DOCSLIB.ORG

Development of Eleven Polymorphic Microsatellite Loci for the Sea Snake

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Development of Eleven Polymorphic Microsatellite Loci for the Sea Snake Conservation Genet Resour (2012) 4:11–14 DOI 10.1007/s12686-011-9461-0 TECHNICAL NOTE Development of eleven polymorphic microsatellite loci for the sea snake Emydocephalus annulatus (Elapidae: Hydrophiinae) and cross-species amplification for seven species in the sister genus Aipysurus Vimoksalehi Lukoschek • John C. Avise Received: 21 May 2011 / Accepted: 1 June 2011 / Published online: 23 June 2011 Ó Springer Science+Business Media B.V. 2011 Abstract We developed eleven microsatellite loci for the in marine systems hinder significant progress. High-reso- turtleheaded sea snake, Emydocephalus annulatus, from lution molecular markers, such as nuclear microsatellites, partial genomic DNA libraries using a repeat enrichment provide compelling alternatives for addressing critical protocol. Nine loci had high numbers of alleles (11–32) per questions about population genetic structure, gene flow, locus, while the other two loci had six alleles each. All dispersal, effective population sizes and relatedness. eleven loci amplified successfully and were polymorphic True sea snakes comprise two evolutionary lineages: the in six of seven sea snake species from the sister genus Hydrophis and Aipysurus groups (Lukoschek and Keogh Aipysurus, while ten loci amplified successfully for the 2006). Ten highly polymorphic microsatellite loci were seventh species. Based on these highly successful cross- recently developed for the Hydrophis group (Lukoschek amplifications we expect these loci to be useful markers for and Avise 2011); however, only five microsatellite loci evaluating population genetic structure, gene flow, relat- previously had been developed for an Aipysurus group edness and effective population sizes for all Aipysurus species, (Lukoschek et al. 2005) and large-scale genotyping group sea snakes. revealed relatively low polymorphism at most loci (Luko- schek et al. 2008). In order to better understand how con- Keywords Aipysurus Á Emydocephalus Á Bottleneck Á temporary demographic processes have affected genetic Connectivity Á Effective population size Á Sea snake diversity, effective population sizes and dispersal in the Aipysurus group, we aimed to develop highly polymorphic microsatellite loci for population genetic analyses. We Recently published IUCN Red List Assessments for all true targeted Emydocephalus annulatus because previous phy- sea snake species (Elapidae: Hydrophiinae) listed two of the logenies based on morphology (Voris 1977) and molecules 54 species as Critically Endangered (CR) and a third species (Lukoschek and Keogh 2006) consistently supported its as Endangered (IUCN 2010). All three species are from the basal position in the Aipysurus group. genus Aipysurus and all are endemic to a handful of reefs in We employed a modified version of a hybridization the Ashmore Reef region of the Timor Sea, where they have capture protocol using magnetic streptavidin beads and undergone recent precipitous population declines (Guinea biotinylated probes (Hamilton et al. 1999; Hauswaldt and 2007; Lukoschek Unpublished Data). The reasons for these Glenn 2003) to enrich for microsatellites in a genomic declines are unknown and difficulties of direct observation library for E. annulatus. Our protocol followed Lukoschek and Avise (2011). A total of 101 inserts were sequenced and microsatellite repeat regions detected by eye. Primers pairs V. Lukoschek Á J. C. Avise Department of Ecology and Evolutionary Biology, were designed for all 25 inserts containing microsatellites University of