sign in sign up
<<
Home , Aipysurus, Emydocephalus, Emydocephalus annulatus

Conservation Genet Resour (2012) 4:11–14 DOI 10.1007/s12686-011-9461-0

TECHNICAL NOTE

Development of eleven polymorphic microsatellite loci for the sea annulatus (: Hydrophiinae) and cross- amplification for seven species in the sister

Vimoksalehi Lukoschek • John C. Avise

Received: 21 May 2011 / Accepted: 1 June 2011 / Published online: 23 June 2011 Ó Springer Science+Business Media B.V. 2011

Abstract We developed eleven microsatellite loci for the in marine systems hinder significant progress. High-reso- turtleheaded , , from lution molecular markers, such as nuclear microsatellites, partial genomic DNA libraries using a repeat enrichment provide compelling alternatives for addressing critical protocol. Nine loci had high numbers of alleles (11–32) per questions about population genetic structure, gene flow, locus, while the other two loci had six alleles each. All dispersal, effective population sizes and relatedness. eleven loci amplified successfully and were polymorphic True sea comprise two evolutionary lineages: the in six of seven sea snake species from the sister genus Hydrophis and Aipysurus groups (Lukoschek and Keogh Aipysurus, while ten loci amplified successfully for the 2006). Ten highly polymorphic microsatellite loci were seventh species. Based on these highly successful cross- recently developed for the Hydrophis group (Lukoschek amplifications we expect these loci to be useful markers for and Avise 2011); however, only five microsatellite loci evaluating population genetic structure, gene flow, relat- previously had been developed for an Aipysurus group edness and effective population sizes for all Aipysurus species, (Lukoschek et al. 2005) and large-scale genotyping group sea snakes. revealed relatively low polymorphism at most loci (Luko- schek et al. 2008). In order to better understand how con- Keywords Aipysurus Emydocephalus Bottleneck temporary demographic processes have affected genetic Connectivity Effective population size Sea snake diversity, effective population sizes and dispersal in the Aipysurus group, we aimed to develop highly polymorphic microsatellite loci for population genetic analyses. We Recently published IUCN Red List Assessments for all true targeted Emydocephalus annulatus because previous phy- sea snake species (Elapidae: Hydrophiinae) listed two of the logenies based on morphology (Voris 1977) and molecules 54 species as Critically Endangered (CR) and a third species (Lukoschek and Keogh 2006) consistently supported its as Endangered (IUCN 2010). All three species are from the basal position in the Aipysurus group. genus Aipysurus and all are endemic to a handful of reefs in We employed a modified version of a hybridization the Ashmore Reef region of the Timor Sea, where they have capture protocol using magnetic streptavidin beads and undergone recent precipitous population declines (Guinea biotinylated probes (Hamilton et al. 1999; Hauswaldt and 2007; Lukoschek Unpublished Data). The reasons for these Glenn 2003) to enrich for microsatellites in a genomic declines are unknown and difficulties of direct observation library for E. annulatus. Our protocol followed Lukoschek and Avise (2011). A total of 101 inserts were sequenced and microsatellite repeat regions detected by eye. Primers pairs V. Lukoschek J. C. Avise Department of Ecology and Evolutionary Biology, were designed for all 25 inserts containing microsatellites University of California at Irvine, Irvine, CA 92697, USA using OligoAnalyzer 3.0 (Integrated DNA Technologies) and tested on E. annulatus (n = 48). One primer from each & V. Lukoschek ( ) pair was 50 end labeled with a tag (50-GGAAACAGCT ARC Centre of Excellence for Coral Reef Studies, 0 James Cook University, Townsville, QLD 4811, ATGACCATG-3 ) for tailed PCR with an M13 primer e-mail: [email protected] labeled with a 6-FAM, HEX, or NED (Applied Biosystems) 123 12 Conservation Genet Resour (2012) 4:11–14

