different Kuruna species. The numbers in each box indicate the elevation for that population and the six K. debilis populations with their genetic clustering. Map source: Wikipedia ( http://en.wikipedia.org/wiki/Sri_Lanka#mediaviewer/File:Topography_ Sri_Lanka.jpg )

Marker selection 3730 DNA analyser (Perkin-Elmer, Applied Biosystems Division, Norwalk, Connecticut) by the DNA Sequencing Microsatellite sequences (SSRs) are highly polymorphic )DFLOLW\DWWKH,RZD6WDWH8QLYHUVLW\$OO3&5DQGF\FOH and readily replicable markers, evenly distributed sequencing reactions were performed in an MJ Research throughout eukaryotic genomes. Based on previous 37&WKHUPDOF\FOHU3&5ZDVSHUIRUPHGLQ—/ studies on temperate woody bamboos (Kitamura et al ., YROXPHV7KHDPSOL¿FDWLRQSURGXFWVZHUHFOHDQHGXVLQJ 2009; Zhan et al ., 2009), 25 primer pairs were tested with SRO\HWK\OHQH JO\FRO 3(*   SUHFLSLWDWLRQ WR DVXEVHWRIVDPSOHVWRHYDOXDWHVXFFHVVIXODPSOL¿FDWLRQ remove unincorporated primers and dNTPs from the Of the 25 microsatellite primers, 12 were successfully PCR products. Genotyping of microsatellite loci were DPSOL¿HGDQGVHOHFWHGIRUWKHVWXG\ 7DEOH  subjected to standard error checking procedures, as described in DeWoody et al    DNA extraction and genotyping  Individual tetraploid genotypes were scored from Total genomic DNA extractions were performed the electropherograms following the microsatellite from silica gel-dried specimens using the Iowa State DNA allele counting-peak ratios (MAC-PR) method 8QLYHUVLW\ '1$ )DFLOLW\¶V $XWRJHQSUHS  '1$ of Esselink et al . (2004) using the GeneMapper ® v4.1 extraction robot. Genotyping was performed on an ABI (Applied Biosystems) software.

Journal of the National Science Foundation of Sri Lanka 45(1) March 2017 56 Lakshmi Attigala et al. ., 2009 ., 2009 ., 2009 et al et al =KDQ Label range (bp)  )&*77&&$*&*&77&&$ )$0 ௅   )7&&$$$&&&7$$7&&&&77&$$7& )$0 ௅ ƒ&PLQî ƒ&Vƒ&V n n  )&$*$*&77&7*&&$77&&77& )$0 ௅  )$&*$$7&&&$$*&&7&&7& )$0 ௅ n n  )&&&7*&$$&&77&$&7&&7$&$ 9,& ௅ ƒ&PLQî ƒ&Vƒ&V .LWDPXUD  )$&&&$&$$***$*$*$*$* +(; ௅ ƒ&PLQî ƒ&Vƒ&V  )&*$7$&7$&7$*&7***$**$$* )$0 ௅ ƒ&PLQî ƒ&Vƒ&V  )*$***&*$*$**777*$**$$7** +(; ௅ ƒ&PLQî ƒ&Vƒ&V  )*&$$7&*&**$*7$$$*$$ +(; ௅ ƒ&PLQî ƒ&Vƒ&V (TG) (AG)  ) 7&  $&  )$0 ௅  )&77&*&*777**7777&7*7&&77 +(; ௅  )*&$*$77*&&**77*777$* 3(7 ௅  n n n n n n n n 1n n  0LFURVDWHOOLWHPDUNHUVXVHGIRU3&5DPSOL¿FDWLRQ  Sasa11E (AC)  5&&&7*&$$&&77&$&7&&7$&$   ƒ&V ƒ&PLQ FAN29 (CCG) ACCCGGTCGCAACTTATCCACT R: 72 °C, 45 s); 72 °C, 7 min FAN28 (CA) R: GTTGTCCACCATCAGACGC /RFXV 5HSHDWSasa500 (AT) 3ULPHUVHTXHQFH  ±  motif   $OOHOHVL]H 3&5SDUDPHWHUV 5HIHUHQFH )$1 $& R:TCCTTCCCATTTCGGAGCC 72 °C, 45 s); 72 °C, 7 min FAN27 (AG) R: GAGGAAAGCGAACACCAGC 72 °C, 45 s); 72 °C, 7 min FAN21 (AG) AGGACGAACGGAGGAGGAAGCACT R: 72 °C, 45 s); 72 °C, 7 min FAN20 (AG) TAAGCACACAGCAGCCAGTAGG R: 72 °C, 45 s); 72 °C, 7 min FAN30 (TG) R:TTGCCAACGTCTTCTGTGC Sasa718 (CT) R: GGAGGGCCAAGAGGTTACA FAN11 (AG) ATATTGTTTGCCTGACCTACA R: )$1 $$* R:GTCCACCCACGCCTTCAC TGCGGCCAAAACTACTCCCTAATC R: 7DEOH