California at Irvine, Irvine, CA 92697, USA using OligoAnalyzer 3.0 (Integrated DNA Technologies) and tested on E. annulatus (n = 48). One primer from each & V. Lukoschek ( ) pair was 50 end labeled with a tag (50-GGAAACAGCT ARC Centre of Excellence for Coral Reef Studies, 0 James Cook University, Townsville, QLD 4811, Australia ATGACCATG-3 ) for tailed PCR with an M13 primer e-mail: [email protected] labeled with a 6-FAM, HEX, or NED (Applied Biosystems) 123 12 Conservation Genet Resour (2012) 4:11–14 fluorophore. Eleven microsatellite loci (Table 1), which disequilibrium (LD). MICRO-CHECKER (van Oosterhout amplified consistently and without multiple peaks, were et al. 2004) was used to test for null alleles. screened further. For E. annulatus, nine microsatellite loci had high Polymerase chain reaction (PCR) amplification of numbers of alleles (11–32) per locus, while the other two microsatellite loci were performed following the reaction loci had six alleles each. Eight loci had expected hetero- conditions and thermal cycling protocols described in zygosities (He) C 0.75 (Table 2). All eleven loci amplified Lukoschek and Avise (2011) using the locus specific successfully in six of the seven Aipysurus species while annealing temperatures (Tm) given in Table 1.We only one locus failed in A. pooleorum (Table 2); however screened 225 adult E. annulatus from five Australian and only two A. pooleorum museum samples were screened two New Caledonian locations. Cross-species amplifica- and the DNA was somewhat degraded. Allele sizes and tions were conducted for all seven species in the sister frequency distributions varied considerably among species genus Aipysurus.ForAipysurus laevis we screened 326 (Table 2). individuals from 11 locations throughout its Australian Genotype frequencies for A. laevis from seven locations range, while sample sizes for the remaining six species with n [ 30 were in HWE at P = 0.05 for 74 of the 77 ranged from 2 to 30 (Table 2), typically from one or tests, and the three significant tests (two loci in three two locations per species. Tissue samples were obtained locations) did not remain significant after Bonferroni cor- from biopsy of live snakes, trawler by-catch and museum rection. Moreover, eleven loci were in HWE for A. fuscus collections. Exact tests implemented in GenePop Web at Ashmore Reef (n = 27). Microchecker did not find Version 4.0.10 (Raymond and Rousset 1995; Rousset evidence for null alleles for A. laevis or A. fuscus. Geno- 2008) were used to evaluate whether genotype frequencies type frequencies for E. annulatus departed from HWE in conformed to Hardy–Weinberg equilibrium (HWE) (Guo nine of 44 tests and one locus (Ea478) departed from HWE and Thompson 1992) and whether loci were in linkage in all four locations tested. Three tests remained significant Table 1 Characteristics of eleven microsatellite loci developed for Emydocephalus annulatus Locus Repeat motif Primer sequence (50–30) (F/R) Tm (°C) Expected GenBank product size accession (bp) no. Ea407 (TAGA)12 M13_TCTAACCACTGCACCACCACAGTT 55 168 JF969261 TGTCCATAGTCTGGTGGGCCAAAT Ea823 (GATA)15 M13_AACGTGTGGACTCCAATTCCCAGA 55 168 JF969262 TAGGACTCCAGCTGTTGAGCTATC Ea462 (GAAGA)11(GGAGA)(GAAGA)9 M13_AGCATTCTGTCAAGTGAGGCTCCA 53 397 JF969263 ACGCCACCTGAAGATACCTCAACA Ea820 (CTTT)16(CTTC)(CTTT)3 M13_ATGCGAGGCAAATGACAGTGGTTG 51 380 JF969264 TGGCTGTTCAACTGTTAGCTGGT Ea475 (CT)2GTCTGT(CT)4(GT)5CTGT(CT)4 M13_TCAGTTATTTCTGTGAACTTTG 51 363 JF969265 GT(CT)6GTCTGT (CT)3(GT)2(CT)2 GTTGCAACATAGCGTACCTC GT(CT)6GT(CT)2GT(CT)4GT(CT)6 Ea804 (TG)9(AG)10 M13_GCAAGTTGATGTCTTATCCTTCTCC 57 201 JF969266 TGGACAACAGCTGCTTAGTACAGCTC Ea886 (CTTT)3(CT)4(TTCT)2(AC)(CTTT)2 M13_ACAGGTAGAACAAGCAGTGTGGTC 47 182 JF969267 (CTTC)(TTCC)2 (ATTCTTT) GAGGACTATGATACATGATTGGACA (CCTTCTTT)2(CCTT)5CCCT(CCTT)4 Ea844 (GATA)17 M13_GAGCATATCAGAAACATGGACTGC 55 267 JF969268 CCTATTATCTTGTAAGCAATTGACA Ea478 (TACTC)18 M13_TTCCCACCACTCCTTATCACCCAT 57 446 JF969269 ACTCCTGAGGAAGTAGACAGGAAC Ea841 (TC)10*int*(CTAT)14*int*(TC)3(TG)3 M13_GTTCTGGTTTGTCCACAGCTTTCAG 53 398 JF969270 (TC)4(TG)2(TC)3*int*(T)8(TCTG)4(TC)6 TTGGGATGAGGAGTGATCTTCGGA Ea879 (TC)4(TG)14(TA)2 M13_CGTTTCAGCAGAATCTCATCTGCC 51 179 JF969271 AGCTATGGTTCCGAGCTCTTCACA 123 Conservation Genet Resour (2012) 4:11–14 13 Table 2 Attributes of eleven microsatellite loci developed for Emydocephalus annulatus and the results of cross-species amplification trials for seven sea snake species in the genus Aipysurus Locus Emydocephalus annulatus (N = 225) Aipysurus laevis (N = 326) Size range (bp) N Na Ho He Size range (bp) N Na Ho He Ea407 174–214 219 11 0.64 0.75 174–218 317 12 0.84 0.85 Ea823 169–205 210 16 0.77 0.79 133–161 317 5 0.25 0.24 Ea462 342–452 212 17 0.81 0.88 372–467 312 17 0.86 0.89 Ea820 369–453 197 18 0.87 0.90 365–433 299 17 0.87 0.89 Ea475 373–421 222 11 0.30 0.57 375–431 310 19 0.89 0.90 Ea804 202–226 225 6 0.23 0.31 198–222 324 12 0.32 0.42 Ea886 160–262 222 19 0.75 0.86 196–294 316 25 0.93 0.93 Ea844 244–300 185 15 0.84 0.84 248–288 254 11 0.72 0.85 Ea478 365–435 197 12 0.52 0.80 355–425 319 12 0.81 0.82 Ea841 405–483 207 32 0.80 0.90 377–463 306 30 0.86 0.91 Ea879 191–203 219 6 0.16 0.20 198–253 307 15 0.81 0.83 Locus Aipysurus fuscus (N = 30) Aipysurus apraefrontalis (N = 2) Size range (bp) N Na Ho He Size range (bp) N Na Ea407 186–206 28 6 0.74 0.75 190 2 1 Ea823 141–149 29 3 0.32 0.33 141 2 1 Ea462 372–427 27 9 0.84 0.85 382 1 1 Ea820 381–421 26 11 0.80 0.82 381, 393, 401 2 3 Ea475 375–427 22 7 0.73 0.75 413, 431 1 2 Ea804 200–214 30 4 0.67 0.68 210, 212 2 2 Ea886 238–282 28 13 0.86 0.87 266 1 1 Ea844 256–276 22 6 0.79 0.81 268 1 1 Ea478 360–395 30 8 0.83 0.85 375, 380 2 2 Ea841 343–411 30 12 0.68 0.69 345, 351 1 2 Ea879 225–241 30 9 0.80 0.81 245 1 1 Locus Aipysurus duboisii (N = 25) Aipysurus eydouxi (N = 10) Size range (bp) N Na Ho He Size range (bp) N Na Ho He Ea407 174–202 23 7 0.78 0.77 186–248 10 5 0.70 0.76 Ea823 133–141 24 3 0.42 0.34 133–189 8 8 0.88 0.80 Ea462 372–427 22 12 0.77 0.89 387–422 8 6 0.75 0.73 Ea820 373–425 22 11 0.82
Load more

Recommended publications
  • NHBSS 061 1G Hikida Fieldg
    Book Review N$7+IST. BULL. S,$0 SOC. 61(1): 41–51, 2015 A Field Guide to the Reptiles of Thailand by Tanya Chan-ard, John W. K. Parr and Jarujin Nabhitabhata. Oxford University Press, New York, 2015. 344 pp. paper. ISBN: 9780199736492. 7KDLUHSWLOHVZHUHÀUVWH[WHQVLYHO\VWXGLHGE\WZRJUHDWKHUSHWRORJLVWV0DOFROP$UWKXU 6PLWKDQG(GZDUG+DUULVRQ7D\ORU7KHLUFRQWULEXWLRQVZHUHSXEOLVKHGDV6MITH (1931, 1935, 1943) and TAYLOR 5HFHQWO\RWKHUERRNVDERXWUHSWLOHVDQGDPSKLELDQV LQ7KDLODQGZHUHSXEOLVKHG HJ&HAN-ARD ET AL., 1999: COX ET AL DVZHOODVPDQ\ SDSHUV+RZHYHUWKHVHERRNVZHUHWD[RQRPLFVWXGLHVDQGQRWJXLGHVIRURUGLQDU\SHRSOH7ZR DGGLWLRQDOÀHOGJXLGHERRNVRQUHSWLOHVRUDPSKLELDQVDQGUHSWLOHVKDYHDOVREHHQSXEOLVKHG 0ANTHEY & GROSSMANN, 1997; DAS EXWWKHVHERRNVFRYHURQO\DSDUWRIWKHIDXQD The book under review is very well prepared and will help us know Thai reptiles better. 2QHRIWKHDXWKRUV-DUXMLQ1DEKLWDEKDWDZDVP\ROGIULHQGIRUPHUO\WKH'LUHFWRURI1DWXUDO +LVWRU\0XVHXPWKH1DWLRQDO6FLHQFH0XVHXP7KDLODQG+HZDVDQH[FHOOHQWQDWXUDOLVW DQGKDGH[WHQVLYHNQRZOHGJHDERXW7KDLDQLPDOVHVSHFLDOO\DPSKLELDQVDQGUHSWLOHV,Q ZHYLVLWHG.KDR6RL'DR:LOGOLIH6DQFWXDU\WRVXUYH\KHUSHWRIDXQD+HDGYLVHGXV WRGLJTXLFNO\DURXQGWKHUH:HFROOHFWHGIRXUVSHFLPHQVRIDibamusZKLFKZHGHVFULEHG DVDQHZVSHFLHVDibamus somsaki +ONDA ET AL 1RZ,DPYHU\JODGWRNQRZWKDW WKLVERRNZDVSXEOLVKHGE\KLPDQGKLVFROOHDJXHV8QIRUWXQDWHO\KHSDVVHGDZD\LQ +LVXQWLPHO\GHDWKPD\KDYHGHOD\HGWKHSXEOLFDWLRQRIWKLVERRN7KHERRNLQFOXGHVQHDUO\ DOOQDWLYHUHSWLOHV PRUHWKDQVSHFLHV LQ7KDLODQGDQGPRVWSLFWXUHVZHUHGUDZQZLWK H[FHOOHQWGHWDLO,WLVDYHU\JRRGÀHOGJXLGHIRULGHQWLÀFDWLRQRI7KDLUHSWLOHVIRUVWXGHQWV