fluorophore. Eleven microsatellite loci (Table 1), which disequilibrium (LD). MICRO-CHECKER (van Oosterhout amplified consistently and without multiple peaks, were et al. 2004) was used to test for null alleles. screened further. For E. annulatus, nine microsatellite loci had high Polymerase chain reaction (PCR) amplification of numbers of alleles (11–32) per locus, while the other two microsatellite loci were performed following the reaction loci had six alleles each. Eight loci had expected hetero- conditions and thermal cycling protocols described in zygosities (He) C 0.75 (Table 2). All eleven loci amplified Lukoschek and Avise (2011) using the locus specific successfully in six of the seven Aipysurus species while annealing temperatures (Tm) given in Table 1.We only one locus failed in A. pooleorum (Table 2); however screened 225 adult E. annulatus from five Australian and only two A. pooleorum museum samples were screened two New Caledonian locations. Cross-species amplifica- and the DNA was somewhat degraded. Allele sizes and tions were conducted for all seven species in the sister frequency distributions varied considerably among species genus Aipysurus.ForAipysurus laevis we screened 326 (Table 2). individuals from 11 locations throughout its Australian Genotype frequencies for A. laevis from seven locations range, while sample sizes for the remaining six species with n [ 30 were in HWE at P = 0.05 for 74 of the 77 ranged from 2 to 30 (Table 2), typically from one or tests, and the three significant tests (two loci in three two locations per species. Tissue samples were obtained locations) did not remain significant after Bonferroni cor- from biopsy of live snakes, trawler by-catch and museum rection. Moreover, eleven loci were in HWE for A. fuscus collections. Exact tests implemented in GenePop Web at Ashmore Reef (n = 27). Microchecker did not find Version 4.0.10 (Raymond and Rousset 1995; Rousset evidence for null alleles for A. laevis or A. fuscus. Geno- 2008) were used to evaluate whether genotype frequencies type frequencies for E. annulatus departed from HWE in conformed to Hardy–Weinberg equilibrium (HWE) (Guo nine of 44 tests and one locus (Ea478) departed from HWE and Thompson 1992) and whether loci were in linkage in all four locations tested. Three tests remained significant

Table 1 Characteristics of eleven microsatellite loci developed for Emydocephalus annulatus Locus Repeat motif Primer sequence (50–30) (F/R) Tm (°C) Expected GenBank product size accession (bp) no.

Ea407 (TAGA)12 M13_TCTAACCACTGCACCACCACAGTT 55 168 JF969261 TGTCCATAGTCTGGTGGGCCAAAT

Ea823 (GATA)15 M13_AACGTGTGGACTCCAATTCCCAGA 55 168 JF969262 TAGGACTCCAGCTGTTGAGCTATC

Ea462 (GAAGA)11(GGAGA)(GAAGA)9 M13_AGCATTCTGTCAAGTGAGGCTCCA 53 397 JF969263 ACGCCACCTGAAGATACCTCAACA

Ea820 (CTTT)16(CTTC)(CTTT)3 M13_ATGCGAGGCAAATGACAGTGGTTG 51 380 JF969264 TGGCTGTTCAACTGTTAGCTGGT

Ea475 (CT)2GTCTGT(CT)4(GT)5CTGT(CT)4 M13_TCAGTTATTTCTGTGAACTTTG 51 363 JF969265 GT(CT)6GTCTGT (CT)3(GT)2(CT)2 GTTGCAACATAGCGTACCTC GT(CT)6GT(CT)2GT(CT)4GT(CT)6

Ea804 (TG)9(AG)10 M13_GCAAGTTGATGTCTTATCCTTCTCC 57 201 JF969266 TGGACAACAGCTGCTTAGTACAGCTC

Ea886 (CTTT)3(CT)4(TTCT)2(AC)(CTTT)2 M13_ACAGGTAGAACAAGCAGTGTGGTC 47 182 JF969267 (CTTC)(TTCC)2 (ATTCTTT) GAGGACTATGATACATGATTGGACA (CCTTCTTT)2(CCTT)5CCCT(CCTT)4

Ea844 (GATA)17 M13_GAGCATATCAGAAACATGGACTGC 55 267 JF969268 CCTATTATCTTGTAAGCAATTGACA

Ea478 (TACTC)18 M13_TTCCCACCACTCCTTATCACCCAT 57 446 JF969269 ACTCCTGAGGAAGTAGACAGGAAC

Ea841 (TC)10*int*(CTAT)14*int*(TC)3(TG)3 M13_GTTCTGGTTTGTCCACAGCTTTCAG 53 398 JF969270 (TC)4(TG)2(TC)3*int*(T)8(TCTG)4(TC)6 TTGGGATGAGGAGTGATCTTCGGA