Genetic data analysis and the following estimates of genetic diversity: the

number of alleles per locus (N A); the effective number of

The software SPAGeDi 1.4c (Hardy & Vekemans, 2002) alleles (N Ae ) estimated following Nielsen et al . (2003); was used to compute the percentage of missing genotypes UDUH¿HGDOOHOLFULFKQHVV $ R) expressed as the expected

March 2017 Journal of the National Science Foundation of Sri Lanka 45(1) Genetic diversity and population structure of Kuruna debilis 57 number of alleles among k gene copies (12 gene copies was based on 10,000 permutation replicates. For both IRUWKHFXUUHQWVWXG\ DQGWKHH[SHFWHGKHWHUR]\JRVLW\ AMOVA and IBD analyses, the tetraploids were treated

FRUUHFWHGIRUVDPSOHVL]H + e). These measures and the as diploids (Saltonstall, 2003) as there was no evidence

LQEUHHGLQJ FRHI¿FLHQW ) IS ) were estimated for each of inbreeding within populations of K. debilis and locus and each K. debilis population. The A R used in the also the analysis programmes allowed only diploid or FXUUHQWVWXG\LVFRUUHFWHGIRUYDULDWLRQLQVDPSOHVL]HE\ haploid data. The diploid data matrix was generated by using the rarefaction method recommended for uneven randomising the genotypes within each population. VDPSOHVL]HV +XUOEHUW3HWLWet al ., 1998). Further, global F-statistics (F IT , F IS and F ST ) were estimated over A rooted majority rule consensus tree was constructed all loci and populations using SPAGeDi 1.4c (Hardy & using the neighbour-joining (NJ) method with Cavalli- 9HNHPDQV ZLWKWKHVLJQL¿FDQFHRIDYHUDJHYDOXHV 6IRU]D DQG (GZDUG¶V FKRUG GLVWDQFH &DYDOOL6IRU]D determined by permutation (10,000 replicates). The  (GZDUG   7KH GLVWDQFHV DQG WKH 1- WUHH

REVHUYHG KHWHUR]\JRVLW\ + o) was calculated manually were generated using a combination of SEQBOOT, for each population over all loci. *(1',67 1(,*+%285 DQG &216(16( PRGXOHV LQ3+

UHODWLYH WR WKH WRWDO SRSXODWLRQ ĭSC , genetic differentiation among subpopulations within a genetic Despite the small number of plants available within

FOXVWHUDQGĭCT , genetic differentiation among genetic SRSXODWLRQV  ௅  LQGLYLGXDOV  PHDVXUHV RI DYHUDJH FOXVWHUVUHODWLYHWRWKHWRWDOSRSXODWLRQ7KHVLJQL¿FDQFH genetic diversity were relatively high (Table 3). For RI ĭYDOXHV ZDV GHWHUPLQHG E\ SHUPXWDWLRQ  individual populations, the average per-locus number of replicates). Isolation by distance (IBD) was evaluated DOOHOHVUDUH¿HGDOOHOLFULFKQHVVDQGHIIHFWLYHQXPEHURI by assessing the correlation between the log transformed alleles were N A  UDQJH௅ $R = 3.75 genetic distance measure F ST / (1-F ST ) (Rousset, 1997) ௅ DQG1Ae   ௅ UHVSHFWLYHO\ DQG JHRJUDSKLF GLVWDQFH ZLWK VLJQL¿FDQFH GHWHUPLQHG 3RSXODWLRQV /$ DQG /$ FRQVLVWHQWO\KDG by the Mantel test in the programme IBDWS 3.22 the lowest levels of allelic diversity, while values for (Jensen et al ., 2005). For the IBD analyses, geographic populations 2 (LA124) and 5 (LA 154) were consistently GLVWDQFHV ZHUH FDOFXODWHG PDQXDOO\ 7KH VLJQL¿FDQFH the highest. Similarly, for each population, the average

Journal of the National Science Foundation of Sri Lanka 45(1) March 2017 58 Lakshmi Attigala et al.

REVHUYHGKHWHUR]\JRVLW\ + O) and the average expected /$  DOO WKH RWKHU SRSXODWLRQV VKRZHG GH¿FLWV LQ

KHWHUR]\JRVLW\FRUUHFWHGIRUVDPSOHVL]H + e) were 0.758 KHWHUR]\JRWHV DYHUDJH)IS  UDQJH௅  UDQJH௅ DQG UDQJH௅  However, the LA159 population showed an excess of respectively. Except for the population at Adams Peak KHWHUR]\JRWHV>) IS = - 0.024 (Table 3)].