    [Show full text]
  • Sea Snakes Lose Their Stripes to Deal with Pollution : Nature News
    NATURE | NEWS Sea snakes lose their stripes to deal with pollution Melanin pigment in darkened skin binds to pollutants and helps animals rid themselves of chemicals. Rachael Lallensack 10 August 2017 Klaus Stiefel The melanin pigment in the turtle-headed sea snake's dark bands binds to pollutants. Sea snakes that live in polluted waters have evolved to ‘fill in’ their light stripes, darkening their skins to cope with pollution. The finding1 adds turtle-headed sea snakes (Emydocephalus annulatus) to the diverse list of creatures that exhibit ‘industrial melanism’, when darker animal varieties become dominant in polluted environments. The phenomenon is a classic example of natural selection, and one of the best-known cases — the spread of the dark version of the peppered moth in sooty nineteenth-century Britain — is often quoted in biology textbooks. For decades, evolutionary ecologist Rick Shine has snorkelled in the bays of Nouméa in the South Pacific island of New Caledonia to study the sea snake species and collect their shed skins. Over the years, while studying the Related stories Related stories snakes in the Indo–Pacific, he • Dark satanic wings • Dark satanic wings noticed something curious: in some populations, most snakes were jet • Evolution sparks silence • Evolution sparks silence black, whereas in others, most of the crickets of the crickets sported pale banding or blotchy • The peppered moth's • The peppered moth's white markings. dark genetic past dark genetic past revealed revealed In 2014, Claire Goiran, a marine biologist at the University of New More related stories More related stories Caledonia in Nouméa who sometimes helped Shine to collect sea snakes, came across a study about Parisian pigeons2.
    [Show full text]
  • Surveys of the Sea Snakes and Sea Turtles on Reefs of the Sahul Shelf
    Surveys of the Sea Snakes and Sea Turtles on Reefs of the Sahul Shelf Monitoring Program for the Montara Well Release Timor Sea MONITORING STUDY S6 SEA SNAKES / TURTLES Dr Michael L Guinea School of Environment Faculty of Engineering, Health, Science and the Environment Charles Darwin University Darwin 0909 Northern Territory Draft Final Report 2012-2013 Acknowledgements: Two survey by teams of ten and eleven people respectively housed on one boat and operating out of three tenders for most of the daylight hours for 20 days and covering over 2500 km of ocean can only succeed with enthusiastic members, competent and obliging crew and good organisation. I am indebted to my team members whose names appear in the personnel list. I thank Drs Arne Rasmussen and Kate Sanders who gave their time and shared their knowledge and experiences. I thank the staff at Pearl Sea Coastal Cruises for their organisation and forethought. In particular I thank Alice Ralston who kept us on track and informed. The captains Ben and Jeff and Engineer Josh and the coxswains Riley, Cam, Blade and Brad; the Chef Stephen and hostesses Sunny and Ellen made the trips productive, safe and enjoyable. I thank the Department of Environment and Conservation WA for scientific permits to enter the reserves of Sandy Islet, Scott Reef and Browse Island. I am grateful to the staff at DSEWPaC, for facilitating and providing the permits to survey sea snakes and marine turtles at Ashmore Reef and Cartier Island. Activities were conducted under Animal Ethics Approval A11028 from Charles Darwin University. Olive Seasnake, Aipysurus laevis, on Seringapatam Reef.