Ea879 (TC)4(TG)14(TA)2 M13_CGTTTCAGCAGAATCTCATCTGCC 51 179 JF969271 AGCTATGGTTCCGAGCTCTTCACA

123 Conservation Genet Resour (2012) 4:11–14 13

Table 2 Attributes of eleven microsatellite loci developed for Emydocephalus annulatus and the results of cross-species amplification trials for seven sea snake species in the genus Aipysurus Locus Emydocephalus annulatus (N = 225) (N = 326) Size range (bp) N Na Ho He Size range (bp) N Na Ho He

Ea407 174–214 219 11 0.64 0.75 174–218 317 12 0.84 0.85 Ea823 169–205 210 16 0.77 0.79 133–161 317 5 0.25 0.24 Ea462 342–452 212 17 0.81 0.88 372–467 312 17 0.86 0.89 Ea820 369–453 197 18 0.87 0.90 365–433 299 17 0.87 0.89 Ea475 373–421 222 11 0.30 0.57 375–431 310 19 0.89 0.90 Ea804 202–226 225 6 0.23 0.31 198–222 324 12 0.32 0.42 Ea886 160–262 222 19 0.75 0.86 196–294 316 25 0.93 0.93 Ea844 244–300 185 15 0.84 0.84 248–288 254 11 0.72 0.85 Ea478 365–435 197 12 0.52 0.80 355–425 319 12 0.81 0.82 Ea841 405–483 207 32 0.80 0.90 377–463 306 30 0.86 0.91 Ea879 191–203 219 6 0.16 0.20 198–253 307 15 0.81 0.83 Locus (N = 30) (N = 2) Size range (bp) N Na Ho He Size range (bp) N Na

Ea407 186–206 28 6 0.74 0.75 190 2 1 Ea823 141–149 29 3 0.32 0.33 141 2 1 Ea462 372–427 27 9 0.84 0.85 382 1 1 Ea820 381–421 26 11 0.80 0.82 381, 393, 401 2 3 Ea475 375–427 22 7 0.73 0.75 413, 431 1 2 Ea804 200–214 30 4 0.67 0.68 210, 212 2 2 Ea886 238–282 28 13 0.86 0.87 266 1 1 Ea844 256–276 22 6 0.79 0.81 268 1 1 Ea478 360–395 30 8 0.83 0.85 375, 380 2 2 Ea841 343–411 30 12 0.68 0.69 345, 351 1 2 Ea879 225–241 30 9 0.80 0.81 245 1 1

Locus (N = 25) Aipysurus eydouxi (N = 10) Size range (bp) N Na Ho He Size range (bp) N Na Ho He

Ea407 174–202 23 7 0.78 0.77 186–248 10 5 0.70 0.76 Ea823 133–141 24 3 0.42 0.34 133–189 8 8 0.88 0.80 Ea462 372–427 22 12 0.77 0.89 387–422 8 6 0.75 0.73 Ea820 373–425 22 11 0.82 0.85 381–413 9 9 1.00 0.84 Ea475 409–435 18 4 0.56 0.44 405–445 9 8 0.78 0.81 Ea804 200–214 21 2 0.19 0.24 206–214 10 4 0.60 0.70 Ea886 230–284 24 18 0.79 0.91 212–290 10 12 0.90 0.89 Ea844 260–280 21 6 0.67 0.79 264–288 8 5 0.38 0.70 Ea478 370–405 22 8 0.82 0.83 365–390 10 6 0.90 0.82 Ea841 343–387 22 11 0.91 0.84 369–427 10 14 0.90 0.89 Ea879 237–239 23 2 0.04 0.26 223–255 10 8 0.50 0.84

Locus Aipysurus tenuis (N = 7) Aipysurus pooleorum (N = 2) Size range (bp) N Na Ho He Size range (bp) N Na

Ea407 186–202 7 5 0.43 0.77 190, 198, 202 2 3 Ea823 133, 141, 145 7 3 0.71 0.52 137 2 1

123 14 Conservation Genet Resour (2012) 4:11–14

Table 2 continued Locus Aipysurus tenuis (N = 7) Aipysurus pooleorum (N = 2) Size range (bp) N Na Ho He Size range (bp) N Na