7DEOH Locus-level and average measures of genetic diversity for 12 microsatellite loci genotyped across six K. debilis populations

Locus Sample Percentage of NA NAe He HO  VL]H PLVVLQJJHQRW\SHV

6DVD       Sasa718 28 0 7 5.40 0.815 0.900 6DVD(       )$1       )$1       )$1       FAN21 28 0 10 5.99 0.833 1.000 )$1       )$1       )$1       )$1       FAN30 28 0 3 1.40 0.284 0.245 Average over 28 2.7 7.83 4.24 0.708 0.758 all loci

NA: QXPEHURIDOOHOHVZLWKQRQ]HURIUHTXHQF\1Ae : effective number of alleles; H e: expected

KHWHUR]\JRVLW\FRUUHFWHGIRUVDPSOHVL]H+OREVHUYHGKHWHUR]\JRVLW\

7DEOH Measures of genetic diversity for each of the six populations of K. debilis averaged across 12 microsatellite loci

Population Locality Sample Percentage NA NAe AR He HO FIS   VL]H RIPLVVLQJ genotypes

3RSXODWLRQ 3LGXUXWKDODJDOD         (LA120) Mountain 3RSXODWLRQ +RUWRQ3ODLQV         (LA124) (north) 3RSXODWLRQ +RUWRQ3ODLQV         (LA130) (south) Population 4 Handapan Ella 3 0 3.83 4.01 3.83 0.712 0.834 0.119 (LA148) Plains 3RSXODWLRQ +DQGDSDQ(OOD         (LA154) Plains 3RSXODWLRQ $GDPV3HDN         (LA159) Multilocus Average: all 28 2.7 7.83 4.24 4.58 0.708 0.758 0.170 populations combined

NA: QXPEHURIDOOHOHVZLWKQRQ]HURIUHTXHQF\1Ae : effective number of alleles; A RUDUH¿HGDOOHOLFULFKQHVV+eH[SHFWHGKHWHUR]\JRVLW\

FRUUHFWHGIRUVDPSOHVL]H+OREVHUYHGKHWHUR]\JRVLW\)IS LQEUHHGLQJFRHI¿FLHQW

March 2017 Journal of the National Science Foundation of Sri Lanka 45(1) Genetic diversity and population structure of Kuruna debilis 59

3RSXODWLRQJHQHWLFVWUXFWXUH SRSXODWLRQ VWUXFWXUH LQIHUUHG IRU .   ௅  KDV EHHQ shown in Figure 3A. The three clusters correspond The proportion of the observed genetic variation between well to the geographic distribution of the populations clusters ranged from F ST = - 0.053 for locus FAN27 to (Figure 1), with populations 1, 2 and 3 (LA120, LA124 0.394 for locus FAN30 with an average value of 0.113 and LA130) forming an Eastern cluster, populations WKDW ZDV VLJQL¿FDQWO\ JUHDWHU WKDQ ]HUR S   4 and 5 (LA148 and LA154) a Southern cluster, and Table 4). Individual locus estimates of the inbreeding SRSXODWLRQ /$ D:HVWHUQFOXVWHU )LJXUH$ 7KH

FRHI¿FLHQW ) IS UDQJHGIURP )$1 WR populations in the Eastern cluster were sampled from the )$1 ZLWKDPHDQRI S 7DEOH  Piduruthalagala Mountain (LA120) and the Horton Plains (LA124 and LA130). These two localities are in relatively Structure analyses using the Evanno method in close proximity and are separated by ca. 15 km. The two Structure Harvester grouped the six populations into populations in the Southern cluster are from Handapan K = 3 clusters (Figures 2 and 3A). The estimated Ella Plains and Western cluster is from Adams Peak.

)LJXUH Structure Harvester results of structure analyses for K = 2 – 5 putative genetic clusters of K. debilis individuals. A: mean L(K) “6' RYHUUXQVIRUHDFK.YDOXH%UDWHRIFKDQJHRIWKHOLNHOLKRRGGLVWULEXWLRQ PHDQ“6' FDOFXODWHGDV/ƍ .  / . ± L(K– 1); C: absolute values of the second order rate of change of the likelihood distribution (mean ± SD) calculated according to WKHIRUPXOD_/ƍƍ . _ _/ƍ . ±/ƍ . _'¨.FDOFXODWHGDV¨. PHDQ_/ƍƍ . _VG>/ . @7KHPRGDOYDOXHRIWKLVGLVWULEXWLRQ is the most probable number of clusters or the uppermost level of structure, here three clusters.

Journal of the National Science Foundation of Sri Lanka 45(1) ƍ March 2017

ƍƍ ƍ ƍ ¨ ¨ ƍƍ

 60 Lakshmi Attigala et al.

Figure 3. Analyses of genetic structure among the six K. debilis populations; A: Bayesian clustering )LJXUH Analyses of genetic structure among the six K. debilis SRSXODWLRQV$%D\HVLDQFOXVWHULQJXVLQJ6WUXFWXUHIRU. ௅SXWDWLYH genetic clusters. Each individual is represented by a vertical column and the populations are separated by a vertical black line. Different colours in the same column for each individual indicate the percentage of estimated membership in a cluster; B: rooted QHLJKERXUMRLQLQJ 1-  WUHH EDVHG RQ &DYDOOL6IRU]D DQG (GZDUGV¶FKRUG GLVWDQFH & QHLJKERXUQHW QHWZRUN VKRZLQJ JHQHWLF UHODWHGQHVVDPRQJWKHVWXG\SRSXODWLRQVEDVHGRQ&DYDOOL6IRU]DDQG(GZDUG¶VFKRUGGLVWDQFH'LVRODWLRQE\GLVWDQFHSORWRI Rousset’s genetic differentiation on geographical distance (km)