    [Show full text]
  • Morphology, Reproduction and Diet of the Greater Sea Snake, Hydrophis Major (Elapidae, Hydrophiinae)
    Coral Reefs https://doi.org/10.1007/s00338-019-01833-5 REPORT Morphology, reproduction and diet of the greater sea snake, Hydrophis major (Elapidae, Hydrophiinae) 1 1 2 R. Shine • T. Shine • C. Goiran Received: 5 January 2019 / Accepted: 9 June 2019 Ó Springer-Verlag GmbH Germany, part of Springer Nature 2019 Abstract Although widespread, the large Hydrophiinae relatives in some respects, other characteristics (such as sea snake Hydrophis major is poorly known ecologically. scale rugosity, low proportion of juveniles in collections, We dissected 119 preserved specimens in museum col- frequent production of small litters of large offspring) may lections to quantify body sizes and proportions, sexual reflect adaptation to marine habitats. dimorphism, reproductive biology and diet. The sexes mature at similar snout–vent lengths (SVLs, about 75 cm) Keywords Dietary specialisation Á Disteira major Á and attain similar maximum sizes (females 123 cm vs. Elapidae Á Life-history Á Olive-headed sea snake Á Trophic males 122 cm SVL), but females in our sample exhibited ecology larger mean sizes than did males (means 98.8 vs. 93.1 cm SVL). The adult sex ratio in museum specimens was highly female-biased (64:30), and the high proportion of repro- Introduction ductive females during the austral summer suggests annual reproduction. At the same SVL, females had shorter tails Rates of speciation are higher in the viviparous sea snakes and wider bodies than did males, but sex differences in (Hydrophiinae) than in any other extant group of reptiles. other body proportions (e.g. tail shape, head dimensions, In particular, one clade of sea snakes—the Hydrophis eye diameter) were minimal.
    [Show full text]
  • Annotated Bibliography of Herpetological Related Articles in the National Geographic Magazine, Volumes 1 - 194, 1890 - 1998
    ANNOTATED BIBLIOGRAPHY OF HERPETOLOGICAL RELATED ARTICLES IN THE NATIONAL GEOGRAPHIC MAGAZINE, VOLUMES 1 - 194, 1890 - 1998 ERNEST A. LINER Houma, Louisiana and CARL GANS Austin, Texas SMITHSONIAN HERPETOLOGICAL INFORMATION SERVICE NO. 133 2004 SMITHSONIAN HERPETOLOGICAL INFORMATION SERVICE The first number of the SMITHSONIAN HERPETOLOGICAL INFORMATION SERVICE series appeared in 1968. SHIS number 1 was a list of herpetological publications arising from within or through the Smithsonian Institution and its collections entity, the United States National Museum (USNM). The latter exists now as little more than an occasional title for the registration activities of the National Museum of Natural History. No. 1 was prepared and printed by J. A. Peters, then Curator-in-Charge of the Division of Amphibians & Reptiles. The availability of a NASA translation service and assorted indices encouraged him to continue the series and distribute these items on an irregular schedule. The series continues under that tradition. Specifically, the SHIS series prints and distributes translations, bibliographies, indices, and similar items judged useful to individuals interested in the biology of amphibians and reptiles, and unlikely to be published in the normal technical journals. We wish to encourage individuals to share their bibliographies, translations, etc. with other herpetologists through the SHIS series. If you have such an item, please contact George Zug for its consideration for distribution through the SHIS series. Contributors receive a pdf file for personal distribution. Single copies are available to interested individuals at $5 per issue. We plan to make recent SHIS publication available soon as pdf files from our webpage, www. nmnh.si. edu/vert/reptiles.
