C. R. Biologies 333 (2010) 395–404 Contents lists available at ScienceDirect Comptes Rendus Biologies www.sciencedirect.com Molecular biology and genetics/Biologie et ge´ne´tique mole´culaires Genetic identification of Southern Ocean octopod samples using mtCOI Eivind Andreas Baste Undheim a,b, Janette Ann Norman b, Hanne Halkinrud Thoen a,b, Bryan Grieg Fry b,* a Norwegian University of Technology and Science, Department of Biology, Trondheim Biological Station, N-7491, Trondheim, Norway b Department of Biochemistry & Molecular Biology, Bio21 Institute, University of Melbourne, Melbourne, Victoria 3010, Australia ARTICLE INFO ABSTRACT Article history: East Antarctic octopods were identified by sequencing mtCOI and using four analytical Received 11 January 2010 approaches: Neighbor-joining by Kimura-2-Parameter-based distances, character-based, Accepted after revision 1 February 2010 BLAST, and Bayesian Inference of Phylogeny. Although the distance-based analytical Available online 16 March 2010 approaches identified a high proportion of the sequences (99.5% to genus and 88.1% to species level), these results are undermined by the absence of a clear gap between intra- Keywords: and interspecific variation. The character-based approach gave highly conflicting results Octopus compared to the distance-based methods and failed to identify apomorphic characters for mtCOI many of the species. While a DNA independent approach is necessary for validation of the Pareledone method comparisons, crude morphological observations give early support to the Adelieledone distance-based results and indicate extensive range expansions of several species Southern Ocean Antarctica compared to previous studies. Furthermore, the use of distance-based phylogenetic methods nevertheless group specimens into plausible species clades that are highly useful in non-taxonomical or non-systematic studies. ß 2010 Acade´mie des sciences. Published by Elsevier Masson SAS. All rights reserved. 1. Introduction [5,7–10] and revised [5,11] during the last decades, a large proportion of the Southern Ocean octopod fauna The benthic marine fauna of the Antarctic is highly taxonomy is well mapped and up to date. Furthermore, the endemic and, unlike its northern counterpart [1],is incorporation of mitochondrial cytochrome oxidase sub- comparable in diversity to many temperate and tropical unit I (COI) sequences in several of these studies, as well as non-reef benthic communities [2]. Although the Mollusca in other higher level phylogenetic studies [12–15], is generally poorly represented in the Southern Ocean [3], Antarctic octopods are relatively well covered in terms the octopod fauna is both rich and unique: 12 cirrate of species sequenced for COI. This mainly applies to the (Octopoda: Cirrata) and incirrate (Octopoda: Incirrata) western sector of the Southern Ocean, however, as most of genera are currently recognized from the Southern Ocean, the species described and sequenced have only previously of which five are endemic (Adelieledone, Bathypurpurata, been registered from the Antarctic Peninsula region [4]. Megaleledone, Pareledone, and Praealtus [4]). The most A common feature of many studies dealing with the speciose genus, Pareledone, currently contains 14 extant application of DNA barcoding as proposed by Hebert et al. species [4,5] and probably radiated with the development [16] is the difficulty in morphologically distinguishing of the Circum Antarctic Current approximately 35 Ma [6]. between species, particularly for non-experts [17,18]. This With several of these species and genera described issue applies to the identification of many of the octopod species registered from Antarctic waters, where diagnostic features at genus and species level includes traits often * Corresponding author. difficult to classify correctly for the non-expert, such as E-mail address: [email protected] (B.G. Fry). beak shape, mantle papillae and coloration [8,19]. The 1631-0691/$ – see front matter ß 2010 Acade´mie des sciences. Published by Elsevier Masson SAS. All rights reserved. doi:10.1016/j.crvi.2010.02.002 396 E.A.B. Undheim et al. / C. R. Biologies 333 (2010) 395–404 morphological plasticity of cephalopods [20] as well as the (1398E to 1458E), Antarctica, during Voyage 3 2007–2008 lack of a dichotomous key including locally sampled onboard R/V Aurora Australis. All specimens were photo- specimens also makes the task of identifying East Antarctic graphed, brief morphological observations noted, locality specimens to species, or corresponding clades, particularly and depth recorded, and a tissue sample taken from the tip difficult. Employing DNA barcoding as a means of of a non-hectocotylized arm. Tissue samples were stored in identifying samples [16,21] may represent a