March 2017 Journal of the National Science Foundation of Sri Lanka 45(1)

 Genetic diversity and population structure of Kuruna debilis 61

Genetic structure inferred from AMOVA and genetic Of the various dimensions of genetic diversity, allelic distances richness is often considered to be of key relevance in conservation programmes (Petit et al ., 1998; Simianer, Partitioning of genetic variability by AMOVA revealed  )RXOOH\  2OOLYLHU   $OOHOLF GLYHUVLW\ LV WKDW  DQG   RI WKH WRWDO JHQHWLF YDULDWLRQ SDUWLFXODUO\ VHQVLWLYH WR ERWWOHQHFNV LQ SRSXODWLRQ VL]H was distributed among the K = 3 clusters recognised and genetic drift, and may be an important indicator of a by Structure analysis, and among populations within population’s adaptive potential, as the limit of selection these clusters, respectively. Both of these values were response is mainly determined by the initial number VLJQL¿FDQWO\ JUHDWHU WKDQ ]HUR S   7DEOH   of alleles regardless of the allelic frequencies (Hill & 7KHUHPDLQLQJFDRIWKHYDULDWLRQZDVGLVWULEXWHG 5DVEDVK %DVHGRQWKHVHH[SHFWDWLRQV3HWLWet al . among individuals within populations. (1998) regarded allelic richness as the most informative measure of genetic variation for identifying populations The Mantel test of the correlation between Rousset’s for conservation. From this perspective, population 1 may genetic distance and geographic distance indicated EHRIOHVVHUYDOXHIRUFRQVHUYDWLRQWKDQSRSXODWLRQV± VWURQJDQGKLJKO\VLJQL¿FDQWLVRODWLRQE\GLVWDQFHDPRQJ the six K. debilis populations (r 2 S   (Figure 3D). 7DEOH Individual locus and average F-statistic measures estimated across six populations of K. debilis Genetic relationships within the geographic groups

The rooted NJ tree for the six K. debilis populations Locus F F F (Figure 3B) resulted in three clades corresponding to the IT IS ST three genetic clusters indicated by the Structure analysis Sasa500 0.417*** 0.251*** 0.221*** (Figure 3A). The neighbour-net network derived from Sasa718 -0.012 -0.099** 0.079** the SplitsTree analysis also revealed the same three Sasa11E -0.039 -0.103 0.058* population genetic clusters (Figure 3C). )$1     )$1     DISCUSSION FAN20 0.377*** 0.312*** 0.095* FAN21 -0.009 -0.112** 0.092*** Locus and population level genetic diversity )$1    FAN27 0.095 0.140* -0.053 Of the six K. debilis populations sampled for this FAN28 0.043 -0.013 0.055* study, population 1 (LA120), which was collected )$1      FAN30 0.531*** 0.225** 0.394*** from mount Piduruthalagala was unusual in displaying $YHUDJH      lower allelic and genetic diversity compared to the

RWKHU ¿YH SRSXODWLRQV 7DEOH   7KH ORZHU GLYHUVLW\ FIT ¿[DWLRQLQGH[DVWKHJOREDOSRSXODWLRQ)IS LQEUHHGLQJFRHI¿FLHQW in relation to subpopulations; F : inbreeding due to differentiation RI WKLV SRSXODWLRQ LV QRW GXH WR D VPDOOHU VDPSOH VL]H ST or more missing loci, as these were similar to the other RI VXESRSXODWLRQV LQ WKH WRWDO SRSXODWLRQ 6LJQL¿FDQFH RI DYHUDJH SRSXODWLRQVH[DPLQHG7KHRIPLVVLQJJHQRW\SHV F-statistic estimates: *, **, and *** denote p values less than 0.05, is due to failure to amplify certain loci. 0.01, and 0.001, respectively.

7DEOH AMOVA analysis of genetic differentiation among the K = 3 clusters recognised by Structure analysis and among populations within these clusters

6RXUFHRIYDULDWLRQ GI 66' 9DULDQFH 3HUFHQWDJH ĭ ST  ĭ SC  ĭ CT components of variance

Among clusters 2 38.159 0.314 8.35 $PRQJSRSXODWLRQV     within clusters :LWKLQSRSXODWLRQV       7RWDO         

6LJQL¿FDQFHRIHVWLPDWHGSKLVWDWLVWLFV VHHWH[W  DQG GHQRWHSYDOXHVOHVVWKDQDQGUHVSHFWLYHO\

Journal of the National Science Foundation of Sri Lanka 45(1) March 2017 62 Lakshmi Attigala et al.