    [Show full text]
  • The Status of Marine Reptiles in New South Wales
    The Status of Marine Reptiles in New South Wales A Report prepared for the New South Wales National Parks and Wildlife Service by Dr Harold G. Cogger _________ Cogger Consulting Services P/L Table of Contents Executive Summary ………………………………………………………………………………... 3 1. Introduction ……………………………………………………………………………………… 5 2, The conservation status of marine reptiles in NSW: assessment criteria and their significance …………………………….……………………………………… 8 3. Methodology …………………………………………………………………………………..… 9 4. Data Sources ………………………………………………………………………………...… 10 5. Major threatening processes with the potential to impact on marine reptiles ……...10 6. Annotated List of Species of Marine Reptiles recorded from NSW ……………..…… 13 7. Marine Turtles ………..……………………………………………………………………..… 14 Chelonia mydas (Green Turtle) …………………………………...………………..…… 14 Natator depressus (Flatback Turtle) ……………………………………………………. 16 Caretta caretta (Loggerhead Turtle) ……………………………………………………..17 Eretmochelys imbricata (Hawksbill Turtle ………………………………….………….. 19 Dermochelys coriacea (Leathery or Luth Turtle) ……………………………..……….. 20 8. Marine Snakes ……………………………………………………………………………...… 21 Acalyptophis peronii ………………………………………...……………………………. 22 Aipysurus duboisii ………………………………………………………………………… 23 Aipysurus laevis …………………………………………………..………………………. 24 Astrotia stokesii ……………………………………………………...……………………. 25 Disteira kingii …………………………………………………………..………………….. 26 Disteria major …………………………………………………………..…………………. 27 Emydocephalus annulatus ………………………………………………………….…… 28 Hydrophis elegans …………………………………………………………..…….….….. 29
    [Show full text]
  • Browsing by the Sea Snake Emydocephalus Annulatus
    Functional Blackwell Publishing, Ltd. Ecology 2004 A novel foraging mode in snakes: browsing by the sea snake 18, 16–24 Emydocephalus annulatus (Serpentes, Hydrophiidae) R. SHINE,† X. BONNET, M. J. ELPHICK and E. G. BARROTT Biological Sciences A08, University of Sydney, New South Wales 2006, Australia Summary 1. Ecologists often ascribe considerable importance to traits that are widespread within a specific lineage but rarely seen in other kinds of organisms. Unfortunately, such hypotheses cannot be tested robustly unless there is variation in expression of the trait within that lineage; such ‘exceptions to the rule’ provide opportunities to falsify predictions about putative functional correlates of the focal trait. 2. Research on snake foraging has emphasized species that feed infrequently and take large prey, often from ambush positions, but these characteristics do not apply to all snakes. 3. Movement patterns and feeding rates of free-ranging Turtle-Headed Sea Snakes Emydocephalus annulatus (Krefft 1869) were quantified in coral reefs of New Caledonia. These snakes forage by moving slowly (<2 m min−1) but consistently across the sub- strate as they investigate crevices and burrows for fish nests. The snakes feed frequently (sometimes, several times per hour) on large numbers of very small (1 × 0·5 mm2) eggs. Snakes weighed more than one hundred thousand times as much as the prey items (eggs) they consumed, in contrast to high relative prey masses often reported for other snake species. 4. Field experiments in which snakes were exposed to a variety of stimuli indicate that these animals locate their prey by scent rather than visual cues.
    [Show full text]
  • Integrative and Comparative Biology Integrative and Comparative Biology, Volume 52, Number 2, Pp
    Integrative and Comparative Biology Integrative and Comparative Biology, volume 52, number 2, pp. 235–244 doi:10.1093/icb/ics081 Society for Integrative and Comparative Biology SYMPOSIUM Effects of Oceanic Salinity on Body Condition in Sea Snakes Franc¸ois Brischoux,1,*,† Virginie Rolland,‡ Xavier Bonnet,* Matthieu Caillaud§ and Richard Shineô *Centre d’Etudes Biologiques de Chize´, CEBC-CNRS UPR 1934, 79360 Villiers en Bois, France; †Department of Biology, University of Florida, Gainesville, FL 32611, USA; ‡Department of Biological Sciences, PO Box 599, State University, Jonesboro, AR 72467, USA; §IFREMER Nouvelle Cale´donie, LEADNC, Campus IRD, BP 2059, 98846 Noume´a Cedex, Nouvelle Cale´donie, France; ôSchool of Biological Sciences A08, University of Sydney, Sydney, NSW 2006, Australia From the symposium ‘‘New Frontiers from Marine Snakes to Marine Ecosystems’’ presented at the annual meeting of the Society for Integrative and Comparative Biology, January 3–7, 2012 at Charleston, South Carolina. 1E-mail: [email protected] Downloaded from Synopsis Since the transition from terrestrial to marine environments poses strong osmoregulatory and energetic chal- lenges, temporal and spatial fluctuations in oceanic salinity might influence salt and water balance (and hence, body condition) in marine tetrapods. We assessed the effects of salinity on three species of sea snakes studied by mark– http://icb.oxfordjournals.org/ recapture in coral-reef habitats in the Neo-Caledonian Lagoon. These three species include one fully aquatic hydrophiine (Emydocephalus annulatus), one primarily aquatic laticaudine (Laticauda laticaudata), and one frequently terrestrial laticaudine (Laticauda saintgironsi). We explored how oceanic salinity affected the snakes’ body condition across various temporal and spatial scales relevant to each species’ ecology, using linear mixed models and multimodel inference.