Ea462 387–432 6 7 0.33 0.83 412–432 2 4 Ea820 381–417 7 9 0.86 0.87 393 1 1 Ea475 383–427 7 6 0.71 0.81 423 1 1 Ea804 200–220 7 6 0.71 0.63 212 2 1 Ea886 208–282 7 9 1.00 0.87 N/A 0 0 Ea844 244–276 6 6 0.83 0.78 268, 288 2 2 Ea478 370–390 6 5 1.00 0.74 N/A 0 0 Ea841 379–413 6 7 0.83 0.83 381–425 2 3 Ea879 227–239 7 5 0.86 0.74 237–245 2 3

N is the number of samples that successfully amplified and were scored for each locus. Na is the number of alleles. Ho & He refers to observed & expected heterozygosity calculated by GenAlEx (Peakall and Smouse 2006) after Bonferroni correction (two involving Ea478 and one Guo SW, Thompson EA (1992) Performing the exact test of Hardy– for Ea841) and MICRO-CHECKER indicated homozygous Weinberg proportion for multiple alleles. Biometrics 48: 361–372 excess for these loci suggesting null alleles. However, Hamilton MB, Pincus EL, Di Fiore A, Flescher RC (1999) Universal these departures from HWE mostly occurred at two reefs in linker and ligation procedures for construction of genomic DNA the Ashmore Reef region where E. annulatus has under- libraries enriched for microsatellites. BioTechniques 27:500–507 gone recent population declines (Guinea 2007; Lukoschek Hauswaldt JS, Glenn TC (2003) Microsatellite DNA loci from the diamondback terrapin (Malaclemys terrapin). Mol Ecol Notes Unpublished Data), which might account for these results. 3:174–176 Eight of 220 tests (55 tests in each of four locations) for IUCN (2010) IUCN ;. Version 2010.4. www.iucnredlist.org LD in E. annulatus were significant at P = 0.05 but only Lukoschek V, Avise JC (2011) Development of ten polymorphic one test remained significant after Bonferroni correction. In microsatellite loci for the sea snake Hydrophis elegans (Elap- idae: Hydrophiinae) and cross-species amplification for fifteen addition, the eight significant LD tests involved eight dif- marine hydrophiine species. Cons Gen Res. doi:10.1007/s12686- ferent locus-pairs across the four locations, suggesting 011-9388-5 sampling effects rather than physical genetic linkage. For Lukoschek V, Keogh JS (2006) Molecular phylogeny of sea snakes A. fuscus, three of 55 tests showed departures from LD but reveals a rapidly diverged adaptive radiation. Biol J Linn Soc 89:523–539 all involved different locus pairs than for E. annulatus and Lukoschek V, Waycott M, Dunshea G (2005) Isolation and charac- none remained significant after Bonferroni correction. terization of microsatellite loci from the Australasian sea snake, Similarly, while some locus pairs were in LD for A. laevis Aipysurus laevis. Mol Ecol Notes 5:875–881 (18 of 385 tests significant at P = 0.05) they invariably Lukoschek V, Waycott M, Keogh JS (2008) Relative information content of polymorphic microsatellites and mitochondrial DNA involved different locus-pairs in different locations and for inferring dispersal and population genetic structure in the also different locus-pairs than for E. annulatus and A. olive sea snake, Aipysurus laevis. Mol Ecol 17:3062–3077 fuscus, indicating sampling artefacts rather than true LD. Peakall R, Smouse PE (2006) GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Acknowledgments This work was supported by the Sea World Mol Ecol Notes 6:288–295 Research and Rescue Foundation, UC Irvine and the ARC CoECRS. We Raymond M, Rousset F (1995) GENEPOP (version 1.2): population thank Rick Shine for E. annulatus samples from , and genetics software for exact tests and ecumenicism. J Hered Andrei Tatarenkov for helpful tips about microsatellite development. 86:248–249 Rousset F (2008) Genepop’007: a complete reimplementation of the Genepop software for Windows and Linux. Mol Ecol Resour 8:103–106 van Oosterhout C, Hutchinson WF, Wills D, Shipley P (2004) References MICRO-CHECKER: software for identifying and correcting genotyping errors in microsatellite data. Mol Ecol Notes 4: Guinea ML (2007) Sea snakes of Ashmore Reef, Hibernia Reef and 535–538 Cartier Island with comments on Scott Reef. DEWHA Final Rep Voris HK (1977) A phylogeny of the sea snakes (Hydrophiidae). Surv 2007:1–20 Fieldiana: Zool 70:79–166

123