9HNHPDQVDQG+DUG\  VXUYH\HG¿QHVFDOHVSDWLDO high levels of genetic diversity (Table 4). Population genetic structure analyses in plant populations based on 2 (LA124) from the northern part of the Horton Plains

ERWKDOOR]\PHVDQGPLFURVDWHOOLWHVDQGVKRZHGWKDWRQ showed the highest levels of N A, N Ae and A R, and is a average outcrossing species have a F IS value of 0.014. particularly good candidate for conservation. The single

The global F IS value of 0.078 (Table 4) obtained for SRSXODWLRQ IURP $GDPV 3HDN SRSXODWLRQ  /$  K. debilis  LV VLJQL¿FDQWO\ ORZ DQG LQGLFDWHV WKDW WKHVH formed its own genetically distinct cluster and is also populations are primarily outcrossing. a potential candidate for conservation due to its unique genetic diversity. Although the three genetic clusters Genetic structure of .GHELOLV populations do not provide evidence for morphologically distinct ecotypes, their unique genetic diversity must be taken Genetic differentiation among angiosperm populations into consideration by conservation managers when arises due to a variety of factors. Factors associated identifying conservation management units. Many with relatively low values of genetic differentiation studies show that, while ecotypes do matter when include woody habit, outcrossing breeding systems and GH¿QLQJ PDQDJHPHQW XQLWV UHFRPPHQGDWLRQV IRU wind dispersal (Hamrick et al ., 1992), all of which are conservation are commonly made based on the genetic characteristic of K. debilis . Based on Wright’s (1978) uniqueness of the populations (Soule & Simberloff, qualitative guidelines for the interpretation of F ST , the %DUUHWW .RKQ $VWKHVL[SRSXODWLRQVRI K. debilis global value for K. debilis (F ST = 0.113) obtained in this IRUPHGWKUHHJHQHWLFDOO\LGHQWL¿DEOHFOXVWHUV study is within the suggested range for moderate genetic we recommend that populations separated by more than GLIIHUHQWLDWLRQ UDQJH௅ 7KDWVDLGLWLVUDWKHU ca. 35 km (as is the case for these clusters) should be high given the relatively close spatial proximity of the treated as distinct units for management and conservation, study populations. This study showed that K. debilis while those within ca. 15 km should be managed jointly. populations cluster into three genetically distinct sub- These recommendations serve as an initial step towards JURXSVLQWKHFHQWUDOPRXQWDLQVRI6UL/DQNDRQHVSHFL¿F identifying management units for threatened bamboos in to the East (populations LA120, LA124 and LA130), one 6UL/DQND+RZHYHUVLQFHRXUVDPSOHVL]HVDUHUHODWLYHO\ VSHFL¿F WR WKH 6RXWK SRSXODWLRQV /$ DQG /$  smaller one must use these results cautiously. and a single unique population to the West (LA159). These groupings were evident from all three of the  'HVSLWH WKH VPDOO VDPSOH VL]HV OHYHOV RI JHQHWLF clustering analyses used (structure, neighbour joining, variation were found to be relatively high within and neighbour-net). The observation that the number individual populations. Further, tests of genetic of genetic clusters being lower than the number of differentiation among populations were found to be SRSXODWLRQVLVLQGLFDWLYHRISDUWLDOEDUULHUVWRJHQHÀRZ KLJKO\ VLJQL¿FDQW &RQVHTXHQWO\ WKLV VWXG\ SURYLGHV which may be either historical or ongoing (Vergara et al ., important insight into the genetic diversity and 2014). Also consistent with this observation, the Mantel connectivity of K. debilis DQGLVDVLJQL¿FDQWLQLWLDOVWHS WHVWVKRZVWKDWJHRJUDSKLFGLVWDQFHH[SODLQVRIWKH towards the conservation management of this threatened genetic distance between population pairs. This positive temperate woody bamboo species. For these rare and association between geographic distance and genetic threatened species with limited distribution areas, a distance suggests that migration rates between these single stochastic event, such as a serious insect attack or K. debilis populations decrease with increasing distance pathogen infection, could cause catastrophic reductions as expected under an isolation by distance (IBD) model LQ SRSXODWLRQ VL]H DQG JHQHWLF GLYHUVLW\ DQG HYHQ RIJHQHÀRZ :ULJKW  extinction (Ma et al ., 2013). Taking proper measures to protect their current populations is required. Conservation implications Acknowledgement 7KLVDQDO\VLVLVWKH¿UVWVWXG\LQYHVWLJDWLQJWKHJHQHWLF diversity and structure of K. debilis from Sri Lanka, with Field work was supported by the National Science samples from almost all known populations evaluated )RXQGDWLRQ RI 86$ JUDQW '(% WR /\QQ * using microsatellite markers. Although several studies Clark and the genotyping was funded by an Ecology, KDYH SUHYLRXVO\ TXDQWL¿HG SRSXODWLRQ OHYHO JHQHWLF Evolution and Organismal Biology (EEOB) Finch Fund variation in bamboos, none of them have related this DZDUG LQ  ௅  DQG DQ ((2% JUDGXDWH VWXGHQW variation to the conservation of bamboo populations research grant. The authors thank the Forest Department, or species (Ramanayake et al ., 2007; Lalhruaitluanga Sri Lanka, the Department of Wildlife Conservation & Prasad, 2009; Mukherjee et al ., 2010; Triplett & of Sri Lanka and Sri Lanka Customs for providing the Clark, 2010). Populations 2 – 5 showed generally necessary permits to collect and export both herbarium