    [Show full text]
  • Snake Venom Potency and Yield Are Associated with Prey-Evolution, Predator Metabolism and Habitat Structure
    Snake venom potency and yield are associated with prey-evolution, predator metabolism and habitat structure Kevin Healy a, b, c, *, Chris Carbone d and Andrew L. Jackson a. a Department of Zoology, School of Natural Sciences, Trinity College Dublin, Dublin 2, Ireland. b School of Biology, University of St Andrews, St Andrews KY16 9TH, UK. c School of Natural Sciences, National University of Ireland Galway, Galway, Republic of Ireland. d Institute of Zoology, Zoological Society of London, London, UK * Corresponding author: [email protected], School of Biology, University of St Andrews, St Andrews KY16 9TH, UK. Short running title Macroecological factors drive venom evolution Article type: Letters Number of words in abstract: 150 Number of words in main text: 4984 Number of references: 73 Number of Figures: 4 Statement of authorship KH collated the dataset and conducted the analysis. All authors contributed to the analysis, design, discussion and interpretation of the results, and writing of the manuscript. Data accessibility statement Data available from the Figshare Digital Repository https://doi.org/10.6084/m9.figshare.7128566.v1 Keywords Venom, Body size, Comparative analysis, Scaling, trophic ecology, Macroecology, LD50, Phylogenetic analysis, Snake, Abstract Snake venom is well known for its ability to incapacitate and kill prey. Yet, potency and the amount of venom available varies greatly across species, ranging from the seemingly harmless to those capable of killing vast numbers of potential prey. This variation is poorly understood, with comparative approaches confounded by the use of atypical prey species as models to measure venom potency. Here, we account for such confounding issues by incorporating the phylogenetic similarity between a snake’s diet and the species used to measure its potency.
    [Show full text]
  • The Conservation Status of Marine Elapid Snakes
    Herpetological Conservation and Biology 8(1): 37 – 52. Submitted:1 August 2012; Accepted: 7 January 2013; Published: 30 April 2013. FASCINATING AND FORGOTTEN: THE CONSERVATION STATUS OF MARINE ELAPID SNAKES 1,2 3,4 5 CRISTIANE T. ELFES SUZANNE R. LIVINGSTONE , AMANDA LANE , VIMOKSALEHI 6,7 8 9 10 LUKOSCHE , KATE L. SANDERS , ANTHONY J. COURTNEY , JOEY L. GATUS , MICHAEL 11 12 13 14 15 GUINEA , AARON S. LOBO , DAVID MILTON , ARNE R. RASMUSSEN , MARK READ , 16 17 18 19 MAHREE-DEE WHITE , JONNELL SANCIANGCO , ANGEL ALCALA , HAROLD HEATWOLE , 20 20 21 4 DARYL R. KARNS , JEFFREY A. SEMINOFF , HAROLD K. VORIS , KENT E. CARPENTER , 21, 22 JOHN C. MURPHY 1Department of Ecology, Evolution and Marine Biology, University of California Santa Barbara, Santa Barbara, California 93106, USA 2IUCN Global Species Programme/Conservation International, Biodiversity Assessment Unit, 2011 Crystal Drive, Arlington, Virginia 22202, USA 3Department of Ecology and Environmental Biology, University of Glasgow, Glasgow, Scotland G128QQ 4IUCN Global Species Programme/Global Marine Species Assessment, Biological Sciences, Old Dominion University, Norfolk Virginia 23529, USA 5Faculty of Veterinary Science, University of Sydney, Sydney, New South Wales 2006, Australia 6Present address: ARC Center of Excellence for Coral Reef Studies, James Cook University, Townsville, Queensland 4811, Australia 7Department of Ecology and Evolutionary Biology, University of California, Irvine, California 92697, USA 8School of Earth and Environmental Sciences, University of Adelaide, Adelaide,
    [Show full text]
  • Status of the World's Sea Snakes IUCN Red List Assessment