way around liquid nitrogen. We deposited specimens with the these issues in specimen identification. In addition, a Collaborative East Antarctic Marine Census (CEAMARC) molecular approach to sample identification bypasses collection, with each specimen and its tissue sample given problems that arise when there is little morphology left to a unique CEAMARC reference number (Supplementary interpret, such as when identifying stomach contents of table). Tissue samples used for this study are stored in the cephalopod predators or when specimens are heavily research collection of B.G. Fry, University of Melbourne, damaged by trawls. along with a small number of specimens retained for There are, however, issues that have been raised further histological studies (see the Supplementary table). regarding the use of DNA barcoding in the identification of cephalopod samples [22]. One of these relates to the 2.2. DNA extraction, amplification and sequencing method by which the obtained COI sequences are analyzed and specimens identified. Two main approaches to We extracted DNA using the Qiagen1 DNeasy extrac- identifying samples to species using DNA barcodes have tion kit, following the manufacturer’s recommendations. been put forward; the distance-based Neighbor Joining We then modified universal invertebrate COI forward and (NJ) analysis using the Kimura-2-Parameter (K2P) model reverse primers (LCO1490 and HCO2198 respectively) to for nucleotide substitutions [16,23,24] and the character- better fit octopod COI using complete COI sequences from based method using the freeware Phylogenomenclature Octopus vulgaris (AB158363) downloaded from Genbank (P-Gnome) [25] to identify phylogenetically informative (http://www.ncbi.nlm.nih.gov/sites/entrez) and ordered apomorphic sites [26–28]. Both these approaches identify the following M13-tailed primer sequences primers from unknown samples in terms of a lack of matching geneworks: sequences, but while the NJ analysis gives an estimate of the taxonomic status of the unknowns, the character- eCOI-F 50 CACGACGTTGTAAAACGAC - TCTCAACAAAY- based method can only list these within the last identified CATAAAGAYATTGG node. However, it has been argued that a character-based eCOI-R 50 GGATAACAATTTCACACAGG - TATACTTCTGG- approach is less dependent on a ‘‘barcoding gap’’, a distinct GTGTCCAAARAAYCA gap between intraspecific variation and interspecific divergence [27], which has been found to be present in PCR reaction mixtures contained 1 mL DNA template, some molluscan taxa [29] but not others [30]. A third, less 4 mLGoTaq Green Mastermix (Promega), and 0.32 mM powerful, but faster and more accessible method to forward and reverse primers to a total reaction volume of identify specimens by DNA barcoding is Basic Local 10 mL. PCR was conducted using the thermal cycle: 95 8C Alignment Search Tool [31]. Employing BLASTN 2.2.22+ for 2 min; 40 cycles of 95 8C for 20 s, 58 8C for 20 s, 72 8C for [32] to search for the most similar sequence lodged in 20 s; and a final extension at 72 8C for 5 min. Gel- GenBank (http://www.ncbi.nlm.nih.gov/Genbank/), how- electrophoresis using 1.2% agarose gels and subsequent ever, will always give a closest match, and is therefore staining with EtBr was used to check the PCR products. We unable to unequivocally detect new sequences. used a molecular weight marker (Hyperladder II, Bioline1) During the 2007–2008 Voyage 3 research cruise aboard to determine approximate fragment sizes of the respective R/V Aurora Australis, tissue samples were collected from bands. PCR product purification, DNA sequencing (using more than 200 specimens of cirrate and incirrate octopods M13R or F as sequencing primers) and electrophoretic caught by bottom trawl off George V Land. However, due to separation were all performed by the Australian Genomic time constraints and specimen allocation, most of these Research Facility (AGRF). We proofread and aligned specimens could not be identified morphologically. Here, sequences by eye using PROcessor of SEQuences (ProSeq) we compare four approaches for the identification of these v3 [35] and MEGA v4 [36]. All octopod COI sequences samples to species by means of mtDNA sequencing. In deposited in GenBank were then obtained and included in addition to the three methods mentioned above (NJ by the dataset, once again aligned by eye using ProSeq3 and K2P-based distances, Character-based, and BLAST), the MEGA4. phylogenetically more powerful analysis of Bayesian Inference of Phylogeny [33,34] is used as a comparison 2.3. Variation at COI to the more commonly employed methods for grouping barcode sequence data. We assessed the extent of intra- and interspecific variation in octopod mtCOI from all the 111 previously 2. Methods lodged sequences. Distances were calculated