March 2017 Journal of the National Science Foundation of Sri Lanka 45(1) Genetic diversity and population structure of Kuruna debilis 63 material and silica dried leaf material from Sri Lanka. for plant conservation. Annual Review of Ecology and We would also like to thank Mr. Nuwan De Silva Systematics 24 : 217 – 242. and Mr. Abayapala De Silva for their generous help DOI: KWWSVGRLRUJDQQXUHYHV GXULQJ ¿HOGZRUN $ VSHFLDO WKDQNV WR 'U +DVKHQGUD 12. Esselink G.D., Nybom H. & Vosman B. (2004). Assignment Kathriarachchi for her collaboration. We also thank Mr. RI DOOHOLF FRQ¿JXUDWLRQ LQ SRO\SORLGV XVLQJ WKH 0$&35 (microsatellite DNA allele counting-peak ratios) method. Arun Sethuraman for technical assistance. Theoretical Applied Genetics : 402 – 408. DOI: KWWSVGRLRUJV REFERENCES 13. Evanno G. , Regnaut S. & Goudet J. (2005). Detecting the number of clusters of individuals using the software 1. Abayasinghe K.R.K., Ranawana K.B., Gamage M.G.E. & 6758&785(DVLPXODWLRQVWXG\ . Molecular Ecology 14 : Nilanthi R.M.R. (2014). Change detection in vegetation – . cover of Horton plains national park for adaptive DOI: KWWSVGRLRUJM;[ management: a practical geoinformatics approach. Journal 14. ([FRI¿HU / /DYDO *  6FKQHLGHU 6  $UOHTXLQ of the Department of Wildlife Conservation 2: 113 – 131. ver. 3.0: an integrated software package for population genetics data analysis. Evolutionary Bioinformatics Online 2. $WWLJDOD / .DWKULDUDFKFKL +6  &ODUN /*   Taxonomic revision of the temperate woody bamboo 1: 47 – 50. genus Kuruna (Poaceae: Bambusoideae: Arundinarieae). 15. Felsenstein J. (1989). PHYLIP – Phylogeny Inference Cladistics 5 Systematic Botany 41  ± 3DFNDJH YHUVLRQ  ± Fischer M. & Matthies D. (1998). RAPD variation in DOI: KWWSVGRLRUJ; 3. Attigala L., Triplett J.K., Kathriarachchi H.-S. & Clark UHODWLRQ WR SRSXODWLRQ VL]H DQG SODQW SHUIRUPDQFH LQ WKH rare Gentianella germanica . American Journal of Botany L.G. (2014). A new genus and a major temperate bamboo 85 : 811 – 819. lineage of the Arundinarieae (Poaceae: Bambusoideae) DOI: KWWSVGRLRUJ from Sri Lanka based on a multi-locus plastid phylogeny. 17. Fischer M., Van Kleunen M. & Schmid B. (2000). Genetic PhytoTaxa 174(1): 187 – 205. allele effects on performance, plasticity and developmental DOI: KWWSVGRLRUJSK\WRWD[D stability in a clonal plant. Ecology Letters 3: 530 – 539. 4. Bandaratillake H.M. & Fernando M.P.S. (2003). National DOI: KWWSVGRLRUJM[ Forest Policy Review: Sri Lanka. An Overview of Forest 18. )RRGDQG$JULFXOWXUH2UJDQL]DWLRQRIWKH8QLWHG1DWLRQV Policies in Asia (eds. T. Enters, M. Qiang & R.N. Leslie). (FAO) (2005). Global Forest Resources Assessment, Food and Agriculture Organisation, Bangkok, Thailand. Country Reports-Sri Lanka . FRA2005/123. Food and 5. Barrett S. & Kohn J. (1991). Genetic and evolutionary $JULFXOWXUH2UJDQL]DWLRQ5RPH,WDO\ FRQVHTXHQFHV RI VPDOO SRSXODWLRQ VL]H LQ SODQWV 19. Forestry Sector Master Plan (FSMP) (1995). Forest implications for conservation. Genetics and Conservation Department, Ministry of Agriculture, Lands and Forestry, of Rare Plants (eds. D.A. Falk & K.E. Holsinger), pp. Sri Lanka. ±2[IRUG8QLYHUVLW\3UHVV1HZ

Journal of the National Science Foundation of Sri Lanka 45(1) March 2017 64 Lakshmi Attigala et al.