    Status of the World’s Sea Snakes IUCN Red List Assessment Final Report August 2009 IUCN Global Red List Assessment of Sea Snakes Workshop: 11‐14th February 2009 Brisbane, Australia Contact: Suzanne R Livingstone, PhD, Global Marine Species Assessment Email: [email protected] OR [email protected] Website: http://www.sci.odu.edu/gmsa/ 1. Contents Page 1. Contents 2 2. Acknowledgments 3 3. Project Rationale 3 4. Background 4 4.1. The Red List of Threatened Species 4 4.2. Global Marine Species Assessment 5 5. Methods 5 5.1. Data collection and IUCN Red List assessment process 5 5.2 IUCN Red List Categories 6 6. Results and Discussion 7 6.1. Sea snakes 7 6.2. Homalopsids 8 7. Conclusions 9 8. Reporting and outcomes 10 8.1. Results on the IUCN Red List of Threatened Species 10 8.2. Peer‐reviewed publications 10 8.3. Nominations for Australia’s EPBC Act 11 8.4. Creation of the IUCN Sea Snake Specialist Group 12 9. References 13 10. Appendices Appendix 1 ‐ workshop participants 14 Appendix 2 ‐ IUCN staff and project partners 15 Appendix 3 ‐ Sea snake species list and Red List Category 16 Appendix 4 ‐ Homalopsid snake species and Red List Category 18 2 2. Acknowledgements We would like to thank Dr Colin Limpus (Australian Government Environmental Protection Agency) and the International Sea Turtle Symposium committee for logistical and organizational support for the workshop. Special thanks to Jenny Chapman (EPA) and Chloe Schauble (ISTS). Thank you also to Dr Gordon Guymer (Chief Botanist – Director of Herbarium) for accommodating us at the Herbarium in the Brisbane Botanical Gardens.
    [Show full text]
  • Final Rule to List the Dusky Sea Snake and Three
    60560 Federal Register / Vol. 80, No. 194 / Wednesday, October 7, 2015 / Rules and Regulations Manufacturer Subject lines Passat. Tiguan. VOLVO ......................................................................................... S60. 1 Granted an exemption from the parts marking requirements beginning with MY 2016. 2 The X1 carline was replaced by the X1 MPV line beginning in MY 2016. According to BMW, production of its X1 carline ceased in MY 2015. 3 Granted an exemption from the parts marking requirements beginning with MY 2015. 4 According to Mercedes-Benz, the CL-Class was renamed the S-Coupe Class beginning with MY 2015. Under authority delegated in 49 CFR part FOR FURTHER INFORMATION CONTACT: whether a group of organisms 1.95. Dwayne Meadows, Ph.D., NMFS, Office constitutes a ‘‘species’’ under the ESA, Raymond R. Posten, of Protected Resources, (301) 427–8403. then whether the status of the species Associate Administrator for Rulemaking. SUPPLEMENTARY INFORMATION: qualifies it for listing as either [FR Doc. 2015–25369 Filed 10–6–15; 8:45 am] threatened or endangered. Section 3 of Background BILLING CODE 4910–59–P the ESA defines a ‘‘species’’ to include On July 15, 2013, we received a ‘‘any subspecies of fish or wildlife or petition from WildEarth Guardians to plants, and any distinct population list 81 marine species as threatened or segment of any species of vertebrate fish DEPARTMENT OF COMMERCE endangered under the Endangered or wildlife which interbreeds when Species Act (ESA). We found that the mature.’’ National Oceanic and Atmospheric petitioned actions may be warranted for Section 3 of the ESA defines an Administration 27 of the 81 species and announced the endangered species as ‘‘any species initiation of status reviews for each of which is in danger of extinction 50 CFR Parts 223 and 224 the 27 species (78 FR 63941, October 25, throughout all or a significant portion of 2013; 78 FR 66675, November 6, 2013; its range’’ and a threatened species as [Docket No.
    [Show full text]