Hardy O. & Vekemans X . (2002 ). SPAGeDi: a versatile 38. Mukherjee A.K., Ratha S., Dhar S., Debata A.K., Acharya FRPSXWHUSURJUDPWRDQDO\]HVSDWLDOJHQHWLFVWUXFWXUHDWWKH P.K., Mandal S., Panda P.C. & Mahapatra A.K. (2010). individual or population levels . Molecular Ecology Notes Genetic relationships among 22 taxa of bamboo revealed 2: – . by ISSR and EST-based random primers. Biochemical DOI: KWWSVGRLRUJM[ Genetics 48 : 1015 – 1025. 27. +LOO :*  5DVEDVK -   0RGHOV RI ORQJ WHUP DOI: https://doi.org/10.1007/s10528-010-9390-8 DUWL¿FLDO VHOHFWLRQ LQ ¿QLWH SRSXODWLRQ Genetic Research 39. Muktesh Kumar M.S. (2011). Grasses and Bamboos- 48 : 41 – 50. Bamboos of Peninsular India , pp. 140. Kerala Forest DOI: KWWSVGRLRUJ6 Research Institute, Peechi, Kerala, India. 28. Hurlbert S.H. (1971). The nonconcept of species diversity: 40. 1DQD\DNNDUD 95   Forests and Forestry in Sri a critique and alternative parameters. Ecology 52 : 577 – Lanka: An Historical Perspective . Commonwealth  6HFUHWDULDW8. DOI: https://doi.org/10.2307/1934145 41. Nielsen R., Tarpy D.R. & Reeve H.K. (2003). Estimating 29. +XVRQ '+  %U\DQW '   $SSOLFDWLRQ RI effective paternity number in social insects and the effective phylogenetic networks in evolutionary studies. Molecular number of alleles in a population. Molecular Ecology 12 : Biology and Evolution 23  ± ± DOI: https://doi.org/10.1093/molbev/msj030 DOI: KWWSVGRLRUJM;[ 30. -DNREVVRQ 0  5RVHQEHUJ 1$   &/8033 D 42. Paschke M., Abs C. & Schmid B. (2002). Relationship cluster matching and permutation program for dealing with EHWZHHQ SRSXODWLRQ VL]H DOOR]\PH YDULDWLRQ DQG SODQW label switching and multimodality in analysis of population performance in the narrow endemic Cochlearia bavarica . Conservation Genetics 3: 131 – 144. structure. Bioinformatics 23 ± DOI: https://doi.org/10.1093/bioinformatics/btm233 DOI: KWWSVGRLRUJ$ 43. Petit R.J., El Mousadik A. & Pons O. (1998). Identifying 31. Jensen J.L., Bohonak A.J. & Kelley S.T. (2005). Isolation populations for conservation on the basis of genetic by distance, web service. BMC Genetics 6: 13. v.3.22. markers. Conservation Biology 12 : 844 – 855. Available at http://ibdws.sdsu.edu/ , Assessed 12 June 2013. DOI: KWWSVGRLRUJM[ 32. -XG]LHZLF] (- &ODUN /* /RQGRxR ;  6WHUQ 0- 44. Pluess A.R. & Stocklin J. (2004). Genetic diversity and (1999). American Bamboos , pp. 392. Smithsonian ¿WQHVVLQScabiosa columbaria in the Swiss Jura in relation ,QVWLWXWLRQ3UHVV:DVKLQJWRQ'&86$ WRSRSXODWLRQVL]HConservation Genetics 5± 33. .DUL\DZDVDP'  %DPERRUHVRXUFHVDQGXWLOL]DWLRQ DOI: https://doi.org/10.1023/B:COGE.0000029999.10808.c2 in Sri Lanka. In: Bamboo - conservation, diversity, 45. Pritchard J.K. , Stephens M. & Donnelly P. (2000). Inference HFRJHRJUDSK\ JHUPSODVP UHVRXUFH XWLOL]DWLRQ DQG of population structure using multilocus genotype data . taxonomy. Proceedings of Training Course cum Workshop Genetics 155: 945 – 959. (eds. A.N. Rao & R. Rao), Kunming and Xishuangbanna, Rajapakse M.C. (1992). Studies on the in vitro development Yunnan, China, 10 – 17 May, International Plant Genetic of Dendrocalamus giganteus . M. Phil thesis , Postgraduate Resources Institute (IPGRI), Rome, Italy. ,QVWLWXWH RI $JULFXOWXUH 8QLYHUVLW\ RI 3HUDGHQL\D 34. Kitamura K., Saitoh T., Matsuo A. & Suyama Y. (2009). Peradeniya. Development of microsatellite markers for the dwarf 47. Ramanayake S.M.S.D. & Weerawardene T.E. (2003). bamboo species Sasa cernua and Sasa kurilensis (Poaceae) Flowering in a bamboo, Meloccana (Bambusoideae: in northern Japan. Molecular Ecology Resources 9   Poaceae). Botanical Journal of the Linnaean Society – 1472. 143(3): 287 – 291. DOI: KWWSVGRLRUJM[ DOI: KWWSVGRLRUJM[ 35. Lalhruaitluanga H. & Prasad M.N.V. (2009). Comparative 48. Ramanayake S.M.S.D. & Yakandawala K. (1995). Some results of RAPD and ISSR markers for genetic diversity REVHUYDWLRQVLQWKHÀRZHULQJLQDendrocalamus giganteus assessment in Melocanna baccifera Roxb. growing in and Bambusa vulgaris . Proceedings of the 6 th Regional 0L]RUDP6WDWHRI,QGLDAfrican Journal of Biotechnology Workshop on Multipurpose Tree Species in Sri Lanka 8± HG +30 *XQDVHQD  SS  ±  0376 5HVHDUFK DOI: https://doi.org/10.5897/AJB09.047 1HWZRUN)DFXOW\RI$JULFXOWXUH8QLYHUVLW\RI3HUDGHQL\D Luijten H., Dierick A., Oostermeijer J., Raijmann L. & Peradeniya. 'HQ1LMV+  3RSXODWLRQVL]HJHQHWLFYDULDWLRQDQG 49. Ramanayake S.M.S.D. & Yakandawala K. (1998). reproductive stress in rapidly declining, self-incompatible ,QFLGHQFH RI ÀRZHULQJ GHDWK DQG WKH SKHQRORJ\ RI WKH perennial ( Arnica montana ) in the Netherlands. giant bamboo ( Dendrocalamus giganteus Wall. Ex Munro). Conservation Biology 14 ± Annals of Botany 82  ± DOI: KWWSVGRLRUJM[ DOI: KWWSVGRLRUJDQER 37. Ma Y.P., Chen G., Grumbine R.E., Dao Z.L., Sun W.B. & 50. Ramanayake S.M.S.D., Meemaduma V.N. & Weerawardene Guo H.J. (2013). Conserving plant species with extremely T.E. (2007). Genetic diversity and relationships between small populations (PSESP) in China. Biodiversity and nine species of bamboo in Sri Lanka, using random Conservation 22 : 803 – 809. DPSOL¿HG SRO\PRUSKLF '1$ Plant Systematics and DOI: https://doi.org/10.1007/s10531-013-0434-3 Evolution 269±

March 2017 Journal of the National Science Foundation of Sri Lanka 45(1) Genetic diversity and population structure of Kuruna debilis 65

DOI: KWWSVGRLRUJV 59. Triplett J.K. & Clark L.G. (2010). Phylogeny of the 51. Ramanayake S.M.S.D., Wanniarachchi W.A.V.R. & temperate woody bamboos (Poaceae: Bambusoideae) with Tennakoon T.M.A. (2001). Axillary shoot proliferation and an emphasis on Arundinaria and allies. Systematic Botany LQYLWURÀRZHULQJLQDQDGXOWJLDQWEDPERRDendrocalamus 35 : 102 – 120. giganteus Wall. ex Munro. In vitro Cellular and DOI: KWWSVGRLRUJ Developmental Biology - Plant 37 ± 9HUJDUD5*LW]HQGDQQHU0$6ROWLV' 6ROWLV3   DOI: KWWSVGRLRUJV Population genetic structure, genetic diversity, and natural 52. Rosenberg N.A.   ',6758&7 : a program for the history of the South American species of Nothofagus graphical display of population structure. Molecular subgenus Lophozonia (Nothofagaceae) inferred from Ecology Notes 4: 137 – 138. nuclear microsatellite data. Ecology and Evolution 4(12): DOI: KWWSVGRLRUJM[ 2450 – 2471. 53. Rousset F. (1997). Genetic differentiation and estimation DOI: https://doi.org/10.1002/ece3.1108 RIJHQHÀRZIURP)VWDWLVWLFVXQGHULVRODWLRQE\GLVWDQFH 9HNHPHQV; +DUG\2-  1HZLQVLJKWVIURP¿QH Genetics 145: 1219 – 1228. scale spatial genetic structure analyses in plant populations. 54. Saltonstall K. (2003). Microsatellite variation within and Molecular Ecology 13 : 921 – 935. among North American lineages of Phragmites australis . DOI: KWWSVGRLRUJM;[ Molecular Ecology 12 ± Wijesundara D.S.A., Kathriarachchi H.-S., Ranasinghe DOI: KWWSVGRLRUJM;[ S.W. & Hapuarachchi G. (2012). Analysis of seed plants 55. Seethalakshmi K.K. & Muktesh Kumar M.S. (1998). of Sri Lanka. The National Red List 2012 of Sri Lanka: Bamboos of India-a Compendium , pp. 342. Bamboo Conservation Status of the Fauna and Flora . Biodiversity Information Centre-India, Kerala Forest Research Institute, Secretariat of the Ministry of Environment and the Peechi and International Network for Bamboo and Rattan, Beijing. Eindhoven, New Delhi. Department of National Botanic Gardens, Colombo and Peradeniya. 6LPLDQHU +   8VLQJ H[SHFWHG DOOHOH QXPEHU DV objective function to design between and within breed Wright S. (1943). Isolation by distance. Genetics 28 : conservation of farm animal biodiversity. Journal of 114 – 138. Animal Breed Genetics 122: 177 – 187. Wright S. (1978). Evolution and the Genetics of DOI: https://doi.org/10.1111/j.1439-0388.2005.00523.x Populations. Variability within and among Natural 57. Soderstrom T.R. & Calderón C.E. (1979). Ecology Populations  YROXPH  8QLYHUVLW\ RI &KLFDJR 3UHVV and phytosociology of bamboo vegetation. Ecology of &KLFDJR86$ Grasslands and Bamboo Lands of the World (ed. M. 

Journal of the National Science Foundation of Sri Lanka 45(1) March 2017